ABCMdb

ABCC7 p.Tyr122*

[switch to full view]
Comments [show]

None has been submitted yet.

Publications

PMID: 10376575 [PubMed] Mak V et al: "Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia."

No. Sentence Comment

28 Analysis for 31 of the most common CFTR mutations found within the white CF population,60 consisting of ⌬F508, W1282X, G542X, G551D, N1303K, R553X, G85E, R117H, S549N, V520F, R334W, A455E, R347P, R1162X, Y122X, S549R, 621+1G→T, ⌬I507, R560T, R347H, 3659delC, Q493X, 1898+1G→T, 711+1G→T, 3849+10C→T, 1717-1G→A, 3849+4A→G, 3905insT, 1078delT, 2183AA→G, and 2789+5G→A. Briefly, the technique involved amplification by polymerase chain reaction61 of the relevant exons, followed by digestion with appropriate restriction endonucleases and acrylamide gel electrophoresis with ethidium bromide staining. Login to comment

PMID: 10444722 [PubMed] Gasparini P et al: "Analysis of 31 CFTR mutations by polymerase chain reaction/oligonucleotide ligation assay in a pilot screening of 4476 newborns for cystic fibrosis."

No. Sentence Comment

46 Table 1 Mutations analysed in the CFTR gene using polymerase chain reaction/oligonucleotide litigation assay/sequence coded separation Mutation Location Nucleotide Result F508 Exon 10 3 bp deletion Deletion of Phe-508 I507 Exon 10 3 bp deletion Deletion of Ile-507 (or -506) Q493X Exon 10 C-1609 →→ T Gln-493 → Stop V520F Exon 10 G-1690 → T Val-520 → Phe 1717-1G → A Intron 10 G-1717-1 → A 3`-splice site mutation G542X Exon 11 G-1756 → T Gly-542 → Stop G551D Exon 11 G-1784 → A Gly-551 → Asp R553X Exon 11 C-1789 → T Arg-553 → Stop R560T Exon 11 G-1811 → C Arg-560 → Thr S549R Exon 11 T-1779 → G Ser-549 → Arg S549N Exon 11 G-1778 → A Ser-549 → Asn 3849+10 kb C → T Intron 19 C-3849+10 kb → T Splice mutation 3849+4A → G Intron 19 A-3849+4 → G Splice mutation R1162X Exon 19 C-3616 → T Arg-1162 → Stop 3659delC Exon 19 1 bp deletion Frameshift W1282X Exon 20 G-3978 → A Trp-1282 → Stop 3905insT Exon 20 1 bp insertion Frameshift N1303K Exon 21 C-4041 → G Asn-1303 → Lys G85E Exon 3 G-386 → A Gly-85 → Glu 621+1G → T Intron 4 G-621+1 → T 5`-splice site mutation R117H Exon 4 G-482 → A Arg-117 → His Y122X Exon 4 T-498 → A Tyr-122 → Stop 711+1G → T Intron 5 G-711+1 → T 5`-splice site mutation 1078delT Exon 7 1 bp deletion Frameshift R347P Exon 7 G-1172 → C Arg-347 → Pro R347H Exon 7 G-1172 → A Arg-347 → His R334W Exon 7 C-1132 → T Arg-334 → Trp A455E Exon 9 C-1496 → A Ala-455 → Glu 1898+1G → A Intron 12 G-1898+1 → A 5`-splice site mutation 2184delA Exon 13 Deletion A-2184; A-2183 → G Frameshift 2789+5G → A Intron 14B G-2789+5 → A Splice mutation Table 2 Summary of cystic fibrosis screening results No of samples analysed Normal subjects Carriers Carrier frequency Turin 1574 1521 53 1/29.7 Pavia 1341 1299 42 1/31.9 San Giovanni Rotondo 1561 1512 49 1/31.8 Total 4476 4332 144 1/31.1 Table 3 Detailed list of mutations detected in the Italian population Centre F508 G542X R347P 2183-AG N1303K 711+1GT 1717-1A R347H R117H 1898+1G 2789+5G W1282X R1162X I507 Other TO 33 2 1 1 5 1 1 2 3 2 2 - - - PV 27 - - 1 2 - 1 - 5 - 1 2 1 1 SGR 30 14 2 1 1 1 - - - - - - - - TO, Dipartimento di Patologia Clinica, Ospedale Infantile "Regina Margherita, Torino; PV, Istituto di Anatomia Patologica, Sezione di Anatomia Patologica, Università di Pavia, Pavia; SGR, Servizio di Genetica Medica and Divisione di Neonatologia, IRCCS Casa Sollievo della SoVerenza, San Giovanni Rotondo, Foggia. Login to comment

PMID: 10973878 [PubMed] Costes B et al: "Prenatal detection by real-time quantitative PCR and characterization of a new CFTR deletion, 3600+15kbdel5.3kb (or CFTRdele19)."

No. Sentence Comment

51 The mutations tested were S549N, S549R, R553X, G551D, V520F, ⌬I507, ⌬F508, Q493X, 1717-1G3A, G542X, R560T, R347P, R347H, 3849ϩ4A3G, W1282X, R334W, 1078delT, 3849ϩ10kbC3T, R1162X, N1303K, 3659delC, 3905insT, A455E, R117H, Y122X, 2183AA3G, 2789ϩ5G3A, 1898ϩ1G3A, 621ϩ1G3T, 711ϩ1G3T, and G85E. Login to comment

PMID: 11388756 [PubMed] Heim RA et al: "Improved detection of cystic fibrosis mutations in the heterogeneous U.S. population using an expanded, pan-ethnic mutation panel."

No. Sentence Comment

83 These mutations, Y122X, 556delA, 2909delT, 3358delAC, 3750delAG, W1310X, and W1316X, were subsequently excluded from the 86-mutation panel. Login to comment

PMID: 11569691 [PubMed] Truninger K et al: "Mutations of the cystic fibrosis gene in patients with chronic pancreatitis."

No. Sentence Comment

56 Using multiplex PCR, 15 genomic fragments were amplified which contain the following mutations: ⌬F508, ⌬I507, Q493X, V520F, 1717-1G3A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ϩ 10kbC3T, 3849 ϩ 4A3G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 ϩ 1G3T, R117H, Y122X, 711 ϩ 1G3T; 1078delT, R347P, R347H, R334W, A455E, 1898 ϩ 1G3A, 2183AA3G, 2789 ϩ 5G3A. Login to comment

PMID: 11883825 [PubMed] Padoan R et al: "Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis."

No. Sentence Comment

34 It was initially performed by polyacrylamide gel electrophoretic (PAGE) analysis for the delF508 mutation, and later by polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) (31 mutations: G85E, 621 ‡ 1G ® T, R117H, Y122X, 711 ‡ 1G ® T, 1078delT, R347P, R347H, R334W, A455E, 1898 ‡ 1G ® A, 2183-AA ® G, 2789 ‡ 5G ® A, DelF508, I507del, Q493X, V520F, 1717-1G ® A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ‡ 10kbC ® T, 3849 ‡ 4A ® G, R1162X, 3659delC, W1282X, 3905insT, N1303K) (14). Login to comment

PMID: 12007216 [PubMed] Bobadilla JL et al: "Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening."

No. Sentence Comment

109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment
110 Germany ∆F508 (71.8%) 1789+5G→A (0.9%) 87.6 76.7 17 5662/1316 Dörk et al. [1992]; Dörk et al. R553X (2.0%) 3272-26A→G (0.9%) [1994]; Tümmler et al. [1996]; N1303K (1.8%) W1282X (0.7%) Estivill et al. [1997]; Dörk et G542X (1.2%) 2143delT (0.7%) al. [2000] R347P (1.2%) 1078delT (0.6%) CFTRdele2,3 (1.2%) 2183AA→G (0.6%) 3849+10KbC→T (1.0%) 2184insA (0.6%) G551D (0.9% 3659delC (0.6%) 1717-1G→A (0.9%) Greece ∆F508 (52.9%) 3272-26A→G (0.8%) 82.2 67.6 22 2097/718 Kanavakis et al. [1995]; Estivill 621+1G→T (5.0%) R1070Q (0.8%) et al. [1997]; Tzetis et al. G542X (4.1%) W496X (0.7%) [1997]; Macek et al. [2002] N1303K (3.3%) 621+3A→G (0.7%) 2183AA→G (1.8%) ∆I507 (0.7%) 2789+5G→A (1.7%) W1282X (0.7%) E822X (1.6%) 574delA (0.7%) R117H (1.2%) 1677delTA (0.7%) R334W (1.1%) A46D (0.6%) R1158X (1.0%) 3120+1G→A (0.6%) G85E (1.0%) G551D (0.5%) Hungary ∆F508 (54.9%) W1282X (1.8%) 68.3 46.6 9 1133/976 CFGAC [1994]; Estivill et al. 1717-1G→A (1.9%) G542X (1.7%) [1997]; Macek et al. [2002] R553X (2.1%) N1303K (1.3%) Y1092X (1.8%) G551D (1.0%) S1196X (1.8%) Ireland ∆F508 (70.4%) G542X (1.0%) 82.1 67.4 7 801/509 CFGAC [1994]; Estivill et al. G551D (5.7%) 621+1G→T (0.8%) [1994] R117H (2.4%) 1717-1G→A (0.6%) R560T (1.2%) Italy ∆F508 (50.9%) ∆I507 (0.65%) 60.3 36.4 9 3524 Estivill et al. [1997] (total) G542X (3.1%) W1282X (0.62%) 1717-1G→A (1.6%) Y122K (0.59%) N1303K (1.4%) G551D (0.53%) R553X (0.94%) Italy ∆F508 (47.6%) R553X (1.3%) 87.1 75.9 15 225 Bonizzato et al. [1995] (Northeast) R1162X (9.8%) 2789+G→A (1.3%) 2183AA→G (9.3%) Q552X (1.3%) N1303K (4.0%) 621+1G→T (0.9%) G542X (2.7%) W1282X (0.9%) 711+5G→A (2.7%) 3132delTG (0.9%) 1717-1G→A (2.2%) 2790-2A→G (0.9%) G85E (1.3%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS583 Italy ∆F508 (56.4%) 711+1G→T (1.3%) 85.7 73.4 13 660/396 Castaldo et al. [1996]; Castaldo (southern) N1303K (6.8%) G1244E (1.3%) et al. [1999] G542X (5.7%) R1185X (1.3%) W1282X (3.8%) L1065P (1.3%) 1717-1G→A (2.3%) R553X (1.1%) 2183AA→G (1.9%) I148T (0.7%) 4016insT (1.8%) Latvia 1) DF508 (58.3%) 4) CFTRdele2,3 (2.8%) - - 6 36 Dörk et al. [2000]; Macek et al. 2) 3849+10KbC®T (8.3%) 5) W1282X (2.8%) [2002] 3) N1303K (5.6%) 6) 394delTT (2.8%) Lithuania ∆F508 (31.0%) N1303K (2.0%) 39.0 15.2 4 94 Dörk et al. [2000]; Macek et al. R553X (4.0%) CFTRdele2,3 (2.0%) [2002] Macedonia ∆F508 (54.3%) 711+3A→G (1.0%) 69.2 47.9 12 559/226 Petreska et al. [1998]; Dörk et G542X (4.2%) 3849G→A (1.0%) al. [2000]; Macek et al. N1303K (2.0%) 2184insA (0.9%) [2002] CFTRdele2,3 (1.3%) 457TAT→G (0.7%) 621+1G→T (1.3%) V139E (0.7%) 611-1G→T (1.2%) 1811+1G→C (0.6%) Netherlands ∆F508 (74.2%) R1162X (0.9%) 86.8 75.3 9 3167/1442 Gan et al. [1995]; Estiville et al. A455E (4.7%) S1251N (0.9%) [1997]; Collee et al. [1998] G542X (1.8%) N1303K (0.9%) 1717-1G→A (1.5%) W1282X (0.7%) R553X (1.2%) Norway ∆F508 (60.2%) G551D (1.2%) 69.8 48.7 6 410/242 Schwartz et al. [1994]; Estivill 394delTT (4.2%) G542X (0.6%) et al. [1997] R117H (3.0%) N1303K (0.6%) Poland ∆F508 (57.1%) CFTRdele2,3 (1.8%) 73.5 54.0 11 4046/1726 CFGAC [1994]; Estivill et al. 3849+10Kb C→T (2.7%) R560T (1.5%) [1997]; Dörk et al [2000]; G542X (2.6%) W1282X (0.7%) Macek et al. [2002] 1717-1G→A (2.4%) ∆I507 (0.5%) R553X (1.9%) G551D (0.5%) N1303K (1.8%) Portugal ∆F508 (44.7%) R334W (0.7%) 49.7 24.7 5 739/454 CFGAC [1994]; Estivill et al. G542X (1.6%) N1303K (0.7%) [1997] R1066C (2.0%) Romania ∆F508 (36.6%) G542X (1.4%) 51.5 26.5 11 224/74 CFGAC [1994]; Estivill et al. 2043delG (2.0%) R553X (1.4%) [1997]; Popa et al. [1997]; W1282X (1.7%) G576X (1.4%) Macek et al. [2002] 1717-2A→G (1.4%) 1898+1G→A (1.4%) I148T (1.4%) 2183AA→G (1.4%) 621+1G→T (1.4%) Russia ∆F508 (54.4%) 552insA (0.9%) 70.7 50.0 12 5073/2562 CFGAC [1994]; Estivill et al. CFTRdele2,3 (5.0%) G542X (0.9%) [1997]; Dörk et al. [2000]; R553X (3.5%) R334W (0.9%) Macek et al. [2002] 2183AA→G (1.3%) 1677delTA (0.8%) W1282X (1.0%) Y122X (0.5%) 394delTT (1.0%) 1367del5 (0.5%) (Continued) BOBADILLAETAL. Login to comment
112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL. Login to comment

PMID: 12116247 [PubMed] Muller F et al: "Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases."

No. Sentence Comment

51 T, R117H, Y122X, 711 þ 1G ! Login to comment

PMID: 12124743 [PubMed] Salvatore F et al: "Genotype-phenotype correlation in cystic fibrosis: the role of modifier genes."

No. Sentence Comment

18 Several mutations are frequent in specific populations: W1282X among Ashkenazi [Shoshani et al., 1992], 2143delT in Germany [Dork et al., 1994], Y122X in Iceland [Chevalier-Porst et al., 1994], T338I in Sardinia, and 2183AA > G and R1162X in Northeast Italy [Rendine et al., 1997]. Login to comment

PMID: 12133923 [PubMed] Corbetta C et al: "Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population."

No. Sentence Comment

266 Mutations identified by the assay are G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183-AA→G, 2789+5G→A, delF508, I507del, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, and N1303K. Login to comment

PMID: 12151438 [PubMed] Wang Z et al: "Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens."

No. Sentence Comment

20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

PMID: 12357328 [PubMed] McCormick J et al: "Demographics of the UK cystic fibrosis population: implications for neonatal screening."

No. Sentence Comment

83 The additional eleven are S549N, 3849+4A?G, 3905insT, 2789+5G?A, Y122X, 711+1G?T, R347P, R347H, R334W, A455E and 3281AA?G. Login to comment

PMID: 12592165 [PubMed] Navarro J et al: "[National program for neonatal screening for cystic fibrosis: implementation and preliminary results]."

No. Sentence Comment

46 3 Les mutations étudiées sont : 1717-1G > A - G542X - W 1282 X - N 1303 K - DF 508 (M) - 3849 + 10kbC > T - 621+1 G > T - R553X - G 551D, R117H, R1162X - R 334W - A455E - 2183 AA > G - 3659delC-- 1078 delT - D1507 - R347P - S 1251N, E60X, 2789+5G > A - 394del T - G 85 E - 1811+1.6 - Y122X - 711+1G > T - W 846 X - Y 1092 - 3272-26A > G. Login to comment

PMID: 12794695 [PubMed] Timmreck LS et al: "Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina."

No. Sentence Comment

82 CFTR Gene Mutations Tested DF508 R334W Y1092X 5T variant Y122X R347H G542X S549R 3,849 þ 4 G551D 3,849 þ 10 kb 2,789 þ 5 W1282X R553X 711 þ 1 3,905 þ T 621 þ 1 1,898 þ 1 N1303K 1,717À1 R1162X R117H 1078dT A455E D1507 Q493X 218dA R347P V520F G85E R560T S549N 3659dC Wolffian duct must occur at a time when the Mu¨llerian duct is no longer dependent on the Wolffian duct for development. Login to comment

PMID: 12815607 [PubMed] Scotet V et al: "Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland."

No. Sentence Comment

64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment

PMID: 12820707 [PubMed] Hicks K et al: "Cystic fibrosis: S158N (605G --> A) is a rare genetic variant found in coupling with deltaF508."

