PMID: 17560176

Viel M, Leroy C, Hubert D, Fajac I, Bienvenu T
ENaCbeta and gamma genes as modifier genes in cystic fibrosis.
J Cyst Fibros. 2008 Jan;7(1):23-9. Epub 2007 Jun 7., [PubMed]
Sentences
No. Mutations Sentence Comment
72 ABCC7 p.Arg553*
X
ABCC7 p.Arg553* 17560176:72:128
status: NEW
view ABCC7 p.Arg553* details
ABCC7 p.Gly542*
X
ABCC7 p.Gly542* 17560176:72:258
status: NEW
view ABCC7 p.Gly542* details
ABCC7 p.Ser549Arg
X
ABCC7 p.Ser549Arg 17560176:72:2524
status: NEW
view ABCC7 p.Ser549Arg details
ABCC7 p.Ser549Arg
X
ABCC7 p.Ser549Arg 17560176:72:2531
status: NEW
view ABCC7 p.Ser549Arg details
ABCC7 p.Tyr122*
X
ABCC7 p.Tyr122* 17560176:72:2563
status: NEW
view ABCC7 p.Tyr122* details
ABCC7 p.Tyr122*
X
ABCC7 p.Tyr122* 17560176:72:2570
status: NEW
view ABCC7 p.Tyr122* details
Twenty-one were homozygous for the Phe508del mutation and 17 were compound heterozygous or homozygous for two severe mutations (R553X:1717-1GNA, Phe508del:W1282X, Phe508del:1717-1GNA, 2 Phe508del:3659delC, Phe508del:N1303K, Phe508del:W57X, Phe508del:Q1411X, G542X:1380insT, Phe508del:R553X, Table 1 Parameters for amplification of the ENaCβ and ENaCγ gene fragments (GenBank accession number NM_000336 and NM_001039, respectively) Fragment Sequence of primers Annealing temperature (°C) ENaCβ Exon 2 2F 5' gtgtcccagctgatgtgcgt 3' 55 2R 5' tgaggccagctgtgcactcc 3' Exon 3 3F 5' acagactactatggagtggg 3' 55 3R 5' aagaaacacccatcagcctc 3' Exon 4 4F 5' gtcctgctagcagctcccac 3' 59 4R 5' caaccgtaacatgccactgt 3' Exon 5 5F 5' ctgccctgcagctgatgctg 3' 55 5R 5' ccctgcaacagctgatggtc 3' Exon 6 6F gtctcctttctgcctcagga 3' 59 6R 5' tcagaccctctaggactgcc 3' Exon 7 7F 5' aggtgcagaaagggcttcct 3' 63 7R 5' catgaggcgtgcaccaccttcccac 3' Exon 8 8F 5' ctgaccatgcctgtgttctc 3' 59 8R 5' ctctatggtcagagcctctg 3' Exon 9-10 9F 5' cagaggctcagcagggaaca 3' 63 10R 5' catcttatgcccagacttgt 3' Exon 11 11F 5' gatgctgcagatggcaactt 3' 55 11R 5' gagctgtcctgtgtccaaac 3' Exon 12 12F 5' acattagtcccggcccttct 3' 55 12R 5' ggtattgggagactcctaaa 3' Exon 13 13F 5' fgaggcaagaatgtgtggcct 3' 59 13R 5' tcttggctgctcagtgagtt 3' ENaCγ Exon 2 2F 5' agcacgcccgtcctcagagt 3' 57 2R 5' ccagtgtgtcactttcggga 3' Exon 3 3F 5' tgaggctgacacgtgttgat 3' 55 3R 5' tgcccctaagcagtgaaaga 3' Exon 4 4F 5' agtagcgataggaccgatgg 3' 55 4R 5' tcagagctgccagtccttag 3' Exon 5 5F 5' cccaacttcagctaagatgc 3' 55 5R 5' agatctccttggcacaggtt 3' Exon 6 6F 5' ttggatcacagcaggttgtc 3' 55 6R 5' gatctgttctctccaagcct 3' Exon 7 7F 5' ctgtctggtgctccttgcaa 3' 55 7R 5' ccagcttagatataactttg 3' Exon 8 8F 5' tgagcaaagacatgaatggc 3' 57 8R 5' agtgcctattgccaggacta 3' Exon 9-10-11 9F 5' tccaaagctcatgctgccct 3' 57 11R 5' acagaggaacagggtagagg 3' Exon 12 12F 5' ggatgccaaggctcttgatt 3' 52 12R 5' gccaggaagatgctcacatt 3' Exon 13 13F 5' aggttcctcttgatggtgt 3' 55 13R 5' ggtcctgactagatctgtct 3' Table 2 Parameters for dHPLC conditions