ABCMdb

PMID: 17394637

Sermet-Gaudelus I, Renouil M, Fajac A, Bidou L, Parbaille B, Pierrot S, Davy N, Bismuth E, Reinert P, Lenoir G, Lesure JF, Rousset JP, Edelman A
In vitro prediction of stop-codon suppression by intravenous gentamicin in patients with cystic fibrosis: a pilot study.
BMC Med. 2007 Mar 29;5:5., [PubMed]

Sentences

No. Mutations Sentence Comment

8 ABCC7 p.Trp1282* ABCC7 p.Gly542* ABCC7 p.Arg1162* ABCC7 p.Tyr122* Results: After in vitro gentamicin incubation, the readthrough efficiency for the Y122X mutation was at least five times higher than that for G542X, R1162X, and W1282X. Login to comment 9 ABCC7 p.Tyr122* In six of the nine patients with the Y122X mutation, CFTR immunodetection showed protein at the membrane of the nasal epithelial cells and the CFTR-dependent Cl-secretion in NPD measurements increased significantly. Login to comment 13 ABCC7 p.Tyr122* Clinical status, NPD and sweat Cl- values did not change in the Y122X patients with no protein expression, in patients with the other stop mutations investigated in vitro and those without stop mutations. Login to comment 27 ABCC7 p.Trp1282* ABCC7 p.Gly542* ABCC7 p.Arg1162* ABCC7 p.Tyr122* Methods Readthrough quantification in cell culture A dual gene reporter system was used to quantify the readthrough efficiency directed by the most frequent stop mutations in the French population (Y122X, G542X, R1162X and W1282X) [10], in the presence or absence of gentamicin. Login to comment 65 ABCC7 p.Gly542* ABCC7 p.Arg1162* ABCC7 p.Tyr122* Table 1: Oligonucleotide sequences used in the dual reporter gene assay, corresponding to the Y122X, G542X, R1162X and W1292X mutations and the TQ in frame control. Login to comment 67 ABCC7 p.Trp1282* ABCC7 p.Gly542* ABCC7 p.Arg1162* ABCC7 p.Tyr122* Readthrough level (%)* Mutation Oligonucleotides** 0 600 μg/ml gentamicin Y122X w 5' CGCTCTATCGCGTAACTAGGCATAGGC 3'; c 5' GCCTATGCCTAGTTACGCGATAGAGCG 3' 0.52 1.6 W1282X w 5` AATATAGTTCTTTGAGAAGGTGGAATC 3` c 5` GATTCCACCTTCTCAAAGAACTATATT 3` 0.115 0.35 R1162X w 5' CGATCTGTGAGCTGAGTCTTTAAGTTC 3'; c 5' GAACTTAAAGACTCAGCTCACAGATCG 3' 0.023 0.22 G542X w 5' ACTTTGCAACAGTGAAGGAAAGCCTTT 3'; c 5' AAAGGCTTCCTTCACTGTTGCAAAGT 3' 0.017 0.26 TQ: in frame control w 5' GCAGGAACACAACAGCAATTACAG 3' c 5' CTGTAATTGCTGTTGTGTTCCTGC 3' 100 100 *At least five independent experiments were performed with each construct and showed less than 20% variation. Login to comment 78 ABCC7 p.Gly542* ABCC7 p.Arg1162* The R1162X and the G542X mutations yielded basal readthrough of less than 0.03% and increased by a factor of 10 and 15 respectively after gentamicin. Login to comment 79 ABCC7 p.Trp1282* ABCC7 p.Gly542* ABCC7 p.Arg1162* The basal readthrough of W1282X was ~10 times higher than those of R1162X and G542X and tripled after gentamicin. Login to comment 80 ABCC7 p.Trp1282* ABCC7 p.Gly542* ABCC7 p.Arg1162* ABCC7 p.Tyr122* Y122X had a basal readthrough level five times higher than that for the W1282X mutation, 22 times that for R1162X and 30 times that for G542X. Login to comment 81 ABCC7 p.Trp1282* ABCC7 p.Gly542* ABCC7 p.Arg1162* ABCC7 p.Tyr122* After gentamicin incubation, Y122X readthrough efficiency remained at least 4.5 times higher than that for W1282X, six times that for G542X and 7.3 that for R1162X. Login to comment 82 ABCC7 p.Tyr122* We therefore decided to focus the clinical trial on patients with the Y122X mutation. Login to comment 84 ABCC7 p.Tyr122* ABCC7 p.Tyr122* ABCC7 p.Tyr122* Nine carried the Y122X mutation (eight were