No. Sentence Comment

16 Novel fragments with sizes not compatible with 621 1 1G R T, Y122X, or any other previously described CF mutation in this exon (www.genet.sickkids. Login to comment

PMID: 12939655 [PubMed] Perri F et al: "Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis."

No. Sentence Comment

33 Mutation screening of the CFTR gene The 31 most frequent mutations (F508del, I507del, G551D, G542X, N1303K, 1717-1G4A, W1282X, R553X, R347P, R347H, R334W, 3849+10kb C4T, R117H, 621+1G4T, A455E, S549N, R560T, S549R, V520F, Q493X, 3849+ 4A4G, 1078delT, R1162X, 3659delC, 3905insT, Y122X, 2183delAA4G, 2789+5G4A, 1898+1G4A, 711+1G4T, and G85E) were examined with the polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (OLA, Applied Biosystems, Foster City, CA, USA) and finally a sequence-coded separation. Login to comment

PMID: 14641997 [PubMed] Raskin S et al: "High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing."

No. Sentence Comment

63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes. Login to comment

PMID: 14739679 [PubMed] Farriaux JP et al: "Neonatal screening for cystic fibrosis: France rises to the challenge."

No. Sentence Comment

115 It will soon be upgraded to include a further 10 mutations (2789 þ 5G>A, 394delT, G85E, 1811 þ 1,6kbA>G, Y122X, 711 þ 1G>T, W846X2, Y1092X C>A, 3272 À 26A>G, 3120 þ 1G>A 320pb). Login to comment

PMID: 15246977 [PubMed] van Heeckeren AM et al: "Role of Cftr genotype in the response to chronic Pseudomonas aeruginosa lung infection in mice."

No. Sentence Comment

15 Mice bearing different mutations in the murine homolog to CFTR (Cftr) (R117H, S489X, Y122X, and ⌬F508, all backcrossed to the C57BL/6J background) were compared with respect to growth and in their ability to respond to lung infection elicited with Pseudomonas aeruginosa-laden agarose beads. Login to comment
17 The inflammatory responses to P. aeruginosa-laden agarose beads were comparable in mice of all four Cftr mutant genotypes with respect to absolute and relative cell counts in bronchoalveolar lavage fluid, and cytokine levels (TNF-␣, IL-1beta, IL-6, macrophage inflammatory protein-2, and keratinocyte chemoattractant) and eicosanoid levels (PGE2 and LTB4) in epithelial lining fluid: the few small differences observed occurred only between cystic fibrosis mice bearing the S489X mutation and those bearing the knockout mutation Y122X. Login to comment
49 In these experiments we tested cystic fibrosis mice bearing the ⌬F508, R117H, Y122X, or S489X genotypes, all backcrossed to the common C57BL/6J genetic background, using the mucoid P. aeruginosa agarose bead model to compare their inflammatory responses. Login to comment
56 Nomenclature rules available on the Jackson Laboratory website were followed; B6.129S6-Cftrtm2Uth mice bear the R117H mutation, and B6.129S6-Cftrtm3Uth mice bear the Y122X mutation. Login to comment
61 Cystic fibrosis mice bearing the severe mutations S489X, Y122X, and ⌬F508 were fed the liquid elemental diet Peptamen (Nestle Clinical Nutrition, Deerfield, IL) after weaning, whereas cystic fibrosis mice bearing the mild mutation R117H were fed a standard rodent chow until 1 wk before the start of the experiment at which point they were fed Peptamen until the termination of the experiment. Login to comment
78 At 3 wk of age mice were weighed and then weaned, at which point cystic fibrosis mice bearing the severe Cftr mutations S489X, Y122X, and ⌬F508 were fed a liquid diet. Login to comment
124 Cystic fibrosis mice bearing the severe Cftr mutations Y122X, S489X, and ⌬F508 weighed significantly less (P Ͻ 0.05) than homozygote wild-type controls at 7, 14, and 21 days of life with one exception; cystic fibrosis mice with the Y122X mutation did not differ significantly from wild-type mice at 7 days of age (P Ͼ 0.05), but sample sizes were small. Login to comment
133 Absolute body weight of cystic fibrosis mice before weaning Cftr Genotype Sample Size Age, days 7 14 21 S489X/S489X 14 3.0Ϯ0.6 5.8Ϯ0.9 7.0Ϯ1.1 Y122X/Y122X 4 3.6Ϯ1.7 6.1Ϯ2.3 7.2Ϯ2.5 ⌬F508/⌬F508 10 3.1Ϯ0.9 5.6Ϯ1.2 6.7Ϯ0.8 R117H/R117H 15 4.7Ϯ0.7* 7.1Ϯ0.9* 7.9Ϯ1.8 Data are represented as means Ϯ SD. Login to comment
145 That is, when comparisons were made between mice bearing the S489X mutation and those bearing the Y122X mutation, we combined data from experiments 68, 72, 80, and 94, taking into account any differences between the experiments. Login to comment
149 There were no significant differences in starting weight between cystic fibrosis mice bearing the S489X mutation and those bearing any other Cftr mutation (Fig. 3A). Login to comment
152 After differences between the experiments are taken into consideration (Fig. 3B), weight loss in cystic fibrosis mice bearing the S489X mutation is significantly greater than those bearing the Y122X mutation on days 1, 2, and 3 (P Ͻ 0.05) and significantly less than those bearing the R117H mutation on days 1 and 2 (P Ͻ 0.05). Login to comment
153 There were no significant differences in weight loss between cystic fibrosis mice bearing the S489X mutation and those bearing the ⌬F508 mutation. Login to comment
156 When stratifying for experiment, we found significant differences (P Ͻ 0.05) between cystic fibrosis mice bearing the Y122X mutation and those bearing the S489X mutation with Fig. 1. Login to comment
160 Cystic fibrosis mice bearing the S489X mutation were removed from this study to be used in other studies starting at 6 wk of age, and data are censored by death in cystic fibrosis mice bearing the Y122X mutation starting after 6 wk of age. Login to comment
167 In a comparison of S489X vs. Y122X, ⌬F508, and R117H genotypes, the available sample sizes provide 80% power to detect Fig. 2. Login to comment
171 The difference in nasal PD from the start of the response to 1 min later was determined, and representative tracings are shown to the end of the tracing period from wild type (A), S489X (B), Y122X (C), ⌬F508 (D), and R117H (E) mice. Login to comment
173 Nasal potential differences in wild-type mice and mice bearing mutations in Cftr Cftr Mutation Sample Size Amiloride, mV Chloride-free, Amiloride, Forskolin, mV None 3 -2.1Ϯ1.5 14.4Ϯ1.2 S489X 7 -13.2Ϯ5.1* -2.6Ϯ2.2* Y122X 3 -10.9Ϯ3.7 -0.8Ϯ1.3* ⌬F508 6 -7.6Ϯ3.5 -1.8Ϯ0.8* R117H 3 -8.5Ϯ0.1 0.1Ϯ0.8* Data are means Ϯ SD. Login to comment
176 Starting sample sizes in each experiment Experiment Mouse Strain by Cftr Mutation S489X Y122X ⌬F508 R117H 64 9 (1) 0 0 9 (1) 68 8 4 5 0 72 8 (1)* 8 0 0 75 7 (1) 0 11 (1) [2]* 0 80 9* 10 0 0 90† 10 0 10 0 94† 9 7* 9 (1) 9 (1)* Total 60 (3) 29 35 (2) [2] 18 (2) The number of mice that died due to surgical complications or pulmonary obstruction is noted in parentheses and brackets, respectively. Login to comment
181 When comparing the S489X to Y122X or ⌬F508 strains, we could detect even smaller differences with high power. Login to comment
196 Inflammatory mediators in epithelial lining fluid Parameter Comparison 1 Comparison 2 Comparison 3 Y122X S489X ⌬F508 S489X R117H S489X TNF-␣ 7.8* (5.1/13.1) 10.3 (6.0/14.3) 8.0 (6.7/12.2) 9.5 (7.2/12.4) 14.7 (5.9/23.5) 13.6 (9.1/22.3) IL-1beta 14.5* (5.6/19.3) 16.0 (7.5/25.7) 14.4 (10.0/20.2) 16.0 (8.2/20.2) 12.2 (3.0/32.6) 18.2 (8.1/24.3) IL-6 12.3 (5.9/28.4) 14.6 (7.9/33.1) 11.9 (7.8 (22.8) 13.4 (8.0/19.2) 16.6 (7.3/24.7) 20.8 (9.0/62.4) MIP-2 55.8 (12.1/86.3) 66.9 (34.8/107.3) 90.8 (58.8/129.7) 102.2 (48.0/140.8) 55.6 (21.2/202.5) 96.0 (37.6/131.5) KC 4.1 (3.3/5.5) 5.9 (3.5/7.8) 5.4 (4.1/9.4) 6.3 (4.8/8.6) 12.8 (5.0/15.8) 7.4 (4.6/10.7) LTB4 1.2 (0.2/3.3) 2.3 (1.3/7.8) 5.9 (3.6/10.5) 7.1 (2.3/10.5) 2.1 (1.2/16.7) 2.3 (1.3/7.8) PGE2 4.4 (2.3/6.0) 8.0 (4.4/12.2) 11.4 (7.3/16.6) 12.9 (7.6/22.0) 9.2 (5.9/13.5) 8.0 (4.4/12.2) Data are pooled from available data, are represented as the median (25th/75th percentiles), and are expressed as ng/ml epithelial lining fluid (ELF). Login to comment
207 Correcting the Cftr defect in the gut of cystic fibrosis mice bearing the S489X mutation, by transgenic provision of human CFTR driven by the fatty acid binding protein promoter, results in a much more robust cystic fibrosis mouse that grows normally and does not have intestinal obstruction on a diet of normal mouse chow. Login to comment
210 In this model of lung infection and inflammation, four different genotypes of cystic fibrosis mice were tested: two knockout mice, Y122X and S489X; mice homozygous for the major processing mutation in cystic fibrosis, ⌬F508; and mice homozygous for a channel mutant, R117H, which reaches the plasma membrane but does not function normally. Login to comment
211 None of the cystic fibrosis mice studied here grows as well as their wild-type littermates, although the cystic fibrosis mice bearing the R117H mutation maintain weight better at week 1 of life. Login to comment
214 Here we show that cystic fibrosis mice bearing the Cftr mutations S489X, ⌬F508, Y122X, and R117H on the congenic C57BL/6J background also display the cystic fibrosis electrophysiological phenotype. Login to comment
227 Cell numbers in BAL fluid Parameter Comparison 1 Comparison 2 Comparison 3 Y122X S489X ⌬F508 S489X R117H S489X %AM 5.3 (2.8/41.1) 6.0 (4.3/11.9) 5.8 (3.3/8.7) 4.3 (2.4/5.9) 12.7 (5.8/25.0) 4.7 (4.3/7.4) %PMN 94.3 (58.9/96.9) 94.0 (87.3/95.6) 94.2 (91.3/96.7) 95.3 (94.1/97.6) 87.3* (75.0/94.2) 95.0 (92.6/95.3) %Lymph 0.0 (0.0/0.7) 0.0 (0.0/1.3) 0.0 (0.0/0.0) 0.0 (0.0/0.0) 0.0 (0.0/0.0) 0.0 (0.0/0.0) AM/ml 36 (12/66) 34 (15/72) 47 (23/88) 60 (12/126) 104* (32/168) 78 (56/102) PMN/ml 787 (14/1,449) 801 (422/1,528) 850 (396/1,310) 1,378 (423/1,714) 857 (415/1,549) 1,520 (1,125/1,716) Data are pooled from available data and are represented as the median (25th/75th percentiles). Login to comment
243 Only the cystic fibrosis mice bearing the Y122X mutation differed in two cytokines from S489X, and this may represent the effect of multiple comparisons, rather than a real difference between them. Login to comment
13 Mice bearing different mutations in the murine homolog to CFTR (Cftr) (R117H, S489X, Y122X, and ⌬F508, all backcrossed to the C57BL/6J background) were compared with respect to growth and in their ability to respond to lung infection elicited with Pseudomonas aeruginosa-laden agarose beads. Login to comment
46 In these experiments we tested cystic fibrosis mice bearing the ⌬F508, R117H, Y122X, or S489X genotypes, all backcrossed to the common C57BL/6J genetic background, using the mucoid P. aeruginosa agarose bead model to compare their inflammatory responses. Login to comment
53 Nomenclature rules available on the Jackson Laboratory website were followed; B6.129S6-Cftrtm2Uth mice bear the R117H mutation, and B6.129S6-Cftrtm3Uth mice bear the Y122X mutation. Login to comment
58 Cystic fibrosis mice bearing the severe mutations S489X, Y122X, and ⌬F508 were fed the liquid elemental diet Peptamen (Nestle Clinical Nutrition, Deerfield, IL) after weaning, whereas cystic fibrosis mice bearing the mild mutation R117H were fed a standard rodent chow until 1 wk before the start of the experiment at which point they were fed Peptamen until the termination of the experiment. Login to comment
75 At 3 wk of age mice were weighed and then weaned, at which point cystic fibrosis mice bearing the severe Cftr mutations S489X, Y122X, and ⌬F508 were fed a liquid diet. Login to comment
121 Cystic fibrosis mice bearing the severe Cftr mutations Y122X, S489X, and ⌬F508 weighed significantly less (P Ͻ 0.05) than homozygote wild-type controls at 7, 14, and 21 days of life with one exception; cystic fibrosis mice with the Y122X mutation did not differ significantly from wild-type mice at 7 days of age (P Ͼ 0.05), but sample sizes were small. Login to comment
130 Absolute body weight of cystic fibrosis mice before weaning Cftr Genotype Sample Size Age, days 7 14 21 S489X/S489X 14 3.0Ϯ0.6 5.8Ϯ0.9 7.0Ϯ1.1 Y122X/Y122X 4 3.6Ϯ1.7 6.1Ϯ2.3 7.2Ϯ2.5 ⌬F508/⌬F508 10 3.1Ϯ0.9 5.6Ϯ1.2 6.7Ϯ0.8 R117H/R117H 15 4.7Ϯ0.7* 7.1Ϯ0.9* 7.9Ϯ1.8 Data are represented as means Ϯ SD. Login to comment
142 That is, when comparisons were made between mice bearing the S489X mutation and those bearing the Y122X mutation, we combined data from experiments 68, 72, 80, and 94, taking into account any differences between the experiments. Login to comment
157 Cystic fibrosis mice bearing the S489X mutation were removed from this study to be used in other studies starting at 6 wk of age, and data are censored by death in cystic fibrosis mice bearing the Y122X mutation starting after 6 wk of age. Login to comment
164 In a comparison of S489X vs. Y122X, ⌬F508, and R117H genotypes, the available sample sizes provide 80% power to detect Fig. 2. Login to comment
168 The difference in nasal PD from the start of the response to 1 min later was determined, and representative tracings are shown to the end of the tracing period from wild type (A), S489X (B), Y122X (C), ⌬F508 (D), and R117H (E) mice. Login to comment
170 Nasal potential differences in wild-type mice and mice bearing mutations in Cftr Cftr Mutation Sample Size Amiloride, mV Chloride-free, Amiloride, Forskolin, mV None 3 -2.1Ϯ1.5 14.4Ϯ1.2 S489X 7 -13.2Ϯ5.1* -2.6Ϯ2.2* Y122X 3 -10.9Ϯ3.7 -0.8Ϯ1.3* ⌬F508 6 -7.6Ϯ3.5 -1.8Ϯ0.8* R117H 3 -8.5Ϯ0.1 0.1Ϯ0.8* Data are means Ϯ SD. Login to comment
178 When comparing the S489X to Y122X or ⌬F508 strains, we could detect even smaller differences with high power. Login to comment
193 Inflammatory mediators in epithelial lining fluid Parameter Comparison 1 Comparison 2 Comparison 3 Y122X S489X ⌬F508 S489X R117H S489X TNF-␣ 7.8* (5.1/13.1) 10.3 (6.0/14.3) 8.0 (6.7/12.2) 9.5 (7.2/12.4) 14.7 (5.9/23.5) 13.6 (9.1/22.3) IL-1beta 14.5* (5.6/19.3) 16.0 (7.5/25.7) 14.4 (10.0/20.2) 16.0 (8.2/20.2) 12.2 (3.0/32.6) 18.2 (8.1/24.3) IL-6 12.3 (5.9/28.4) 14.6 (7.9/33.1) 11.9 (7.8 (22.8) 13.4 (8.0/19.2) 16.6 (7.3/24.7) 20.8 (9.0/62.4) MIP-2 55.8 (12.1/86.3) 66.9 (34.8/107.3) 90.8 (58.8/129.7) 102.2 (48.0/140.8) 55.6 (21.2/202.5) 96.0 (37.6/131.5) KC 4.1 (3.3/5.5) 5.9 (3.5/7.8) 5.4 (4.1/9.4) 6.3 (4.8/8.6) 12.8 (5.0/15.8) 7.4 (4.6/10.7) LTB4 1.2 (0.2/3.3) 2.3 (1.3/7.8) 5.9 (3.6/10.5) 7.1 (2.3/10.5) 2.1 (1.2/16.7) 2.3 (1.3/7.8) PGE2 4.4 (2.3/6.0) 8.0 (4.4/12.2) 11.4 (7.3/16.6) 12.9 (7.6/22.0) 9.2 (5.9/13.5) 8.0 (4.4/12.2) Data are pooled from available data, are represented as the median (25th/75th percentiles), and are expressed as ng/ml epithelial lining fluid (ELF). Login to comment
224 Cell numbers in BAL fluid Parameter Comparison 1 Comparison 2 Comparison 3 Y122X S489X ⌬F508 S489X R117H S489X %AM 5.3 (2.8/41.1) 6.0 (4.3/11.9) 5.8 (3.3/8.7) 4.3 (2.4/5.9) 12.7 (5.8/25.0) 4.7 (4.3/7.4) %PMN 94.3 (58.9/96.9) 94.0 (87.3/95.6) 94.2 (91.3/96.7) 95.3 (94.1/97.6) 87.3* (75.0/94.2) 95.0 (92.6/95.3) %Lymph 0.0 (0.0/0.7) 0.0 (0.0/1.3) 0.0 (0.0/0.0) 0.0 (0.0/0.0) 0.0 (0.0/0.0) 0.0 (0.0/0.0) AM/ml 36 (12/66) 34 (15/72) 47 (23/88) 60 (12/126) 104* (32/168) 78 (56/102) PMN/ml 787 (14/1,449) 801 (422/1,528) 850 (396/1,310) 1,378 (423/1,714) 857 (415/1,549) 1,520 (1,125/1,716) Data are pooled from available data and are represented as the median (25th/75th percentiles). Login to comment
240 Only the cystic fibrosis mice bearing the Y122X mutation differed in two cytokines from S489X, and this may represent the effect of multiple comparisons, rather than a real difference between them. Login to comment

PMID: 15371908 [PubMed] Buyse IM et al: "Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation."