Fragment Temperature (°C) ENaCβ Exon 2 62.3/63.3 Exon 3 59.5/60.7 Exon 4 62.2/63.4 Exon 5 59.5/61 Exon 6 63 Exon 7 61.6/62.6/63.6 Exon 8 62.8/64.8 Exon 9-10 61.5/62.5/65 Exon 11 61/62/63.5 Exon 12 69 Exon 13 61/63.3/64.8 ENaCγ Exon 2 60.8/63.2/66 Exon 3 61/61.4 Exon 4 60.6 Exon 5 59.5/60.5 Exon 6 56.5/59/60.5 Exon 7 63/63.6 Exon 8 59.5/63 Exon 9-10-11 60.7/61.5/62.7/64.7 Exon 12 59.5/61.7 Exon 13 61/62.2 Phe508del:I507del, Phe508del:4382delA, S549R:3120+ 1GNA, Phe508del:3120+1GNA, Y122X:Y122X; Phe508del:W846X; Phe508del:E60X). Login to comment
74 ABCC7 p.Gly542*
X
ABCC7 p.Gly542* 17560176:74:24
status: NEW
view ABCC7 p.Gly542* details
ABCC7 p.Ser1251Asn
X
ABCC7 p.Ser1251Asn 17560176:74:99
status: NEW
view ABCC7 p.Ser1251Asn details
ABCC7 p.Gly1061Arg
X
ABCC7 p.Gly1061Arg 17560176:74:189
status: NEW
view ABCC7 p.Gly1061Arg details
ABCC7 p.Leu227Arg
X
ABCC7 p.Leu227Arg 17560176:74:254
status: NEW
view ABCC7 p.Leu227Arg details
Their genotypes were: 2 G542X:3849+10kbCNT, Phe508del:3276-26ANG, Phe508del:A455E, 297-3CNT:W361R, S1251N:3849+10kbCNT, Phe508del:G178R, Phe508del:3849+10kbCNT, Phe508del:A561E, Phe508del: G1061R, 1717-1GNA:3272-26ANG, 2 Phe508del:R347P, Phe508del:G85E, L227R:L227R, R300G:3007delG, Phe508del:R347H, Phe508del:G1244E. Login to comment
106 ABCC7 p.Arg347Pro
X
ABCC7 p.Arg347Pro 17560176:106:207
status: NEW
view ABCC7 p.Arg347Pro details
Lung transplant IV antibiotic courses/year Bronchial colonization 1 F508del: F508del p.G589S 36 PI 19.7 76 No 0 P. aeruginosa 2 F508del: F508del p.L481Q: p.V546IL 24 PI 25.6 74 No 1 P. aeruginosa 3 F508del: R347P p.T313M 27 PS 15.0 18 Awaiting 12 B. cepacia PI: pancreatic insufficient, PS: pancreatic sufficient, FEV1: forced expiratory flow in one second, BMI: body mass index. Login to comment
113 ABCC7 p.Arg347Pro
X
ABCC7 p.Arg347Pro 17560176:113:111
status: NEW
view ABCC7 p.Arg347Pro details
The new variant p.Thr313Met was present in a CF patient aged 27 years old, with mild CFTR genotype (Phe508del: R347P) but presenting a severe lung disease with Burkholderia cepacia colonization (FEV1 18%; continuous intravenous antibiotic treatment awaiting lung transplantation) (Table 3). Login to comment
135 ABCC7 p.Arg347Pro
X
ABCC7 p.Arg347Pro 17560176:135:370
status: NEW
view ABCC7 p.Arg347Pro details
ABCC7 p.Arg347Pro
X
ABCC7 p.Arg347Pro 17560176:135:375
status: NEW
view ABCC7 p.Arg347Pro details
Table 4 Nasal PD measurements and sweat test in CF patients bearing a missense mutation in ENaCβ or ENaCγ Patient number CFTR mutations ENaC mutations Basal NPD (mV) Δamil (mV) Δ0Cl-/amil (mV) Δ(iso/0Cl-) (mV) Cl- sweat mmol/L 1 F508del: F508del p.Gly589Ser -61 56 0 -5 114 2 F508del: F508del p.Leu481Gln: p.Val546Ileu -51 22 1 1 115 3 F508del: R347P p.Thr313Met Not done 64 NPD: nasal potential difference; amil: amiloride. Login to comment