Y122X homozygous and one was Y122X/F508del) (Group A). Login to comment 85 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Gly542* ABCC7 p.Arg1162* Four had another stop mutation: one was homozygous for G542X, one for R1162X, and two were compound heterozygous for W1282X/F508del and R553X/CFTRdele17b (Group B). Login to comment 90 ABCC7 p.Tyr122* Clinical scores for the nine patients with the Y122X mutation (Group A) improved significantly at the end of the study, mainly because of improvements in coughing, sputum production, dyspnea and energy level. Login to comment 102 ABCC7 p.Tyr122* These levels decreased significantly after treatment among patients with the Y122X mutation (Group A) (Tables 3 and 5; Figure 1). Login to comment 114 ABCC7 p.Tyr122* In contrast to the patients with the Y122X mutation, the patients with other stop mutations (Group B) and those without any stop mutations (Group C) had no significant modifications of their basal potential difference or response to amiloride or isoproterenol (Table 5). Login to comment 116 ABCC7 p.Arg1162* ABCC7 p.Tyr122* ABCC7 p.Tyr122* The effect of parenteral gentamicin on CFTR was analysed in patients who agreed to nasal brushing, i.e., seven Y122X homozygous patients, one compound F508del/Y122X patient, one R1162X homozygous patient, and the five patients without stop mutations. Login to comment 117 ABCC7 p.Tyr122* Before gentamicin treatment, no CFTR labeling was observed in any of the Y122X homozygous patients (see representative picture in Figure 2c), while afterwards, five patients expressed CFTR at the membrane in 10 to 80% of cells (Figure 2d). Login to comment 120 ABCC7 p.Tyr122* Before treatment, cytoplasmic labeling in the compound heterozygous Y122X/ΔF508 patient was found in 20% of the cells with 24-1 antibody and 70% of the cells with MATG 1061 antibody and, after treatment, in 70% and 100% of the cells, respectively. Login to comment 122 ABCC7 p.Tyr122* Among the Y122X responders, CFTR-depend- Table 3: Characteristics of the subjects with stop codon mutations and variation of clinical and functional parameters after treatment with gentamicin. Login to comment 123 ABCC7 p.Trp1282* ABCC7 p.Arg553* ABCC7 p.Gly542* ABCC7 p.Arg1162* Genotype Sputum colonisation Age (year) Δscore FEV1var FVCvar FEF25-75var Sweat Cl- at D0 Sweat Cl- at D15 ΔCl-free-iso at D0 ΔCl-free-iso at D15 ICC Y122X+/+ SA 11 -4 24 23 31 126 91 0 0 - Y122X+/+ PA* 16 -2 -12 -6 -15 79 37 NP 0 - Y122X+/+ PA*,SA 18 -4 2 -2 -8 109 115 0 NP + Y122X+/+ PP* 15 -5 25 19 86 90 91 -0.5 0 + Y122X+/+ PP* 13 -15 18 8 96 103 46 -1.6 -3.8 + Y122X+/+ SA 22 -13 3 0 7 108 100 -3.7 -17.6 + Y122X+/+ BC* 21 -22 18 24 150 136 135 0 -4 + Y122X+/+ PA* 12 -12 3 -9 NP 119 86 0 -8.2 NP Y122X+/F508del SA* 10.5 -3 21 21 45 114 65 -1 -3.3 + R1162X +/+ SA 14 -2 0.4 0 4 116 131 0 0 - F508del/W1282X PA 13 -2 15 14 27 103 100 0 -1.3 NP G542X +/+ SA 11 -4 21 17 20 113 105 0 0 NP R553X/CFTRdele17b PA* 10 0 NP NP NP 115 NP -4 NP NP PA: Pseudomonas aeruginosa; SA: Staphylococcus aureus; PP: Pseudomonas putida; BC: Burkholderia cepacia; * bacteria resistant to gentamicin. Login to comment 131 ABCC7 p.Tyr122* Patients Group A n = 9 Group B n = 4 Group C n = 5 p Group A vs. B p Group A vs. C p Group B vs. C Age 15.4(4.2) 12(1.8) 16.5(1.7) NS NS NS CFCS 31(8) 26(2) 24(2) NS NS NS FEV1 (%) 69(21) 80(12) 74(10) NS NS NS FVC (%) 70(20) 83(7) 84(22) NS NS NS FEF25-75 (%) 46(30) 67(26) 54(26) NS NS NS Group A: patients with the Y122X stop mutation. Group B: patients with