No. Sentence Comment

77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment

PMID: 15638824 [PubMed] Castaldo G et al: "Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population."

No. Sentence Comment

14 Most mutations are "private," but some are frequent in specific regions or ethnic groups (Estivill et al. 1997): 2143delT in Germany (Dork et al. 1992), W1282X among Ashkenazim (Shoshani et al. 1992), Y122X in Reunion Island (Chevalier-Porst et al. 1992), 2183AA>G and R1162X in northeast Italy and T338I in Sardinia (Rendine et al. 1997). Login to comment

PMID: 15908456 [PubMed] Sanchez-Garcia JF et al: "Multiple mutation analysis of the cystic fibrosis gene in single cells."

No. Sentence Comment

62 G, R1162X, 3659delC, W1282X, 3905insT, N1303K, 1078delT, R347P, R347H and R334W labelled with TET (green) and A455E, 1898þ1G.A, 2183AA.G, 2789þ5G.A, G85E, 621þ1G.T, R117H, Y122X and 711þ1G.T labelled with HEX (yellow). Login to comment

PMID: 16014420 [PubMed] Bensalem N et al: "Down-regulation of the anti-inflammatory protein annexin A1 in cystic fibrosis knock-out mice and patients."

No. Sentence Comment

8 More importantly, annexin A1 was down-regulated in nasal epithelial cells from CF patients bearing homozygous nonsense mutations in the CFTR gene (Y122X, 489delC) and differentially expressed in F508del patients. Login to comment
48 Nasal Epithelial Cells from CF Patients-Six CF patients with a Y122X/Y122X nonsense mutation were followed up in the CF centers at the Saint Pierre Children Hospital and at Saint Denis Children Hospital (La Re´ union, France). Login to comment
156 Six CF patients, bearing the Y122X/Y122X nonsense mutation and one homozygous for 489delC, both predicted to encode a truncated protein ending at part of the second transmembrane domain of the CFTR protein, were analyzed. Login to comment
160 First, we conducted an immunocytochemistry investigation to confirm the absence of CFTR in nasal epithelial cells from Y122X/Y122X and 489delC patients (data not shown). Login to comment
259 d-f, annexin A1 staining could not be detected in CF patients bearing the Y122X/ Y122X mutation (d and f); slight staining was observed in another Y122X/Y122X CF patient (e). Login to comment
262 CF patients Age Sweat test FEV1 a Annexin A1 staining Severity yr meq/liter % Y122X/Y122X 18 126 99 - Mild Y122X/Y122X 13 103 78 ϩ/- Mild Y122X/Y122X 22 108 80 - Mild Y122X/Y122X 14 116 76 - Mild Y122X/Y122X 15 90 62 - Mild 489delC/489delC 12 130 89 - Severe F508del/ F508del 15 98 77 ϩϩ Mild F508del/ F508del 2 ND ND ϩϩ Mild F508del/ F508del 11 110 60 ϩ Severe a Forced expiratory volume. Login to comment

PMID: 16088579 [PubMed] Gallati S et al: "Genetics of cystic fibrosis."

No. Sentence Comment

50 In effect, virtually no func- Table 2 Unusually Common Cystic Fibrosis Mutations in Specific Populationsa Total Exon/ Number Number Frequency Mutation Intron Ethnic Origin Observed Screened (%) 296+12T→C intron 02 Pakistani 02 24 8.33 E60X exon 03 Belgian 06 394 1.52 G91R exon 03 French 04 266 1.50 394delTT exon 03 Scandinavian 78 1588 4.91 457TAT→G exon 04 Austrian 04 334 1.20 Y122X exon 04 Réunion Island 14 29 48.27 I148T exon 04 French Canadian 06 66 9.09 711+5G→A intron 05 Italian (North East) 06 225 2.67 1078delT exon 07 Celtic 27 475 5.68 1161delC exon 07 Pakistani 02 24 8.33 T338I exon 07 Italian, Sardinian 04 86 4.65 Q359K/T360K exon 07 Georgian Jews 07 8 87.50 R347H exon 07 Turkish 04 134 2.98 1609delCA exon 10 Spanish 03 96 3.12 1677delTA exon 10 Bulgarian 05 222 2.25 S549I exon 11 Arabs 02 40 5.00 Q552X exon 11 Italian (North East) 03 225 1.33 A559T exon 11 African-American 02 79 2.53 1811+1.2kbA→G intron 11 Spanish 22 1068 2.06 1898+5G→T intron 12 Chinese 03 10 30.00 1949del84 exon 13 Spanish 02 136 1.47 2143delT exon 13 Russian 04 118 3.39 2183AA→G exon 13 Italian (North East) 21 225 9.33 2184insA exon 13 Russian 03 118 2.54 3120+1G→A intron 16 African-American 14 112 12.50 3272-26A→G intron 17a Portugese, French 06 386 1.55 R1066C exon 17b Portugese 05 105 4.76 R1070Q exon 17b Bulgarian 04 166 2.41 Y1092X exon 17b French Canadian, 11 725 1.52 French M1101K exon 17b Hutterite 22 32 68.75 3821delT exon 19 Russian 03 118 2.54 S1235R exon 19 French (South) 04 340 1.18 S1251N exon 20 Dutch, Belgian 11 792 1.39 S1255X exon 20 African-American 02 79 2.53 3905insT exon 20 Swiss 45 982 4.58 Amish, Arcadian 13 86 15.12 W1282X Exon 20 Jewish-Ashkenazi 50 95 52.63 R1283M exon 20 Welsh 03 183 1.64 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/. Login to comment
67 SSCP analysis is one of the most popular methods for the detection of sequence variants in polymerase chain reaction (PCR) amplified DNA fragments.29 The princi- Table 3 Cystic Fibrosis Mutations Detected by Commercial Kits INNO-LiPA Mutations CF2 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K CFTR12 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K, S1251N, R560T, 3905insT, Q552X CFTR17+Tn 394delTT, G85E, 621+1G→T, R117H, 1078delT, R347P, R334W, E60X, 2183AA→G, 2184delA, 711+5G→A, 2789+5G→A, R1162X, 3659delC, 3849+10kbC→T, 2143delT, A455E, (5T/7T/9T) Elucigene CF4 ⌬F508, G542X, G551D, 621+1G→T CF12 ⌬F508, G542X, G551D, N1303K, W1282X, 1717-1G→A, R553X, 621+1G→T, R117H, R1162X, 3849+10kbC→T, R334W CF20 1717-1G→A, G542X, W1282X, N1303K, ⌬F508, 3849+10kbC→T, 621+1G→T, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA→G, 3659delC, 1078delT, ⌬I507, R345P, S1251N, E60X CF Poly-T 5T/7T/9T OLA CF OLA assay ⌬F508, F508C, ⌬I507, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183AA→G, 2789+5G→A b Figure 2 Mutation screening of exon 19 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene using polymerase chain reaction (PCR) followed by single-strand conformation polymorphism/heteroduplex (SSCP/HD) analysis on a silver-stained polyacrylamide gel. Login to comment

PMID: 16191501 [PubMed] Chou LS et al: "A comparison of high-resolution melting analysis with denaturing high-performance liquid chromatography for mutation scanning: cystic fibrosis transmembrane conductance regulator gene as a model."

No. Sentence Comment

18 Materials and Methods Sample Source and Study Design Eleven commercially genotyped samples were obtained from Coriell Cell Repositories, Coriell Institute for Medical Research, Camden, NJ (Y122X, R334W, R347P, A455E, I507del, F508del, F508C, G542X/G542X, R553X, R560T, and M1101K). Login to comment
31 ❚Table 1❚ Mutations Analyzed in the Study Position From 5' Exon (or Intron) Genotype* No. of Samples Nucleotide Change SNP Class† End/Amplicon Size (bp) 3 394delTT 1 Del‡ - 132/234 4 R117H 1 G→A 1 83/270 Y122X 1 T→A 4 99/270 I148T 2 T→C 1 176/270 Intron 4 621+1 2 G→T 2 233/270 7 R334W 1 C→T 1 208/345 R347P 1 G→C 3 248/345 9 A455E 2 C→A 2 155/263 10 I507del 1 Del‡ - 171/292 F508del 3 Del‡ - 174/292 F508del/F508del 1 Del - 174/292 F508C 1 T→G 2 175/292 11 G542X 1 G→T 2 90/175 G542X/G542X 1 G→T 2 90/175 G551D 1 G→A 1 118/175 R553X 2 C→T 1 123/175 R560T 1 G→C 3 145/175 13 2184delA 1 Del‡ - 356/458 17b M1101K 1 T→A 4 196/292 21 N1303K 1 C→G 3 175/250 bp, base pairs; SNP, single nucleotide polymorphism. Login to comment
39 Mutation Scanning by dHPLC Twenty-two of the samples (all except 394delTT, Y122X, 2184delA, and M1101K) also were amplified under conditions optimized for dHPLC with the same primers (Transgenomic, Omaha, NE). Login to comment
90 Y122X and M1101K are both class 4 SNPs20 (A/T heterozygotes), a class otherwise absent from our study. Login to comment
113 To discriminate differences at single base resolution, saturating DNA Temperature (°C) Fluorescence 81 82 83 84 85 86 87 88 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - Y122X het A::A T::T WT T::A Temperature (°C) Fluorescence 79 80 81 82 83 84 85 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - 2184delA het WT Temperature (°C) Fluorescence 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - M1101K het A::A T::T WT T::A Temperature (°C) Fluorescence 77 78 79 80 81 82 83 84 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - 394delTT het WT A B C D ❚Figure 5❚ High-resolution melting detection of heterozygous A/T single nucleotide polymorphisms and small (1-2 base pair) deletions. Login to comment

PMID: 16379540 [PubMed] Stanziale P et al: "Indirect CFTR mutation identification by PCR/OLA anomalous electropherograms."

No. Sentence Comment

59 Case 1 In a 34-year-old male subject affected by obstructive azoospermia resulting from CBAVD diagnosed by scrotal exploration and impalpable vasa clinically observed, no signal could be obtained at either the wild-type or the mutated site with the allele-specific probes R117H, Y122X and 621 ϩ 1G Ͼ T (Fig. 1). Login to comment

PMID: 16435054 [PubMed] Zilfalil BA et al: "Detection of F508del mutation in cystic fibrosis transmembrane conductance regulator gene mutation among Malays."

No. Sentence Comment

55 MUTATIONS R553X G551D 1507 del F508 del 1717-1 G>A G542X R560T R347P W1282X R334W 1078 Del T 3849 + 10KB C>T R1162X N1303K 3659 Del C A455E R117H 2183 AA>G 2789+5 G>A 1898 +1 G>A 621+1 G>T 711+1 G>T G85E S549N S549R V520F Q493X R347H 3849 +4 A>G 3905 INS T Y122X 4 software before running the gel electrophoresis in 1X TBE using ABI PRISM® 377 Genetic Analyzer (Applied Biosystems, USA) for 45 minutes. Login to comment

PMID: 16791827 [PubMed] Ollero M et al: "Cystic fibrosis enters the proteomics scene: new answers to old questions."

No. Sentence Comment

184 It is worth noting that annexin-1 expression in nasal cells from patients bearing the homozygous nonsense mutation Y122X, a genotype that resembles that of cftr2/2 mice, was strongly diminished as compared to healthy subjects, suggesting that annexin-1 expression may be related to CF pathogenesis. Login to comment

PMID: 17394637 [PubMed] Sermet-Gaudelus I et al: "In vitro prediction of stop-codon suppression by intravenous gentamicin in patients with cystic fibrosis: a pilot study."

No. Sentence Comment

8 Results: After in vitro gentamicin incubation, the readthrough efficiency for the Y122X mutation was at least five times higher than that for G542X, R1162X, and W1282X. Login to comment
9 In six of the nine patients with the Y122X mutation, CFTR immunodetection showed protein at the membrane of the nasal epithelial cells and the CFTR-dependent Cl-secretion in NPD measurements increased significantly. Login to comment
13 Clinical status, NPD and sweat Cl- values did not change in the Y122X patients with no protein expression, in patients with the other stop mutations investigated in vitro and those without stop mutations. Login to comment
27 Methods Readthrough quantification in cell culture A dual gene reporter system was used to quantify the readthrough efficiency directed by the most frequent stop mutations in the French population (Y122X, G542X, R1162X and W1282X) [10], in the presence or absence of gentamicin. Login to comment
65 Table 1: Oligonucleotide sequences used in the dual reporter gene assay, corresponding to the Y122X, G542X, R1162X and W1292X mutations and the TQ in frame control. Login to comment
67 Readthrough level (%)* Mutation Oligonucleotides** 0 600 μg/ml gentamicin Y122X w 5' CGCTCTATCGCGTAACTAGGCATAGGC 3'; c 5' GCCTATGCCTAGTTACGCGATAGAGCG 3' 0.52 1.6 W1282X w 5` AATATAGTTCTTTGAGAAGGTGGAATC 3` c 5` GATTCCACCTTCTCAAAGAACTATATT 3` 0.115 0.35 R1162X w 5' CGATCTGTGAGCTGAGTCTTTAAGTTC 3'; c 5' GAACTTAAAGACTCAGCTCACAGATCG 3' 0.023 0.22 G542X w 5' ACTTTGCAACAGTGAAGGAAAGCCTTT 3'; c 5' AAAGGCTTCCTTCACTGTTGCAAAGT 3' 0.017 0.26 TQ: in frame control w 5' GCAGGAACACAACAGCAATTACAG 3' c 5' CTGTAATTGCTGTTGTGTTCCTGC 3' 100 100 *At least five independent experiments were performed with each construct and showed less than 20% variation. Login to comment
80 Y122X had a basal readthrough level five times higher than that for the W1282X mutation, 22 times that for R1162X and 30 times that for G542X. Login to comment
81 After gentamicin incubation, Y122X readthrough efficiency remained at least 4.5 times higher than that for W1282X, six times that for G542X and 7.3 that for R1162X. Login to comment
82 We therefore decided to focus the clinical trial on patients with the Y122X mutation. Login to comment
84 Nine carried the Y122X mutation (eight were Y122X homozygous and one was Y122X/F508del) (Group A). Login to comment
90 Clinical scores for the nine patients with the Y122X mutation (Group A) improved significantly at the end of the study, mainly because of improvements in coughing, sputum production, dyspnea and energy level. Login to comment
102 These levels decreased significantly after treatment among patients with the Y122X mutation (Group A) (Tables 3 and 5; Figure 1). Login to comment
114 In contrast to the patients with the Y122X mutation, the patients with other stop mutations (Group B) and those without any stop mutations (Group C) had no significant modifications of their basal potential difference or response to amiloride or isoproterenol (Table 5). Login to comment
116 The effect of parenteral gentamicin on CFTR was analysed in patients who agreed to nasal brushing, i.e., seven Y122X homozygous patients, one compound F508del/Y122X patient, one R1162X homozygous patient, and the five patients without stop mutations. Login to comment
117 Before gentamicin treatment, no CFTR labeling was observed in any of the Y122X homozygous patients (see representative picture in Figure 2c), while afterwards, five patients expressed CFTR at the membrane in 10 to 80% of cells (Figure 2d). Login to comment
120 Before treatment, cytoplasmic labeling in the compound heterozygous Y122X/ΔF508 patient was found in 20% of the cells with 24-1 antibody and 70% of the cells with MATG 1061 antibody and, after treatment, in 70% and 100% of the cells, respectively. Login to comment
122 Among the Y122X responders, CFTR-depend- Table 3: Characteristics of the subjects with stop codon mutations and variation of clinical and functional parameters after treatment with gentamicin. Login to comment
131 Patients Group A n = 9 Group B n = 4 Group C n = 5 p Group A vs. B p Group A vs. C p Group B vs. C Age 15.4(4.2) 12(1.8) 16.5(1.7) NS NS NS CFCS 31(8) 26(2) 24(2) NS NS NS FEV1 (%) 69(21) 80(12) 74(10) NS NS NS FVC (%) 70(20) 83(7) 84(22) NS NS NS FEF25-75 (%) 46(30) 67(26) 54(26) NS NS NS Group A: patients with the Y122X stop mutation. Group B: patients with another stop mutation. Group C: patients without any stop mutation. CFCS refers to the Cystic Fibrosis Clinical Score. FEV1, FVC, FEF25-75 refer respectively to forced expiratory volume in one second, forced vital capacity, and forced expiratory flow at 25 to 75 percent of vital capacity and are expressed as percentages of predicted values for age, sex, and height. Login to comment
140 Overall, the pattern of the in vitro readthrough, clearly most efficient for the Y122X mutation, was strongly correlated with the immunocytochemically determined CFTR expression in nasal cells, as assessed by the CFTR staining after treatment for the Y122X patients, compared with the lack of staining in both the R1162X patient and the patients without stop mutations. Login to comment
142 In patients carrying the Y122X mutation, gentamicin treatment resulted in delivery of the CFTR protein at the membrane and in restoration of CFTR-dependent chloride transport in nasal epithelial cells. Login to comment
157 Group A n = 9 Group B n = 4 Group C n = 5 D0 D15 p D0 D15 p D0 D15 p CFCS 30(8) 21(8) 0.007 25(1) 22 (1) NS 23.5(2) 23(3) NS FEV1(L) 1.82(0.8) 2.07(0.8) 0.04 1.68(0.4) 1.77(0.3) NS 2(0.3) 2.12(0.4) NS FVC(L) 2.2(1) 2.36(0.9) NS 2.08(0.6) 2.14(0.5) NS 2.93(0.5) 3(0.4) NS FEF25-75(L) 1.54(1.1) 1.95(1.06) NS 1.91(0.9) 1.96(0.8) NS 1.93(1.8) 1.99(1.8) NS Group A: patients with the Y122X stop mutation. Group B: patients with another stop mutation. Group C: patients without any stop mutation. CFCS refers to the Cystic Fibrosis Clinical Score. FEV1, FVC, FEF25-75 as defined in Table 2 and are expressed as absolute values. Login to comment
164 Group A n = 9 Group B n = 4 Group C n = 5 Patients D0 D15 p D0 D15 p D0 D15 p Sweat chloride (mM/L) 109(17) 85(31) 0.03 110(7) 112(16) NS 96(1.5) 105(18) NS Basal PD -56(10) -49(5) 0.12 -53(11) -50(8) NS -52(8) -52(7) NS ΔAmiloride 20(6) 15(7) 0.09 22(15) 20(9) NS 19(12) 21(13) NS ΔCl-free-isoproterenol -0.8(1.3) -4.6(6) 0.04 -0.2(0.5) -0.9(1) NS 0(0.5) -0.8(1) NS Group A: patients with the Y122X stop mutation. Group B: patients with another stop mutation. Group C: patients without any stop mutation. Login to comment
167 Sweat chloride concentration and ΔCl-free-isoproterenol before and after gentamicin in Y122X patients (●)Figure 1 Sweat chloride concentration and ΔCl-free-isoproterenol before and after gentamicin in Y122X patients (●). Login to comment
171 Although there was a correlation in patients carrying the Y122X mutation between the decrease of the response to amiloride (sodium absorption) and the increase of the response to isoproterenol (CFTR dependent chloride secretion), there was only a trend in the decrease of the response to amiloride, the non-significant level probably being due to the small sample of patients. Login to comment
173 Interestingly, the R1162X patient did not have positive protein immunostaining at the end of the treatment, demonstrating a correlation between proteic expression and Example of nasal potential difference tracing (NPD) (a, b) and CFTR immunostaining with MATG 1061 monoclonal antibody ofnasal ciliated cells (c,d) before (a,c) and after (b,d) parenteral gentamicin treatment in a Y122X homozygous CF patientFigure 2 Example of nasal potential difference tracing (NPD) (a, b) and CFTR immunostaining with MATG 1061 monoclonal antibody of nasal ciliated cells (c,d) before (a,c) and after (b,d) parenteral gentamicin treatment in a Y122X homozygous CF patient. Login to comment
189 The readthrough efficiency for the Y122X mutation, a nonsense mutation mainly found among inhabitants of the Reunion Island and resulting in an ochre termination codon (UAA) [18], was at least five times higher than that for the other CFTR stop mutations tested and more generally, 10 to 40 times higher than that for other previously tested TAA-coded mutations [11]. Login to comment
191 The high readthrough levels observed for the Y122X mutation, both basal and induced, suggest that the nucleotide environment of the stop codon may overcome the strong termination efficiency directed by the UAA codon. Login to comment
193 As the readthrough levels obtained with this experimental system for a given mutation are similar to those obtained in vivo [11], these results suggested that patients with the Y122X mutation may benefit from gentamicin treatment. Login to comment
194 We therefore decided to focus the clinical study on patients homozygous for the Y122X mutation and compare them with a group of patients with the other stop mutations we tested in vitro, and a control group of patients with no stop mutations. Login to comment
197 Cell membrane staining with an antibody that recognises the C terminal region of CFTR demonstrated that gentamicin treatment of CF patients with the Y122X mutation can induce the readthrough of this stop mutation and the synthesis of a full-length CFTR protein delivered at the membrane. Login to comment
201 The absence of response to gentamicin in two of the Y122X patients enrolled may be due to inefficient uptake or distribution of gentamicin in patients' bronchial secretions, depending on individual pharmacokinetic characteristics, but also to inefficiency at any step during the complex mechanism of stop codon readthrough [23]. Login to comment
204 Conclusion Although our data concern only the Y122X genotype, a rare mutation, they can theoretically be generalised. Login to comment

PMID: 17850636 [PubMed] Girardet A et al: "Negative genetic neonatal screening for cystic fibrosis caused by compound heterozygosity for two large CFTR rearrangements."

No. Sentence Comment

35 6 k b A .G , 3 2 7 2 - 2 6 A .G , 2 7 8 9 15 G .A , 312011G.A, 71111G.T, G85E, Y122X and W846X). Login to comment

PMID: 17949287 [PubMed] Lebo RV et al: "One multiplex control for 29 cystic fibrosis mutations."

No. Sentence Comment

229 The nine normal sequences detected at other tested mutation sites (3876delA; S1255X; 2307insA; 1898ϩ5G Ǟ T; S549R; S549N; V520F; Y122X; and 394delTT) reflected the correct sequence in this mixture of nine cloned sequences. Login to comment

PMID: 19885835 [PubMed] McWilliams RR et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations and risk for pancreatic adenocarcinoma."

No. Sentence Comment

85 * Mutations recommended for screening by the American College of Medical Genetics.16 Mutations not listed but included in the 39-site assay: 3120þ1G>A, R334W, 3569delC, 1078delT, S549N, 3876delA, 1898þ5G>T, 2307insA, Y1092X, M1101K, S1255X, Y122X, A559T; in the 33-site assay: 3120þ1G>A, R334W, 3569delC, S549N, 3876delA, F508C. Login to comment

PMID: 20829696 [PubMed] Sloane PA et al: "Cystic fibrosis transmembrane conductance regulator protein repair as a therapeutic strategy in cystic fibrosis."

No. Sentence Comment

92 A trial examining systemic gentamicin in seven French individuals with Y122X CFTR, a mutation highly susceptible to readthrough, also indicated rescue of CFTR activity in the airway and sweat duct [53]. Login to comment

PMID: 21228336 [PubMed] Brown MB et al: "Low abundance of sweat duct Cl- channel CFTR in both healthy and cystic fibrosis athletes with exceptionally salty sweat during exercise."

No. Sentence Comment

114 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X. Login to comment
119 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X. Login to comment

PMID: 21257352 [PubMed] Salvatore D et al: "An overview of international literature from cystic fibrosis registries. Part 3. Disease incidence, genotype/phenotype correlation, microbiology, pregnancy, clinical complications, lung transplantation, and miscellanea."

No. Sentence Comment

1256 Finally, 4 studies evaluated the genotype-phenotype correlation for rare mutations (E60X, W486X, Y122X, 3849+10KbCNT and 2789+5 GNA) [27-30]. Login to comment

PMID: 21658634 [PubMed] Wilke M et al: "Mouse models of cystic fibrosis: phenotypic analysis and research applications."

No. Sentence Comment

67 Unfortunately, there is no Table 1 CFTR mutant mice Mouse Mutation Cftr mRNA Genetic Survival to Body wt Contact References background maturity Null mutations Cftrtm1Unc S489X Ex10 R Not detectable* C57Bl/6 <5% 10-25% reduction BH Koller/Jax Labs [113,158] Cftrtm1Cam R487X Ex10 R Not detectable 129S6/Sv/Ev <5% 20% reduction WH Colledge [159] Cftrtm1Hsc M1X Ex1 R Not detectable CD1 x 129 25% Delayed LC Tsui [160] Cftrtm3Bay Ex2 R Not detectable C57Bl/6 x 129 40% Reduced AT Beaudet [161] Cftrtm3Uth Y122X Ex4 R Not detectable C57Bl/6 25% 25-50% reduction M Capecchi/PB Davis [113,162] Hypomorphic mutations Cftrtm1Hgu ** Ex10 I 10% of wt MF1 x 129 90% No reduction J Dorin [113] Cftrtm1Bay Ex3 I <2% wt C57Bl/6 x 129 40% 70% reduction AL Beaudet [163] F508del mutations Cftrtm2Cam F508del R 30% of wt 129S6/Sv/Ev <5% 10-20% reduction WH Colledge [164] Cftrtm1Kth F508del R Low in intestine C57Bl/6 x 129 40% 10-50% reduction KR Thomas/Jax labs [165] Cftrtm1Eur F508del (H&R) Normal levels FVB/129; FVB 90% 10-20% reduction BJ Scholte [9] C57Bl/6 Other point mutations Cftrtm2Hgu G551D R 50% of wt CD1/129 65% 30-50% reduction J Dorin [11] Cftrtm3Hgu G480C (H&R) Normal levels C57Bl/6/129 Normal No reduction J Dorin [166] Cftrtm2Uth R117H R 5-20% of wt C57/Bl6 95% 10-25% reduction M Capecchi/PB Davis [113,162] Transgenes Mouse Transgene Promoter Expression Phenotype References Tg(FABPCFTR) CFTR Rat intestinal fatty acid Intestinal villus epithelia Rescue of CF intestinal pathology [167] binding protein Tg(CCSPScnn1b) Scnn1b Clara cell secretory Airway surface epithelia Na+ hyperabsorption [13] protein (CCSP) Reduced airway surface fluid volume Mucus accumulation, CF-like lung disease; 40% survival. Login to comment

PMID: 9842999 [PubMed] Cartault F et al: "Detection of more than 91% cystic fibrosis mutations in a sample of the population from Reunion Island and identification of two novel mutations (A309G, S1255L) and one novel polymorphism (L49L)"

No. Sentence Comment

15 Five have a frequency of 1% and above: AF508 (51%), Y122X (22.4%), 3120+ lG+A (7.7%), A455E (2.1%) and G551D (1.4%). Login to comment
23 The nonsense mutation Y122X has only been found on CF chromosomes of white Caucasians known as "petits blancs". Login to comment
30 Ten CFTR mutations identified in 69 CF families from Reunion Island Mutationa Exonlintron CF alleles Percentage Ama E.10 72 52 Y122X E.4 33 24 A455E E.9 3 2.2 G551D E.11 2 1.4 1717-1G-+A i.10 1 0.7 G542X E.ll 1 0.7 116ldelC E.7 1 0.7 A3G9G E.7 1 0.7 zag+ 5~-+A i.14b 1 0.7 3120tlG-A i.16 11 a Unknown mutations 12 8.7 aCystic Fibrosis Genetic Analysis Consortium: Web site: http // w.genet.sickkids.on.ca/cftr/ CFTR represents the missense mutation A309G (Fig. 1A). Login to comment

PMID: 17020473 [PubMed] Nectoux J et al: "A frequent large rearrangement in the CFTR gene in cystic fibrosis patients from Reunion Island."

No. Sentence Comment

111 The three most frequent mutations are: p.F508del (47%), p.Y122X (20%) and c.3120ϩ1G Ǟ A (8.7%). Login to comment

PMID: 22878883 [PubMed] De Boeck K et al: "Cftr biomarkers: time for promotion to surrogate endpoint?"