another stop mutation. Group C: patients without any stop mutation. CFCS refers to the Cystic Fibrosis Clinical Score. FEV1, FVC, FEF25-75 refer respectively to forced expiratory volume in one second, forced vital capacity, and forced expiratory flow at 25 to 75 percent of vital capacity and are expressed as percentages of predicted values for age, sex, and height. Login to comment 136 ABCC7 p.Arg1162* The R1162X patient had no CFTR labeling either before or after treatment (data not shown). Login to comment 138 ABCC7 p.Arg1162* Both the R1162X homozygous patient and the group C patients were considered non-responders. Login to comment 140 ABCC7 p.Arg1162* ABCC7 p.Tyr122* ABCC7 p.Tyr122* Overall, the pattern of the in vitro readthrough, clearly most efficient for the Y122X mutation, was strongly correlated with the immunocytochemically determined CFTR expression in nasal cells, as assessed by the CFTR staining after treatment for the Y122X patients, compared with the lack of staining in both the R1162X patient and the patients without stop mutations. Login to comment 142 ABCC7 p.Tyr122* In patients carrying the Y122X mutation, gentamicin treatment resulted in delivery of the CFTR protein at the membrane and in restoration of CFTR-dependent chloride transport in nasal epithelial cells. Login to comment 157 ABCC7 p.Tyr122* Group A n = 9 Group B n = 4 Group C n = 5 D0 D15 p D0 D15 p D0 D15 p CFCS 30(8) 21(8) 0.007 25(1) 22 (1) NS 23.5(2) 23(3) NS FEV1(L) 1.82(0.8) 2.07(0.8) 0.04 1.68(0.4) 1.77(0.3) NS 2(0.3) 2.12(0.4) NS FVC(L) 2.2(1) 2.36(0.9) NS 2.08(0.6) 2.14(0.5) NS 2.93(0.5) 3(0.4) NS FEF25-75(L) 1.54(1.1) 1.95(1.06) NS 1.91(0.9) 1.96(0.8) NS 1.93(1.8) 1.99(1.8) NS Group A: patients with the Y122X stop mutation. Group B: patients with another stop mutation. Group C: patients without any stop mutation. CFCS refers to the Cystic Fibrosis Clinical Score. FEV1, FVC, FEF25-75 as defined in Table 2 and are expressed as absolute values. Login to comment 164 ABCC7 p.Tyr122* Group A n = 9 Group B n = 4 Group C n = 5 Patients D0 D15 p D0 D15 p D0 D15 p Sweat chloride (mM/L) 109(17) 85(31) 0.03 110(7) 112(16) NS 96(1.5) 105(18) NS Basal PD -56(10) -49(5) 0.12 -53(11) -50(8) NS -52(8) -52(7) NS ΔAmiloride 20(6) 15(7) 0.09 22(15) 20(9) NS 19(12) 21(13) NS ΔCl-free-isoproterenol -0.8(1.3) -4.6(6) 0.04 -0.2(0.5) -0.9(1) NS 0(0.5) -0.8(1) NS Group A: patients with the Y122X stop mutation. Group B: patients with another stop mutation. Group C: patients without any stop mutation. Login to comment 167 ABCC7 p.Tyr122* ABCC7 p.Tyr122* Sweat chloride concentration and ΔCl-free-isoproterenol before and after gentamicin in Y122X patients (●)Figure 1 Sweat chloride concentration and ΔCl-free-isoproterenol before and after gentamicin in Y122X patients (●). Login to comment 171 ABCC7 p.Tyr122* Although there was a correlation in patients carrying the Y122X mutation between the decrease of the response to amiloride (sodium absorption) and the increase of the response to isoproterenol (CFTR dependent chloride secretion), there was only a trend in the decrease of the response to amiloride, the non-significant level probably being due to the small sample of patients. Login to comment 172 ABCC7 p.Trp1282* ABCC7 p.Gly542* ABCC7 p.Arg1162* In contrast, patients with mutations producing lower levels of translational readthrough in the cell culture assay (G542X, R1162X and W1282X) did not show significant changes in clinical status, chloride secretion in either the nasal or sweat gland epithelia