No. Sentence Comment

220 15d intravenous gentamycin treatment 9 CF with Y122X mutation NS 0.09 (20 to 15mV) 0.04 (‐0.8 to ‐4.6mV) 0.03 (109 to 85 mmol/L) Wilcoxon (mean before and after) (74) 4 CF with other nonsense mutation NS NS NS 5 CF without nonsense mutation NS NS NS 15d nasal aminoglycoside treatment 11 CF with nonsense mutation NS NS NS NA paired t‐test (75) 18 CF without nonsense mutation NS NS NS NA 7d intravenous gentamycin treatment 5 CF with nonsense mutation NS NS NS (/5) NS GLM for repeat measures (76) 5 CF without nonsense mutation NS NS NS (0/5) NS (#patients with ≥1 reading ≥5mV) 14d gentamycin nose drops TID 11 CF homozygous nonsense mutation 0.008 (‐48 to ‐ 34mV) 0.05 (33 to 24mV) 0.001 (0.4 to ‐5.5mV) NA t‐test/MWU p value (mean before and after) (17) 8 CF heterozygous nonsense mutation NS NS 0.04 (‐.05 to ‐4.8mV) NA 5 CF homozygous F508del NS NS NS NA 14d gentamycin nose drops TID 9 CF with nonsense mutation NS NS <0.001 (‐0.6 to ‐10mV) NA MWU (mean before and after) (77) Systemic administration of VX‐770 to CF adults and children carrying at least 1 G551D mutation is associated with large drop in sweat chloride and a moderate improvement of total chloride response measured by NPD. Login to comment
94 TABLE 3 Responsiveness of nasal potential difference (NPD) and sweat chloride concentration First author [ref.] Subject n and type Intervention Basal potential p-value D amiloride p-value D low chloride + isoproterenol p-value Sweat chloride Statistic The total chloride response (low chloride + isoproterenol) improves during treatment with ataluren t.i.d. in phase-II open label trials in children and adults with CF carrying at least one nonsense mutation S ERMET- G AUDELUS [19] 30 CF with nonsense mutation Ataluren 4, 4, 8 mg (14 d) NS NS 0.04 (-4.6 mV) ND Paired t-test (mean change) Ataluren 10, 10, 20 mg (14 d) NS NS 0.05 (-3.9 mV) ND K EREM [18] 53 CF with nonsense mutation Ataluren 4, 4, 8 mg (14 d) Ataluren 10, 10, 20 mg (14 d) NS NS NS NS 0.0001 (-7.1 mV) 0.03 (-3.7 mV) NS NS Paired t-test (mean change) Inconsistent findings whether systemic administration of aminoglycoside changes NPD or sweat chloride values in patients with CF Local administration of gentamycin nose drops improves NPD read-out in CF patients carrying at least one nonsense mutation 15 d intravenous gentamycin treatment S ERMET -G AUDELUS [46] 9 CF with Y122X mutation NS 0.09 (20 to 15 mV) 0.04 (-0.8 to -4.6 mV) 0.03 (109 to 85 mmol?L -1 ) Wilcoxon (mean before and after) 4 CF with other nonsense mutation NS NS NS 5 CF without nonsense mutation NS NS NS 15 d nasal aminoglycoside treatment C LANCY [47] 11 CF with nonsense mutation NS NS NS NA Paired t-test 18 CF without nonsense mutation NS NS NS NA 7 d intravenous gentamycin treatment C LANCY [48] 5 CF with nonsense mutation NS NS NS (4/5) NS GLM for repeat measures (number of patients with o1 reading o5 mV) 5 CF without nonsense mutation NS NS NS (0/5) NS 14 d gentamycin nose drops t.i.d. W ILSCHANSKI [17] 11 CF homozygous nonsense mutation 0.008 (-48 to -34 mV) 0.05 (33 to 24 mV) 0.001 (0.4 to -5.5 mV) NA t-test/MWU p-value (mean before and after) 8 CF heterozygous nonsense mutation NS NS 0.04 (-05 to -4.8 mV) NA 5 CF homozygous F508del NS NS NS NA 14 d gentamycin nose drops t.i.d. W ILSCHANSKI [49] 9 CF with nonsense mutation NS NS ,0.001 (-0.6 to -10 mV) NA MWU (mean before and after) Systemic administration of VX-770 to CF adults and children carrying at least one G551D mutation is associated with large drop in sweat chloride and a moderate improvement of total chloride response measured by NPD A CCURSO [20] 20 CF with G551D mutation VX-770 75 mg b.i.d. 14 d ND ND 0.003 (-4.7 mV) ,0.001 (-40 mEq?L -1 ) Paired t-test (mean change from baseline) VX-770 150 mg b.i.d. 14 d ND ND 0 .01 (-5.3 mV) ,0.001 (-42 mEq?L -1 ) VX-770 150 mg b.i.d. 28 d ND ND 0.02 (-3.5 mV) 0.008 (-60 mEq?L -1 ) VX-770 250 mg b.i.d. 28 d ND ND 0.05 (-5.5 mV) 0.02 (-38 mEq?L -1 ) First author [ref.] Subject n and type Intervention Basal potential p-value D amiloride p-value D low chloride + isoproterenol p-value Sweat chloride Statistic R AMSEY [50] 161 CF with G551D mutation 83 VX-770 150 mg b.i.d. 48 wks ND ND ND ,0.0001 (-49 mEq?L -1 ) MMRM (mean change from baseline through 24 wks) 78 placebo ND ND ND NS (-0.8 mEq?L -1 ) A HERNS [51] 52 CF (6-11 yrs) with G551D mutation 26 VX-770 150 mg b.i.d. 24 wks ND ND ND ,0.0001 (-56 mEq?L -1 ) MMRM (mean change from baseline through 24 wks) 26 placebo ND ND ND NS (-1.2 mEq?L -1 ) Systemic administration of VX-809 to CF patients homozygous for F508del is associated with a small, dose-dependent drop in sweat chloride C LANCY [21] 89 CF homozygous F508del mutation VX-809 25 mg q.d. 28 d ND ND NS NS Paired t-test (mean change from baseline); linear trend test p50.0013 VX-809 50 mg q.d. 28 d ND ND NS NS VX-809 100 mg q.d. 28 d ND ND NS ,0.05 (-6 mEq?L -1 ) VX-809 200 mg q.d. 28 d ND ND NS ,0.01 (-8 mEq?L -1 ) After treating patients homozygous for F508del with VX-809 for 14 days, the addition of ivacaftor 250 mg b.i.d. for 7 days is associated with a further small but statistically significant drop in sweat chloride B OYLE [52] 61 CF homozygous F508del mutation VX-809 200 mg q.d. 14 d ND ND ND ,0.01 (-4.2 mEq?L -1 ) # Paired t-test mean change from day 14 or baseline # +VX-770 150 mg b.i.d. 7 d ND ND ND NS (-2.2 mEq?L -1 ) +VX-770 250 mg b.i.d. 7 d ND ND ND p,0.001(-9.1 mEq?L -1 ) NPD parameters detect effect of treatment in phase-II trials of various modes of gene therapy K ONSTAN [53] 12 CF Compacted DNA nanoparticles in saline 0.8 mg, 2.67 mg or 8.0 mg, single dose No change ND 8 out of 12 subjects showed partial to complete response NA Descriptive N OONE [54] 11 CF EDMPC cholesterol complexed with CFTR cDNA 0.4375 mg, 1.3 mg or 4 mg total dose NS NS NS NA Paired t-test A LTON [55] 16 CF pCF1-CFTR cDNA complexed with 229 mg GL-67/DOPE/DMPE-PEG 5000 single dose NS NS NS NA MWU and Wilcoxon rank sum Z ABNER [56] 9 CF pCF1-CFTR plasmid 1.25 mg, single dose NS NS p,0.05 (3 mV to -3 mV) NA Not reported (mean before and after) pCF1-CFTR plasmid 1.25 mg complexed with 2 mg GL-67:DOPE, single dose NS NS p,0.05 (3 mV to 0.5 mV) NA TABLE 3 Continued First author [ref.] Subject n and type Intervention Basal potential p-value D amiloride p-value D low chloride + isoproterenol p-value Sweat chloride Statistic P ORTEOUS [57] 16 CF 400 mg pCMV-CFTR complexed with 2.4 mg DOTAP cationic liposome, single dose NS for group 2/8 treated patients demonstrated partial correction NS for group 2/8 treated patients demonstrated partial correction NS for group 2/8 treated patients demonstrated partial correction NA Not reported Z ABNER [58] 6 CF CFTR cDNA via adenovirus vector, single dose Sign rank statistic 2610 9 IU NS NS p50.04 (2 to -2 mV) (terbutaline) NA 6610 9 IU NS NS p50.03 (2 to -0.5 mV) (terbutaline) NA G ILL [59] 12 CF CFTR cDNA via DC-Chol/ DOPE NS NS NS NA Not reported C APLEN [60] 9 CF CFTR cDNA NS p,0.05 (+4 mV) NS NA Not reported H AY [61] 9 CF AdCFTR cDNA via adenovirus vector, single dose p50.01 (-53 to -35 mV) p50.02 (37 to 20 mV) p50.05 (-5 to -9 mV) NA Paired t-test M IDDLETON [29] 3 CF DC-Chol:DOPE NS NS NS NA Not reported No observed effect of single dose of CPX on either NPD or sweat chloride parameters M C C ARTY [62] 37 CF CPX, single dose NS NS NS NS ANOVA NPD total chloride response detects effect of Moli1901 (activator of alternative chloride channels) Z EITLIN [63] 4 CF Moli1901 (1, 3 and 10 mmol?L -1 ) NA NA ,0.05 for all doses NA Paired t-test versus vehicle NPD total chloride response detects effect of CFTR activation in patients homozygous for F508del mutation R UBENSTEIN [64] 10 CF homozygous F508del mutation Sodium 4-phenylbutu- rate 6, 6, 7 g (7 d) NS NS p50.0055 (5.2 to 0.6) NS Paired t-test (mean before and after) Basal NPD detects effect of aerosolised sodium channel blockers R ODGERS [65] 10 CF Amiloride nasal spray p,0.0001 (+20 mV) NA NA NA Two way ANOVA Benzamil nasal spray p,0.0001 (+21 mV) H OFMANN [66] 12 CF Aerosolised amiloride p,0.05 NA NA NA Independent t-test H OFMANN [67] 41 CF Aerosolised amiloride (10 -3 M) (n516) +35 mV NA NA NA No statistics Aerosolised benzamil (7610 -3 M) (n55) +35 mV TABLE 3 Continued First author [ref.] Subject n and type Intervention Basal potential p-value D amiloride p-value D low chloride + isoproterenol p-value Sweat chloride Statistic NPD detects effect of flavonoids on CFTR function P YLE [68] 12 non-CF Quercetin 20 mg:mL single dose NR p,0.05 (-7 mV) p,0.05 (-15 mV) NA ANOVA I LLEK [69] 25 non-CF Quercetin (n515), genistein (n53), kaempferol (n53), apigenin (n54) p,0.05 (-3 mV) ND ND ND Paired t-test NPD detects effect of hypertonic saline M IDDLETON [70] 7 non-CF 150 mM p,0.05 (6.6 mV) ND ND ND Paired t-test 250 mM p,0.05 (7.6 mV) 500 mM p,0.05 (10.0 mV) 1200 mM p,0.05 (13.1 mV) 2000 mM p,0.05 (14.8 mV) NPD detects effect of fluticasone propionate on epithelial sodium absorption G RAHAM [71] 6 non-CF Fluticasone propionate ND p50.03 (1.8 to 3.3 mV) NS NA Paired t-test NPD detects effect of milrinone on epithelial sodium absorption S MITH [72] 6 CF Milrinone (perfused during NPD) p,0.05 (52 to 57 mV) NS NS NA MWU Total chloride response increases in response to increased temperature B OYLE [73] 32 non-CF NS NS 0.01 (-4.4 mV) NA Paired t-test PD recorded at the end of Ringers (i.e. basal) and at the end of isoproteronol were more polarised when using agar catheter versus perfusion method S OLOMON [74] 26 non-CF p,0.05 (-15.9 versus -14.0 mV) NS p,0.05 (-31.2 versus -24.8 mV) NA Paired t-test Basal NPD and amiloride response detects effect of moderate exercise A LSUWAIDAN [75] 7 CF Cycle ergometer exercise at 80% HR peak p,0.05 ND ND ND Paired t-test H EBESTREIT [76] 9 CF Cycle ergometer exercise at 85% of VT p,0.01 (-34 to -7 mV) p,0.01 (+26 to +16 mV) NS ND Paired t-test CF: cystic fibrosis; NS: nonsignificant; ND: no data; NA: not applicable; GLM: generalised linear model; MWU: Mann-Whitney U-test; MMRM: mixed-effects models for repeated measurements; NR: not reported; HR peak : peak heart rate, VT: ventilatory threshold. Login to comment

PMID: 22581207 [PubMed] Krulisova V et al: "Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA."

No. Sentence Comment

81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

PMID: 21825083 [PubMed] Clancy JP et al: "Results of a phase IIa study of VX-809, an investigational CFTR corrector compound, in subjects with cystic fibrosis homozygous for the F508del-CFTR mutation."

No. Sentence Comment

124 For example, PTC124 has been shown to have detectable bioactivity by NPD over 2 weeks of treatment in patients with CF possessing premature termination codons in CFTR, while sweat chloride measurements remained unchanged.24 Improvements in lung function and cough frequency were not observed until months of treatment were completed.25 Systemic gentamicin has also been shown to suppress PTCs26 and improve NPD parameters in two pilot studies, but effects on sweat chloride were predominantly limited to a subset of patients with the Y122X mutation.27 28 Using a separate CFTR modulator strategy, Rubenstein and colleagues treated F508del-CFTR homozygous patients with CF with the F508del-CFTR modulator 4-phenyl butyrate. Login to comment

PMID: 19896304 [PubMed] Edelman A et al: "Twenty years after cystic fibrosis gene identification: Where are we and what are we up to?"

No. Sentence Comment

97 Our initial pilot study showed that systemic administration of gentamycin, an antibiotic known to suppress two PTCs found in CFTR (G542X and R553X) when expressed in HeLa cells, improves the clinical status of patients bearing the Y122X mutation. Login to comment

PMID: 18346874 [PubMed] Borthwick LA et al: "Defective formation of PKA/CnA-dependent annexin 2-S100A10/CFTR complex in DeltaF508 cystic fibrosis cells."

No. Sentence Comment

307 Interestingly, recent evidence shows firstly that annexin A1 could not be detected in mice lacking cftr (cftrtm1Unc ), secondly is down-regulated in nasal epithelial cells from CF patients bearing homozygous nonsense mutations in the CFTR gene (Y122X, 489delC) and thirdly is differentially expressed in F508del patients [58]. Login to comment
306 Interestingly, recent evidence shows firstly that annexin A1 could not be detected in mice lacking cftr (cftrtm1Unc ), secondly is down-regulated in nasal epithelial cells from CF patients bearing homozygous nonsense mutations in the CFTR gene (Y122X, 489delC) and thirdly is differentially expressed in F508del patients [58]. Login to comment

PMID: 18262467 [PubMed] Campodonico VL et al: "Airway epithelial control of Pseudomonas aeruginosa infection in cystic fibrosis."

No. Sentence Comment

228 In a study of nine French CF patients with the Y122X CFTR allele, six patients treated with parenteral gentamicin showed detectable CFTR protein and improved respiratory function and sweat chloride values [83]. Login to comment
229 In another study of 11 CF patients with stop mutations (none of whom had the Y122X allele), no effect of gentamicin on CFTR expression or nasal potential difference was achieved [84]. Login to comment

PMID: 17560176 [PubMed] Viel M et al: "ENaCbeta and gamma genes as modifier genes in cystic fibrosis."

No. Sentence Comment

72 Twenty-one were homozygous for the Phe508del mutation and 17 were compound heterozygous or homozygous for two severe mutations (R553X:1717-1GNA, Phe508del:W1282X, Phe508del:1717-1GNA, 2 Phe508del:3659delC, Phe508del:N1303K, Phe508del:W57X, Phe508del:Q1411X, G542X:1380insT, Phe508del:R553X, Table 1 Parameters for amplification of the ENaCβ and ENaCγ gene fragments (GenBank accession number NM_000336 and NM_001039, respectively) Fragment Sequence of primers Annealing temperature (°C) ENaCβ Exon 2 2F 5' gtgtcccagctgatgtgcgt 3' 55 2R 5' tgaggccagctgtgcactcc 3' Exon 3 3F 5' acagactactatggagtggg 3' 55 3R 5' aagaaacacccatcagcctc 3' Exon 4 4F 5' gtcctgctagcagctcccac 3' 59 4R 5' caaccgtaacatgccactgt 3' Exon 5 5F 5' ctgccctgcagctgatgctg 3' 55 5R 5' ccctgcaacagctgatggtc 3' Exon 6 6F gtctcctttctgcctcagga 3' 59 6R 5' tcagaccctctaggactgcc 3' Exon 7 7F 5' aggtgcagaaagggcttcct 3' 63 7R 5' catgaggcgtgcaccaccttcccac 3' Exon 8 8F 5' ctgaccatgcctgtgttctc 3' 59 8R 5' ctctatggtcagagcctctg 3' Exon 9-10 9F 5' cagaggctcagcagggaaca 3' 63 10R 5' catcttatgcccagacttgt 3' Exon 11 11F 5' gatgctgcagatggcaactt 3' 55 11R 5' gagctgtcctgtgtccaaac 3' Exon 12 12F 5' acattagtcccggcccttct 3' 55 12R 5' ggtattgggagactcctaaa 3' Exon 13 13F 5' fgaggcaagaatgtgtggcct 3' 59 13R 5' tcttggctgctcagtgagtt 3' ENaCγ Exon 2 2F 5' agcacgcccgtcctcagagt 3' 57 2R 5' ccagtgtgtcactttcggga 3' Exon 3 3F 5' tgaggctgacacgtgttgat 3' 55 3R 5' tgcccctaagcagtgaaaga 3' Exon 4 4F 5' agtagcgataggaccgatgg 3' 55 4R 5' tcagagctgccagtccttag 3' Exon 5 5F 5' cccaacttcagctaagatgc 3' 55 5R 5' agatctccttggcacaggtt 3' Exon 6 6F 5' ttggatcacagcaggttgtc 3' 55 6R 5' gatctgttctctccaagcct 3' Exon 7 7F 5' ctgtctggtgctccttgcaa 3' 55 7R 5' ccagcttagatataactttg 3' Exon 8 8F 5' tgagcaaagacatgaatggc 3' 57 8R 5' agtgcctattgccaggacta 3' Exon 9-10-11 9F 5' tccaaagctcatgctgccct 3' 57 11R 5' acagaggaacagggtagagg 3' Exon 12 12F 5' ggatgccaaggctcttgatt 3' 52 12R 5' gccaggaagatgctcacatt 3' Exon 13 13F 5' aggttcctcttgatggtgt 3' 55 13R 5' ggtcctgactagatctgtct 3' Table 2 Parameters for dHPLC conditions Fragment Temperature (°C) ENaCβ Exon 2 62.3/63.3 Exon 3 59.5/60.7 Exon 4 62.2/63.4 Exon 5 59.5/61 Exon 6 63 Exon 7 61.6/62.6/63.6 Exon 8 62.8/64.8 Exon 9-10 61.5/62.5/65 Exon 11 61/62/63.5 Exon 12 69 Exon 13 61/63.3/64.8 ENaCγ Exon 2 60.8/63.2/66 Exon 3 61/61.4 Exon 4 60.6 Exon 5 59.5/60.5 Exon 6 56.5/59/60.5 Exon 7 63/63.6 Exon 8 59.5/63 Exon 9-10-11 60.7/61.5/62.7/64.7 Exon 12 59.5/61.7 Exon 13 61/62.2 Phe508del:I507del, Phe508del:4382delA, S549R:3120+ 1GNA, Phe508del:3120+1GNA, Y122X:Y122X; Phe508del:W846X; Phe508del:E60X). Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
73 Genomic DNA Samples Used for Mutation Evaluation on the APEX Array Mutations validated with native DNA CFTRdel 2,3 (21 kb) 394delTT G85E R75X 574delA Y122X R117C R117H 621 ϩ 1GϾT 621 ϩ 3AϾG 711 ϩ 1GϾT I336K R334W R347P IVS8-5T IVS8-7T IVS8-9T A455E ⌬F508 ⌬I507 1677delTA 1717 - 1GϾA G542X G551D R553X R560T S549N 1898 ϩ 1GϾA 1898 ϩ 1GϾC 2183AAϾG 2043delG R668C 2143delT 2184delA 2184insA 2789 ϩ 5GϾA S945L 3120 ϩ 1GϾA I1005R 3272 - 26AϾG R1066C G1069R Y1092X (CϾA) 3500 - 2AϾT R1158X R1162X 3659delC S1235R 3849 ϩ 10 kb CϾT W1282X primer. Login to comment

PMID: 15698946 [PubMed] des Georges M et al: "High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France."

No. Sentence Comment

68 of chromosomes (frequency %) p.M1V 1 1 (0.23) p.M1K 1 1 (0.23) c.300delA 3 1 (0.23) p.P67L 3 1 (0.23) c.359insT 3 1 (0.23) p.G85E 3 3 (0.70) c.394delTT 3 1 (0.23) p.Q98R 4 1 (0.23) p.R117H 4 2 (0.47) p.Y122X 4 2 (0.47) p.Y161N 4 1 (0.23) c.621+1GNT intron 4 1 (0.23) c.621+2TNG intron 4 1 (0.23) p.I175V 5 2 (0.47) c.711+1GNT intron 5 5 (1.16) p.L206W 6 3 (0.70) p.Q220X 6 1 (0.23) p.L227R 6 1 (0.23) c.1078delT 7 2 (0.47) p.R334W 7 7 (1.63) p.R347P 7 2 (0.47) c.1215delG 7 1 (0.23) c.T5 intron 8 1 (0.23) p.D443Y 9 1 (0.23) p.I506T 10 1 (0.23) p.I507del 10 4 (0.93) p.F508del 10 259 (60.23) p.F508C 10 1 (0.23) c.1677delTA 10 1 (0.23) c.1717-8GNA intron 10 1 (0.23) c.1717-1GNA intron 10 6 (1.40) p.G542X 11 23 (5.35) p.S549R 11 1 (0.23) p.G551D 11 2 (0.47) p.R553X 11 1 (0.23) c1811+1.6kbANG intron 11 4 (0.93) c.1812-1GNA intron 11 1 (0.23) p.T582I 12 1 (0.23) p.E585X 12 2 (0,47) c.1898+1GNA intron 12 1 (0.23) [c.1898+5GNA ;p.E725K] intron 12 1 (0.23) c.1898+73TNG intron 12 1 (0.23) c.2183AANG 13 4 (0.93) c.2184insA 13 1 (0.23) p.K710X 13 4 (0.93) c.2423delG 13 1 (0.23) p.S776X 13 1 (0.23) c.2493ins8 13 1 (0.23) p.R792X 13 1 (0.23) p.K830X 13 1 (0.23) p.D836Y 14a 1 (0.23) p.W846X1 14a 1 (0.23) c.2711delT 14a 1 (0.23) c.2789+5GNA intron 14b 3 (0.70) p.S945L 15 3 (0.70) p.D993Y 16 1 (0.23) c.3129del4 17a 1 (0.23) c.3195del6 17a 1 (0.23) c.3272-26ANG intron 17a 1 (0.23) [c.3395insA ;pI148T] 17b/4 1 (0,23) p.Y1092X 17b 3 (0.70) Table 1 (continued) Mutation Location exon/intron No. Login to comment
131 The panel of 30 mutations (c.1717-1GNA, p.G542X, p.W1282X, p.N1303K, p.F508del, c.3849+10kbCNT, c.621+1GNT, p.R553X, p.G551D, p.R117H, p.R1162X, p.R334W, p.A455E, c.2183AANG, c.3659delC, c.1078delT, p.I507del, p.R347P, p.S1251N, p.E60X, p.Y1092X, c.394delTT, c.1811+1.6kbANG, c.3272-26ANG, c.2789+5GNA, c.3120+1GNA, c.711+ 1GNT, p.G85E, p.Y122X, p.W846X) should account for 83.32% of the CF alleles in L-R and 84.25% in the whole country. Login to comment

PMID: 15463906 [PubMed] Dugueperoux I et al: "Cystic fibrosis at the Reunion Island (France): spectrum of mutations and genotype-phenotype for the Y122X mutation."

No. Sentence Comment

5 Three CFTR mutations accounted for 75% of the detected CF alleles at the Reunion Island (DF508, Y122X, and 3120 + 1G ! Login to comment
7 The DF508/DF508, DF508/Y122X, and Y122X/Y122X genotypes accounted for 60.2% of the CF patients. Login to comment
8 Patients carrying at least one Y122X mutation were pancreatic insufficient, had high sweat chloride values and significantly lower anthropometric measures. Login to comment
12 The Y122X allele appears to be associated with a severe phenotype. Login to comment
14 Keywords: Cystic fibrosis; Y122X; Genotype-phenotype; Reunion Island; Rare mutations; 3120+1G!A 1. Login to comment
21 Because of its specificity (history and population constitution), we decided to study the spectrum of mutations identified in the island and the genotype-phenotype correlation of the most frequent mutation (Y122X) using the French Cystic Fibrosis Registry. Login to comment
32 In a second step, we extracted the available data for all 11 patients homozygous for the Y122X mutation and 17 compound heterozygotes for the Y122X and DF508 mutations, as previously described [1]. Login to comment
33 Because of the small size of the CF population, the patients followed at the Reunion Island (ten Y122X homozygotes and ten compound heterozygotes) were compared to all 20 Reunion Island patients homozygous for the DF508 mutation. Login to comment
45 Three accounted for 90.4% of the identified mutations: DF508 (53.4%), Y122X (32.2%), and 3120 + 1G ! Login to comment
49 Three genotypes accounted for 79.1% of the fully identified genotypes; they were DF508/DF508 (32.8%), DF508/Y122X (26.9%), and Y122X/Y122X (19.4%). Login to comment
50 Fifty-six patients (28 DF508/DF508, 17 Y122X/DF508, and 11 Y122X/Y122X) were included in the genotype-phenotype study (Table 2). Login to comment
53 Although the mean age at diagnosis (excluding those diagnosed prenatally or on familial history and those neonatally screened) was not statistically different between all three groups ( p = 0.90), patients homozygous for the Y122X tended to be diagnosed early, the median age for this group being much lower than for both other groups. Login to comment
58 Patients homozygous for the Y122X mutation or compound heterozygous for the Y122X and DF508 mutations had significantly lower anthropometric measures (height and weight) than those homozygous for the DF508 mutation. Login to comment
62 Aspergillus was more frequently identified in the patients carrying at least one Y122X allele, but the difference was not significant ( p = 0.08). Login to comment
63 One 17-year-old Y122X/DF508 male had a cardiopulmonary transplantation in 2000. Login to comment
66 Nasal polyposis was more frequent among CF patients carrying at least one Y122X allele compared to Table 1 Mutations and genotypes identified among CF patients born in the Reunion Island Mutations Number (%) Genotypes Number (%) DeltaF508 78 (53.42) DeltaF508/DeltaF508 22 (32.84) Y122X 47 (32.19) DeltaF508/Y122X 18 (26.87) 3120 +1G ! Login to comment
67 A 7 (4.79) Y122X/Y122X 13 (19.40) G542X 2 (1.37) 3120 + 1G ! Login to comment
77 G 1 (1.49) D993Y 1 (0.68) DeltaF508/ G551D 1 (1.49) G149R 1 (0.68) DeltaF508/1161delC 1 (1.49) G85E 1 (0.68) Y122X/3120 + 1G ! Login to comment
78 A 1 (1.49) R1162X 1 (0.68) Y122X/1717-1G ! Login to comment
83 The spectrum of CFTR mutations in natives of the Reunion Island is dominated by three mutations: DF508 present on 44.3%, Y122X on 26.7% and 3120 + 1G ! Login to comment
85 The Cystic Fibrosis database maintained at the Sickkids Hospital in Toronto (Canada) reports that the world-wide frequency of the DF508 mutation is close to 66% and that the Y122X and 3120 + 1G ! Login to comment
86 A alleles are Table 2 Characteristics of patients homozygous for the Y122X mutation, compound heterozygous for the Y122X and DF508 mutations compared to homozygous for the DF508 mutation (*no significant difference at p = 0.05) DeltaF508/DeltaF508 Y122X/DeltaF508 Y122X/Y122X p values Sex (males/females) 20/8 = 28 8/9 = 17 7/4 = 11 Age at 01/01/2001 (years) Mean age F SD 12.4 F 5.7 12.4 F 6.1 12.4 F 3.8 * Median age 11.5 13.0 12.0 Range 3-24 1-23 7-19 Age at diagnosis (months)a Mean age 31.36 F 44.53 32.50 F 51.2 24.67 F 56.02 * Median age 7.0 8.0 2.0 Range 0-160 1-159 0-139 Sweat chloride concentration (mEq/l) Mean value F SD 106.8 F 33.7 119.9 F 26.7 107.9 F 36.7 * Median value F SD 119.0 114.0 99.5 Range 25-179 110-166 68-175 Status at diagnosis Family history 3 1 1 * Prenatal diagnosis 0 0 2 0.022 Neonatal screening 3 4 3 * Meconium ileus 6 (21.4%) 4 (23.5%) 3 (27.3%) * Dehydration 0 1 0 * Gastrointestinal symptoms 19 (73.1%) 8 (53.3%) 5 (45.4%) * Respiratory symptoms 11 (39.2%) 9 (52.9%) 3 (27.3%) * Nasal polyposis 1 0 0 * Physical status Height (Z score F SD) À 0.572 F 1.095 À 1.007 F 1.025 À 2.164 F 1.474 0.002 Weight (Z score F SD) À 1.180 F 1.092 À 1.621 F1.207 À 2.291 F1.451 0.047 BMI F SD (kg/m2) 16.80 F 2.45 16.11 F1.93 16.23 F 2.79 * Pulmonary status (% of predicted value) FEV1 F SD 73.25 F 25.47 62.74 F 22.74 80.71 F 27.06 * FVC F SD 80.21 F 21.87 66.47 F 16.46 80.21 F19.37 * Throat cultures (nr of patients) Haemophilus influenzae 14 (50.0%) 3 (17.6%) 2 (18.1%) 0.042 Staphylococcus aureus 19 (67.9%) 9 (52.9%) 10 (90.9%) * Pseudomonas aeruginosa 14 (50.0%) 8 (47.0%) 7 (63.6%) * Stenotrophomonas maltophilia 2 0 0 * Burkholderia cepacia 4 1 1 * Aspergillus 6 (21.4%) 8 (47.1%) 6 (54.5%) 0.080 Candida 2 2 1 * Clinical events (number of patients) Cirrhosis 3 (10.7%) 3 (17.6%) 1 (9.1%) * Mellitus diabetes 3 (10.7%) 1 (5.9%) 1 (9.1%) * Gallstones 1 0 1 * Nasal polyposis 4 (14.2%) 6 (36.3%) 4 (36.4%) * a Excluding patients diagnosed prenatally or on familial history and those neonatally screened. Login to comment
89 The Y122X mutation was first described by Chevalier-Porst et al. [2] in 1992 in a white native patient of the Reunion Island. Login to comment
91 The Cystic Fibrosis Genetic Analysis Consortium counted 14 CF chromosomes carrying the Y122X allele, all coming from France, without specification [3]. Login to comment
103 It is presumed that the Y122X mutation was present among the first French settlers, its high frequency being probably the result of a founder effect and isolation from the mainland, followed by genetic drift. Login to comment
106 This is the first genotype-phenotype correlation study on the Y122X mutation using a cohort approach. Login to comment
107 Our results showed that patients carrying the Y122X allele, either in an homozygous or compound heterozygous status, have a severe CF phenotype. Login to comment
90 The Y122X mutation was first described by Chevalier-Porst et al. [2] in 1992 in a white native patient of the Reunion Island. Login to comment
92 The Cystic Fibrosis Genetic Analysis Consortium counted 14 CF chromosomes carrying the Y122X allele, all coming from France, without specification [3]. Login to comment
104 It is presumed that the Y122X mutation was present among the first French settlers, its high frequency being probably the result of a founder effect and isolation from the mainland, followed by genetic drift. Login to comment
108 Our results showed that patients carrying the Y122X allele, either in an homozygous or compound heterozygous status, have a severe CF phenotype. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

103 b 3905insT, 1811+1.6kbA>G, S945L, S1251N, Y122X, 2711delT, R117H, E60X, 2184insA, E585X, L558S, S1235R, D1152H, K710X, Q493X, A455E, G178R, I148T, 574delA. Login to comment

PMID: 9222762 [PubMed] Jordanova A et al: "SSCP analysis: a blind sensitivity trial."

No. Sentence Comment

22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
54 These included G551D(G→A) inexon11 (see Fig. 2);S945L(C→T) in exon 15; 1215delG in exon 7; Y122X (T→A), 621 + 1 (G→T), and 621 + 2 (T→G) in exon 4. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment
89 Mutations detected by the referring laboratories using SSCP analysis. This group included mutations 621+1(G→T), 621+2(T→G), Y122X, G551D, and S945L. Login to comment
90 They had been detected after preliminary restriction digestion (mutations G551D and S945L) or under two different SSCP conditions (mutations 621+1(G→T), 621+2(T→G) and Y122X) (see Table 1). Login to comment

PMID: 8617131 [PubMed] McGill JM et al: "Survey of cystic fibrosis transmembrane conductance regulator genotypes in primary sclerosing cholangitis."

No. Sentence Comment

33 In total, 32 mutations were evaluated, which represent 90% of the most common mutations (t4): AF508 G542X G551D W1282X 3905insT NI303K 3849+ 10kbC--~T R553X 621+ IG--*T 1717- IG--,A lt)78delT 2789+5G---~A 3849+4A--~G 711+ IG---oT R1162X 1898+IG----~A R117H 3659delC G85E 2184delA A1507 R347P Y1092X R560T A455E R334W Y122X S549R(T---~G) Q493X V520F $549N R347H Patient Selection. Login to comment

PMID: 7525963 [PubMed] Chevalier-Porst F et al: "Mutation analysis in 600 French cystic fibrosis patients."

No. Sentence Comment

41 We also identified four other mutations which have already been reported, a nonsense mutation in exon 4 (Y122X)22 and three frameshift mutations in exon 13, 1918delGC, 2118del4, and 2372del8.2' This study underlines some other factors. Login to comment

PMID: 7513293 [PubMed] Chillon M et al: "Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes."

No. Sentence Comment

31 At present, we have not detected any Spanish CF chromosomes bearing any of the following mutations: 394delTA, Y122X, 556delA, 852de122, R347P, $492F, 1677delTA, V520F, Q552X, R553X, L559S, R560K, R560T, Y563N, P564H, 2043delG, 3320ins5, R1066H, A1067T, H1085R, 3732delA, 3737delA, I1234V, S1255P, 3898insC, Q1291H or 4005+ 1G---~A. Login to comment

PMID: 7509564 [PubMed] Grebe TA et al: "Genetic analysis of Hispanic individuals with cystic fibrosis."

No. Sentence Comment

45 The following CFTR gene mutations were identified by published methods: AF508 (Rommens et al. 1990); G542X (Kerem et al. 1990); GS51D and R553X (Cutting et al. 1990); R1162X (Gasparini et al. 1991); W1282X (Vidaud et al. 1990); N1303K (Osborne et al. 1991); 3849 +lOkbC- T (Highsmith et al., submitted); and R117H, Y122X, 1148T, 621+1G-*oT, 711+1G- T, G314E, 1078AT, R334W, R347P, Q493X, A1507, V520F, 1717 -1G-oA, R560T, and 3569AC (J. DeMarchi et al., submitted). Login to comment
54 COther = A1507, 621+1G- T, R117H, N1303K, 711+1G-*.T, 1717-1G-.A, R560T, Y122X, 1148T, G314E, 1078AT, R347P, Q493X, V520F, and 3659AC. Login to comment
56 The G542X mutation was found in 5.4% of Hispanic CF chromosomes, similar to the 3% frequency in the general population. Login to comment
47 The following CFTR gene mutations were identified by published methods: AF508 (Rommens et al. 1990); G542X (Kerem et al. 1990); GS51D and R553X (Cutting et al. 1990); R1162X (Gasparini et al. 1991); W1282X (Vidaud et al. 1990); N1303K (Osborne et al. 1991); 3849 +lOkbC-T (Highsmith et al., submitted); and R117H, Y122X, 1148T, 621+1G-*oT, 711+1G-T, G314E, 1078AT, R334W, R347P, Q493X, A1507, V520F, 1717 -1G-oA, R560T, and 3569AC (J. DeMarchi et al., submitted). Login to comment

PMID: 7691344 [PubMed] Claustres M et al: "Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France."