after gentamicin treatment. Login to comment 173 ABCC7 p.Arg1162* ABCC7 p.Tyr122* ABCC7 p.Tyr122* Interestingly, the R1162X patient did not have positive protein immunostaining at the end of the treatment, demonstrating a correlation between proteic expression and Example of nasal potential difference tracing (NPD) (a, b) and CFTR immunostaining with MATG 1061 monoclonal antibody ofnasal ciliated cells (c,d) before (a,c) and after (b,d) parenteral gentamicin treatment in a Y122X homozygous CF patientFigure 2 Example of nasal potential difference tracing (NPD) (a, b) and CFTR immunostaining with MATG 1061 monoclonal antibody of nasal ciliated cells (c,d) before (a,c) and after (b,d) parenteral gentamicin treatment in a Y122X homozygous CF patient. Login to comment 189 ABCC7 p.Tyr122* The readthrough efficiency for the Y122X mutation, a nonsense mutation mainly found among inhabitants of the Reunion Island and resulting in an ochre termination codon (UAA) [18], was at least five times higher than that for the other CFTR stop mutations tested and more generally, 10 to 40 times higher than that for other previously tested TAA-coded mutations [11]. Login to comment 191 ABCC7 p.Tyr122* The high readthrough levels observed for the Y122X mutation, both basal and induced, suggest that the nucleotide environment of the stop codon may overcome the strong termination efficiency directed by the UAA codon. Login to comment 192 ABCC7 p.Gly542* ABCC7 p.Arg1162* The +4C nucleotide could account for the better response to gentamicin, because it is associated with greater readthrough efficiency, whereas the other mutations tested in our study, R1162X and G542X, imply a +4G nucleotide, which is associated with a poor readthrough [11]. Login to comment 193 ABCC7 p.Tyr122* As the readthrough levels obtained with this experimental system for a given mutation are similar to those obtained in vivo [11], these results suggested that patients with the Y122X mutation may benefit from gentamicin treatment. Login to comment 194 ABCC7 p.Tyr122* We therefore decided to focus the clinical study on patients homozygous for the Y122X mutation and compare them with a group of patients with the other stop mutations we tested in vitro, and a control group of patients with no stop mutations. Login to comment 197 ABCC7 p.Tyr122* Cell membrane staining with an antibody that recognises the C terminal region of CFTR demonstrated that gentamicin treatment of CF patients with the Y122X mutation can induce the readthrough of this stop mutation and the synthesis of a full-length CFTR protein delivered at the membrane. Login to comment 201 ABCC7 p.Tyr122* The absence of response to gentamicin in two of the Y122X patients enrolled may be due to inefficient uptake or distribution of gentamicin in patients' bronchial secretions, depending on individual pharmacokinetic characteristics, but also to inefficiency at any step during the complex mechanism of stop codon readthrough [23]. Login to comment 203 ABCC7 p.Trp1282* Indeed, a considerable variability in the level of CFTR nonsense transcript was found among the patients carrying the W1282X mutation and receiving a topical administration of nasal gentamicin, with a significant correlation between the amount of CFTR nonsense transcripts and the modification of CFTR function after treatment [24]. Login to comment 204 ABCC7 p.Tyr122* Conclusion Although our data concern only the Y122X genotype, a rare mutation, they can theoretically be generalised. Login to comment