No. Sentence Comment

26 Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation? Login to comment

PMID: 1284471 [PubMed] Chevalier-Porst F et al: "A nonsense mutation in exon 4 of the cystic fibrosis gene frequent among the population of the Reunion Island."

No. Sentence Comment

6 This mutation creates a stop codon (TAA) at amino acid position 122 of CFTR instead of a tyrosine (TAT) and thus was named Y122X. Login to comment
7 Y122X is located in the first transmembrane spanning region and is predicted to create a truncated, non functional, polypeptide. Login to comment
10 The maternal CF chromosome bearing Y122X carries the C haplotype defined by the extragenic DNA markers XV2C and KM19 (7). Login to comment
12 The screening for Y122X in this particular population by Msel digestion showed that 19 CF chromosomes out 66 are positive, 4 patients being homozygous. Login to comment
13 In this population delta F508 represents 39% of the CF alleles and Y122X 29%. Login to comment
14 In our sample of 1000 CF chromosomes from mainland France, delta F508 accounts for 68 % of the CF alleles and none of them tested by Msel digestion carry Y122X. Login to comment
18 Identification of Y122X on a 10% acrylamide gel electrophoresis after Msel digestion of exon 4 amplified product showing the segregation in a CF family: the affected child is homozygous for this mutation. Login to comment
19 F508 + Y122X) account for 68% of the CF chromosomes is probably due to the settlement of the population in this island. Login to comment
20 Y122X has been found only on CF chromosomes of white Caucasians known as 'petits blancs' who are the descendants of * To whom correspondence should be addressed atUniversityofNorthCarolinaatChapelHillonOctober25,2012http://hmg.oxfordjournals.org/Downloadedfrom 648 Human Molecular Genetics, Vol. 1, No. 8 the first French Settlers (46 men and 37 women) in the XVIIth century (8). Login to comment
24 The real origin of Y122X is unknown but the fact that all the Y122X chromosomes are of the same haplotype group (C) suggests a common origin for these chromosomes. Login to comment
25 In the remaining non delta F508, non Y122X CF chromosomes, the distribution of haplotypes does not differ significantly from the one observed in mainland France, suggesting that several rare mutations must account for these alleles. Login to comment

PMID: 1279852 [PubMed] Tsui LC et al: "The spectrum of cystic fibrosis mutations."

No. Sentence Comment

64 Frequent cystic fibrosis mutations Name Relative freqeenc~ Mutation Con~,~'~luence Ref. Z~508 67.2 G542X 3.4 G551D 2.4 W1282X 2.1 3905insT 2.1 N1303K 1.8 3849+10kbC-+T 1.4 1717-1G-+A 1078delT 2789+5G--+A Deletion of 3 bp between nt 1652 and t655 in exon 10 G-+T at nt 1756 in exon 11 G-+A at nt 1784 in exon 1I G-+A at nt 3978 in exon 20 Insertion of T after nt 3905 in exon 20 C-+G at nt 4041 in exon 21 C-->T in a 6.2 kb EcoRI fragment 10 kb from 5' junction of intron 19 3849+4A-+G 1.0 7tt÷IG--+T 0.9 Rl162X 0.9 1898+lG-+A 0.9 Rll7H 0.8 3659delc 0.8 G85E 0.7 2184delA 0.7 AI5W 0.5 R347P 0.5 R~ 0.4 1,3 C-+T at nt 1"789in exon 11 1.3 G-+T at nt 1 from 5' junction of intron 4 1.1 G--+A at nt 1 from 3' junction of intron 10 1.1 Deletion of T at nt 1078 in exon 7 1.1 G-cA at 5 nt from 5' end of intron 14b A-->G at 4 nt from 5' end of intron 19 G-+T at nt 1 from 5' junction of intron 5 C-+T at nt 3616 in exon 19 G-+A at nt 1 from 5' junction of intron 12 G--)A at nt 482 in exon Deletion of C at nt 3659 in exon 19 G-+A at nt 386 in exon 3 A-->G at nt 2183 and deletion of A at nt 2184 in exon 13 Deletion of 3 bp between nt 1648 and 1653 in exon 10 G-+C at nt 1172 in exon 7 G-~C at nt 1811 in exon 11 A455E 0.4 R334W 0.4 Y122X 0.3 S549R(T-+G) 0.3 Q493X 0.3 V520F 0.2 S549N 0.2 C-+A at nt 1496 in exon 9 C-+T at nt 1132 in exon 7 T-cA at nt ~i98 in exon 4 T--+G at nt 1779 in exon 11 C-+T at nt 1609 in exon 10 G-+T at nt 1690 in exon 10 G-->A at nt I778 in exon !1 Deletion of Phe at codon 508 Gly-+Stop at codon 542 12 Gly-~Asp at codon 551 10 l"rp-->Stop at codon t282 35 Frameshift -~ Asn-+Lys at codon 1303 36 Aberrant splicing -~ Arg~Stop ~ codon 553 Splice mutation 10 37 Splice mutation 12 Frameshift 38 Splice mutation _c Splice mutation? Login to comment

PMID: 11232455 [PubMed] Federici S et al: "[CFTR gene analyis in 207 patients with cystic fibrosis in southwest France: high frequency of N1303K and 1811+1.6bA>G mutations]."

No. Sentence Comment

36 Dans certaines populations constitu&#e9;es plus r&#e9;cemment, l`importance d`un effet fondateur appara&#ee;t encore plus significativement, c`est le cas, par exemple, de la population de l`&#ee;le de la R&#e9;union dans laquelle la mutation Y122X repr&#e9;sente presque la moiti&#e9; des all&#e8;les CF [5]. Login to comment

PMID: 11755047 [PubMed] Gomez-Llorente MA et al: "Analysis of 31 CFTR mutations in 55 families from the South of Spain."

No. Sentence Comment

29 A I.10 R117H E.4 G542X E.11 Y122X E.4 G551D E.11 711 + 1G ! Login to comment

PMID: 14613688 [PubMed] Flodrops H et al: "[Clinical aspects and genetic specificities of cystic fibrosis in Reunion Island]."

No. Sentence Comment

12 Un g&#e8;ne proche du g&#e8;ne CFTR (Cystic Fibrosis Transmenbrane conductance Regulator) a pu subir la m&#ea;me s&#e9;gr&#e9;gation que la mutation Y122X, ou la population &#ab; des petits blancs &#bb; habitant les hauts plateaux de la R&#e9;union est significativement plus petite pour des raisons ethniques. Login to comment
15 - Evaluation of the phenotype-genotype correlation of a specific mucoviscidosis mutation, "Y122X", in Reunion Island. Login to comment
24 - In our population, we identified 10 mutations, of which three of them represented more than 80% of the cases: D F508 (51.8%), Y122X (24.4%) and 3120 + 1G ࢐ A (4.8%). Login to comment
25 The authors report clinical significant differences in children with the homozygote mutation Y122X as compared with children presenting the D F508 CF-mutation: failure to thrive affecting mainly the height with, paradoxically, a relatively normal weight development, and a better pulmonary function. Login to comment
38 Cette mixit&#e9; et une certaine consanguinit&#e9; dans les cirques (Mafate, Cilaos, Sa- lazie) et les hauts de l`&#ee;le longtemps renferm&#e9;s sur eux-m&#ea;mes, expliquent en partie pourquoi la mutation Y122X pr&#e9;domine dans le sud de l`&#ee;le, car ce n`est que depuis 1960 que Cilaos poss&#e8;de une route fiable. Login to comment
41 L`absence d`&#e9;tude &#e9;pid&#e9;miologique depuis 1989 et les progr&#e8;s consid&#e9;rables effectu&#e9;s en biologie mol&#e9;culaire ces dix derni&#e8;res ann&#e9;es nous ont conduits &#e0; refaire le point sur la mucoviscidose &#e0; l`&#ee;le de la R&#e9;union et &#e0; tenter de pr&#e9;ciser la corr&#e9;lation ph&#e9;notype-g&#e9;notype d`une mutation, &#e0; notre connaissance typiquement r&#e9;unionnaise, la mutation Y122X, ainsi que sa fr&#e9;quence [4,5]. Login to comment
72 La mutation Y122X &#e0; l`&#e9;tat homozygote &#e9;tait retrouv&#e9;e chez 14,3 % des patients et chez 23,8 % &#e0; l`&#e9;tat h&#e9;t&#e9;rozygote composite, soit 38 % des patients. Login to comment
74 La comparaison des g&#e9;notypes entre la R&#e9;union et la m&#e9;tropole a mis en &#e9;vidence deux diff&#e9;rences significatives : ߦ la premi&#e8;re concernait les homozygotes pour la mutation DF508 qui sont retrouv&#e9;s avec une fr&#e9;quence moindre &#e0; la R&#e9;union qu`en m&#e9;tropole (34,4 contre 49,6 %), (p < 0,01) ; ߦ la deuxi&#e8;me concernait les patients porteurs de deux mutations autres que DF508, en particulier les mutations Y122X et 3120+1G࢐A qui sont relev&#e9;es avec une fr&#e9;- quence plus &#e9;lev&#e9;e &#e0; la R&#e9;union qu`en m&#e9;tropole, (20,3 vs 4,6 %) (p < 0,0001). Login to comment
76 Tableau 1 R&#e9;sultats des dosages du chlore sudoral G&#e9;notypes Chlore sudoral en meq/litre* Nombre d`enfants Moyenne &#c9;cart-type Extr&#ea;mes DF508/DF508 29 103,5 34 80-179 DF508/Y122X 14 125,4 36 85-218 Y122X/Y122X 12 115 32 85-160 * Meq/litre : milli&#e9;quivalent de chlore par litre de sueur. Login to comment
77 Tableau 2 R&#e9;partition g&#e9;ographique des g&#e9;notypes &#e0; la R&#e9;union G&#e9;notypes Nord % Sud % Total % DF508/DF508 18 21,4 11 13,1 29 34,5 DF508/Y122X 6 7,1 8 9,5 14 16,6 DF508/A455E 2 2,4 1 1,2 3 3,6 DF508/3120+1G࢐A 2 2,4 - - 2 2,4 D F508/G551D - - 1 1,2 1 1,2 DF508/2789+5G࢐A 1 1,2 - - 1 1,2 D F508/1161 del C - - 1 1,2 1 1,2 D F508/1078 del T - - 1 1,2 1 1,2 D F508/ ??? Login to comment
78 6 7,1 - - 6 7,1 Y122X/Y122X 4 4,8 8 9,5 12 14,3 Y122X/3120+1G࢐A 2 2,4 - - 2 2,4 3120+1G࢐A/3120+1G࢐A 1 1,2 1 1,2 2 2,4 1717-1G࢐A/Y122X 1 1,2 - - 1 1,2 G452X / ??? Login to comment
82 = mutation non identifi&#e9;e. Tableau 3 Distribution des mutations &#e0; la R&#e9;union Mutation Nombre de chromosomes Total % Total cumul&#e9; nord (1) sud (2) D F508 53 34 87 51,8 87 Y122X 17 24 41 24,4 128 3120+1G࢐A 6 2 8 4,8 136 A455E 2 1 3 1,8 139 G551D - 1 1 0,6 140 2789+5G࢐A 1 - 1 0,6 141 1161 del C - 1 1 0,6 142 1078 del T - 1 1 0,6 143 1717-1G࢐A 1 - 1 0,6 144 G542X - 1 1 0,6 145 ??? Login to comment
86 La mutation Y122X para&#ee;t &#ea;tre une particularit&#e9; de la population r&#e9;unionnaise Le s&#e9;quen&#e7;age direct du produit de la PCR (polymerase chain reaction) de l`exon 4 a montr&#e9; une substitution du nucl&#e9;otide T par A en position 498 de la s&#e9;quence d`ADNc. Login to comment
88 Elle a &#e9;t&#e9; responsable de la formation d`un polypeptide tronqu&#e9;, non fonctionnel [12], ce qui a permis de la situer parmi les anomalies de codage du g&#e8;ne de classe I. La mutation Y122X, fr&#e9;quente &#e0; la R&#e9;union (24,4 % des cas), n`a &#e9;t&#e9; retrouv&#e9;e qu`exceptionnellement en m&#e9;tropole (0,15 % des cas). Login to comment
91 Il existait une diff&#e9;rence hautement significative de la distribution de la mutation Y122X entre R&#e9;union et m&#e9;tropole (p < 0,00001). Login to comment
94 La v&#e9;ritable origine de cette mutation restait inconnue, mais le fait que tous les chromosomes &#ab; Y122X &#bb; portaient le m&#ea;me haplotype &#ab; C &#bb; sugg&#e9;rait un lien de communaut&#e9; et un probable effet fondateur [4]. Login to comment
98 L`analyse des effectifs cumul&#e9;s sur les cinq ans &#e9;tudi&#e9;s a permis de mettre en &#e9;vidence les diff&#e9;rences significatives suivantes (Tableau 4) : ߦ concernant la taille (exprim&#e9;e en DS) : les homozygotes Y122X pr&#e9;sentaient un retard statural plus important que les homozygotes DF508, -1,6 DS vs -0,6DS (p < 0,001), que les h&#e9;t&#e9;rozygotes composites DF508/Y122X, -1,6 DS vs -0,2 DS (p < 0,000005), et que l`ensemble des patients, -1,6DS vs -0,6DS (p < 0,0002) ; ߦ concernant le poids (en % du poids id&#e9;al pour la taille) : les homozygotesY122X avaient un meilleur &#e9;tat nutritionnel que les homozygotes DF508, 97,3 vs 92,6 % (p < 0,02), que les h&#e9;t&#e9;rozygotes composites DF508/ Y122X, 97,3 vs 92 % (p < 0,01) et que l`ensemble des patients , 97,3 vs 93,4 % (p < 0,05) ; ߦ concernant le poids (exprim&#e9; en DS) : les homozygotes Y122X avaient un retard pond&#e9;ral plus marqu&#e9; que les homozygotes DF508, -1,3 DS vs -1 DS (p < 0,05), que les h&#e9;t&#e9;rozygotes composites DF508/Y122X, -1,3 DS vs -0,8 DS (p < 0,01) et que l`ensemble des patients, -1,3 DS vs -1DS (p < 0,05) ; ߦ concernant la fonction pulmonaire, les homozygotes Y122X avaient une moindre alt&#e9;ration de leur VEMS que les homozygotes DF508, et que l`ensemble des patients. Login to comment
99 Les homozygotes Y122X avaient une moindre alt&#e9;ration de leur CVF que les homozygotes DF508, 88 vs 68 % (p < 0,00002), et que les h&#e9;t&#e9;rozygotes composites DF508/Y122X, 88 vs 76 % (p < 0,02) et par rapport &#e0; l`ensemble des patients, 88 vs 72 % (p < 0,00005). Login to comment
104 Les r&#e9;sultats pr&#e9;liminaires de notre &#e9;tude sugg&#e8;rent que les homozygotes Y122X ont un retard statural plus marqu&#e9;, un meilleur &#e9;tat nutritionnel et une moindre alt&#e9;ration de leur fonction pulmonaire ; &#e0; l`inverse les homozygotes DF508 pr&#e9;sentent une alt&#e9;ration de leur fonction pulmonaire plus prononc&#e9;e. Login to comment
105 Le meilleur &#e9;tat nutritionnel des homozygotes Y122X montre que le retard statural de ces derniers n`est pas &#e0; mettre en rapport avec une insuffisance pancr&#e9;atique ou une malnu- Tableau 4 Comparaison de l`expression ph&#e9;notypique entre les trois principaux g&#e9;notypes. Login to comment
106 Donn&#e9;es cumul&#e9;es de 1994 &#e0; 1998 &#e0; la R&#e9;union DF508/DF508 DF508/Y122X Y122X/Y122X Total Tous Patients Sex-Ratio 5 0,7 2,3 1,7 A c6; ge Moyen 9,4 8,9 8,7 10,1 Taille (DS) -0,6 -0,2 -1,6 -0,6 &#c9;cart-Type 0,36 0,33 0,31 0,35 Poids (DS) -1 -0,8 -1,3 -1 &#c9;cart-Type 0,4 0,375 0,30 0,4 Poids id&#e9;al (%) 92,6 91,9 97,3 93,4 &#c9;cart-Type 3,8 3,4 3,7 3,75 IMC 15,6 14,9 15,8 15,4 VEMS (%) 65,4 74,8 85,4 70 CVF (%) 68,1 76,1 87,9 71,9 Effectifs cumul&#e9;s 96 47 49 281 trition associ&#e9;e. Login to comment
108 Une des hypoth&#e8;ses &#e9;voqu&#e9;es est qu`un g&#e8;ne proche de celui de la mucoviscidose pourrait &#ea;tre en rapport avec la croissance et que s`il existe, il subirait la m&#ea;me s&#e9;gr&#e9;gation que la mutation Y122X. Login to comment
112 Dans notre &#e9;tude, l`esp&#e9;rance de vie des homozygotes Y122X n`a pu &#ea;tre compar&#e9;e &#e0; celle des patients ayant d`autres g&#e9;notypes, faute de recul suffisant. Login to comment
113 Toutefois, compte tenu du fait que les homozygotes Y122X, malgr&#e9; leur &#ab; petite taille &#bb;, pr&#e9;sentent une moindre alt&#e9;ration de leur fonction pulmonaire et un meilleur &#e9;tat nutritionnel, une diminution de leur esp&#e9;rance de vie semble peu probable. Login to comment
115 Conclusion Notre &#e9;tude a permis de r&#e9;actualiser le g&#e9;notype CFTR en confirmant la pr&#e9;sence d`une mutation particuli&#e8;re, la mutation Y122X, &#e0; un taux important de 25 % sur l`&#ee;le de la R&#e9;union. Login to comment
118 L`hypoth&#e8;se que nous faisons est que le facteur &#ab; petite taille &#bb; est un marqueur de la population des porteurs de la mutation Y122X. Login to comment

PMID: 15463882 [PubMed] Hubert D et al: "Diagnosis of cystic fibrosis in adults with diffuse bronchiectasis."

No. Sentence Comment

47 We used an oligonucleotide ligation assay using a commercially available kit (Cystic Fibrosis Assay, Applied Biosystems, Foster City, CA, USA) to seek 31 mutations in the CFTR gene (F508del, I507del, Q943X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA) which allowed to detect 82% of the CF alleles in France. Login to comment
129 * 31 mutations: F508del, I507del, Q493X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q ** 4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA. that the laboratory criteria for the diagnosis of CF should be expanded to include identification of CFTR mutations and abnormal bioelectrical properties of the nasal epithelium, in addition to the sweat test w7x. Login to comment

PMID: 16635477 [PubMed] Lucarelli M et al: "A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene."

No. Sentence Comment

26 None of these subjects showed any clinical manifestations of CF, nor were any positive for CFTR mutations when analyzed by means of the PCR/OLA/SCS method (Celera Diagnostics) [21], which searches for the most common worldwide 31 CFTR mutations (G85E, R117H, Y122X, 621+1G->T, 711+1G->T, 1078delT, R347P, R347H, R334W, A455E, DF508, DI507, Q493X, V520F, 1717-1G->A, G542X, G551D, R553X, R560T, S549R(T->G), S549N, 1898+1G->A, 2183AA->G, 2789+5G->A, R1162X, 3659delC, 3849+10kbC->T, 3849+4A->G, W1282X, 3905insT, N1303K), including the 12 most common in Italy [1,22]. Login to comment

PMID: 16963320 [PubMed] Perez MM et al: "CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent."

No. Sentence Comment

78 At least another 38 mutations have been searched for, but none of them were found in the CF patients from Latin America: p.E60X, p.Y122X, p.G178R, p.G330X, p.R347H, p.R352Q, p.S364P, p.A455E, p.Q493X, p.V520F, p.C524X, p.R560T, p.Y563D, p.P574H, p.K710X, p.Q890X, p. R1158X, p.S1196X, p.S1255X, p.D1270N, p.W1310X, p. W1316X, c.405+1G-A, c.444delA, c.556delA, c.574delA, c.1677delTA, c.2043delG, c.2307insA, c.2909delT, c.3120G-A, c.3358delAC, c.3662delA, c.3750delAG, c.3791delC, c.3821delT, c.3849+4A-G, c.3905insT. Login to comment

PMID: 18822253 [PubMed] Munck A et al: "[The French nationwide cystic fibrosis newborn screening program: strategy and results]."

No. Sentence Comment

50 L`organigramme du DNN (fig. 1) pr&#e9;voit une valeur seuil de TIR &#e0; J3 d&#e9;termin&#e9;e sur les donn&#e9;es des r&#e9;gions fran&#e7;aises ayant d&#e9;but&#e9; ce d&#e9;pistage il y a plus de 10 ans afin de s&#e9;lec- Mutations recherch&#e9;es par le Kit Elucigen dans le cadre du d&#e9;pistage n&#e9;onatal de la mucoviscidose (Kit CF30) : F508del ; I 507del ; 1078delT, 1717-1 G>A ; 2183AA>G ; 3659delC ; 3849+10kbC>T ; 621+1G>T ; A455E ; E60X ; G542X ; G551D ; N1303K ; R1162X ; R117H ; R334W ; R347P ; R553X ; S1251N ;W1282X ; 1811+1.6kbA>G ; 2789+5G>A ; 3120+1G>A ; 3272-26A>G ; 394delT ; 711+1G>T ; G85E ; Y1092X ; Y122X ;W846X. Login to comment

PMID: 19627168 [PubMed] Rowe SM et al: "Pharmaceuticals targeting nonsense mutations in genetic diseases: progress in development."

No. Sentence Comment

559 Sermet-Gaudelus et al.,[52] recently reported correction of CFTR-dependent Cl-conductance, as measured by NPD, following 15 days of systemic treatment with gentamicin in six of nine CF patients with the Y122X mutation (eight of nine were homozygous). Login to comment
561 Notably, the sweat Cl-concentration improved from a mean of 109 mEq at baseline to 85mEq in CF patients with the Y122X mutation, following treatment with gentamicin (see further discussion of related studies below). Login to comment
571 A rank order of Y122X, W1282X, G542X, and R1162X was seen among the most frequent stop mutations after gentamicin treatment, with relative suppression varying by as much as 7.2-fold, post-therapy. Login to comment

PMID: 22043142 [PubMed] Lilley M et al: "Newborn screening for cystic fibrosis in Alberta: Two years of experience."

No. Sentence Comment

46 These include the following mutations: delF508, I507del, G542X, G85E, R117H, 621+1G࢐T, 711+1G࢐T, G551D, R334W, R347P, A455E, 1717-1G࢐A, R560T, R553X, N1303K, 1898+1G࢐A, 2184delA, 2789+5G࢐A, 3120+1G࢐A, R1162X, 3659delC, 3849+10kbC࢐T, W1282X, 1078delT, 394delTT, Y122X, R347H, V520F, A559T, S549N, S549R, 1898+5G࢐T, 2183AA࢐G, 2307insA, Y1092X, M1101K, S1255X, 3876delA and 3905insT. Login to comment
84 TAbLe 1 Mutation frequency Mutation name Number of times detected (247 total mutations) Frequency, % expected, % (reference) delF508* 156 63.2 68.6 (1) R117H* 36 14.6 0.7 (1) G551D* 11 4.5 2.1 (1) 3849+10kbC࢐T* 6 2.4 0.7 (1) M1101K 5 2.0 Undetermined (1) G542X* 4 1.6 2.4 (1) 1717-1G࢐A* 4 1.6 0.7 (1) 621+1G࢐T* 3 1.2 0.9 (1) 3120+1G࢐A* 3 1.2 1.5 (1) G85E* 2 0.8 0.3 (1) A455E* 2 0.8 0.2 (1) R553X* 2 0.8 0.9 (1) 2789+5G࢐A* 2 0.8 0.3 (1) ƊI507* 1 0.4 0.3 (1) 711+1G࢐T* 1 0.4 0.1 (1) R334W* 1 0.4 0.2 (1) N1303K* 1 0.4 1.3 (1) 1898+1G࢐A* 1 0.4 Undetermined (1) 2184delA* 1 0.4 0.1 (1) 394delTT 1 0.4 Undetermined (1) R347H 1 0.4 0.2 (4) V520F 1 0.4 0.2 (4) S549N 1 0.4 0.1 (1) 2307insA 1 0.4 0.2 (1) R347P* 0 0 0.2 (1) R560T* 0 0 0.2 (1) R1162X* 0 0 0.2 (1) 3659delC* 0 0 0.2 (1) W1282X* 0 0 1.4 (1) 1078delT 0 0 0.03 (2) Y122X 0 0 Undetermined (3) A559T 0 0 0.2 (1) S549R 0 0 Undetermined (1) 1898+5G࢐T 0 0 Undetermined (1) 2183AA࢐G 0 0 0.1 (1) Y1092X 0 0 Undetermined (1) S1255X 0 0 0.2 (1) 3876delA 0 0 Undetermined (4) 3905insT 0 0 0.12 (1) *American College of Medical Genetics-recommended mutations TAbLe 2 Positive cystic fibrosis newborn screen summary Screen result Unaffected Affected Further follow-up required Lost to follow-up Total Probable screen 0 23 0 0 23 Inconclusive screen One mutation 179 8 2 2 191 Markedly elevated IRT 2 0 0 0 2 R117H/F508del 0 0 5 0 5 Total 181 31 7 2 221 Data presented as n. IRT Immunoreactive trypsinogen TAbLe 3 F508del/R117H cases ID number Mutation status Sweat test result(s), &#b5;mol/L Other clinical information 24827 F508del/R117H 28 None 23726 F508del/R117H 36/insufficient/20 Fecal elastase normal 22578 F508del/R117H 10 None 24500 F508del/R117H 34/insufficient None 18527 F508del/R117H 29 None 23317 F508del/R117H+5T 47/62 Affected sibling 5T 5 thymine There were 23 newborns with probable screens. Login to comment

PMID: 23199563 [PubMed] Leonard A et al: "[Mucoviscidosis: CFTR mutation-specific therapy: a ray of sunshine in a cloudy sky]."

No. Sentence Comment

128 Une seconde e &#b4;tude mettait en e &#b4;vidence, sous gentamicine, une ame &#b4;lioration significative de la STC et une re &#b4;duction moyenne du taux de chlorure dans la sueur de 24 mmol/L chez 9 patients porteurs d`une copie de la mutation Y122X [35]. Login to comment
130 Dans une partie distincte du travail, les auteurs de &#b4;montraient in vitro une translecture en pre &#b4;sence de gentamicine 4 a ` 7 fois plus efficace pour la mutation Y122X que pour les mutations W1282X, G542X et R1162X. Login to comment

PMID: 23209179 [PubMed] Ferec C et al: "Assessing the Disease-Liability of Mutations in CFTR."

No. Sentence Comment

39 Besides these rather common mutations, which are largely distributed in the Caucasian population, there are also some foundereffects of mutated allelesobserved C. Ferec and G.R. Cutting 2 Cite this article as Cold Spring Harb Perspect Med 2012;2:a009480 www.perspectivesinmedicine.org by Cold Spring Harbor Laboratory Press at SEMMELWEIS UNIV OF MEDICINE on December 5, as, for example, in the Reunion Island, where the Y122X (p.Tyr122X) mutation displays a frequency of 24% (Dugue &#b4;pe &#b4;roux et al. 2004), or the 394delTT (p.Leu88IlefsX22) referred to as aNordicmutationfoundincountriesbordering the Baltic sea (Schwartz et al. 1994). Login to comment

PMID: 24357848 [PubMed] Zvereff VV et al: "Cystic fibrosis carrier screening in a North American population."

No. Sentence Comment

63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment
80 The Table 3ߒ Frequency of 5T/7T/9T genotypes as a result of R117H reflex testing Poly-T alleles Number of detected alleles (%) CF32 panel CF69 panel 5T/5T 23 (0.44) 2 (0.73) 5T/7T 430 (8.27) 26 (9.49) 5T/9T 38 (0.73) 1 (0.37) 7T/7T 4,103 (78.93) 219 (79.92) 7T/9T 604 (11.61) 26 (9.49) 9T/9T 1 (0.02) 0 Total 5,198 (100) 274 (100) 394delTTd c.262_263delTT 3 0.10 G178Rd p.G178R 3 0.10 V520Fd p.V520F 3 0.10 2143delTd c.2012delT 2 0.06 935delAe c.803delA 2 0.06 A455Eb p.A455E 2 0.06 Q890Xd p.Q890X 2 0.06 S549Rd p.S549R 2 0.06 2869insGd c.2737insG 1 0.03 405ߙ+ߙ3A>Ce c.273ߙ+ߙ3A>C 1 0.03 G480Ce p.G480C 1 0.03 M1101Kd p.M1101K 1 0.03 Y122Xd p.Y122X 1 0.03 Total 3,088 100 a 1898ߙ+ߙ5G>Te , 444delA, G330X, S364Pe , K710X, and S1196X mutations were not detected in the target population. Login to comment

PMID: 24517344 [PubMed] Raju SV et al: "Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis."

No. Sentence Comment

81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

PMID: 24685677 [PubMed] Pranke IM et al: "Biosynthesis of cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

1372 The nonsense and frameshift mutations, belonging to the Class I, lead to creation of premature termination codons (PTCs) such as W1282X, G542X, Y122X, and result either in the synthesis of truncated and unstable protein or in the decrease of the half-lives of mutant mRNAs. Login to comment

PMID: 25122143 [PubMed] Audrezet MP et al: "Comprehensive CFTR gene analysis of the French cystic fibrosis screened newborn cohort: implications for diagnosis, genetic counseling, and mutation-specific therapy."

No. Sentence Comment

53 Because only a limited number of functional studies have assessed the pathogenicity of variants, mutations have been classified in previous studies according to their disease-causing potential.16,22,23 Based on the recommendations and data from these studies (UMD-CFTR-France),24 variants were classified into four groups: A, CF-causing; B, associated with CFTR-RDs; C, no clinical consequences; and D, unknown or Table 1ߒ Allelic frequencies of CF30-kit mutations, identified in neonates with CF, and correspondence between traditional mutation nomenclature and that on the Human Genome Variation Society website Frequency (F) % Mutation Legacy mutation nomenclature Number of alleles/2,320 % of alleles/2,320 Cumulative % ࣙ5 p.Phe508del F508del 1,560 67.24 67.24 p.Gly542* G542X 113 3.19 10.51 p.Asn1303Lys N1303K 81 1.98 c.1585-1G>A 1717-1G>A 48 1.47 1.00ࣙFࣙ4.99 c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A 37 1.42 p.Arg553* R553X 36 1.29 p.Gly551Asp G551D 31 1.16 p.Tyr122* Y122X 26 0.97 6.86 c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 22 0.82 c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 18 0.67 p.Ile507del I507del 17 0.63 c.3140-26A>G 3272-26A>G 16 0.59 0.40ࣙFࣙ0.99 p.Arg347Pro R347P 15 0.56 p.Arg1162* R1162X 15 0.56 p.Trp1282* W1282X 14 0.52 p.Tyr1092* Y1092X 13 0.48 c.2051_2052delinsG 2183AA>G 12 0.45 c.3528delC 3659delC 11 0.41 c.1680-886A>G 1811ߙ+ߙ1.6kbA>G 9 0.39 p.Gly85Glu G85E 8 0.34 3.06 p.Ser1251Asn S1251N 7 0.30 p.Arg334Trp R334W 7 0.30 p.Arg117His R117H 7 0.30 0.1ࣙFࣙ0.39 p.Trp846* W846X 6 0.26 c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T 6 0.26 c.948delT 1078delT 5 0.22 p.Ala455Glu A455E 5 0.22 p.Glu60* E60X 4 0.17 c.262_263delTT 394delTT 4 0.17 c.3718-2477C>T 3849ߙ+ߙ10kbC>T 3 0.13 Total 2,034 87.67 87.67 Mutations are clustered into four groups of frequency intervals (>5%, 1-4.99%, 0.99-0.4%, and <0.4%). Login to comment
121 The mutation spectrum in neonates with CF diagnosed through NBS is consistent with the previously reported spectrum in patients with CF diagnosed based on clinical symptoms.12 The percentage of the main mutations was similar (Figure 3); however, there were significantly higher rates of specific mutations, including p.Tyr122* (Y122X) in CF patients from the R&#e9;union Island (prevalence, 0.97 vs. 0.16%; P < 10-6 ) and c.2988+1G>A (3120+1G>A) (prevalence, 0.82 vs. 0.09%; P < 10-6 ) in patients of African origin. Login to comment

PMID: 25443471 [PubMed] Marion H et al: "The p.Gly622Asp (G622D) mutation, frequently found in Reunion Island and in black populations, is associated with a wide spectrum of CF and CFTR-RD phenotypes."

No. Sentence Comment

34 For patients, healthy individuals and fetuses originating for Reunion Island (903 samples in total), a systematic search for c.366T N A, p.Tyr122Ter (Y122X) and c.1865G N A, p.Gly622Asp (G622D) was performed because of their particular occurrence in this population. Login to comment
49 All carried on the other allele a severe CF-causing mutation such as c.366T N A, p.Tyr122Ter (Y122X), n = 3, and c.2988 + 1G N A (3120 + 1G N A), n = 1 (Table 3). Login to comment

PMID: 26014425 [PubMed] Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."

No. Sentence Comment

79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment