ABCMdb

ABCC7 p.Ser549Arg

[switch to full view]
Comments [show]

II-III (maturation defect, gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications

PMID: 10376575 [PubMed] Mak V et al: "Proportion of cystic fibrosis gene mutations not detected by routine testing in men with obstructive azoospermia."

No. Sentence Comment

28 Analysis for 31 of the most common CFTR mutations found within the white CF population,60 consisting of ⌬F508, W1282X, G542X, G551D, N1303K, R553X, G85E, R117H, S549N, V520F, R334W, A455E, R347P, R1162X, Y122X, S549R, 621+1G→T, ⌬I507, R560T, R347H, 3659delC, Q493X, 1898+1G→T, 711+1G→T, 3849+10C→T, 1717-1G→A, 3849+4A→G, 3905insT, 1078delT, 2183AA→G, and 2789+5G→A. Briefly, the technique involved amplification by polymerase chain reaction61 of the relevant exons, followed by digestion with appropriate restriction endonucleases and acrylamide gel electrophoresis with ethidium bromide staining. Login to comment
45 (%) Men With 2 Mutations ⌬F508/IVS8-5T 7 (11) ⌬F508/IVS8-5T 1 (10) ⌬F508/IVS8-5T 1 (1.8) ⌬F508/R117H 6 (9) W1282X/IVS8-5T 1 (1.8) ⌬F508/L206W 1 (1.6) G544S/IVS8-5T 1 (1.8) ⌬F508/M952T 1 (1.6) V754M/-741T→G 1 (1.8) ⌬F508/P67L 1 (1.6) R75Q/R258G 1 (1.8) ⌬F508/S549R 1 (1.6) R334W/R334W 1 (1.6) R117H/R117H 1 (1.6) R117H/IVS8-5T 1 (1.6) R347P/IVS8-5T 1 (1.6) N1303K/IVS8-5T 1 (1.6) 1677delTA/IVS8-5T 1 (1.6) R117L/IVS8-5T 1 (1.6) D979A/IVS8-5T 1 (1.6) IVS8-5T/IVS8-5T 1 (1.6) Men With 1 Mutation IVS8-5T/N 10 (16) ⌬F508/N 1 (10) IVS8-5T/N 9 (16) ⌬F508/N 1 (2) ⌬F508/N 6 (9) IVS8-5T/N 1 (10) ⌬F508/N 1 (1.8) G542X/N 1 (2) W1282X/N 2 (3) R75Q/N 1 (1.8) IVS8-5T/N 5 (10) L206W/N 1 (1.6) W1282X/N 1 (1.8) 4016insT/N 1 (1.6) R117H/N 1 (1.8) 2423delG/N 1 (1.8) Men With No Mutations 18 (28) 7 (70) 37 (66) 42 (86) *N indicates that no CFTR mutations or variants were detected. Login to comment
47 tion panel included W1282X (2 alleles), R334W (2 alleles), S549R (1 allele), R347P (1 allele), and N1303K (1 allele). Login to comment
58 (%) 31 Mutation panel† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1 (1) R117H 9 (7) W1282X 2 (1.8) G542X 1 (1) W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) Extensive screen† ⌬F508 23 (18) ⌬F508 2 (10) ⌬F508 2 (1.8) ⌬F508 1Mutations included in R117H 9 (7) W1282X 2 (1.8) G542X 131 mutation panel W1282X 2 (1.6) R117H 1 (0.9) R334W 2 (1.6) S549R 1 (0.8) R347P 1 (0.8) N1303K 1 (0.8) L206W 2 (1.6)‡ R75Q 2 (1.8)‡Mutations not included in P67L 1 (0.8)‡ G544S 1 (0.9)‡31 mutation panel 1677delTA 1 (0.8)‡ 2423delG 1 (0.9)‡ R117L 1 (0.8)‡ V754M 1 (0.9)‡ 4016insT 1 (0.8)‡ -741T→G 1 (0.9)‡ D979A 1 (0.8)§ R258G 1 (0.9)§ M952T 1 (0.8)¶ IVS8-5T 25 (20)# 2 (10) 12 (11) 5 (5) Detectable mutations 72 (56)# 4 (20) 24 (21)# 7 (7) Detectable mutations missed by 31 mutation panel 33 (46) 2 (50) 19 (79) Detectable non-IVS8-5T mutations missed by 31 mutation panel 8 (17) 0 (0) 7 (58) *Percentages indicate allele frequency. Login to comment
83 These severe CFTR gene mutations are associated with pancreatic insufficiency and are generally class 1 through 3 mutations: ⌬F508, W1282X, N1303K, S549R, 1677delTA, R117L, 4016insT, G544S, 2423delG, V754M, and 741T→G. Login to comment
90 Except for 1 subject who had the ⌬F508/ S549R genotype, all 32 (25%) of 130 men with 2 mutant CFTR alleles carried at least 1 mild class 4 or 5 mutation. Login to comment

PMID: 10401194 [PubMed] Frossard PM et al: "Radiological analysis of children with cystic fibrosis who are homozygous for cystic fibrosis transmembrane conductance regulator mutation S549R (T-->G)."

No. Sentence Comment

2 We investigated the extent and severity of lung disease associated with CFTR mutation S549R (T ! Login to comment
6 Detailed radiological analyses were performed by a single observer in 12 children with CF from the United Arab Emirates who were homozygous for CFTR mutation S549R (T ! Login to comment
15 Genotype±phenotype correlations have been established with pancreatic status, while lung involvement is not clearly related to the CFTR genotype.6±9 We have reported previously that a very severe form of cystic ®brosis amongst nationals from the UAE is due to mutation S549R (T ! Login to comment
29 CFTR S549R mutation analysis DNA samples from the 12 CF patients were extracted from leukocytes isolated from 2 ml of venous blood collected in ethylene diamine tetraacetic acid (EDTA) tubes according to standard protocols.11 The determination of presence of mutation S549R in both alleles was done routinely by DraIII restriction endonuclease analysis of exon 11 polymerase chain reaction (PCR) products, and con®rmed by sequencing analysis according to protocols and conditions that have been described elsewhere.11 Clinical investigations Detailed radiological analyses were carried out in the 12 patients by a single observer in order to evaluate both the severity and the extent of lung disease. Login to comment
65 We sought to determine the degree of homogeneity in the pulmonary phenotypic expression of mutation S549R (T ! Login to comment
67 P. M. FROSSARD ET AL. Journal of Tropical Pediatrics Vol. 45 June 1999 We have previously shown that, amongst UAE nationals who are of Bedouin origin, CF is due to mutation S549R (T ! Login to comment
69 As the two NBFs have key regulatory roles in CFTR function, S549R (T ! Login to comment
82 These combined ®ndings clearly indicate that the phenotypic expression of lung disease due to CFTR mutation S549R (T ! Login to comment
84 In this respect, the pulmonary phenotype expression of mutation S549R (T ! Login to comment

PMID: 10444722 [PubMed] Gasparini P et al: "Analysis of 31 CFTR mutations by polymerase chain reaction/oligonucleotide ligation assay in a pilot screening of 4476 newborns for cystic fibrosis."

No. Sentence Comment

46 Table 1 Mutations analysed in the CFTR gene using polymerase chain reaction/oligonucleotide litigation assay/sequence coded separation Mutation Location Nucleotide Result F508 Exon 10 3 bp deletion Deletion of Phe-508 I507 Exon 10 3 bp deletion Deletion of Ile-507 (or -506) Q493X Exon 10 C-1609 →→ T Gln-493 → Stop V520F Exon 10 G-1690 → T Val-520 → Phe 1717-1G → A Intron 10 G-1717-1 → A 3`-splice site mutation G542X Exon 11 G-1756 → T Gly-542 → Stop G551D Exon 11 G-1784 → A Gly-551 → Asp R553X Exon 11 C-1789 → T Arg-553 → Stop R560T Exon 11 G-1811 → C Arg-560 → Thr S549R Exon 11 T-1779 → G Ser-549 → Arg S549N Exon 11 G-1778 → A Ser-549 → Asn 3849+10 kb C → T Intron 19 C-3849+10 kb → T Splice mutation 3849+4A → G Intron 19 A-3849+4 → G Splice mutation R1162X Exon 19 C-3616 → T Arg-1162 → Stop 3659delC Exon 19 1 bp deletion Frameshift W1282X Exon 20 G-3978 → A Trp-1282 → Stop 3905insT Exon 20 1 bp insertion Frameshift N1303K Exon 21 C-4041 → G Asn-1303 → Lys G85E Exon 3 G-386 → A Gly-85 → Glu 621+1G → T Intron 4 G-621+1 → T 5`-splice site mutation R117H Exon 4 G-482 → A Arg-117 → His Y122X Exon 4 T-498 → A Tyr-122 → Stop 711+1G → T Intron 5 G-711+1 → T 5`-splice site mutation 1078delT Exon 7 1 bp deletion Frameshift R347P Exon 7 G-1172 → C Arg-347 → Pro R347H Exon 7 G-1172 → A Arg-347 → His R334W Exon 7 C-1132 → T Arg-334 → Trp A455E Exon 9 C-1496 → A Ala-455 → Glu 1898+1G → A Intron 12 G-1898+1 → A 5`-splice site mutation 2184delA Exon 13 Deletion A-2184; A-2183 → G Frameshift 2789+5G → A Intron 14B G-2789+5 → A Splice mutation Table 2 Summary of cystic fibrosis screening results No of samples analysed Normal subjects Carriers Carrier frequency Turin 1574 1521 53 1/29.7 Pavia 1341 1299 42 1/31.9 San Giovanni Rotondo 1561 1512 49 1/31.8 Total 4476 4332 144 1/31.1 Table 3 Detailed list of mutations detected in the Italian population Centre F508 G542X R347P 2183-AG N1303K 711+1GT 1717-1A R347H R117H 1898+1G 2789+5G W1282X R1162X I507 Other TO 33 2 1 1 5 1 1 2 3 2 2 - - - PV 27 - - 1 2 - 1 - 5 - 1 2 1 1 SGR 30 14 2 1 1 1 - - - - - - - - TO, Dipartimento di Patologia Clinica, Ospedale Infantile "Regina Margherita, Torino; PV, Istituto di Anatomia Patologica, Sezione di Anatomia Patologica, Università di Pavia, Pavia; SGR, Servizio di Genetica Medica and Divisione di Neonatologia, IRCCS Casa Sollievo della SoVerenza, San Giovanni Rotondo, Foggia. Login to comment

PMID: 10450871 [PubMed] Frossard PM et al: "Determination of the prevalence of cystic fibrosis in the United Arab Emirates by genetic carrier screening."

No. Sentence Comment

9 Mutation S549R is localized in exon 11 (TG at nucleotide 1779) and alters a DraIII restriction site. Login to comment
25 This analysis was carried out on DNA samples of a UAE national family in which CF alleles harbour mutation S549R (TG). Login to comment

PMID: 10480369 [PubMed] Romey MC et al: "Complex allele [-102T>A+S549R(T>G)] is associated with milder forms of cystic fibrosis than allele S549R(T>G) alone."

No. Sentence Comment

2 Age at diagnosis was higher, and current age was significantly higher (P = 0.0032) in the group with the complex allele, compared with the S549R/S549R group. Login to comment
23 In order to better understand the discrepancy between the phenotypes presented by patients carrying mutation S549R, we have conducted a collaborative study aimed at comparing ethnic, clinical, and genetic data from patients with this mutation. Login to comment
49 Almost all patients carrying the double mutant allele, who have been investigated so far, have a mild to moder- 146 Table 1 Clinical characteristics of 16 patients homozygous for the S549R(T>G) mutation (UAE United Arab Emirates, ND no data) Characteristic Patient D1 D2 D3 D4 D5 D6 D7 D8 D9 D10 D11 D12 D13 D14 D15 D16 Genotype S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R S549R Geographic background Oman UAE UAE UAE UAE UAE UAE UAE UAE UAE UAE UAE UAE UAE UAE UAE Ethnic background Arab Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Bedouin Gender F F M F F F F M M F M F F F M M Current age (years) - 4 9 - 12 8.5 5 3 7 2 10 5 3 2 - 2 Age at death 5 months - - 6.5 years - - - - - - - - - - 5 months - Age at diagnosis 3 months 6 months 2 years 1 year 4 months 8 months 8 months 3 months 3.5 years 3 months 3 years 1 year 3 months 3 months 1 month 1 month Sweat Cl- (mmol/l) 70 120 123 155 133 100 150 120 150 100 120 90 90 120 ND ND Height (percentile) ND 10 5 5 5 25 25 ND ND ND ND ND ND ND ND ND Weight (percentile) >3 5 5 5 5 10 25 ND ND ND ND ND ND ND ND ND Shwachman- ND 60 55 45 50 55 40 55 45 55 45 60 55 45 35 50 Kulczycki score Lung colonization Yes No Yes Yes Yes Yes Yes No No Yes Yes Yes Yes Yes Yes Yes Pseudomonas aerug. Login to comment
67 Discussion Mutation S549R is a serine to arginine change resulting from a T to G substitution at nucleotide 1779, a site included in a six-amino acid region defined as "C consensus", which appears to be a unique feature of the ABC transporter superfamily (reviewed by Ko and Pedersen 1997). Login to comment
70 S549R was originally considered as a "severe" mutation with respect to PI. Login to comment

PMID: 10605524 [PubMed] Banjar H et al: "Geographic distribution of cystic fibrosis transmembrane regulator gene mutations in Saudi Arabia."

No. Sentence Comment

4 Pancreatic insuf® ciency (PI) was found in the following mutations: 1548delG in exon 10 (15%) which occurred mainly in native Saudi patients in the central province; 3120 1 1G ® A in intron 16 (10%) and H139L in exon 4 (7%), found mainly in native Saudis from the eastern province; D F508 mutation (13%) which occurred mainly in expatriates of Middle Eastern origin from different provinces; L117X in exon 19 (2%); G115X in exon 4 (2%); 7111 1G ® A in intron 5 (2%); N 1303K in exon 21(2%) and 425del42 in exon 4 (1%); I1234V in exon 19 (13%) with a predominance of nasal polyps and a variable degree of PI and lung disease; R553X in exon 11 (1%), with electrolyte imbalance; and S549R in 11 (2%) with pancreatic suf® ciency and minimal pulmonary disease. Login to comment
30 1 Sa E 1 1 8 Total 14 Total 15 Total Exon 19 L1177X 1 NonSa W 2 2 PI, PU Exon 10 D F508 2 Sa C 4 4 PI, PU 1/1/1 NonSa W/E/C 2/2/2 2/2/2 5 Total 10 Total 10% Total Exon 11 S549R 1 Sa E 2 2 PS Exon 11 553X/31201 1G ® A* 1 NonSa W 1 1 EL Intron 16 31201 1G ® A 3 Sa E 6 7 PI, PU 31201 1G ® A/? Login to comment
44 S549R was found in one family with pancreatic suf® ciency (PS) and minimal chest symptoms. Login to comment

PMID: 10764788 [PubMed] Van Oene M et al: "Cystic fibrosis mutations lead to carboxyl-terminal fragments that highlight an early biogenesis step of the cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

1 Analysis of cystic fibrosis-associated missense mutations in the first nucleotide binding domain (NBD1), including A455E, S549R, Y563N, and P574H, revealed reduced levels of mature CFTR with elevated levels of carboxyl-terminal polypeptide fragments of 105 and 90 kDa. Login to comment
41 EXPERIMENTAL PROCEDURES Construction of CFTR Expression Plasmids-The CFTR mutants A455E, S549R, P574H, and Y563N were generated from pBQ6.2 (34) as described previously (35). Login to comment
84 Analysis of the S549R mutant showed measurable but intermediate levels of band C, whereas A455E, Y563N, and P574H mutants showed markedly reduced levels using both tagged and untagged CFTR. Login to comment
90 Consistent with the observed steady state glycosylation pattern, CHA-S549R shows both cell surface and ER-like staining. Login to comment
92 Identification of Carboxyl CFTR Derivatives-In addition to full-length CFTR forms, both the M3A7 and the anti-HA antibodies revealed products with relative molecular masses of 105 and 90 kDa that were most prominent in detergent extracts of HEK293 cells expressing the A455E and S549R mutants (Fig. 1, B and C, lanes 4 and 5). Login to comment
105 Representative COS-7 cells transfected with (A) CHA-CFTRwt, (B) CHA-⌬F508, (C) CHA-A455E, and (D) CHA-S549R are shown. Login to comment
107 CHA-S549R also shows obvious cell surface staining consistent with the mature protein identified in immunoblot analyses. Login to comment
157 Results with CHA-S549R at steady state expression are shown (Fig. 6) as the 105-and 90-kDa intermediates as well as both core-and complex-glycosylated full-length protein forms are detectable. Login to comment
158 The treatment of CHA-S549R with N-glycosidase F (left panel) shifted both complex-glycosylated (band C) and core-glycosylated (band B) CFTR to the unglycosylated form (band A), as expected. Login to comment
159 Digestion with endoglycosidase H (right panel) removed only the high mannose-type asparagine-linked glycans from the band B form of CHA-S549R with minimal effect on band C forms of the protein (18, 46). Login to comment
181 It is imposed on the wt protein but is more prominent in the presence of missense mutations such as A455E or S549R. Login to comment
193 RIPA soluble protein extracts of CHA-S549R were treated with N-glycosidase F (N-Glyc F) and endoglycosidase H (Endo H). Login to comment
209 It would therefore be interesting to closely examine its interaction with the S549R and A455E CFTR mutants. Login to comment
228 The proximity of the amino acid deletion to a proteolytic site may account for this; however, analysis of cells expressing CFTR versions with both the ⌬F508 mutation and either S549R or A455E mutations retain the formation of prominent levels of the carboxyl-terminal fragments (data not shown). Login to comment
235 In attempting to correlate the abundance of the carboxyl degradation bands with the formation of band C, it was evident from the S549R mutation that moderate levels of complex-glycosylated CFTR can be generated even though the production of 90- and 105-kDa products is prominent. Login to comment

PMID: 10782933 [PubMed] Frossard PM et al: "Identification of cystic fibrosis mutations in Oman."

No. Sentence Comment

23 Distribution by ethnicity and by ethnic origins of CF patients and families that were recruited for this study on the population of Oman, and number of alleles carrying either of the two mutations, S549R (TG) and DF508 Ethnic origin No. of families No. of patients No. of CF allelesMutation Bedouin descent 1312 22/26S549R(TG) DF508 4/633Baluch origin have other CFTR mutations that have not yet been identified; their sweat chlorides, however, were lower (90-117 mmol/l) and their ages ranged between 3 and 8 years. Login to comment

PMID: 10834512 [PubMed] Kambouris M et al: "Identification of novel mutations in Arabs with cystic fibrosis and their impact on the cystic fibrosis transmembrane regulator mutation detection rate in Arab populations."

No. Sentence Comment

63 Of more than 850 known CFTR mutations (http:// www.genet.sickkids.on.ca/cftr-cgi-bin/Mutation Table), only 9 were encountered in this study: R75X, A141D, 1249G ® A, DF508, S549R, R553X, 3120 + 1G ® A, I1234V and N1303K. Login to comment
109 1 (private mutation) 475G ® T G115X ± protein truncation 1 2 1a [I1234V] 1 Total: 2 2.5% 536C ® T A141D 1 2 (private mutation) 548A ® T H139L 3 6 1a [S549R] 1 Total: 4 6% Exon 5 711 + 1G ® A Splice site 1 2 1a [?] Login to comment
114 1 (private mutation) 1779T ® G S549R 1 2 1a [H139L] 1 Total: 2 2.5% 1789C ® T R553X ± protein truncation 1a [3120 + 1G ® A] 1 (private mutation) 1811 + 2T ® C Splice site 1a [1548delG] 1 (private mutation) Exon 16 3120 + 1G ® A Splice site 5 10 1a [R533X] 1 1a [N1303K] 1 1a [?] Login to comment

PMID: 10836331 [PubMed] Frossard PM et al: "Genotype-phenotype correlations in cystic fibrosis: clinical severity of mutation S549R(T-->G)."

No. Sentence Comment

21 In this report, the clinical characteristics that are associated with this mutation in a group of 15 CF patients who are homozygous for S549R are presented. Login to comment
38 CFTR S549R mutation analysis Deoxyribonucleic acid (DNA) was extracted from leukocytes isolated from 2±5 mL of the subject's venous blood collected in ethylenediaminetetraacetic acid (EDTA) tubes according to standard protocols [17]. Login to comment
39 The detection of mutation S549R localized in exon 11 (T?G at nucleotide 1779) was performed routinely by DraIII restriction endonuclease analysis of exon 11 polymerase chain reaction (PCR) products, and the mutation was confirmed by sequencing analysis according to protocols and conditions that have been described elsewhere [14]. Login to comment
40 Results The clinical presentation of 15 CF children (6 males and 9 females) who were homozygous for mutation S549R wasdetermined.Theclinicaldescriptionofthepooledgroup of patients is presented in table 1. Login to comment
49 Discussion S549R is a missense mutation that was first reported in 1989 by KEREM et al. Login to comment
50 [18] in a Moroccan Jewish individual who was a compound heterozygote S549R/DF508. Login to comment
53 [19] screened 105 mutations in 600 CF patients from France and identified one S549R homozygote. Login to comment
63 Previous work [14] by the authors indicated that all CF patients of Bedouin origin that have been investigated so far were homozygous for S549R (T?G), which led to the hypothesis that the mutation is the result of a founder effect that occurred in an ancestral Bedouin tribe. Login to comment
64 Although S549R has been described elsewhere as a private mutation only, the uniquely high number of homozygotes in the UAE allowed us to evaluate the overall clinical presentation that is associated with S549R. Login to comment
65 This data indicates that S549R is a very severe mutational allele. Login to comment
70 Sweat chloride concentrations associated with S549R homozygosity were high, even at very young ages (mean sweat chloride levels in the group of 15 patients were 12021 mEq.L-1 ). Login to comment
75 An interesting feature of the clinical presentation associated with S549R in the UAE is that none of the 15 homozygous patients had presented with meconium ileus at birth. Login to comment
88 Detection of the S549R mutation is thus imperative in these cystic fibrosis children, as aggressive treatment and management modalities should be instigated as soon as possible in order to increase the patient's chances of survival. Login to comment

PMID: 10875853 [PubMed] Casals T et al: "Heterogeneity for mutations in the CFTR gene and clinical correlations in patients with congenital absence of the vas deferens."

No. Sentence Comment

98 Vasograms performed in six patients with CUAVD E92K/- 5T/7T 1 not only confirmed ultrasonographic findings, but also showed 711ϩ1G→T/- 5T/7T 1 additional abnormalities at various levels of the seminal tract.R334W/- 5T/7T 1 S549R/- 5T/7T 1 The volume and consistency of testes was normal, except in 1949del84/- 5T/7T 1 patients with other concomitant pathologies, such as crypt- K1060T/- 5T/7T 1 orchidism (n ϭ 6), trauma (n ϭ 2), orchitis (n ϭ 2) orR1162X/- 5T/7T 1 S1235R/- 5T/7T 1 tumour (n ϭ 1). Login to comment

PMID: 10973878 [PubMed] Costes B et al: "Prenatal detection by real-time quantitative PCR and characterization of a new CFTR deletion, 3600+15kbdel5.3kb (or CFTRdele19)."

No. Sentence Comment

51 The mutations tested were S549N, S549R, R553X, G551D, V520F, ⌬I507, ⌬F508, Q493X, 1717-1G3A, G542X, R560T, R347P, R347H, 3849ϩ4A3G, W1282X, R334W, 1078delT, 3849ϩ10kbC3T, R1162X, N1303K, 3659delC, 3905insT, A455E, R117H, Y122X, 2183AA3G, 2789ϩ5G3A, 1898ϩ1G3A, 621ϩ1G3T, 711ϩ1G3T, and G85E. Login to comment

PMID: 11005149 [PubMed] Frossard PM et al: "Mild clinical phenotype associated with R1158X/S549R(T-->G) CFTR genotype."

No. Sentence Comment

8 Moreover, the clinical presentation associated with S549R homozygosity is quite homogeneous and shows an extreme degree and course of CF severity - at least as much as those associated with DF508 (5, 6). Login to comment
9 We report here the identification of the first compound heterozygote patient in the UAE, who harbours mutations S549R/R1158X in his CFTR gene. Login to comment

PMID: 11157821 [PubMed] McCallum T et al: "Unilateral renal agenesis associated with congenital bilateral absence of the vas deferens: phenotypic findings and genetic considerations."

No. Sentence Comment

61 ThereW1282X; ∆F508; R553X; N1303K; 3849ϩ10 kb C-T; R117L; I506; R553G; R560K; 1811ϩ1G-C; 1774delCT; S549R; S549I; R1283K; were no significant correlations with ethnic origin. Login to comment

PMID: 11336401 [PubMed] Orgad S et al: "Prevalence of cystic fibrosis mutations in Israeli Jews."

No. Sentence Comment

33 These were: delF508 (Kerem et al., 1989), W1282X (Vidaud et al., 1990), G542X, 1717-1G R A, S549R (Kerem et al., 1990), N1303K (Osborn et al., 1991), 3849 1 10Kb C R T (Highsmith et al., 1994), T359K/Q360K (Shoshani et al., 1992), G85E (Zielenski et al., 1991), 405 1 1G R A (Dork et al., 1993), W1089X (Shosani et al., 1994), and D1152H (Highsmith et al., 1993). Login to comment
40 THE CONSENSUS POLICY OF SCREENING OF CF MUTATIONS IN ETHNIC GROUPS OF ISRAELI JEWSa Buchara and Iran Georgia Libya Morocco Tunis Turkey Egypt Sephardi W1089X 1 1 1 G85E 1 1 405-1 G® A 1 1 1 S549R 1 1 D1152H 1 1 1 1 T360K 1 Individuals of all ethnic groups were screened for the mutations W1282X, delF508, G5429X, N1303K, 3849110Kb C® T and 1717-1G® A. Login to comment
45 There were 173 (46.3%) carriers of the W1282X mutation; 110 (29.4%) carriers of delF508; 23 (6.1%) carriers of G542X; 10 (2.7%) carriers of N1303K; and 22 (5.9%) carriers of 3849 1 10KbC R T. Twenty (5.3%) were found to carry D1152H; 11 (2.9%) carried 405 1 1G R A; 4 (1.1%) carried W1089X; and 1 (0.3%) carried S549R. No carriers were detected for the mutations 1717-1G R A, G85E, and T360K, which were tested for in 7,383, 1,436, and 41 individuals, respectively. Login to comment
52 Mutations tested for all individuals in the cohort North Total Ashkenazi Sephardi Africa Eastern number of Mutation no. 6850 no. 933 no. 1146 no. 468 carriers W1282X 142 17 8 6 173 delF508 86 12.25 11.5 0.25 110 G542X 20.25 0.5 1.75 0.5 23 N1303K 7.5 1.5 0.25 0.75 10 3849110Kb 17 2 2 1 22 C® T B. Mutations tested for individuals of non-Ashkenazi origin, mixed origin, and of spouses of carriers Type of Total number mutation Number tested Ashkenazi Sephardi North Africa Eastern of carriers D1152H Number tested 1,305 458.25 722.75 280 Carriers 11.5 4.5 3.5 0.5 20 405 Number tested 425.75 372 633.5 119 11G® A Carriers 0.5 1 9.5 0 11 W1089X Number tested 539.25 345 638.5 135 Carriers 2 0.5 1 0.5 4 S549R Number tested 534.5 385.5 686 110 Carriers 0 1 0 0 1 a Ethnic origin was classified according to the country of origin of the four grandparents of each individual. Each grandparent was calculated as contributing a quarter of his/her gene pool and these were summed up for each ethnic origin. Login to comment
91 One might reconsider the cost effectiveness of testing for infrequent mutations such as 1717-1G R A, W1089X, S549R, and G85E when screening the general Jewish population. Login to comment

PMID: 11523757 [PubMed] Dawson KP et al: "The S549R (T-->G) cystic fibrosis gene mutation."

No. Sentence Comment

2 Among the several mutations that have been described in exon 11 of the CFTR is S549R (T➝G). Login to comment
5 Serine is a highly conserved amino acid in this important binding domain and its replacement by an arginine residue is expected to result in a severe chloride dysfunction and hence severe clinical disease.4 S549R is defined as a Class II mutation.5-8 These are associated with defective protein processing. Login to comment
12 The existence of the mutation S549R (T➝G), was first reported to the Cystic Fibrosis Genetic Analysis Consortium on 9th February 1990 by Kerem and Tsui.2 The individual who carried the CF chromosome was a non-Ashkenazi Jewish patient from Morocco who also carried the ∆F508 mutation on the other allele.4 Further reference to this and one other Moroccan patient was made by Kerem, et al.9 who studied cystic fibrosis mutations in Jewish communities. Login to comment
14 S549R was found only in these two patients from Morocco and it thus accounted for 6 per cent of the identified Jewish CF patients from that country. Login to comment
15 There have been four separate mutations described in codon 549, namely S549R (A➝C), S549I, S549R (T➝G), and S549N2 (codons = triplet codes for each amino acid). Login to comment
16 A study of 27 177 CF chromosomes from 29 European and three north African countries showed that of the 272 mutations examined, S549R occurred on 12 occasions (0.04 per cent) and the S549N on 16 occasions (0.059 per cent). Login to comment
17 Interestingly, despite its general rarity, the S549R mutation accounted for 2.6 per cent of all mutations in Algeria.3 However, a recent detailed study of 10 Algerian CF families revealed no patients with a mutation on exon 11.10 Another important report in the literature regarding the S549R mutation is from Saudi Arabia. Login to comment
21 However, El-Harith, et al.13 investigated 15 Arab children from 12 Occasional Review The S549R (T➝G) Cystic Fibrosis Gene Mutation by K. P. Dawson and P. M. Frossard Departments of Paediatrics and Pathology, Faculty of Medicine and Health Sciences, UAE University,Al Ain, United Arab Emirates Correspondence: Professor K. P. Dawson, Chairman, Department of Paediatrics, Faculty of Medicine and Health Sciences, PO Box 17666, Al Ain, United Arab Emirates. Login to comment
26 No examples of S549R were detected and it is of significance that the families studied were all from the eastern region from where the one previous Saudi patient with S549R had been identified. Login to comment
27 While studying patients with CF in the United Arab Emirates (UAE), it became apparent that the otherwise common CF mutation, ∆F508, was mostly found in those belonging to the minority Baluch ethnic group, while it was absent in the majority Bedouin population.14 Overall in the UAE, those who are homozygous for the mutation S549R (T➝G) account for over 90 per cent of all patients with CF. Login to comment
28 Only one example of a heterozygote has been encountered and this patient had a mild phenotype and a genotype R1158X/S549R (T➝G). Login to comment
30 The study of 15 Bedouin families with CF revealed that they were all homozygous for the S549R (T➝G) mutation.14 In a genotype-phenotype correlation with assessment based upon 20 outcome variables, it was apparent that in the homozygous state this mutation leads to a severe disease presentation with pancreatic insufficiency, early severe lung disease, and early colonization with Pseudomonas aeruginosa.15 Further radiological assessment of this group confirmed the association of extreme lung disease and rapid pulmonary decline in those patients homozygous for the mutation.16 To establish the carrier rate of the S549R (T➝G) mutation in the UAE, a sample of 400 unrelated UAE nationals was examined. Login to comment
31 The estimated frequency of carriers of S549R (T➝G) was determined as 1:100.17 The question then arose as to whether this was a unique finding in the UAE or whether the mutation was to be found commonly in the neighbouring Arab countries. Login to comment
35 The debate then arises as to the comparative severity associated with S549R (T➝G) and the ∆F508 mutation. Login to comment
37 We concluded that the clinical severity of S549R (T➝G) at least equates to that of homozygous ∆F508 individuals in a UAE setting (unpublished observation). Login to comment
39 Thus, the data from eastern Arabia points to S549R (T➝G) being a mutation causing severe clinical disease and probably as severe as found in CF. Login to comment
47 The -102T➝A mutation was found on the same allele with the mutation S549R (T➝G) in a compound heterozygote situation with ∆F508 in one female patient. Login to comment
48 A male patient had a compound heterozygote S549R (T➝G)/S945L with -102T➝A promoter mutation. Login to comment
50 This contrasted with the prior report that S549R was associated with severe disease.1 The French patients were not, however, homozygous for S549R, but one had a severe mutation, ∆F508, in a compound heterozygote situation. Login to comment

PMID: 11569691 [PubMed] Truninger K et al: "Mutations of the cystic fibrosis gene in patients with chronic pancreatitis."

No. Sentence Comment

56 Using multiplex PCR, 15 genomic fragments were amplified which contain the following mutations: ⌬F508, ⌬I507, Q493X, V520F, 1717-1G3A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ϩ 10kbC3T, 3849 ϩ 4A3G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621 ϩ 1G3T, R117H, Y122X, 711 ϩ 1G3T; 1078delT, R347P, R347H, R334W, A455E, 1898 ϩ 1G3A, 2183AA3G, 2789 ϩ 5G3A. Login to comment

PMID: 11574497 [PubMed] Josserand RN et al: "Cystic fibrosis phenotype evaluation and paternity outcome in 50 males with congenital bilateral absence of vas deferens."

No. Sentence Comment

30 Leukocytes samples were analysed for a series of 22 CF mutations including the five most frequently encountered in our region (The CF Genotype Consortium, 1994): ∆F508, G542X, N1303K, 1717-G-A, 885E; and 17 others: R117H, R334W, R347H, R347P, 556delA, S549N, S549I, S549R, G551D, R553X, R560T, G1244E, S1255X, W1282X, R1283K, 3898ins C, D1270N. Login to comment

PMID: 11781704 [PubMed] Larriba S et al: "ATB(0)/SLC1A5 gene. Fine localisation and exclusion of association with the intestinal phenotype of cystic fibrosis."

No. Sentence Comment

151 Statistical analysis showed that the higher incidence for P17A and the lower incidence for V512L observed in the general population Table 3 CFTR mutations of the CF patients under study with and without meconium ileus (MI) CF-non MI CF-MI CFTR mutations n CFTR mutations n F508del/R117H 2 F508del/F508del 7 F508del/R334W 3 F508del/L365P 1 F508del/R347P 1 F508del/G542X 1 F508del/621+1G4Ta 1 F508del/621+IG4Ta 1 F508del/M1101K 1 F508del/R1066C 1 F508del/1609delCAa 1 F508del/W1089X 1 F508del/2789+5G4Aa 3 F508del/R1162X 1 F508del/3849+10kbC4T 1 F508del/1609delCAa 1 G542X/G85E 1 F508del/Q1281X 1 G542X/V232D 1 F508del/1811+1.6kbA4G 1 G542X/1811+1.6kb A4Ga 1 F508del/2789+5G4Aa 1 G542X/2789+5G4A 1 F508del/2869insG 1 Q890X/L206W 1 F508del/unknown 1 1811+1.6kbA4G/P205S 1 I507del/I507del 1 R1162X/3272-26A4G 1 G542X/1078delT 1 N1303K/R347H 1 G542X/1811+1.6kbA4Ga 1 N1303K/A1006E+5T 1 S549R/CFTR50kbdel 1 2789+5G4A/405+1G4A 1 R1066C/R1066C 1 W1282X/712-1G4T 1 a CF patient with a sibling presenting identical CFTR genotype and discordance of intestinal phenotype. Login to comment

PMID: 11883825 [PubMed] Padoan R et al: "Genetic and clinical features of false-negative infants in a neonatal screening programme for cystic fibrosis."

No. Sentence Comment

34 It was initially performed by polyacrylamide gel electrophoretic (PAGE) analysis for the delF508 mutation, and later by polymerase chain reaction (PCR) and oligonucleotide ligation assay (OLA) (31 mutations: G85E, 621 ‡ 1G ® T, R117H, Y122X, 711 ‡ 1G ® T, 1078delT, R347P, R347H, R334W, A455E, 1898 ‡ 1G ® A, 2183-AA ® G, 2789 ‡ 5G ® A, DelF508, I507del, Q493X, V520F, 1717-1G ® A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 ‡ 10kbC ® T, 3849 ‡ 4A ® G, R1162X, 3659delC, W1282X, 3905insT, N1303K) (14). Login to comment

PMID: 12000363 [PubMed] Visich A et al: "Complete screening of the CFTR gene in Argentine cystic fibrosis patients."

No. Sentence Comment

56 Frequency of cystic fibrosis transmembrane regulator mutations in the Argentine population: 440 chromosomes analysed Mutation Localization Chromosome Number Percentage DF508 Exon 10 258 58.64 G542X Exon 11 18 4.10 W1282X Exon 20 12 2.73 N1303K Exon 21 12 2.73 R334W Exon 7 5 1.14 1717-1G»A Intron 10 5 1.14 3849π10KbC»T Intron 19 4 0.91 1811π1.6KbA»G Intron 11 4 0.91 IVS8-5T Intron 8 4 0.91 G85E Exon 3 3 0.68 621π1G»T Intron 4 3 0.68 2789π5G»A Intron 14b 3 0.68 DI507 Exon 10 3 0.68 2184delA Exon 13 2 0.45 2566insT Exon 13 2 0.45 2686insT Exon 14a 2 0.45 3659delC Exon 19 2 0.45 R1162X Exon 19 2 0.45 4016insT Exon 21 2 0.45 2789π2insA Intron 14b 2 0.45 L6V Exon 1 1 0.23 297π2A»G Intron 2 1 0.23 W57X Exon 3 1 0.23 R75Q Exon 3 1 0.23 Q220X Exon 6a 1 0.23 Y362X Exon 7 1 0.23 D426C Exon 9 1 0.23 1460delAT Exon 9 1 0.23 1353insT Exon 9 1 0.23 1782delA Exon 11 1 0.23 R553X Exon 11 1 0.23 S549R Exon 11 1 0.23 1898π3A»G Intron 12 1 0.23 2594delGT Exon 13 1 0.23 2183AA»G Exon 13 1 0.23 I1027T Exon 17a 1 0.23 R1066C Exon 17b 1 0.23 G1061R Exon 17b 1 0.23 4005-1G»A Intron 20 1 0.23 Total 367 83.45 209 nificant differences were observed among the compared populations (Table2). Login to comment

PMID: 12007216 [PubMed] Bobadilla JL et al: "Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening."

No. Sentence Comment

111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment
112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL. Login to comment
213 Ideal Recommended CFTR Mutation Screening Panel for 2001 Neonatal Screening in the USA* Location Estimated Mutation in CFTRa percentageb Reason for inclusion DF508 Exon 10 68.6% CFF registry, >1%, Pan-European G542X Exon 11 2.4% CFF registry, >1%, Mediterranean G551D Exon 11 2.1% CFF registry, >1%, Celtic W1282X Exon 20 1.4% CFF registry, >1%, Ashkenazi Jew N1303K Exon 21 1.3% CFF registry, >1%, Mediterranean R553X Exon 11 0.9% CFF registry, >0.5%, Hispanic 621+1G®T Intron 4 0.9% CFF registry, >0.5%, multi-ethnic 1717-1G®A Intron 10 0.7% CFF registry, >0.5%, Italian 3849+10KbC®T Intron 19 0.7% CFF registry, >0.5%, Hispanic R117Hc Exon 4 0.7% CFF registry, >0.5% 1898+1G→T Intron 12 0.4% CFF registry, >0.1%, East Asian DI507 Exon 10 0.3% CFF registry, >0.1%, Hispanic 2789+5G®A Intron 14b 0.3% CFF registry, >0.1% G85E Exon 3 0.3% CFF registry, >0.1% R347P Exon 7 0.2% CFF registry, >0.1% R334W Exon 7 0.2% CFF registry, >0.1%, multi-ethnic R1162X Exon 19 0.2% CFF registry, >0.1%, multi-ethnic R560T Exon 11 0.2% CFF registry, >0.1% 3659delC Exon 19 0.2% CFF registry, >0.1% A455E Exon 9 0.2% CFF registry, >0.1% 2184delA Exon 13 0.1% CFF registry, >0.1% S549N Exon 11 0.1% CFF registry, >0.1%, multi-ethnic 711+1G®T Intron 5 0.1% CFF registry, >0.1% R75X Exon 3 0.2% Hispanic 406-1G→A Intron 3 0.2% Hispanic I148T Exon 4 0.2% Hispanic, French 2055del9→A Exon 13 0.1% Hispanic 935delA Exon 6b 0.1% Hispanic I506T Exon 10 0.1% Hispanic 3199del6 Exon 17a 0.1% Hispanic 2183AA→G Exon 13 0.1% Hispanic 3120+1G®A Intron 16 1.5% African American, Arabian 2307insA Exon 13 0.2% African American A559T Exon 11 0.2% African American ∆F311 Exon 7 0.2% African American G480C Exon 10 0.2% African American 405+3A→C Intron 3 0.2% African American S1255X Exon 20 0.2% African American L1093P Exon 17b Undetermined Native American D648V Exon 13 Undetermined Native American I1234V Exon 19 Undetermined Arabian linkage S549R Exon 11 Undetermined Arabian linkage 1898+5G→T Intron 12 Undetermined East Asian linkage CFTRdele2,3 Exons 2,3 Undetermined Eastern European linkage (Slavic) Y1092X Exon 17b Undetermined French linkage 394delTT Exon 3 Undetermined Nordic linkage Y569D Exon 12 Undetermined Pakistani linkage 3905insT Exon 20 Undetermined Swiss linkage (also: Amish, Acadian, Mennonite) 1898+1G®A Intron 12 Undetermined Welsh linkage M1101k Exon 17b Undetermined Hutterite ancestry *This table presents the top 50 mutations in the USA based on the Cystic Fibrosis Foundation CF Registry data from 1997 [Cystic Fibrosis Foundation, 1998], and data generated during our investigation. Login to comment

PMID: 12080183 [PubMed] deCarvalho AC et al: "A novel natural product compound enhances cAMP-regulated chloride conductance of cells expressing CFTR[delta]F508."

No. Sentence Comment

9 CF-causing mutations within NBD1 that result in defective processing of CFTR (⌬F508, ⌬I507, and S549R) disrupted NBD1 interaction in yeast. Login to comment
37 Plasmids identical to pBDNBD1 and pADNBD1, but containing CF-causing mutations (⌬F508, ⌬I507, S549R, and G551D) were similarly constructed (producing pBD⌬F, pAD⌬F, pBD⌬I507, pAD⌬I507, pBDS549R, pADS549R, pBDG551D, pADG551D). Login to comment
109 To assess the effect of CF-causing mutations on NBD1 homodimerization, ⌬I507, ⌬F508, S549R, and G551D were each introduced into NBD1 in both pADNBD1 and pBDNBD1. Login to comment
110 As shown in Figure 1B, the mutations ⌬F508, ⌬I507, and S549R, resulted in a HIS- phenotype, indicating defective NBD1 dimerization. Login to comment
214 CF mutations affecting CFTR processing (⌬F508, ⌬I507, and S549R) resulted in defective CFTR NBD1 dimer formation in yeast. Login to comment

PMID: 12110684 [PubMed] DeCarvalho AC et al: "Mutations in the nucleotide binding domain 1 signature motif region rescue processing and functional defects of cystic fibrosis transmembrane conductance regulator delta f508."

No. Sentence Comment

36 Interestingly, the site of this mutation is flanked by two residues where CF-causing mutations have been identified that impair folding/trafficking of CFTR (S549R) or ATP-dependent channel gating (G551D) (37-41). Login to comment
167 CFTR variant Isc n % of CFTR wt CFTR S549R 1.70 Ϯ 0.11 4 CFTR G551D 1.17 Ϯ 0.12 4 CFTR ⌬F508 0.76 Ϯ 0.07 17 CFTR ⌬F/G550E 9.30 Ϯ 0.55 14 (*) CFTR ⌬F/G550D 6.06 Ϯ 0.63 12 (*) CFTR ⌬F/G550H 4.17 Ϯ 0.40 8 (*) Mutations in the ABC Signature Motif Region Rescue CFTR⌬F50835900 CFTR⌬F/G550E relative to FRT-CFTR ⌬F508 (Fig. 4B), although the mature band C was barely detectable, and the steady-state levels of band B were decreased for the revertant (Fig. 4A). Login to comment
206 CFTR variants bearing CF-causing mutations within the NBD1 signature motif, G551D and S549R, were included in the experiment and produced low Isc, as expected. Login to comment

PMID: 12116247 [PubMed] Muller F et al: "Predicting the risk of cystic fibrosis with abnormal ultrasound signs of fetal bowel: results of a French molecular collaborative study based on 641 prospective cases."

No. Sentence Comment

48 A, G542X, G551D, R553X, R560T, S549R, S549N, 3849 þ 10kbC ! Login to comment

PMID: 12133923 [PubMed] Corbetta C et al: "Screening for cystic fibrosis in newborn infants: results of a pilot programme based on a two tier protocol (IRT/DNA/IRT) in the Italian population."

No. Sentence Comment

266 Mutations identified by the assay are G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183-AA→G, 2789+5G→A, delF508, I507del, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, and N1303K. Login to comment

PMID: 12138064 [PubMed] Blau H et al: "Urogenital abnormalities in male children with cystic fibrosis."

No. Sentence Comment

264 Seven of these were homozygous or compound heterozygotes for the genotypes ∆F508, W1282X, G542X, S549R, and 405+1G→A. Login to comment
294 The vas deferens appeared similar to Table 1 Genotype and clinical features in pancreatic insufficient boys Pt no. Age (y) Sweat chloride CFTR mutations FEV1 Wt Ht Sh. score 1 2 69 W1282X/405+1G→A - 3 3 77 2 3 100 W1282X/W1282X 98% 50 75 92 3 5 78 Unknown 94% 50 10 92 4 6 75 Unknown 86% 50 25 85 5 7 76 W1282X/G542X 105% 95 40 90 6 8 99 W1282X/∆F508 112% 85 50 98 7 9 90 S549R/S549R 77% 25 10 70 8 10 84 W1282X/∆F508 102% 25 20 89 9 10 97 W1282X/∆F508 87% 50 50 98 FEV1, forced expiratory volume in 1 second; Wt , weight, percentile for age; Ht, height, percentile for age; Sh. score, Shwachman score. Login to comment

PMID: 12394352 [PubMed] Richards CS et al: "Standards and guidelines for CFTR mutation testing."

No. Sentence Comment

51 A recent report by Orgad et al.11 indicated that additional mutations were found in Jewish Israeli populations, including D1152H, 405 ϩ 1GϾA, W1089X, and S549R. Login to comment

PMID: 12794695 [PubMed] Timmreck LS et al: "Analysis of cystic fibrosis transmembrane conductance regulator gene mutations in patients with congenital absence of the uterus and vagina."

No. Sentence Comment

82 CFTR Gene Mutations Tested DF508 R334W Y1092X 5T variant Y122X R347H G542X S549R 3,849 þ 4 G551D 3,849 þ 10 kb 2,789 þ 5 W1282X R553X 711 þ 1 3,905 þ T 621 þ 1 1,898 þ 1 N1303K 1,717À1 R1162X R117H 1078dT A455E D1507 Q493X 218dA R347P V520F G85E R560T S549N 3659dC Wolffian duct must occur at a time when the Mu¨llerian duct is no longer dependent on the Wolffian duct for development. Login to comment

PMID: 12815607 [PubMed] Scotet V et al: "Comparison of the CFTR mutation spectrum in three cohorts of patients of Celtic origin from Brittany (France) and Ireland."

No. Sentence Comment

64 Spectrum of the CFTR Mutations Identified in the Cohorts from Brittany, Dublin Centre, and Cork Area Nucleotide Amino acid change * change Exon Number Frequency Number Frequency Number Frequency 211delG 2 1 0.1% 310G>T E60X 3 5 0.6% 4 0.3% 347C>A A72D 3 1 0.1% 368G>A W79X 3 1 0.1% 386G>A G85E 3 2 0.3% 3 0.2% 403G>A G91R 3 2 0.3% 482G>A R117H 4 4 0.5% 38 3.0% 4 1.4% 498T>A Y122X 4 1 0.1% 574delA 4 1 0.1% 577G>A G149R 4 1 0.1% 621+1G>T int 4 5 0.6% 21 1.7% 790C>T Q220X 6a 1 0.1% 875+1G>C int 6a 1 0.4% 905delG 6b 1 0.1% 1065C>G F311L 7 2 0.3% 1078delT 7 28 3.6% 1132C>T R334W 7 1 0.1% 1172G>A R347H 7 5 0.6% 1172G>T R347L 7 1 0.1% 1172G>C R347P 7 1 0.1% 1187G>A R352Q 7 3 0.2% 2 0.7% 1208A>G Q359R 7 1 0.1% 1154insTC 7 2 0.2% 1221delCT 7 2 0.3% 1248+1G>A int 7 1 0.1% 1249-27delTA int 7 1 0.4% 1334G>A W401X 8 1 0.1% 1461ins4 9 5 0.4% 1471delA 9 2 0.2% 1607C>T S492F 10 2 0.3% 1609C>T Q493X 10 1 0.1% 1648_1653delATC I507del 10 3 0.4% 10 0.8% 1 0.4% 1652_1655del 3 bp F508del 10 582 74.8% 966 76.5% 226 81.3% 1690G>T V520F 10 4 0.3% 1717-1G>A int 10 8 1.0% 9 0.7% 1756G>T G542X 11 5 0.6% 8 0.6% 1779T>G S549R 11 1 0.1% 1784G>A G551D 11 29 3.7% 82 6.5% 27 9.7% 1789C>G R553G 11 1 0.1% 1789C>T R553X 11 3 0.4% 1 0.1% 1806delA 11 1 0.1% 1811G>A R560K 11 2 0.3% 1811G>C R560T 11 30 2.4% 2 0.7% 1819T>A Y563N 12 1 0.1% 1853C>A P574H 12 1 0.1% 1898+1G>A int 12 1 0.1% 2184delA 13 1 0.1% 1 0.1% 2184insA 13 1 0.1% 2622+1G>A int 13 1 0.1% 2 0.2% 2622+1G>T int 13 1 0.1% 2623-2A>G ** int 13 1 0.1% 2670G>A W846X2 14a 8 1.0% 2752-1G>T int 14a 1 0.1% 2752-26A>G int 14a 2 0.2% 2789+5G>A int 14b 6 0.8% 2966C>T S945L 15 2 0.3% 3007delG 15 4 0.3% 3040G>C G970R 15 1 0.1% 3062C>T S977F 16 1 0.1% 3120+1G>A int 16 1 0.1% 3272-26A>G int 17a 4 0.5% 2 0.2% 2 0.7% 3320dupli(CTATG) 17b 1 0.1% 3329G>A R1066H 17b 1 0.1% 3340C>T R1070W 17b 1 0.1% 3408C>A Y1092X 17b 7 0.9% 3442G>T E1104X 17b 1 0.1% 3446T>G ** M1105R 17b 1 0.1% 3586G>C D1152H 18 1 0.1% 3601-17T>C + 1367delC int 18 + 9 1 0.1% 3616C>T R1162X 19 1 0.1% 2 0.2% 3659delC 19 2 0.2% 3832A>G I1234V 19 2 0.3% 3849+4A>G int 19 1 0.1% 3849+10kbC>T int 19 3 0.2% 3877G>A G1249R 20 1 0.1% 3884G>A S1251N 20 1 0.1% 3898insC 20 1 0.1% 3905insT 20 2 0.3% 3978G>A W1282X 20 3 0.4% 4005+1G>A int 20 6 0.8% 4016insT 21 1 0.1% 4041C>G N1303K 21 11 1.4% 5 0.4% 4136T>C L1335P 22 1 0.1% 1 0.4% 4279insA 23 1 0.1% Unidentified Unidentified - 3 0.4% 41 3.2% 11 4.0% Total 778 100.0% 1262 100.0% 278 100.0% * All nucleotide changes correspond to cDNA numbering. Login to comment

PMID: 12939655 [PubMed] Perri F et al: "Mutation analysis of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, the cationic trypsinogen (PRSS1) gene, and the serine protease inhibitor, Kazal type 1 (SPINK1) gene in patients with alcoholic chronic pancreatitis."

No. Sentence Comment

33 Mutation screening of the CFTR gene The 31 most frequent mutations (F508del, I507del, G551D, G542X, N1303K, 1717-1G4A, W1282X, R553X, R347P, R347H, R334W, 3849+10kb C4T, R117H, 621+1G4T, A455E, S549N, R560T, S549R, V520F, Q493X, 3849+ 4A4G, 1078delT, R1162X, 3659delC, 3905insT, Y122X, 2183delAA4G, 2789+5G4A, 1898+1G4A, 711+1G4T, and G85E) were examined with the polymerase chain reaction (PCR) followed by an oligonucleotide ligation assay (OLA, Applied Biosystems, Foster City, CA, USA) and finally a sequence-coded separation. Login to comment

PMID: 12940920 [PubMed] Rowntree RK et al: "The phenotypic consequences of CFTR mutations."

No. Sentence Comment

176 The promoter mutation -102T → A has been found in association with S549R (T → G) (Romey et al. 1999). Login to comment
178 As the S549R mutation has previously been described as a 'severe` allele, associated with pancreatic insufficiency, it appears that cis- mutations can modulate the clinical phenotype. Login to comment

PMID: 14641997 [PubMed] Raskin S et al: "High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing."

No. Sentence Comment

63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes. Login to comment

PMID: 14685259 [PubMed] Lewis HA et al: "Structure of nucleotide-binding domain 1 of the cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

216 CF mutations in NBD1 The majority of sites of CF-causing missense mutations occur in NBD1, primarily in its a-subdomain, and the locations in the mNBD1 structure of the most common of these (A455E, G480C, I506T, DI507, DF508, S549N, S549R, G551D, A559T, R560T, Y569D, and D648V; Bobadilla et al, 2002) are shown in Figure 3D. Login to comment

PMID: 15084222 [PubMed] D'Apice MR et al: "Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy."

No. Sentence Comment

55 These mutations included S4X (143 C to A), exon 1; S42F (257 C to T), exon 2; R117L (482 G to T), exon 4; S549R (1779 T to G), exon 11; 3667ins4, exon 19; A1006E (3149 C to A), exon17a; L1065P (3326 T to C), R1066C (3328 C to T), L1077P (3362 T to C), exon 17b. Login to comment
77 Finally, in a single CF patient, we detected two different mutations [G542X (1756 G to T) and S549R (1779 T to G)] in the same exon 11-derived DNA amplicon, which showed a peculiar DHPLC pattern, different from that observed when only one of these mutations was present (data not show). Login to comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

PMID: 15173476 [PubMed] Comeau AM et al: "Population-based newborn screening for genetic disorders when multiple mutation DNA testing is incorporated: a cystic fibrosis newborn screening model demonstrating increased sensitivity but more carrier detections."

No. Sentence Comment

159 Genotypes and Frequencies Observed in 112 CF-Affected Infants First Mutation Second Mutation N ⌬F508 ⌬F508 55 ⌬F508 R117H 7* ⌬F508 G551D 4 ⌬F508 N1303K 3 ⌬F508 W1282X 3 ⌬F508 G542X 2 ⌬F508 1898 ϩ 1 G Ͼ A 2 G85E R117C 2 ⌬F508 1717-GϾA 1 ⌬F508 3849 ϩ 10kbC Ͼ T 1 ⌬F508 R1066C 1 ⌬F508 Y1092X 1 ⌬F508 L206W 1 ⌬F508 R560T 1 ⌬F508 1152H 1 ⌬F508 621 ϩ 1G Ͼ T 1 R117H G551D 1 R117H G85E 1 G551D 2789 ϩ 5GϾA 1 G551D R117C 1 G85E 711 ϩ 1GϾT 1 W1282X 3849 ϩ 10kbCϾT 1 R553X 2183AAϾG 1 A455E S549R 1 ⌬F508 Unknown† 13 N1303K Unknown 2 G542X Unknown 1 Unknown Unknown 2 * Includes 1 of the false-negative screens. Login to comment
171 ࿣ Presumed second CFTR mutation: 2183AAϾG, R117C (2), S549R, and "not present in additional mutation analysis and yet to be identified" (2). Login to comment

PMID: 15334505 [PubMed] Picard E et al: "Familial concordance of phenotype and microbial variation among siblings with CF."

No. Sentence Comment

71 A (1), S549R/S549R (1), Q359K/Q360K (1), DF508/Unknown (4), W1282X/Unknown (3), G542X/Unknown (2), G85E/Unknown (1), and Q359K/ Unknown (1). Login to comment

PMID: 15371903 [PubMed] Sugarman EA et al: "CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations."

No. Sentence Comment

35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment

PMID: 15371908 [PubMed] Buyse IM et al: "Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation."

No. Sentence Comment

77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment

PMID: 15638824 [PubMed] Castaldo G et al: "Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population."

No. Sentence Comment

5 The haplotype analysis of three intragenic polymorphisms (IVS8CA, IVS17bTA and IVS17bCA) compared with data from other studies revealed that several mutations (3849+10kbC>T, 1717-1G>A, E585X, 3272-26G>A, L558S, 2184insA and R347P) originated from multiple events, whereas others (R1158X and S549R) could be associated with one or more intragenic recombinant events. Login to comment
62 A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n. Login to comment
109 Genetists Table 4 Mutations linked to different haplotypes due to recombinant or recurrent events, characteryzed at the level of three CFTR intragenic loci (IVS8CA, IVS17bTA, IVS17bCA) Present study Other studies Cases Haplotype Cases Haplotype (n) (n. of repeats) (n) (n. of repeats) references* I148T and 3195del6 2/2 23-7-17 3 23-7-17 2,3 (in cis) I148T 1/1 23-32-13 S549R (A>C) 1/1 23-33-13 1 16-33-13 2 1717-1G>A 13/13 16-7-17 23 16-7-17 1,2,3 2 16-30-13 1 1 16-32-13 1 R1158X 6/6 16-7-17 1/2 16-7-17 2 1/2 6-45-13 2 1/1 16-31-13 3 1/1 16-45-13 3 3849 +10kbC>T 5/5 23-31-13 2 23-31-13 1 1 16-14-31 4 1 16-7-17 1 3 16-46-13 2 1 16-17-19 2 1 17-31-13 2 E585X 2/2 16-7-17 1 16-32-13 2 1 17-31-13 2 1 16-7-16 see 2 3272-26G>A 1/1 15-7-17 1 16-32-13 1 4 16-7-17 5 L558S 1/1 16-32-13 1 16-32-13 1 1 15-7-17 1 2184 ins A 1/1 16-29-13 1 16-45-13 1 1 16-7-17 1 1 16-24-13 3 * References 1: Morral et al. 1996b. Login to comment

PMID: 15672947 [PubMed] Augarten A et al: "Systemic inflammatory mediators and cystic fibrosis genotype."

No. Sentence Comment

5 Group A included 25 patients who carried two mutations associated with a pathological sweat test and pancreatic insufficiency (∆F508, W1282X, G542X, N1303K, S549R). Login to comment
28 Group A included 25 patients who carried two mutations associated with a pathological sweat test and pancreatic insufficiency (∆F508, W1282X, G542X, N1303K, S549R) [2]. Login to comment
67 : Systemic inflammatory mediators and cystic fibrosis genotype 101 Table 1 Clinical characteristics of cystic fibrosis (CF) patients Group Aa (n=25) Group Bb (n=11) P Age (years) 16.9±7.2 17.7±9.1 NS Pancreatic sufficiency 0% 0/25 36.3% 4/11 <0.01 Sweat chloride (mmol/l) 105±28 92±18.6 NS Weight percentiles 19±19.8 57.2±25.2 <0.01 Sputum Pseudomonas 88% 22/24 40% 4/10 <0.01 a Group A CF patients carrying two mutations associated with severe disease presentation (∆F508, W1282X, G542X, N1303K, S549R) b Group B CF patients carrying mutations associated with mild disease presentation (3849+10kb CǞT, 5T) Table 2 Comparison of serum chemokine levels between groups (IL-8 interleukin-8, MCPI monocyte chemoattractant protein-1) Chemokine Group Aa Group Bb P IL-8 (pg/ml) 11.4±2.1 5.0±0.9 0.01 MCP1(pg/ml) 157±16 88.8+16.4 0.01 RANTES (pg/ml) 323±48 287.5±93 NS a Group A CF patients carrying two mutations associated with severe disease presentation (∆F508, W1282X, G542X, N1303K, S549R) b Group B CF patients carrying mutations associated with mild disease presentation (3849+10kb CÞT, 5T) Fig. 1 Relationship between interleukin-8 (IL-8) levels and forced expiratory volume in 1 s (FEV1) values defective protein production; class II, defective protein processing; class III, defective chloride channel regulation; and class IV, defective chloride channel conduction. Login to comment

PMID: 15880796 [PubMed] Kerem E et al: "Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy."

No. Sentence Comment

58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

PMID: 15948195 [PubMed] Quint A et al: "Mutation spectrum in Jewish cystic fibrosis patients in Israel: implication to carrier screening."

No. Sentence Comment

25 MUTATION ANALYSIS The following mutations are routinely tested in Jewish patients: the Ashkenazi founder mutations, DF508, W1282X, N1303K, G542X, 3849 þ 10 kb C!T, 1717-1G > A [Abeliovich et al., 1992], mutations commonly found in non-Ashkenazi patients, S549R (T!G), G85E, 405 þ 1G!A, W1089X, Y1092X, D1152H. Login to comment
58 Mutations in the CF Bearing Alleles in the Jewish Patients According to the Ethnic Origin Country of origin Ashkenazi Morocco Tunisia Balkan Iraq Iran/ Kurdistan Georgia Yemen Total Number of alleles (%) 193 (69.0) 34 (12.1) 12 (4.3) 21 (7.5) 8 (2.8) 3 (0.7) 8 (2.8) 2 (0.7) 281 W1282X (%) 83 (42.8) 1 (8.3) 4 (19.0) 88 (31.3) DF508 (%) 65 (33.5) 24 (70.6) 3 (25.0) 7 (33.3) 1 100 (35.6) N1303K (%) 10 (5.2) 10 (3.6) G542X (%) 19 (10.3) 4 (19.0) 24 (8.5) 3849-10 kbC!T (%) 10 (5.1) 1 (2.9) 2 (9.5) 13 (4.6) 1717-1G!A (%) 2 (1.0) 2 (0.7) D1152H (%) 1 (0.5) 1 (0.4) S549R (T!G) (%) 4 (11.8) 4 (1.4) G85E (%) 2 (9.5) 2 (0.7) 405 þ 1G!A (%) 8 (66.7) 8 (2.8) Y1092X (%) 3 (37.5) 3 (1.1) W1089X (%) 2 (9.5) 2 (0.7) Q359K/T360K (%) 8 (100) 8 (2.8) I1234V (%) 2 (100) 2 (0.7) 2751 þ 1insT (%) 2 (25.0) 2 (0.7) 3121-1G > A (%) 1 1 (0.4) M952I (%) 1 (12.5) 1 (0.4) L165S (%) 1 (0.5) 1 (0.4) A455E (%) 1 (0.5) 1 (0.4) L997F (%) 1 (2.9) 1 (0.4) G1244E (%) 1 (2.9) 1 (0.4) Unkown (%) 1 (0.5) 3 (8.8) 2 (25.0) 1 7 (2.5) Mutation Spectrum in Jewish CF Patients [Wahab, 2003]. Login to comment
69 We suggest that 15 mutations that were found on two or more CF chromosomes from unrelated patients (DF508, W1282X, N1303K, G542X, 3849 þ 10 kb C!T, 1717-1 G!A, S549R (T!G), G85E, 405 þ 1G!A, W1089X, Y1092X, 2751 þ 1insT, 3121-1G!A, Q359K/T360K, I1234V) be tested in the CF screening of all Jewish individuals regardless of their origin. Login to comment

PMID: 16088579 [PubMed] Gallati S et al: "Genetics of cystic fibrosis."

No. Sentence Comment

67 SSCP analysis is one of the most popular methods for the detection of sequence variants in polymerase chain reaction (PCR) amplified DNA fragments.29 The princi- Table 3 Cystic Fibrosis Mutations Detected by Commercial Kits INNO-LiPA Mutations CF2 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K CFTR12 ⌬F508, ⌬I507, G542X, 1717-1G→A, G551D, R553X, W1282X, N1303K, S1251N, R560T, 3905insT, Q552X CFTR17+Tn 394delTT, G85E, 621+1G→T, R117H, 1078delT, R347P, R334W, E60X, 2183AA→G, 2184delA, 711+5G→A, 2789+5G→A, R1162X, 3659delC, 3849+10kbC→T, 2143delT, A455E, (5T/7T/9T) Elucigene CF4 ⌬F508, G542X, G551D, 621+1G→T CF12 ⌬F508, G542X, G551D, N1303K, W1282X, 1717-1G→A, R553X, 621+1G→T, R117H, R1162X, 3849+10kbC→T, R334W CF20 1717-1G→A, G542X, W1282X, N1303K, ⌬F508, 3849+10kbC→T, 621+1G→T, R553X, G551D, R117H, R1162X, R334W, A455E, 2183AA→G, 3659delC, 1078delT, ⌬I507, R345P, S1251N, E60X CF Poly-T 5T/7T/9T OLA CF OLA assay ⌬F508, F508C, ⌬I507, Q493X, V520F, 1717-1G→A, G542X, G551D, R553X, R560T, S549R, S549N, 3849+10kbC→T, 3849+4A→G, R1162X, 3659delC, W1282X, 3905insT, N1303K, G85E, 621+1G→T, R117H, Y122X, 711+1G→T, 1078delT, R347P, R347H, R334W, A455E, 1898+1G→A, 2183AA→G, 2789+5G→A b Figure 2 Mutation screening of exon 19 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene using polymerase chain reaction (PCR) followed by single-strand conformation polymorphism/heteroduplex (SSCP/HD) analysis on a silver-stained polyacrylamide gel. Login to comment

PMID: 16126774 [PubMed] Morea A et al: "Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility."

No. Sentence Comment

47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T. Login to comment

PMID: 16132229 [PubMed] Eudes R et al: "Nucleotide binding domains of human CFTR: a structural classification of critical residues and disease-causing mutations."

No. Sentence Comment

165 However, S549R (labeled M in fig. 2), which also involves a residue of the NBD1 ABC signature participating in the binding of the ATP γ-phosphate in the conventional site B, was identified as a class II mutation (fig. 1). Login to comment

PMID: 16435054 [PubMed] Zilfalil BA et al: "Detection of F508del mutation in cystic fibrosis transmembrane conductance regulator gene mutation among Malays."

No. Sentence Comment

55 MUTATIONS R553X G551D 1507 del F508 del 1717-1 G>A G542X R560T R347P W1282X R334W 1078 Del T 3849 + 10KB C>T R1162X N1303K 3659 Del C A455E R117H 2183 AA>G 2789+5 G>A 1898 +1 G>A 621+1 G>T 711+1 G>T G85E S549N S549R V520F Q493X R347H 3849 +4 A>G 3905 INS T Y122X 4 software before running the gel electrophoresis in 1X TBE using ABI PRISM® 377 Genetic Analyzer (Applied Biosystems, USA) for 45 minutes. Login to comment

PMID: 16778595 [PubMed] Sun W et al: "CFTR 5T variant has a low penetrance in females that is partially attributable to its haplotype."

No. Sentence Comment

55 These mutations include R347H, S549N, S549R, 3876delA, 394delT, 3905insT, and V520F, in addition to the 25-mutation core panel recommended by ACMG/ACOG for population-based CF screening. Login to comment

PMID: 16837565 [PubMed] Cabello GM et al: "Polymorphic markers suggest a gene flow of CFTR gene from Sub-Saharan/Arabian and Mediterranean to Brazilian Population."

No. Sentence Comment

23 A previous screening of the whole coding region and flanking intronic sequences from the 23 exons of the CFTR gene in 190 chromosomes allowed us to identify 11 different mutations: DF508 (28.4%), G85E (4.7%), 3120 þ 1G / A (3.7%), R334W (2.6%), G542X (2.1%), P205S (1.0%), G551D (0.5%), R1162X (0.5%), Y1092X (0.5%), S549R (0.5%), and S4X (0.5%) (Cabello GMK, Cabello PH, Otsuki, and others 2005). Login to comment

PMID: 16840743 [PubMed] Wilschanski M et al: "Mutations in the cystic fibrosis transmembrane regulator gene and in vivo transepithelial potentials."

No. Sentence Comment

68 One exception, a man in the CBAVD-2 group, carried ⌬F508 with a rare missense mutation (S549R), which has been observed in a CF-PI patient (35). Login to comment

PMID: 17949287 [PubMed] Lebo RV et al: "One multiplex control for 29 cystic fibrosis mutations."

No. Sentence Comment

229 The nine normal sequences detected at other tested mutation sites (3876delA; S1255X; 2307insA; 1898ϩ5G Ǟ T; S549R; S549N; V520F; Y122X; and 394delTT) reflected the correct sequence in this mixture of nine cloned sequences. Login to comment

PMID: 18301294 [PubMed] Augarten A et al: "The changing face of the exocrine pancreas in cystic fibrosis: the correlation between pancreatic status, pancreatitis and cystic fibrosis genotype."

No. Sentence Comment

23 The mutations DF508, W1282X, G542X, S549R, Q359K/T360K, 405 + 1G, 1717, and N1303K were defined as severe and the mutations 3849 + 10 kb, D1152H, G85E, I1234V, R334W, and 5T were defined as mild/variable. Login to comment
46 of patients W1282X/3849 + 10 kb 15 W1282X/5T 15 DF508/5T 7 DF508/D1152H 6 DF508/3849 + 10 kb 5 W1282X/D1152H 5 W1282X/I1234V 2 3849 + 10 kb/405 + 1G- > A 2 R334W/R334W 2 5T/5T 2 D1152H/D1152H 1 D1152H/5T 1 D1152H/3849 + 10 kb 1 DF508/UKN 13 W1282X/UKN 11 5T/UKN 7 D1152H/UKN 3 1717/UNK 1 G85E/UKN 1 Q359K/T360K/UKN 1 S549R/UKN 1 3849 + 10 kb/UKN 1 UKN/UKN 36 CF, cystic fibrosis; CFTR, cystic fibrosis transmembrane regulator. Login to comment

PMID: 19645745 [PubMed] Shah U et al: "Cystic fibrosis: defining a disease under-diagnosed in Pakistan."

No. Sentence Comment

29 For example, S549N (G>A) homozygosity previously reported from a Pakistani family has also been associated with significant disease, while in contrast another patient with a compound heterozygote mutation, S549R / R1158X gene, presented with a mild form of CF (Frossard et al. 1999; Romey et al. 1999). Login to comment
51 Common mutations such as DF508, S549R, S549N, Y569D, 296 + 12(T>C), R553X, G551D and G551X were screened by allele-specific polymerase chain reaction using published oligonucleotide sequences as template primers (Kerem et al. 1989; Riordan et al. 1989; Rommens et al. 1989; : Collins 1992b). Login to comment
60 The remaining 150 samples were tested by PCR for DF508, S549N, S549R, Y569D, 296 + 12(T>C), R553X, G551D, G551X (Table 1). Login to comment
81 These mutations were S549N, S549R, Y569D, 296 + 12(T>C), R553X, G551D and G551X. Login to comment
84 Some of the common mutations detected on PCR in our study, such as the S549N and S549R, were not confirmed by sequencing. We did confirm the results of one patient who was a compound heterozygote for the DF508 / S549N Table 1 Frequencies of mutations identified by allele specific PCR Mutations Homozygous Heterozygous delF508 12 14 S549N 0 1 S549R 1 19 Y569D 0 0 296 + 12(T>C) 0 0 R553X 0 0 G551D 0 0 G551X 0 0 Table 2 Mutations identified by sequencing Exon Sequenced (n) Mutations identified (n) Exon 10 87 4 Exon 11 43 1 Exon 12 29 0 Tropical Medicine and International Health volume 14 no 5 pp 542-545 may 2009 U. Shah et al. Cystic fibrosis in Pakistan ª 2009 Blackwell Publishing Ltd mutation and had very aggressive disease. Login to comment

PMID: 19812525 [PubMed] de Cid R et al: "Independent contribution of common CFTR variants to chronic pancreatitis."

No. Sentence Comment

38 Scanning Methodology Applied in CFTR Gene Analysis Amplicon Name Fragment Size, bp Control Set (n = 93) Patient Set 1 (n = 68) Patient Set 2 (n = 68) Control Sequence Exon 1 192 SSCP/HD SSCP/HD dHPLC 125G9C Exon 2 334 SSCP/HD SSCP/HD dHPLC 296+3insT Exon 3 309 DGGE DGGE dHPLC G85V Exon 4 436 SSCP/HD SSCP/HD dHPLC R117H Exon 5 466 DGGE DGGE dHPLC R170H Exon 6a 345 SSCP/HD SSCP/HD dHPLC L206W Exon 6b 331 SSCP/HD SSCP/HD SSCP/HD TTGA 6/7 Exon 7 410 SSCP/HD SSCP/HD dHPLC R334W Exon 8 328 DGGE DGGE dHPLC 1341+28C9T Exon 9 375 DGGE DGGE DGGE 7T/9T Exon 10 493 SSCP/HD SSCP/HD SSCP/HD F508del; 1540A/A Exon 11 322 DGGE DGGE dHPLC S549R Exon 12 426 DGGE DGGE dHPLC G576A Exon 13a 532 SSCP/HD SSCP/HD dHPLC R668C Exon 13b 498 SSCP/HD SSCP/HD dHPLC I807M Exon 14a 284 DGGE DGGE DGGE 2694T9G Exon 14b 211 DGGE DGGE dHPLC 2789+5G9A Exon 15 487 DGGE DGGE dHPLC D924N Exon 16 294 SSCP/HD SSCP/HD dHPLC 3041-71G9C Exon 17a 294 SSCP/HD SSCP/HD dHPLC L997F Exon 17b 463 DGGE DGGE dHPLC 3272-26A9G Exon 18 451 DGGE DGGE dHPLC N1148K Exon 19 588 SSCP/HD SSCP/HD SSCP/HD 3601-65C9A Exon 20 471 DGGE DGGE dHPLC W1282X Exon 21 477 DGGE DGGE DGGE 4029G9A Exon 22 339 SSCP/HD SSCP/HD dHPLC Q1352H Exon 23 249 DGGE DGGE dHPLC 4374+13A9G Exon 24 362 SSCP/HD SSCP/HD SSCP/HD 4521G9A Control set, general population series analyzed; patient set 1, previous patient series reported in 2004; and patient set 2, new patient series analyzed in this study. Login to comment

PMID: 19843100 [PubMed] Burgel PR et al: "Non-classic cystic fibrosis associated with D1152H CFTR mutation."

No. Sentence Comment

42 The CF genetic analysis panel used in France seeks for 32 mutations: G85E, 394delTT, 621+1G>T, 711+1G>T, R334W, R347P, R347H, 1078delT, 5T/7T/9T, A455E, F508del, I507del, V520F, 1717-1G>A, G542X, G551D, R553X, R560T, S549R (T>G), S549N, 1898+1G>A, 2183AA>G, 2184delA, 2789+5G>A, 3120+1G>A, R1162X, 3659delC, 3849+10kbC>T, W1282X, 3905insT, 3876delA, N1303K. Login to comment

PMID: 19897426 [PubMed] Picci L et al: "A 10-year large-scale cystic fibrosis carrier screening in the Italian population."

No. Sentence Comment

48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT. Login to comment

PMID: 20059485 [PubMed] Dorfman R et al: "Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?"

No. Sentence Comment

64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

PMID: 20108119 [PubMed] Joergensen M et al: "Incidence, prevalence, etiology, and prognosis of first-time chronic pancreatitis in young patients: a nationwide cohort study."

No. Sentence Comment

49 1G [ T, F508del, S549 N, I507del, S549R, 2184delA, G551D, G85E, N1303 K, R560T, R117H, R347H, R347P, R334 W, 2789 ? Login to comment

PMID: 20932301 [PubMed] Green DM et al: "Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients."

No. Sentence Comment

74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

PMID: 21228336 [PubMed] Brown MB et al: "Low abundance of sweat duct Cl- channel CFTR in both healthy and cystic fibrosis athletes with exceptionally salty sweat during exercise."

No. Sentence Comment

114 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X. Login to comment
119 Mutations tested in this panel were ⌬F508, R334W, S549N, 3659delC, ⌬I507, I347P, A559T, S1255X, 1898ϩ1GϾA, R347H, N1303K, 1898ϩ5GϾT, 3876delA, A455E, 394delTT, 2183GGϾA, 3905insT, 3120ϩ1GϾA, V520F, 2184delA, G85E, Y1092X, 711ϩ1GϾT, 2307insA, Y122X, S549R, M1101K, 1078delT, 2789ϩ5GϾA, G551D, G542X, 621ϩ1GϾT, R560T, W1282X, 1717-1 GϾA, 3849 ϩ 10KbCϾT, R553X, R117H, and R1162X. Login to comment

PMID: 21429822 [PubMed] Coiana A et al: "Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program."

No. Sentence Comment

88 Mutation nomenclaturea Alleles (%) T338I (p.Thr338Ile) 26 (65.0) F508del (p.Phe508del) 9 (22.5) N1303K (p.Asn1303Lys) 1 (2.5) 2183AANG (c.2051_2052delAAinsG) 1 (2.5) 621+1GNT (c.489+1GNT) 1 (2.5) exon 2 del (c.54-5811_164+2187del8108ins182) 1 (2.5) R347P (p.Arg347Pro) 1 (2.5) The 3849+10kbCNT (c.3717+12191CNT), G85E (p.Gly85Glu), 2789+5GNA (c.2657+5GNA), W1282X (p.Trp1282X), G1244E (p.Gly1244Glu), 711+5GNA (c.579+5GNA), 711+1GNT (c.579+1GNA), 4016insT (p.Ser1297PhefsX5), G542X (p.Gly542X), 1717-1GNA (c.1585-1GNA), R553X (p.Arg553X), Q552X (p.Gln552X), G551D (p.Gly551Asp), S549R (ANC) (p.Ser549Arg), I507del (p.Ile507del), F508C (p.Phe508Cys), I502T (p.Ile502Thr), 1706del17 (p.Gln525LeufsX37), 1677delTA (p.Tyr515X), R117H (p.Arg117His), D1152H (p.Asp1152His), L1065P (p.Leu1065Pro), R1066H (p.Arg1066His), L1077P (p.Leu1077Pro), 4382delA (p.Glu1418ArgfsX14), R1162X (p.Arg1162X), R1158X (p.Arg1158X), 1259 insA (p.Gln378AlafsX4), 852del22 (p.Gly241GlufsX13), S912X (p.Ser912X), and 991del5bp (p.Asn287LysfsX19) mutations included in the CF panel were not detected in the population tested. Login to comment

PMID: 21474639 [PubMed] Rohlfs EM et al: "Cystic fibrosis carrier testing in an ethnically diverse US population."

No. Sentence Comment

127 Eighteen different mutations were identified in Ashkenazi Jewish individuals; 5 non-ACMG mutations (p.D1152H, c.54-5940_273ϩ10250del21kb, p.S549R, p.W1089X, p. Login to comment

PMID: 21538969 [PubMed] Ren CL et al: "Clinical outcomes in infants with cystic fibrosis transmembrane conductance regulator (CFTR) related metabolic syndrome."

No. Sentence Comment

60 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1-CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected. Login to comment
61 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1- CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected. Login to comment

PMID: 21809164 [PubMed] Rittenhouse DW et al: "Subject Review: Pancreatic Ductal Adenocarcinoma in the Setting of Mutations in the Cystic Fibrosis Transmembrane Conductance Regulator Gene: Case Report and Review of the Literature."

No. Sentence Comment

84 Klapman et al. suggested screening those patients that have two or more first degree relatives with PDA as Year Author Number of patients Average age (years) Pathology Genotype 2001 Malats 9 66.5 PDA 3 ΔF508 6 5T Allele 2003 Pezzilli 1 73.8 PDA 5T Allele 2003 Matsubayashi 42 Not reported PDA 6 ΔF508 36 5T Allele 2006 Piepoli 3 63 PDA 3 ΔF508 2010 Rebours 1 52 IPMN with PanIN-2 2789+G>A/5T Allele 2010 McWilliams 50 67 PDA 35 ΔF508 5 R117H 5 W1282X G551D N1303K R347 P S549R Δ1507 2011 Present Study 1 77 PDA W1282X Table 2 Patients with pancreatic tumors and heterozygous mutations in the CFTR gene CFTR cystic fibrosis transmembrane regulator, PDA pancreatic ductal adenocarcinoma, ΔF508 Delta F508, IPMN intraductal papillary mucinous neoplasm, PanIN-2 pancreatic intraepithelial neoplasia-2 well as those with a family history of any of the known hereditary pancreatic cancer syndromes such as familial adenomatous polyposis, hereditary nonpolyposis colorectal cancer syndrome, hereditary pancreatitis, hereditary breast/ ovarian cancer syndrome, Peutz-Jeghers syndrome, and familial atypical multiple mole and melanoma syndrome.24 It might be worthwhile for those patients with a family history of CF and who have other risk factors such as smoking and obesity, who are known carriers of any of the more disease-associated mutations (i.e., ΔF508, W1282X) to be screened for PDA. Login to comment

PMID: 9781062 [PubMed] Dequeker E et al: "Evaluation of CFTR gene mutation testing methods in 136 diagnostic laboratories: report of a large European external quality assessment."

No. Sentence Comment

144 A fifth laboratory reported the presence of S549R instead of 1717-1 GtoA, based on the results of DGGE with GC-clamps, and confirmation by sequencing. Login to comment
155 Table 6 Detailed genotyping results of the DNA samples included in the quality control trial No. of Sample Allele 1 Allele 2 laboratories Method used CF96-1 dF508 N1303K 119 dF508/N1303K dF508 - 13 dF508 or dI507 N1303K 1 dF508 or dI507 - 1 dF508 wild 1 Inno-Lipa CF2 dF508 dF508 1 Heteroduplex Analysis/ARMS CF96-2 dI507 wild 93 dI507/wild - wild 17 dI507 or dF508 wild 3 dF508 wild 17 13 ´ Heteroduplex analysis 1 ´ allele specific PCR 1 ´ GeneScan analysis 1 ´ ASO reverse dot blot wild wild 1 administration error (Inno-Lipa CF2) dI507 N1303K 1 home-made line probe assay dI507 dF508 4 3 ´ Inno-Lipa CF2 1 ´ method not specified CF96-3 dF508 G551D 120 dF508/G551D dF508 - 7 dF508 G551D or R553X 1 dF508/dI507 G551D 2 broken tube 1 dF580 R553X 2 Restriction enzyme analysis dF508 R553X and G551D 2 1 ´ Restriction enzyme analysis 1 ´ RFLP dF508 2183AAtoG 1 ASO dot blot CF96-4 dF508 621+1 GtoT 53 dF508/621+1GtoT dF508 - 73 dF508 or dI507 621+1 GtoT 1 dF508 or dI507 - 1 wild 621+1 GtoT 1 dF508 wild 4 1 ´ SSCP 1 ´ RFLP 1 ´ home-made reverse dot blot 1 ´ Restriction enzyme analysis dF508 R553X 2 1 ´ SSCP 1 ´ Reverse dot blot dF508 R553X/3849+4 AtoG 1 1 ´ Restriction/enzyme analysis CF96-5 R553X wild 115 R553X/wild - wild 8 R553X or G551D wild 2 No amplification 5 G553X wild 2 administration error wild wild 2 1 ´ ARMS 1 ´ Restriction enzyme analysis R553X 621+1 GtoT 1 RFLP R553X 3849+10kb LtoT 1 Restriction enzyme analysis/ sequencing CF96-6 1717-1 GtoA wild 99 1717-1 GtoA/wild - wild 30 1717-1 GtoA 1717-1 GtoA 3 3 ´ Inno-Lipa CF2 W1717 wild 1 SSCP wild wild 1 Restriction enzyme analysis S549R wild 1 DGGE 1717+1 GtoA wild 1 ARMS administration error almost half of all laboratories. Login to comment

PMID: 9917439 [PubMed] Wilschanski M et al: "Clinical and genetic risk factors for cystic fibrosis-related liver disease."

No. Sentence Comment

117 Classification of Identified Genotype According to Severity of Disease Severe n Milder n Variable n Unclassified n ⌬F508/⌬F508 52 3849 ϩ 10kbC 3 T/⌬F508 7 ⌬F508/G85E 1 S549R/S549R 1 W1282X/W1282X 30 3849 ϩ 10kbC 3 T/405 ϩ 1G3A 3 G85E/G85E 5 S549R/G542X 2 ⌬F508/W1282X 39 3849 ϩ 10 kbC 3 T/W1282X 7 G85E/5T 1 S549R/W1282X 1 ⌬F508/G542X 10 3849 ϩ 10kbC 3 T/G85E 1 ⌬F508/5T 1 ⌬F508/W1089X 1 W1282X/G542X 12 W1282X/5T 2 Y1092X/Y1092X 1 W1282X/N1303K 7 W1282X/5T 1 Q359K-T360K/? Login to comment

PMID: 7914197 [PubMed] Hoof T et al: "Cystic fibrosis-type mutational analysis in the ATP-binding cassette transporter signature of human P-glycoprotein MDR1."

No. Sentence Comment

25 Besides the major mutationAF508, a cluster of missense mutations resides in the linker peptide(Fig. 1).AF508, S549R (Keremet al., 1990; Sangiuloet al.,19911,and G551D (Cuttingetal., 1990;Hamosh et al., 1992)were identified in patients withtypical pulmonary andgastrointestinalmanifestations of CFdiseasewhereas R553Q has been foundon the complex allele AF508-R553Qin a Cystic Fibrosis GeneticAnalysis Consortium,personal communication. Login to comment
163 CFTR S549R and G551D are severe CF mutations(Kerem et al., 1990;Sanguiolo et al., 1991; Hamosh et al., 1992). Login to comment

PMID: 12938099 [PubMed] Keyeux G et al: "CFTR mutations in patients from Colombia: implications for local and regional molecular diagnosis programs."

No. Sentence Comment

8 The results of this pilot study in Colombian patients from various ethnic admixture show six main mutations: p.F508del (41.8%), c.1811+1.6kbA>G (6.5%), p.G542X (3.8%), p.S549R (2.2%), p.W1282X (1.1%) and p.R1162X (1.1%). Login to comment
43 The fourth mutation is p.S549R (T to G at position 1779), present on 4 chromosomes (2.2%). Login to comment
50 CFTR Mutation Frequencies in Colombian Cystic Fibrosis Patients MUTATION ANTIOQUIA BOGOTA BOLIVAR CALDAS VALLE OTHER COLOMBIA n=34 n=76 n=20 n=10 n=24 n=20 n=184 N (%) N (%) N (%) N (%) N (%) N (%) N (%) p.F508del 16 (47.1) 31 (40.8) 5 (25) 6 (60.0) 10 (41.7) 9 (45.0) 77 (41.8) c.1811+1.6KbA>G 0 8 (10.5) 2 (10.0) 0 1 (4.2) 1 (5.0) 12 (6.5) p.G542X 0 4 (5.3) 0 0 2 (8.3) 1 (5.0) 7 (3.8) p.S549R 1 (2.9) 3 (3.9) 0 0 0 0 4 (2.2) p.W1282X 0 1 (1.3) 0 0 1 (4.2) 0 2 (1.1) p.R1162X 0 0 2 (10.0) 0 0 0 2 (1.1) p.A559T 1 (2.9) 0 0 0 0 0 1 (0.5) p.Y1092X 0 0 1 (5.0) 0 0 0 1 (0.5) p.R334W 0 0 0 0 1 (4.2) 0 1 (0.5) c.1215delG 0 1 (1.3) 0 0 0 0 1 (0.5) c.2185_2186insC 0 0 0 0 0 1 (5.0) 1 (0.5) c.2789+5G>A 0 0 0 0 1 (4.2) 0 1 (0.5) c.3120+1G>A 0 0 1 (5.0) 0 0 0 1 (0.5) c.3849+1G>A 0 1 (1.3) 0 0 0 0 1 (0.5) p.R1066C 0 1 (1.3) 0 0 0 0 1 (0.5) p.N1303K 1 (2.9) 0 0 0 0 0 1 (0.5) c.3500-2A>G* 1 (2.9) 0 0 0 0 0 1 (0.5) c.1323_1324insA* 0 0 1 (5.0) 0 0 0 1 (0.5) p.H609R* 0 0 0 0 0 1 (5.0) 1 (0.5) Unidentified 14 (41.2) 26 (34.2) 8 (40.0) 4 (40.0) 8 (33.3) 7 (35) 67 (36.4) The regions of the country where few patients were studied are grouped as other. Login to comment
69 Comparison of the Spectrum of CFTR Mutations in Colombia and Other Ibero-American Countries COLOMBIA1 SPAIN2 MEXICO3 ARGENTINA4 BRAZIL5 MUTATION n=92 n=1356 n=194 n=228 n=272 % % % % % p.F508del 41.8 54.42 40.72 57 45.6 p.G542X 3.8 7.7 6.18 3.94 6.6 p.W1282X 1.1 0.5 0 3.07 2.2 p.R1162X 1.1 1.3 0 0.43 4.4 p.N1303K 0.5 2.5 2.06 1.75 2.9 c.1811+1.6KbA>G 6.5 1.5 0 0.43 0 p.S549R 2.2 0.07 0 0 0 p.A559T 0.5 0 0 0 0 p.Y1092X 0.5 0.01 0.51 0 0 p.R334W 0.5 0.9 0 0 2.9 c.1215delG 0.5 0 0 0 0 c.2185_2186insC 0.5 0 0 0 0 c.2789+5G>A 0.5 0.7 0 0.43 0 c.3120+1G>A 0.5 0 0 0 0 c.3849+1G>A 0.5 0 0 0 0 p.R1066C 0.5 0.7 0 0.43 0 c.3500-2A>G (novel) 0.5 0 0 0 0 c.1323_1324insA (novel) 0.5 0 0 0 0 p.H609R (novel) 0.5 0 0 0 0 Other a (# mutations) - (32) 1.8 (30) 5.28 (9) 4.89 (8) 6.98 Unknown 36.4 17.9 25.25 27.63 28.3 a The frequencies of the other rare mutations found in Spain, Mexico, Argentina and Brazil are pooled together, and the number of different mutations is given in parenthesis. Login to comment

PMID: 15744523 [PubMed] Clain J et al: "A neutral variant involved in a complex CFTR allele contributes to a severe cystic fibrosis phenotype."

No. Sentence Comment

105 The sequence change À102T fi A attenuates the effects of the severe p.S549R (T fi G) missense mutation by causing a significant increase in CFTR expression in vitro. Login to comment
106 This explains the striking differences in genotype-phenotype correlations between patients carrying mutation p.S549R alone, who presented severe disease, and patients carrying the complex allele [À102T fi A; p.S549R], who exhibit milder forms of CF (Romey et al. 2000). Login to comment

PMID: 17331079 [PubMed] Alonso MJ et al: "Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry."

No. Sentence Comment

52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4. Login to comment
67 Seven other complex alleles were observed: [c.296 + 3insT; p.V754M], [p.F508del; p.I1027T], [p.S549R; -102T > A], [p.G576A; p.R668C], [p.R1070W; p.R668C], [p.D1270N; p.R74W] and [p.T1299I; p.I148T]. Login to comment
105 Our impression is that Table 3 Common CF mutations identified in this study and in several Latin American populations Mutation This study Hispanic1 Mexico2 Colombia3 Brazil4 Argentina5 Chile6 p.F508del 51.7 51.6 40.7 41.8 48.4 58.6 45.0 p.G542X 7.7 4.0 6.2 3.8 8.8 4.1 7.0 p.N1303K 2.9 0.8 2.0 0.5 2.5 2.7 - c.1811 + 1,6kbA > G 1.8 - - 6.5 - 0.9 - p.R334W 1.8 1.6 - 0.5 2.5 1.1 2.0 p.L206W 1.6 - - - 0.6 - - c.711 + 1G > T 1.6 - - - - - - p.Q890X 1.4 - - - - - - p.R1162X 1.3 0.8 - 1.1 2.5 0.4 2.0 c.2789 + 5G > A 1.2 - - 0.5 0.3 0.7 - p.R1066C 1.2 1.6 - 0.5 - 0.2 - p.I507del 1.0 - 2.6 - - 0.7 - c.2183AA > G 0.8 - 1.0 - 0.2 - p.G85E 0.7 0.8 0.5 - 1.3 0.7 - p.W1282X 0.7 0.8 - 1.1 1.3 2.7 5.0 c.3849 + 10kbC > T 0.4 4.0 0.5 - - 0.9 3.0 p.S549N - 2.4 2.6 - - - - c.3120 + 1G > A - 1.6 - 0.5 - - - c.3876delA - 5.6 - - - - - c.406-1G > A - 1.6 1.5 - - - - c.935delA - 1.6 1.0 - - - - p.R75X - 0.8 1.5 - - - - c.2055del9 - - 1.0 - - - - p.I506T - - 1.0 - - - - c.3199del6 - - 1.0 - - - - p.S549R 0.4 - - 2.2 - 0.2 - c.1717-1G > A 0.2 - - - 0.3 1.1 - p.G551D 0.2 0.8 0.5 - - - 1.0 p.R553X 0.4 - 0.5 - 0.6 0.2 1.0 No. Login to comment

PMID: 20502448 [PubMed] Joergensen MT et al: "Genetic, epidemiological, and clinical aspects of hereditary pancreatitis: a population-based cohort study in Denmark."

No. Sentence Comment

57 The samples were also tested for 33 CFTR mutations, and all 6 classeswererepresented:394delTT,p.R553X,621+1G>T,p.R1162X, 1717-1G>A,3659delC,p.G542X,2183AA>G,p.W1282X,1078delT, 711+1G>T, F508del, p.S549N, I507del, p.S549R, 2184delA, p.G551D, p.G85E, p.N1303K, p.R560T, p.R117H, p.R347H, p.R347P, p.R334W, 2789+5G>A, 3849+10kbC>T, p.A445E, 3120+1G>A, p.V520F,1898+1G>A,3876delA,3905insT,andIVS8-5T.DNAwas amplified by multiplex PCR (Hybaid 4 A62, Middlesex, UK). Login to comment

PMID: 21036675 [PubMed] Lay-Son G et al: "Cystic fibrosis in Chilean patients: Analysis of 36 common CFTR gene mutations."

No. Sentence Comment

81 Mutation This study Rios et al. [4] Molina et al. [5] Repetto et al. [6] Perez et al. [13] CFGAC [2] (n=578) (%) (n=72) (%) (n=36) (%) (n=100) (%) (n=4102) (%) (n=43,849) (%) Chile Chile Chile Chile Latin-Americaa Worldwide Unknown 58.0 66.6 61.1 34.0 36.7 22.7 p.F508del 30.6 29.2 30.6 45.0 47.1 66.0 p.R334W 3.1 - - 2.0 0.8 0.1 p.G542X 2.4 0 8.3 7.0 5.0 2.4 c.3849+10Kb CNT 1.7 - - 3.0 0.3 0.2 p.R553X 1.2 4.2 0 1.0 0.4 0.7 p.R1162X 0.9 - - 2.0 1.0 0.3 p.1078delT 0.5 - - 0 b0.1 0.1 p.G85E 0.5 - - - 0.8 0.2 p.W1282X 0.2 - - 5.0 1.0 1.2 c.3120+1 GNA 0.2 - - - 0.3 - c.711+1 GNT 0.2 - - - 0.1 0.1 p.R117H 0.2 - - 0 b0.1 0.3 p.A455E 0.2 - - 0 0 0.1 p.I148T 0.2 - - - - - p.G551D 0 0 0 1.0 0.1 1.6 p.N1303K 0 0 0 0 1.8 1.3 c.621+1 GNT 0 - - 0 0.2 0.7 c.1717-1 GNA 0 - - 0 0.3 0.6 p.I507del 0 - - 0 0.2 0.2 p.R347P 0 - - 0 0 0.2 c.2789+5 GNA 0 - - - 0.2 0.1 c.1898+1 GNA 0 - - - 0.1 0.1 c.2184delA 0 - - - b0.1 0.1 p.S549N 0 - 0 - 0.1 0.1 c.3659delC 0 - - 0 0.1 0.1 p.R560T 0 - - - 0 0.1 c.1811+1.6Kb ANG 0 - - - 0.4 - c.2183AANG 0 - - 0 0.1 - p.S549R 0 - - - 0.1 - c.3272-26 ANG 0 - - - 0.1 - c.3199del6 0 - - - b0.1 - p.E60X 0 - - 0 0 - c.3905insT 0 - - - 0 - p.S1251N 0 - - 0 - - CFTRdele2,3 0 - - - - - p.R347H 0 - - - - - p.V520F 0 - - - - - p.Q552X 0 - - - - - c.394delTT 0 - - - - - c.711+1 GNA 0 - - - - - c.2143delT 0 - - - - - c.3876delA 0 - - - - - a Data from Chilean patients published in Rios et al., Molina et al., and Repetto et al. [4-6] included in this publication were excluded in this table to avoid repetition. Login to comment

PMID: 1718974 [PubMed] Chastre E et al: "Functional insertion of the SV40 large T oncogene in cystic fibrosis intestinal epithelium. Characterization of CFI-3 cells."

No. Sentence Comment

208 Preliminary data from a studyof the Jewish population in Israel and Arabic patients with CF indicatedthat other mutationsat the same position were relatively abundant, such as the S549R and S5491substitutions, both expressing a severe manifestation of the disease (21). Login to comment

PMID: 12169627 [PubMed] Matsuo M et al: "Mutations in the linker domain of NBD2 of SUR inhibit transduction but not nucleotide binding."

No. Sentence Comment

30 Likewise, the CFTR linker mutations G551D and S549R did not change the ATP-binding af®nity of puri®ed NBD1 (Qu et al., 1997), whereas G551D reduced the ATPase activity (Li et al., 1996). Login to comment

PMID: 21889498 [PubMed] Shukla P et al: "Molecular analysis of ABCD1 gene in Indian patients with X-linked adrenoleukodystrophy."

No. Sentence Comment

103 The CFTR mutants p.Ser549Ile, p.Ser549Arg, that involve the same amino acid position as in the ALD mutant fail to produce mature CFTR and therefore prevent trafficking to the correct cellular localization [18]. Login to comment

PMID: 8040304 [PubMed] Fanen P et al: "Identification of mutations in the putative ATP-binding domain of the adrenoleukodystrophy gene."

No. Sentence Comment

48 Asterisks indicate the posi- *l I U13 | tion of the four missense mutations in ALD protein (ALDP): R518W substitution occurs at the same amino acid position as in the CFTR mutant S1255P, and S606L at the same position as in the S5491 or S549R CFTR mutants; R617C and R617H have no equivalents in CFTR mutants. Login to comment
143 The CFTR mutants S5491 and S549R, that involve the same amino acid position as in the ALD mutant S606L, fail to produce mature CFTR and therefore prevent trafficking to the correct cellular localization ( 12). Login to comment

PMID: 11381133 [PubMed] Karttunen JT et al: "Distinct functions and cooperative interaction of the subunits of the transporter associated with antigen processing (TAP)."

No. Sentence Comment

283 Not only is the absence of this serine unique among ABC transporters, but a mutation at this site in CFTR (S549R) is responsible for some cases of cystic fibrosis (46). Login to comment

PMID: 10892749 [PubMed] Hopfner KP et al: "Structural biology of Rad50 ATPase: ATP-driven conformational control in DNA double-strand break repair and the ABC-ATPase superfamily."

No. Sentence Comment

127 across the concave side of the dimer (Figure 4B), which interface of the Rad50 dimer and is analogous to a mutation in CFTR (S549R) that results in cystic fibrosis (Zie-widens toward its ends. Login to comment
167 As likely both ATP molecules5A) and is analogous to a CFTR mutation, S549R. Login to comment

PMID: 22581207 [PubMed] Krulisova V et al: "Prospective and parallel assessments of cystic fibrosis newborn screening protocols in the Czech Republic: IRT/DNA/IRT versus IRT/PAP and IRT/PAP/DNA."

No. Sentence Comment

81 According to the protocol, this result indicated the sequencing of the Table 1 Parallel comparison of CF NBS protocols IRT/DNAa /IRT IRT/PAP IRT/PAP/DNAa Newborns screened (N) 106,522 106,522 106,522 IRT positives (N; %) 1,158 (1.09) 3,155 (2.96) 3,155 (2.96) PAP positives (N; %) - 260 (0.24) 260 (0.24) Median age (range) at the availability of DNA-testinga results (days) 36 (9-222b ) - 36 (9-222b ) 1 and/or 2 CF mutations detected (N; %) 76 (0.07) - 27 (0.03) Recalled newborns for repeated IRT examination (N; %) 47 (0.04) - - Positive CF NBS (N; %) 123 (0.12) 260 (0.24) 27 (0.03) Positive IRT in newborns recalled for repeated examination (N) 1 - - ST indicated (N; %) 77 (0.07) 260 (0.24) 27 (0.03) ST carried out (N; % of indicated ST) 72c (93.51) 204c (78.46) 24c (88.89) CF carriers (N) 55 - 12 Prevalence of CF carriers 1 in 21 - 1 in 22 Diagnosed CF patients (N) 19 16 15 False positives based on performed ST (N; % of all cases screened) 99d (0.09) 188 (0.18) 9 (0.01) Newborns with equivocal diagnosis [F508del/R117H-IVS-8 T(7) and ST<30 mmol/L; N] 2 - 0 False negatives (N) 2 5 6 Total of CF patients detected (N) 21e Median age (range) at diagnosis (days) 36 (9-57)e CF prevalence 1 in 5,072e Sensitivity (TP/TP+FN) 0.9048 0.7619 0.7142 Specificity (TN/TN+FP) 0.9991 0.9982 0.9999 PPV (TP/TP+FP) 0.1610 0.0784 0.625 N number, % of all cases screened, TP true positives, FN false negatives, TN true negatives, FP false positives, PPV positive predictive value, ST sweat test a CF-causing mutations covered by Elucigene assays ("legacy" nomenclature) with the CF-EU1Tm accounting for: p.Arg347Pro (R347P), c.2657+ 5G>A (2789+5G>A), c.2988+1G>A (3120+1G>A), c.579+1G>T (711+1G>T), p.Arg334Trp (R334W), p.Ile507del (I507del), p.Phe508del (F508del), c.3718-2477C>T (3849+10kbC>T), p.Phe316LeufsX12 (1078delT), p.Trp1282X (W1282X), p.Arg560Thr (R560T), p.Arg553X (R553X), p.Gly551Asp (G551D), p.Met1101Lys (M1101K), p.Gly542X (G542X), p.Leu1258PhefsX7 (3905insT), p.Ser1251Asn (S1251N), c.1585-1G>A (1717-1G>A), p.Arg117His (R117H), p.Asn1303Lys (N1303K), p.Gly85Glu (G85E), c.1766+1G>A (1898+1G>A), p.Lys684AsnfsX38 (2184delA), p.Asp1152His (D1152H), c.54-5940_273+10250del (CFTRdele2,3), p.Pro67Leu (P67L), p.Glu60X (E60X), p.Lys1177SerfsX15 (3659delC), c.489+1G>T (621+1G>T), p.Ala455Glu (A455E), p.Arg1162X (R1162X), p.Leu671X (2143delT), c.1210-12T[n] (IVS8-T(n) variant), including additional mutations in the CF-EU2Tm : p.Gln890X (Q890X), p.Tyr515X (1677delTA), p.Val520Phe (V520F), c.3140-26A>G (3272-26A>G), p.Leu88IlefsX22 (394delTT), p.Arg1066Cys (R1066C), p.Ile105SerfsX2 (444delA), p.Tyr1092X (C>A) (Y1092X(C>A)), p.Arg117Cys (R117C), p.Ser549Asn (S549N), p.Ser549ArgT>G (S549R T>G), p.Tyr122X (Y122X), p.Arg1158X (R1158X), p.Leu206Trp (L206W), c.1680-886A>G (1811+1.6kbA>G), p.Arg347His (R347H), p.Val739TyrfsX16 (2347delG) and p.Trp846X (W846X) b failed DNA isolation from DBS, including repetition of DNA-testing c deceased patient or non-compliance with referrals (five CF carriers in IRT/DNA/IRT, 56 newborns in IRT/PAP, three CF carriers in IRT/PAP/DNA) d comprising newborns with repeated IRT (47 newborns) e aggregate data from all protocols entire CFTR coding region in both newborns, and led to the identification of p.Ile336Lys (I336K) and p.Glu1104Lys (E1104K) mutations. Login to comment

PMID: 22300503 [PubMed] Barben J et al: "Retrospective analysis of stored dried blood spots from children with cystic fibrosis and matched controls to assess the performance of a proposed newborn screening protocol in Switzerland."

No. Sentence Comment

80 CFTR mutations Alleles found Percentage of total Homozygous (n) F508del a 86 68.2 30 3905insT a 4 3.2 1 G542X a 3 2.4 - R553X a 3 2.4 1 W1282X a 2 1.6 - 1717-1 GNA a 2 1.6 - N1303K a 0 0.0 - S549R 3 2.4 1 Q525X 3 2.4 - Y1092X 2 1.6 - 3120+1 GNA b 2 1.6 1 2347delG 2 1.6 - 2176insC 1 0.8 - 3659delC 1 0.8 - 3359delCTCTG 1 0.8 - W1089X 1 0.8 - 711+1 GNT 1 0.8 - D1152H 1 0.8 - G1244E 1 0.8 - R1066C 1 0.8 - R31C 1 0.8 - R347P 1 0.8 - R74W 1 0.8 - S945L 1 0.8 - T501I 1 0.8 - K68X 1 0.8 - Total 126 100.0% 34 a Seven most common CF-gene mutations in Switzerland ("Swiss panel")=79.4% (100/126) of alleles. Login to comment

PMID: 22293084 [PubMed] Yu H et al: "Ivacaftor potentiation of multiple CFTR channels with gating mutations."

No. Sentence Comment

4 These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations. Login to comment
39 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11]. Login to comment
67 The CF-associated CFTR mutations, S549N, S549R, and S1251N, are located in the ABC signature sequence (Fig. 4; LSGGQ; S549N,R in NBD1) and Walker A motif (Fig. 4; S1251N in NBD2), that form the ATP binding sites [14]. Login to comment
68 Immunoblot and Ussing chamber studies indicated that, although the maturation of S549N- and S1251N-CFTR was similar to normal, the baseline level of chloride transport was b10% of normal CFTR (Figs. 1 and 3; Table 2). Login to comment
69 S549R-CFTR showed maturation comparable to 26±2% (n=5) of normal CFTR (Fig. 1D), which did not account for the b1% of normal CFTR function (Fig. 3; Table 2). Login to comment
70 These results indicated that the function of S549N-, S549R-, and S1251N-CFTR at the cell surface was minimal. Login to comment
71 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTRmRNA (%NormalCFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTRMaturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations MatureCFTR (%NormalCFTR) A B D C Mature Immature Fig. 1. Login to comment
82 Taken together, these data suggested that defective channel gating was the predominant defect in S549N-, S549R- and S1251N-CFTR. Login to comment
83 In FRT cells expressing S549N-, S549R-, and S1251N-CFTR, acute addition of 10 μM ivacaftor increased the channel open probability and total chloride transport by N10-fold over baseline levels (Figs. 2 and 3; Tables 1 and 2). Login to comment
91 In addition, we showed that the 3 additional mutations, S549N, S549R, and S1251N also have characteristics consistent with gating defects. Login to comment
96 Taken together, these in vitro results provide a rationale for testing the potential benefit of ivacaftor in individuals with CF who have a CFTR gating mutation other than G551D, including the G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P, and G1349D CFTR gating mutations. Login to comment
97 Evaluation of CF-associated CFTR mutations that were expected to cause protein alterations in the ATP-binding sites formed by the NBDs indicated that S549N- and S1251N-CFTR also shared similar in vitro functional characteristics with G551D-CFTR and could be classified as CFTR gating mutations. Login to comment
98 Unlike S549N-CFTR and S1251N-CFTR, S549R-CFTR exhibited a partial reduction in the level of CFTR maturation compared to normal CFTR (see also Ref. [16]). Login to comment
99 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 µM Ivacaftor * * * * * * * * * * * CFTR Mutation ChannelOpenProbability ChannelOpenProbability (%NormalCFTR) B 1pA 3sec + 10 µM Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2. Login to comment
106 Patch-clamp studies showed that the channel open probability of S549R-CFTR was less than 1% of normal CFTR. Login to comment
107 These results indicated that although the predominant defect caused by the S549R CFTR mutation was defective CFTR channel gating, a mild processing defect was also observed. Login to comment
127 Like G551D, the G551S, G1244E, S1255P, and G1349D CFTR gating mutations, as well as the S549N, S549R, and S1251N CFTR gating mutations identified in the Table 1 Effect of ivacaftor on the channel gating activity of CFTR with gating mutations. Login to comment
128 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 μ;M ivacaftor Baseline With 10 μM ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57±0.03 100 0.63±0.02 111 0.400±0.04 100 0.800±0.04 a 200 G551D 0.46±0.06 81 0.46±0.03 81 0.019±0.01 b 5 0.121±0.035 a 30 G178R 0.59±0.11 103 0.66±0.08 116 0.005±0.001 b 1 0.228±0.022 a 57 S549N 0.55±0.02 97 0.61±0.02 108 0.003±0.010 b 1 0.396±0.119 a 99 S549R 0.45±0.01 b 79 0.55±0.02 a 96 0.004±0.010 b 1 0.143±0.031 a 36 G551S 0.57±0.13 100 0.64±0.02 113 0.010±0.001 b 3 0.337±0.110 a 84 G970R 0.55±0.03 96 0.55±0.03 97 0.001±0.001 b 0 0.245±0.042 a 61 G1244E 0.44±0.11 77 0.54±0.08 94 0.011±0.010 b 3 0.470±0.122 a 118 S1251N 0.54±0.07 95 0.63±0.04 111 0.003±0.010 b 1 0.350±0.03 a 88 S1255P 0.70±0.03 b 122 0.71±0.02 125 0.018±0.016 b 5 0.468±0.168 a 117 G1349D 0.49±0.08 85 0.63±0.06 111 0.019±0.015 b 5 0.315±0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation. Login to comment
130 0 100 200 300 400 -9 -8 -7 -6 -5 -4 G178R G551D G551S 0 S549N S549R Ivacaftor [Log M] 0 100 200 300 400 0 50 100 150 200 -9 -8 -7 -6 -5 -4 G970R G1244E S1255P G1349D 0 S1251N Ivacaftor [Log M] ChlorideTransport (%NormalCFTR) Normal Forskolin G178R G551S G970R G1244E 50 2 1 min S1255P Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 0 50 100 150 200 * * * * * * * * * * * * * CFTR Mutation ChlorideTransport(µA/cm2)ChlorideTransport(µA/cm2) ChlorideTransport(A/cm2) ChlorideTransport (%NormalCFTR) B G1349D G551D A F508del C S549N S549R S1251N Baseline Baseline present study, cause protein alterations in the ATP binding pockets formed by the two NBDs required for normal CFTR channel gating (Fig. 4) [2]. Login to comment
131 The G178R and G970R CFTR gating mutations alter the intracellular cytoplasmic loops that are believed to link the ATP-driven conformational changes in the NBDs to the opening of the CFTR channel pore formed by the membrane spanning domains [27]. Login to comment
144 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D. Login to comment
40 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11]. Login to comment
72 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTR mRNA (% Normal CFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTR Maturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations Mature CFTR (% Normal CFTR) A B D C Mature Immature Fig. 1. Login to comment
92 In addition, we showed that the 3 additional mutations, S549N, S549R, and S1251N also have characteristics consistent with gating defects. Login to comment
100 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 &#b5;M Ivacaftor * * * * * * * * * * * CFTR Mutation Channel Open Probability Channel Open Probability (% Normal CFTR) B 1pA 3sec + 10 &#b5;M Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2. Login to comment
108 These results indicated that although the predominant defect caused by the S549R CFTR mutation was defective CFTR channel gating, a mild processing defect was also observed. Login to comment
129 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 bc;M ivacaftor Baseline With 10 bc;M ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57&#b1;0.03 100 0.63&#b1;0.02 111 0.400&#b1;0.04 100 0.800&#b1;0.04 a 200 G551D 0.46&#b1;0.06 81 0.46&#b1;0.03 81 0.019&#b1;0.01 b 5 0.121&#b1;0.035 a 30 G178R 0.59&#b1;0.11 103 0.66&#b1;0.08 116 0.005&#b1;0.001 b 1 0.228&#b1;0.022 a 57 S549N 0.55&#b1;0.02 97 0.61&#b1;0.02 108 0.003&#b1;0.010 b 1 0.396&#b1;0.119 a 99 S549R 0.45&#b1;0.01 b 79 0.55&#b1;0.02 a 96 0.004&#b1;0.010 b 1 0.143&#b1;0.031 a 36 G551S 0.57&#b1;0.13 100 0.64&#b1;0.02 113 0.010&#b1;0.001 b 3 0.337&#b1;0.110 a 84 G970R 0.55&#b1;0.03 96 0.55&#b1;0.03 97 0.001&#b1;0.001 b 0 0.245&#b1;0.042 a 61 G1244E 0.44&#b1;0.11 77 0.54&#b1;0.08 94 0.011&#b1;0.010 b 3 0.470&#b1;0.122 a 118 S1251N 0.54&#b1;0.07 95 0.63&#b1;0.04 111 0.003&#b1;0.010 b 1 0.350&#b1;0.03 a 88 S1255P 0.70&#b1;0.03 b 122 0.71&#b1;0.02 125 0.018&#b1;0.016 b 5 0.468&#b1;0.168 a 117 G1349D 0.49&#b1;0.08 85 0.63&#b1;0.06 111 0.019&#b1;0.015 b 5 0.315&#b1;0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation. Login to comment
145 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D. Login to comment

PMID: 23082198 [PubMed] Sousa M et al: "Measurements of CFTR-Mediated Cl(-) Secretion in Human Rectal Biopsies Constitute a Robust Biomarker for Cystic Fibrosis Diagnosis and Prognosis."

No. Sentence Comment

90 One ''CF suspicion`` patient with severe CF symptoms and the F508del/S549R genotype, evidenced very low levels of CFTR function (,5% normalized to controls). Login to comment
174 For instance, we were able to detect very low function (,5% CFTR function vs non-CF controls) in a patient bearing S549R, recently described as Figure 4. Login to comment
190 For example, the patient with S549R could be tested ex vivo for the correction with the FDA-approved potentiator Ivacaftor, as suggested by the in vitro data [42]. Login to comment

PMID: 21875427 [PubMed] Field PD et al: "CFTR mutation screening in an assisted reproductive clinic."

No. Sentence Comment

37 Table 1 A breakdown of the CFTR mutations identified in the infertile patient population, the percentage of those mutations identified, the percentage of the infertile population screened, the percentage of the same mutations identified in the antenatal population by Massie et al. and figures published by Bobadilla et al. for the corresponding CFTR mutations in a global population study 'Legacy Mutation Name` and HGVS convention nomenclature* Number of mutations identified in infertile population Percentage of mutations identified in infertile population (%) Percentage of mutations identified in antenatal population4 (%) Percentage of mutations identified in a global population5 (%) F508delCTT / c.1521_1523delCTT 185 70.9 88.89 75.48 R117H / c.350G>A 36 13.8 0.63 G551D / c.1652G>A 12 4.6 2.78 3.82 G542X / c.1624G>T 6 2.3 0.93 1.83 N1303K / c.3909C>G 4 1.5 0.93 0.95 621+1G>T / c.489+1G>T 5 1.9 0.93 0.96 I507del / c.1519-1521delATC 2 0.8 0.53 3659delC / c.3528delC 2 0.8 R1162X / c.3484C>T 1 0.4 0.20 3120+1G>A / c.2988+1G>A 1 0.4 2184-delA / c.2052delA 1 0.4 3849+10kbC>T / c.3717-2477C>T 1 0.4 4.63 2789+5G>A / c.2657+5G>A 1 0.4 0.93 R347P / c.1040G>A 1 0.4 0.16 1717-1G>A / c.1585-1G>A 1 0.4 0.81 R553X / c.1657C>T 1 0.4 S549R / c.1647T>G 1 0.4 Total CFTR mutations identified 261 Total patients screened 5600 Incidence of CF carriers at QFG 1 in 21.5 (4.66%) CF, cystic fibrosis; CFTR, CF transmembrane receptor. Login to comment

PMID: 22439061 [PubMed] Mesoraca A et al: "The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis."

No. Sentence Comment

100 48 Journal of Prenatal Medicine 2010; 4 (3): 45-50 Table III Mutations found with II level screening through DHPLC Mutations of mutated alleles DF508 29 W1282X 3 N1303K 8 1717-1G®A 2 3659delC 1 G85E 1 2789 +5G®A 2 R553X 2 R1162X 1 R117H 1 G542X 3 Total 53Table I Mutations found through I level screeningMutations analysed with I level screening through OLA CFTR Mutations Position on the CFTR gene DF508 Exon 10 3849+10KbC®T Intron 19 R334W Exon 7 W1282X Exon 10 V520F Exon 10 3905insT Exon 20 N1303K Exon 21 3876delA Exon 20 1717-1G®A Exon 11 3659delC Exon 19 DI507 Exon 10 A455E Exon 9 G85E Exon 3 2789 +5G®A Exon 14 / Intron 14 2183AA®G Exon 13 1898+1G®A Exon 12 / Intron 12 R347P Exon 7 R347H Exon 7 R560T Exon 11 1078delT Exon 7 R553X Exon 11 711+1G®T Exon 5 / Intron 5 G551D Exon 11 R1162X Exon 19 S549R Exon 11 R117H Exon 4 S549N Exon 11 621+1G®T Exon 4 G542X Exon 11 394delTT Exon 3 3120+1G®ðA Exon 16/ Intron 16 2184delA Exon 13 Table II Mutations found through I level screening Mutations Positions on CFTR gene R1066C Exon 17 b L1065P Exon 17 b A1006E Exon 19 R75Q Exon 3 D537E Exon 11 W1134X Exon 18 W1145X Exon 18 L1077P Exon 17b C524X Exon 11 Total 9 The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis Journal of Prenatal Medicine 2010; 4 (3): 45-50 49 tion was to provide the couple with adequate counselling in order to better understand the genotype-phenotype correlation in the various associations of mutations. Login to comment

PMID: 19457724 [PubMed] Moya-Quiles MR et al: "CFTR H609R mutation in Ecuadorian patients with cystic fibrosis."

No. Sentence Comment

28 Genotypes G85E/G85E and G85E/S549R were found in the other two patients. Login to comment
26 Genotypes G85E/G85E and G85E/S549R were found in the other two patients. Login to comment

PMID: 18455968 [PubMed] Farra C et al: "Cystic fibrosis: a new mutation in the Lebanese population."

No. Sentence Comment

46 Recently, a panel of 11 common mutations accounting overall for 70% of all Arab CF chromosomes have been reported : ΔF508del, 3120+1G"A, N1303K, W1282X, G115X, 711+1G"A, S549R, I1234V, 1548delG , H139L and 4010del4 [9]. Login to comment

PMID: 18687795 [PubMed] Audrezet MP et al: "Validation of high-resolution DNA melting analysis for mutation scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene."

No. Sentence Comment

75 In addition to heterozygous variants, 10 homozygote samples carrying F508del, 394delT, R117H, G542X, S549R, 4016inT homozygous mutations, and R75Q, T854T, 1001ϩ11 CϾT, and Q1463Q homozygous variants, were also tested. Login to comment

PMID: 17662673 [PubMed] Alibakhshi R et al: "Analysis of the CFTR gene in Iranian cystic fibrosis patients: identification of eight novel mutations."

No. Sentence Comment

66 Results A total of 69 unrelated CF patients (38 male and 31 female; aged between 2 months and 15 years) of Iranian Table 2 Genotype of CFTR genes in 53 Iranian patients Genotype Exon/intron Number of patients p.F508del/p.F508del E10/E10 10 p.F508del/p.R1162X E10/E19 2 p.F508del/p.T1036I E10/E17a 1 p.F508del/p.R1066C E10/E17b 1 p.F508del/c.1342-?_1524+?del E10/E9 1 p.S466X/p.S466X E10/E10 4 c.2183_2184delAAinsG/ c.2183_2184delAAinsG E13/E13 4 c.2183_2184delAAinsG/c.186- ?_296+?del E13/E2 1 p.N1303K/p.N1303K E21/E21 2 p.N1303K/p.S945L E21/E15 1 p.N1303K/c.1677delTA E21/E10 1 p.G542X/p.G542X E11/E11 2 p.G542X/c.2789+5GNA E11/I14b 1 c.3120+1GNA/c.3120+1GNA I16/I16 2 c.3120+1GNA/c.3121-1GNA I16 1 c.3121-1GNA/p.T1086I I16/E17b 1 c.3130delA/c.3130delA E17a/E17a 2 p.D192G/p.D192G E5/E5 1 p.R334W/p.R334W E7/E7 1 p.R334W/p.S945L E7/E15 1 p.R334W/p.L1077P E7/E17b 1 c.1525-1GNA/c.1525-1GNA I9/I9 1 p.S549R/p.S549R E11/E11 1 p.A566D/p.A566D E12/E12 1 c.1898+1GNT/c.1898+1GNT I12/I12 1 c.2576delA/p.S1455X/ E13/E24 1 c.2184insA/c.1677delTA E10/E13 1 p.R785X/p.R785X E13/E13 1 c.2752-1_2756delGGTGGCinsTTG/ c.2752-1_2756delGGTGGCinsTTG I14a/E14b 1 c.2789+5GNA/c.2789+5GNA I14b/I14b 1 p.K1177X/p.K1177X E19/E19 1 c.406-?_1716+?del/c.406-?_1716+?del E4-E10/E4-E10 1 Total 53 origin were extensively studied for the presence of mutations in the CFTR gene, for the presence of the deep intronic 3849+10 kbC→T mutation, and large deletions/ duplications. Login to comment
65 Results A total of 69 unrelated CF patients (38 male and 31 female; aged between 2 months and 15 years) of Iranian Table 2 Genotype of CFTR genes in 53 Iranian patients Genotype Exon/intron Number of patients p.F508del/p.F508del E10/E10 10 p.F508del/p.R1162X E10/E19 2 p.F508del/p.T1036I E10/E17a 1 p.F508del/p.R1066C E10/E17b 1 p.F508del/c.1342-?_1524+?del E10/E9 1 p.S466X/p.S466X E10/E10 4 c.2183_2184delAAinsG/ c.2183_2184delAAinsG E13/E13 4 c.2183_2184delAAinsG/c.186- ?_296+?del E13/E2 1 p.N1303K/p.N1303K E21/E21 2 p.N1303K/p.S945L E21/E15 1 p.N1303K/c.1677delTA E21/E10 1 p.G542X/p.G542X E11/E11 2 p.G542X/c.2789+5GNA E11/I14b 1 c.3120+1GNA/c.3120+1GNA I16/I16 2 c.3120+1GNA/c.3121-1GNA I16 1 c.3121-1GNA/p.T1086I I16/E17b 1 c.3130delA/c.3130delA E17a/E17a 2 p.D192G/p.D192G E5/E5 1 p.R334W/p.R334W E7/E7 1 p.R334W/p.S945L E7/E15 1 p.R334W/p.L1077P E7/E17b 1 c.1525-1GNA/c.1525-1GNA I9/I9 1 p.S549R/p.S549R E11/E11 1 p.A566D/p.A566D E12/E12 1 c.1898+1GNT/c.1898+1GNT I12/I12 1 c.2576delA/p.S1455X/ E13/E24 1 c.2184insA/c.1677delTA E10/E13 1 p.R785X/p.R785X E13/E13 1 c.2752-1_2756delGGTGGCinsTTG/ c.2752-1_2756delGGTGGCinsTTG I14a/E14b 1 c.2789+5GNA/c.2789+5GNA I14b/I14b 1 p.K1177X/p.K1177X E19/E19 1 c.406-?_1716+?del/c.406-?_1716+?del E4-E10/E4-E10 1 Total 53 origin were extensively studied for the presence of mutations in the CFTR gene, for the presence of the deep intronic 3849+10 kbC࢐T mutation, and large deletions/ duplications. Login to comment

PMID: 17560176 [PubMed] Viel M et al: "ENaCbeta and gamma genes as modifier genes in cystic fibrosis."

No. Sentence Comment

72 Twenty-one were homozygous for the Phe508del mutation and 17 were compound heterozygous or homozygous for two severe mutations (R553X:1717-1GNA, Phe508del:W1282X, Phe508del:1717-1GNA, 2 Phe508del:3659delC, Phe508del:N1303K, Phe508del:W57X, Phe508del:Q1411X, G542X:1380insT, Phe508del:R553X, Table 1 Parameters for amplification of the ENaCβ and ENaCγ gene fragments (GenBank accession number NM_000336 and NM_001039, respectively) Fragment Sequence of primers Annealing temperature (°C) ENaCβ Exon 2 2F 5' gtgtcccagctgatgtgcgt 3' 55 2R 5' tgaggccagctgtgcactcc 3' Exon 3 3F 5' acagactactatggagtggg 3' 55 3R 5' aagaaacacccatcagcctc 3' Exon 4 4F 5' gtcctgctagcagctcccac 3' 59 4R 5' caaccgtaacatgccactgt 3' Exon 5 5F 5' ctgccctgcagctgatgctg 3' 55 5R 5' ccctgcaacagctgatggtc 3' Exon 6 6F gtctcctttctgcctcagga 3' 59 6R 5' tcagaccctctaggactgcc 3' Exon 7 7F 5' aggtgcagaaagggcttcct 3' 63 7R 5' catgaggcgtgcaccaccttcccac 3' Exon 8 8F 5' ctgaccatgcctgtgttctc 3' 59 8R 5' ctctatggtcagagcctctg 3' Exon 9-10 9F 5' cagaggctcagcagggaaca 3' 63 10R 5' catcttatgcccagacttgt 3' Exon 11 11F 5' gatgctgcagatggcaactt 3' 55 11R 5' gagctgtcctgtgtccaaac 3' Exon 12 12F 5' acattagtcccggcccttct 3' 55 12R 5' ggtattgggagactcctaaa 3' Exon 13 13F 5' fgaggcaagaatgtgtggcct 3' 59 13R 5' tcttggctgctcagtgagtt 3' ENaCγ Exon 2 2F 5' agcacgcccgtcctcagagt 3' 57 2R 5' ccagtgtgtcactttcggga 3' Exon 3 3F 5' tgaggctgacacgtgttgat 3' 55 3R 5' tgcccctaagcagtgaaaga 3' Exon 4 4F 5' agtagcgataggaccgatgg 3' 55 4R 5' tcagagctgccagtccttag 3' Exon 5 5F 5' cccaacttcagctaagatgc 3' 55 5R 5' agatctccttggcacaggtt 3' Exon 6 6F 5' ttggatcacagcaggttgtc 3' 55 6R 5' gatctgttctctccaagcct 3' Exon 7 7F 5' ctgtctggtgctccttgcaa 3' 55 7R 5' ccagcttagatataactttg 3' Exon 8 8F 5' tgagcaaagacatgaatggc 3' 57 8R 5' agtgcctattgccaggacta 3' Exon 9-10-11 9F 5' tccaaagctcatgctgccct 3' 57 11R 5' acagaggaacagggtagagg 3' Exon 12 12F 5' ggatgccaaggctcttgatt 3' 52 12R 5' gccaggaagatgctcacatt 3' Exon 13 13F 5' aggttcctcttgatggtgt 3' 55 13R 5' ggtcctgactagatctgtct 3' Table 2 Parameters for dHPLC conditions Fragment Temperature (°C) ENaCβ Exon 2 62.3/63.3 Exon 3 59.5/60.7 Exon 4 62.2/63.4 Exon 5 59.5/61 Exon 6 63 Exon 7 61.6/62.6/63.6 Exon 8 62.8/64.8 Exon 9-10 61.5/62.5/65 Exon 11 61/62/63.5 Exon 12 69 Exon 13 61/63.3/64.8 ENaCγ Exon 2 60.8/63.2/66 Exon 3 61/61.4 Exon 4 60.6 Exon 5 59.5/60.5 Exon 6 56.5/59/60.5 Exon 7 63/63.6 Exon 8 59.5/63 Exon 9-10-11 60.7/61.5/62.7/64.7 Exon 12 59.5/61.7 Exon 13 61/62.2 Phe508del:I507del, Phe508del:4382delA, S549R:3120+ 1GNA, Phe508del:3120+1GNA, Y122X:Y122X; Phe508del:W846X; Phe508del:E60X). Login to comment

PMID: 16436643 [PubMed] Elahi E et al: "A haplotype framework for cystic fibrosis mutations in Iran."

No. Sentence Comment

177 Six additional mutations reported in at least two other Arab populations, including c.711ϩ1GϾA, p.R75X, c.1548delG, c.3120ϩ1GϾA, c.3199del6, and p.S549R,30,42,53-56 could have been detected in our assay but were not found in Iran. Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment

PMID: 15858154 [PubMed] Schrijver I et al: "Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum."

No. Sentence Comment

176 In comprehensive non-U.S. studies from Brazil, Colombia, and Spain, 420 mutations were identified (231, 117, and 72, respectively).33-35 Only seven occurred with a relative frequency Ͼ1%: ⌬F508 (67.4%), G542X (9%), N1303K (2.4%), R1162X (2.4%), R334W (2.1%), W1282X (1.2%), and S549R (1%). Login to comment
177 Interestingly, all but one of these (S549R) are part of the 25 mutation screening panel, which may reflect a greater Caucasian admixture. Login to comment

PMID: 16156102 [PubMed] Dunbar SA et al: "Rapid screening for 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator gene by Lminex xMAP suspension array."

No. Sentence Comment

119 Coriell Cell Repositories, NA12960 ΔI507/R347P Patient sample G551D/R347P Coriell Cell Repositories, NA12785 621+1G→T/711+1G→T Coriell Cell Repositories, NA11280 621+1G→T/G85E Coriell Cell Repositories, NA11282 3849+10kbC→T/3849+10kbC→T Coriell Cell Repositories, NA11860 A455E/normal Patient sample 621+1G→T/A455E Coriell Cell Repositories, NA11290 R1162X/normal Coriell Cell Repositories, NA12585 ΔF508/3659delC Coriell Cell Repositories, NA11275 2789+5G→A/2789+5G→A Coriell Cell Repositories, NA11859 2184delA/normal Patient sample 1898+1G→A/normal Patient sample 621+1G→T/3120+1G→A Coriell Cell Repositories, NA07441 3120+1G→A/3120+1G→A Patient sample F508C/normal Coriell Cell Repositories, NA13033 I506V/normal Coriell Cell Repositories, NA13032 R347H/normal Patient sample ΔF508/3120G→A Patient sample S549N/normal Patient sample S549R/normal Patient sample CFTR, cystic fibrosis transmembrane conductance regulator gene. Login to comment

PMID: 15698946 [PubMed] des Georges M et al: "High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France."

No. Sentence Comment

68 of chromosomes (frequency %) p.M1V 1 1 (0.23) p.M1K 1 1 (0.23) c.300delA 3 1 (0.23) p.P67L 3 1 (0.23) c.359insT 3 1 (0.23) p.G85E 3 3 (0.70) c.394delTT 3 1 (0.23) p.Q98R 4 1 (0.23) p.R117H 4 2 (0.47) p.Y122X 4 2 (0.47) p.Y161N 4 1 (0.23) c.621+1GNT intron 4 1 (0.23) c.621+2TNG intron 4 1 (0.23) p.I175V 5 2 (0.47) c.711+1GNT intron 5 5 (1.16) p.L206W 6 3 (0.70) p.Q220X 6 1 (0.23) p.L227R 6 1 (0.23) c.1078delT 7 2 (0.47) p.R334W 7 7 (1.63) p.R347P 7 2 (0.47) c.1215delG 7 1 (0.23) c.T5 intron 8 1 (0.23) p.D443Y 9 1 (0.23) p.I506T 10 1 (0.23) p.I507del 10 4 (0.93) p.F508del 10 259 (60.23) p.F508C 10 1 (0.23) c.1677delTA 10 1 (0.23) c.1717-8GNA intron 10 1 (0.23) c.1717-1GNA intron 10 6 (1.40) p.G542X 11 23 (5.35) p.S549R 11 1 (0.23) p.G551D 11 2 (0.47) p.R553X 11 1 (0.23) c1811+1.6kbANG intron 11 4 (0.93) c.1812-1GNA intron 11 1 (0.23) p.T582I 12 1 (0.23) p.E585X 12 2 (0,47) c.1898+1GNA intron 12 1 (0.23) [c.1898+5GNA ;p.E725K] intron 12 1 (0.23) c.1898+73TNG intron 12 1 (0.23) c.2183AANG 13 4 (0.93) c.2184insA 13 1 (0.23) p.K710X 13 4 (0.93) c.2423delG 13 1 (0.23) p.S776X 13 1 (0.23) c.2493ins8 13 1 (0.23) p.R792X 13 1 (0.23) p.K830X 13 1 (0.23) p.D836Y 14a 1 (0.23) p.W846X1 14a 1 (0.23) c.2711delT 14a 1 (0.23) c.2789+5GNA intron 14b 3 (0.70) p.S945L 15 3 (0.70) p.D993Y 16 1 (0.23) c.3129del4 17a 1 (0.23) c.3195del6 17a 1 (0.23) c.3272-26ANG intron 17a 1 (0.23) [c.3395insA ;pI148T] 17b/4 1 (0,23) p.Y1092X 17b 3 (0.70) Table 1 (continued) Mutation Location exon/intron No. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

105 d G149R, S489X, S492F, S549R, 1898+1G>A, 2622+1G>A, G970R, R1066H, W1204X, 3850-1G>A, Q1313X. Login to comment

PMID: 10862085 [PubMed] Ellis LA et al: "A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning."

No. Sentence Comment

81 MDE alone failed to detect R560T, S549R, and R709X under any conditions described. Login to comment
97 Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE. Login to comment
135 Effect of Amplicon Size on Mutation Detection Rate in ABCC7 Exon 11 SSCP slab gels SSCP 310 DHPLC 49:1, 20°C MDE, 20°C 35°C Exon 11 ABCC7 190bp 490bp 190bp 490bp 190bp 490bp 190bp 490bp 1717-1G>A - - + + + + + + G542X + + + + + - + + S549N + + + + + + - - S549R + + - + + + + - G551D - + + + - - + - R553X + + + + + + + - G551D/R553X + + + + + + + - R560T + - - + - - + + R560K + + + + - - + + 1811+1G>C + + + + + + + + Sensitivity 9/10 8/10 8/10 10/10 7/10 6/10 9/10 5/10 ammonium acetate as an ion-pairing agent has the unintended consequence of modifying the stability of GC and AT base pairs in a similar manner to the effects of tetra-alkyl ammonium salts, tetraethyl ammonium chloride and tetramenthyl ammonium chloride. Login to comment

PMID: 10447267 [PubMed] Telleria JJ et al: "Spectrum of CFTR mutations in the Middle North of Spain and identification of a novel mutation (1341G-->A). Mutation in brief no. 252. Online."

No. Sentence Comment

33 Spectrum of CFTR Mutations Table 1 Spectrum of CFTR mutations identified in the present study compared with data published by Casals et al. (Casals et al. 1997) This study Casals et al. Mutation Exon/Intron n % n % ∆F508 E 10 51 65.4 681 53.2 711+1G→T I 5 3 3.8 22 1.7 G542X E 11 3 3.8 108 8.43 1213delT E 7 2 2.6 0 0 1341G→A E 8 2 2.6 0 0 R1066C E 17b 2 2.6 14 1.09 1717-1G→A I 10 1 1.3 1 0.08 S549R E 11 1 1.3 0 0 V562I E 12 1 1.3 0 0 G576A E 12 1 1.3 0 0 2183AA→G E13 1 1.3 5 0.39 2789+5G→A I 14b 1 1.3 11 0.86 Q890X E 15 1 1.3 13 1.01 3849+1G→A I 19 1 1.3 0 0 N1303K E 21 1 1.3 34 2.65 Other 0 0 391 30.5 Known mutations 72 92.3 1155 90.23 Unknown mutations 6 7.7 125 9.7 DISCUSSION The knowledge of the spectrum of mutations causing CF in any specific geographic region provide useful information to design the best approach in pre and postnatal diagnosis of CF; for the screening of mutations in the population at risk; to stimate the genetic risk etc. Moreover, the response to different therapeutic approaches could vary depending on the CF mutations in any case. Login to comment

PMID: 9188468 [PubMed] Qu BH et al: "Localization and suppression of a kinetic defect in cystic fibrosis transmembrane conductance regulator folding."

No. Sentence Comment

5 A disease-causing mutation, G551D, which does not alter the maturation of CFTR in vivo but rather its function as a chloride channel, and the S549R maturation mutation have no discernible effect on the folding of the domain. Login to comment
12 Several other CF-causing mutations known to be maturation-defective, including S549R, are located in NBD1 (11) as are mutations of critical functional residues such as G551D (12). Login to comment
23 In the present study we use this system to examine the effects of the R553M second site mutation, the G551D functional mutation, the S549R maturation-defective mutation, glycerol, and ATP binding on the folding pathway and thermodynamic stability of NBD1. Login to comment
25 EXPERIMENTAL PROCEDURES Expression, Purification, and Folding of CFTR NBD1s-Oligonucleotide-mediated mutagenesis (19) was used to generate R553M, G551D, and S549R mutations in plasmid pBQ2.4 containing CFTR cDNAs. Login to comment
36 Printed in U.S.A. This paper is available on line at http://www.jbc.org CATTTGACCTCCAC-3Ј (25 bases); G551D primer, 5Ј-CTTGCTCGTT- GATCTCCACTCAGTG-3Ј (25 bases); S549R primer, 5Ј-CGTTGAC- CTCCTCTCAGTGTGATTCC-3Ј (26 bases). Login to comment
38 Expression cassette polymerase chain reaction was employed to synthesize the cDNA fragments of CFTR NBD1-R553M, NBD1-G551D, and NBD1-S549R containing a 5Ј NdeI site, a 3Ј XhoI site, and a stop codon as described previously for NBD1 and NBD1⌬F (5). Login to comment
59 The expression levels of NBD1-G551D and NBD1-S549R are approximately one-half of the wild-type NBD1 level (data not shown). Login to comment
88 Significantly the R553M mutation increases the length of the lag phase and decreases the rate of change in light scattering, indicating that the rate of formation of the off pathway conformer is dramatically reduced in this mutant. Login to comment
89 Once again the double mutant NBD1⌬F-R553M dramatically increases the lag time and decreases the rate change in light scattering in comparison with NBD1⌬F. Login to comment
90 Two other mutations, S549R and G551D, do not affect the domain folding yield compared with the wild-type NBD1 in vitro (Fig. 4A). Login to comment
91 In vivo studies indicate that the S549R mutation but not G551D is maturation-defective in the full-length protein (11); however, the NBD1-S549R folding yield is not decreased in vitro indicating that it does not act by altering the ability of the domain itself to fold. Login to comment
101 The mGdnHCl values are similar for the NBD1s except for S549R, which has a somewhat larger value indicating that the change in solvent-accessible surface area upon folding is appropriate for a protein of this size. Login to comment
102 These results indicate that the inability of the ⌬F508 and S549R CFTR to transit to the apical membrane and the effect of the R553M suppressor cannot be explained simply by a reduction or enhancement in the free energy of stability of the mutant proteins. Login to comment
111 Protein NBD1 NBD1⌬F NBD1-R553M NBD1⌬F-R553M NBD1-S549R NBD1-G551D Kd (␮M) 91 88 89 87 81 61 FIG. 3. Login to comment
128 The effects of the S549R and G551D mutations on the temperature-sensitive folding of NBD1 and the rate of formation of off pathway conformers. Login to comment
130 "A,temperature-dependent folding of NBD1 (q), NBD1⌬F (E), NBD1-G551D (ç), and NBD1-S549R (É). Login to comment
131 B, formation of off pathway conformers of NBD1 (solid line), NBD1⌬F (dotted line), NBD1-G551D (dashed line), and NBD1-S549R (dotted and dashed line). Login to comment
137 The 1.8 ␮M folded NBD1 (q), NBD1⌬F (E), NBD1-R553M (ç), NBD1⌬F-R553M (É), NBD1-G551D (f), and NBD1-S549R (Ⅺ) in 30 mM Tris-HCl, pH 8.0, 40 mM arginine, 0.2 mM EDTA, and 0.1 mM dithiothreitol were incubated with GdnHCl at the indicated concentration for 2 h. The sample was excited at 282 nm, and fluorescence emission spectra were collected. Login to comment
149 Protein ⌬GD,0 ⌬⌬GD,0 Cm m kJ/mol kJ/mol M kJ/mol/M NBD1 15.5 1.5 10.3 NBD1⌬F 14.4 -1.1 1.3 11.2 NBD1-R553M 16.6 1.1 1.4 11.7 NBD1⌬F-R553M 14.1 -1.4 1.4 10.1 NBD1-S549R 16.7 1.2 1.2 13.4 NBD1-G551D 16.6 1.1 1.4 11.7 reduction in the folding yield in vitro (5) and of the efficiency of maturation and transit to the plasma membrane in vivo (10). Login to comment
176 In addition, G551D does not significantly alter the binding affinity of NBD1-G551D for ATP. Login to comment
177 The effect of the mutation may be due to altered domain-domain interactions or the reduced ability of NBD1-G551D to hydrolyze ATP (7). Login to comment
178 Similarly, the S549R mutation, which like ⌬F508 inhibits the formation of mature functional CFTR in vivo (11), has no discernible effect on the ability of NBD1 to fold (Fig. 4). Login to comment
179 The S549R mutation may alter a surface important for interaction with other CFTR domains or other proteins during the process of conformational maturation. Login to comment
34 25, Issue of June 20, pp. 15739-15744, 1997 (c) 1997 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U.S.A. This paper is available on line at http://www.jbc.org CATTTGACCTCCAC-39 (25 bases); G551D primer, 59-CTTGCTCGTT- GATCTCCACTCAGTG-39 (25 bases); S549R primer, 59-CGTTGAC- CTCCTCTCAGTGTGATTCC-39 (26 bases). Login to comment
57 The expression levels of NBD1-G551D and NBD1-S549R are approximately one-half of the wild-type NBD1 level (data not shown). Login to comment
99 The mGdnHCl values are similar for the NBD1s except for S549R, which has a somewhat larger value indicating that the change in solvent-accessible surface area upon folding is appropriate for a protein of this size. Login to comment
100 These results indicate that the inability of the DF508 and S549R CFTR to transit to the apical membrane and the effect of the R553M suppressor cannot be explained simply by a reduction or enhancement in the free energy of stability of the mutant proteins. Login to comment
109 Protein NBD1 NBD1DF NBD1-R553M NBD1DF-R553M NBD1-S549R NBD1-G551D Kd (mM) 91 88 89 87 81 61 FIG. 3. Login to comment
126 The effects of the S549R and G551D mutations on the temperature-sensitive folding of NBD1 and the rate of formation of off pathway conformers. Login to comment
129 B, formation of off pathway conformers of NBD1 (solid line), NBD1DF (dotted line), NBD1-G551D (dashed line), and NBD1-S549R (dotted and dashed line). Login to comment
135 The 1.8 mM folded NBD1 (cf;), NBD1DF (E), NBD1-R553M (&#e7;), NBD1DF-R553M (&#c9;), NBD1-G551D (f), and NBD1-S549R (M) in 30 mM Tris-HCl, pH 8.0, 40 mM arginine, 0.2 mM EDTA, and 0.1 mM dithiothreitol were incubated with GdnHCl at the indicated concentration for 2 h. The sample was excited at 282 nm, and fluorescence emission spectra were collected. Login to comment
147 Protein DGD,0 DDGD,0 Cm m kJ/mol kJ/mol M kJ/mol/M NBD1 15.5 1.5 10.3 NBD1DF 14.4 21.1 1.3 11.2 NBD1-R553M 16.6 1.1 1.4 11.7 NBD1DF-R553M 14.1 21.4 1.4 10.1 NBD1-S549R 16.7 1.2 1.2 13.4 NBD1-G551D 16.6 1.1 1.4 11.7 reduction in the folding yield in vitro (5) and of the efficiency of maturation and transit to the plasma membrane in vivo (10). Login to comment

PMID: 9222762 [PubMed] Jordanova A et al: "SSCP analysis: a blind sensitivity trial."

No. Sentence Comment

22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment

PMID: 7539210 [PubMed] Rave-Harel N et al: "CFTR haplotype analysis reveals genetic heterogeneity in the etiology of congenital bilateral aplasia of the vas deferens."

No. Sentence Comment

38 The entire studied group of males with CBAVD was tested for 16 CFTR mutations, using DNA-PCR amplification (Saiki et al. 1985, 1988), followed by specific tests as described elsewhere: AF508 (Rommens et al. 1990); W1282X (Shoshani et al. 1992a); G542X, S549R, S549I, and 1717-1G-+A, by direct sequencing of exon 11, using oligonucleotide primers (Zielenski et al. 1991b); N1303K (Osborne et al. 1991); 3849+10Kb C&-T (Highsmith et al. 1994); W1089X and 4010delTATT (Shoshani et al. Login to comment
58 Mutation Analysis Fourteen CF-R mutations that were elsewhere identified among the Israeli CF patient population (Kerem et al. 1994) were analyzed: W1282X, AF508, N1303K, G542X, 3849+10Kb C--T, S549R, S549I, W1089X, 4010delTATT, G85E, 1717-1G--A, D1152H, 405+1G--A, and Q359K1T360K. Login to comment
59 Mutation Analysis Fourteen CF-R mutations that were elsewhere identified among the Israeli CF patient population (Kerem et al. 1994) were analyzed: W1282X, AF508, N1303K, G542X, 3849+10Kb C--T, S549R, S549I, W1089X, 4010delTATT, G85E, 1717-1G--A, D1152H, 405+1G--A, and Q359K1T360K. Login to comment

PMID: 7525963 [PubMed] Chevalier-Porst F et al: "Mutation analysis in 600 French cystic fibrosis patients."

No. Sentence Comment

21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment

PMID: 7505689 [PubMed] Cheadle JP et al: "Direct sequencing of the complete CFTR gene: the molecular characterisation of 99.5% of CF chromosomes in Wales."

No. Sentence Comment

59 C T T G : S S549R heterozygote G A T C 3659 deIC heterozygote C T A G " , T >G -»•Wt__ T A • C T , T A • A C C C . Login to comment
62 S549N (G-A a: 1778) and S549R (T-G at 1779) were sequenced from 1115', 1078 delT from 7i5\ 3659 deIC from 19e3'b, and 3272-26A-G from 17Bi5'. Login to comment
64 17b 18 19 20 21 22 23 24 M1V E60X O220X | R117H G85E 621*1G>T 977msA AF508 I AI607 1898*1G>A G642X 2184delA 1078delT I I 8549N 2184insA I I 1154insTC S549R G651D I R553X I R560T I 1717-1G>A W846X1 3272-26A>G L1077P R12B3U 3669delC 4 016in aT I N1303K 3849*10kbC>T Figure 2. Login to comment

PMID: 7686820 [PubMed] Welsh MJ et al: "Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis."

No. Sentence Comment

17 Classes of CFTR Mutations That Cause CF Class Defect Examples Do- Fre- Clin- main quency ical Protein production Nonsense mutations Frameshift Splice Processing Conduction 6542X NBDI 3.4 3905 insT NBD2 2.1 621 + G-T MSDl 1.3 Al507 NBDl AF506 NBDl s5491 NBDl S549R NED1 A559T NED1 N1303K NBDP G551 D NBDl G551S NBDl G1244E NBDP S1255P NBDP G1349D NBDP RI 17H MSDI R334W MSDl R347P MSDl 0.5 67.2 Rare 0.3 Rare 1.a 2.4 Rare Rare Rare Rare 0.6 0.4 0.5 PI PI PI PI PI PI PI PI PS PI PI PI PS PS PS NED, nucleotide-binding domain; MSD, membrane-spanning domain; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment

PMID: 7689013 [PubMed] Reiss J et al: "A comprehensive CFTR mutation analysis of German cystic fibrosis patients."

No. Sentence Comment

56 Frequency of CFTR mutations checked routinely in German CF patients Mutation AF508 AI507 R553X G542X G551D R347P N1303K 1717 -lg-a S549R others in exon total Exon 10 10 11 11 11 7 21 llfb) 11 ll(c) Frequency 375/500 1/500 17/124(a) 13/124 7/124 6/124 6/124 5/124 2/124 0/124 % of total CF chromosomes 75.1 0.2 3.4 2.6 1.4 1.2 1.2 1.0 0.4 0.0 86.5 Reference (3) (17) (18) (17) (18) (10) (19) (17) (17) (20) (a) Non-AF508 chromosomes. Login to comment

PMID: 1384328 [PubMed] Abeliovich D et al: "Screening for five mutations detects 97% of cystic fibrosis (CF) chromosomes and predicts a carrier frequency of 1:29 in the Jewish Ashkenazi population."

No. Sentence Comment

50 The mutations G551D, S549N, S5491, S549R, and 1717-1 G-OA were analyzed according to the method of Kerem et al. Login to comment
56 The mutations 621 + 1 G-oT, 1717-1 G-oA, S549N, S549I, S549R, G551D, and R553Xwere not foundin our patients. Login to comment

PMID: 1376016 [PubMed] Kristidis P et al: "Genetic determination of exocrine pancreatic function in cystic fibrosis."

No. Sentence Comment

58 Intron 10: 1717-1G-'A Exon 11: G542X .......... S549R ........... G551D .......... R553X .......... R560T .......... Exon 12: Y563N .......... P574H .......... Exon 19: 3659delC ....... Exon 20: W1282X ....... Exon 21: N1303K ..... G460-C A deletion G482-'A A deletion T575-C 621 + 1G-T C1132-T C1172- G C1496-A G1505-'T G1570-T C1609-T 3-bp deletion 3-bp deletion G1690-T G1717-1-A G1756-T T1779-G G1784- A C1789-T G1811-C T1819- A C1853- A C deletion G3978-A C4041-G Asp 110-His Frameshift Arg 117-His Frameshift Ile 148-Thr Splice mutation Arg 334-Trp Arg 347-Pro Ala 455- Glu Gly 458-'Val Gly480-Cys Gln 493- stop del of Ile 507 del of Phe 508 Val 520-Phe Splice mutation Gly 542- stop Ser 549-'Arg Gly 551-WAsp Arg 553- stop Arg 560- Thr Tyr 563- Asn Pro 574-His Frameshift Trp 1282-stop Asn 1303-Lys Dean et al. 1990 White et al. 1991 Dean et al. 1990 Zielenski et al. 1991a F. Rininsland, D. Bozon, and L.-C. Tsui, unpublished data Zielenski et al. 1991a Gasparini et al. 1991 Dean et al. 1990 Kerem et al. 1990b Cuppens et al. 1990 Strong et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1989b Jones et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Cutting et al. 1990 Cutting et al. 1990 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Vidaud et al. 1990 Osborne et al. 1990 PI or PS, but not with both. Login to comment

PMID: 1370365 [PubMed] Shoshani T et al: "Association of a nonsense mutation (W1282X), the most common mutation in the Ashkenazi Jewish cystic fibrosis patients in Israel, with presentation of severe disease."

No. Sentence Comment

29 In a previous study of a small group of Israeli CF patients, four additional rare mutations (1717- 1G--A, G542X, S5491, and S549R) were found (Kerem et al. 1990b). Login to comment
56 The G542X, S5491, S549R, N1303K, and 1717- 1G--A mutations were detected by PCR and subse- quent allele specific oligo nucleotide hybridization as described elsewhere (Kerem et al. 1990b; Osborne et al. 1991). Login to comment
79 Therefore, for assessment of the severity of the W1282X mutation, it would have been appropriate to compare patients homozygous for the W1282X mutation with patients homozygous for the AF508 mutation and with patients heterozygous for Table I Analysis of Mutation Frequencies Identified in 97 Israeli CF Patients JEWISH PATIENTS ARAB Ashkenazim Sepharadim Unclassified PATIENTS No. of chromosomes sampled.... 95 51 8 40 W1282X (no. [%]) .................. 57 (60) 1 (2) 3 (38) 2 (5) AF508 (no. [%])..................... 21 (23) 18 (35) 2 (25) 10 (25) G542X (no. [%]).................... 4 (4) 2 (4)0 2 (5) N1303K (no. [%]) .................. 4 (4) 0 0 2 (5) 1717-1G-A (no. [%]) ............. 1 (1) 0 0 1 (3) S5491 (no. [%])...................... 0 0 0 2 (5) S549R (no. [%])..................... 0 1 (2) 2 (25) 2 (5) Total mutations (no. [%])...... 87 (92) 22 (43) 7 (88) 21 (53) both mutations. Login to comment

PMID: 1370807 [PubMed] Plieth J et al: "Single-strand conformation polymorphism (SSCP) analysis of exon 11 of the CFTR gene reliably detects more than one third of non-delta F508 mutations in German cystic fibrosis patients."

No. Sentence Comment

72 SSCP analysis performed on DNAs of six individuals with the following genotypes (nucleotide change in brackets): lanes W wildtype/wildtype, lanes 1 G551D/wildtype (G-*A), lanes 2 1717- 1G-~A/wildtype (G--~A), lanes 3 G542X/wildtype (G--~T), lanes 4 R553X/wildtype (C----~T),lanes 5 S549R/S549R(T-*G). Login to comment

PMID: 11055897 [PubMed] Hogenauer C et al: "Active intestinal chloride secretion in human carriers of cystic fibrosis mutations: an evaluation of the hypothesis that heterozygotes have subnormal active intestinal chloride secretion."

No. Sentence Comment

57 The remaining patient (patient 6) had only one detected CFTR mutation; however, because this patient definitely Table 1 Demographics and CFTR Mutation Analysis Group and Subject (Sex [Age])a Ethnicityb CFTR Mutation Analysisc CFTR Intron 8 Poly(T) Analysis Parents: 1 (M [28]) White Negative/DF508 7T/9T 2 (F [32]) White Negative/DF508 7T/9T 3 (F [44]) White Negative/DF508 7T/9T 4 (M [36]) AA Negative/DF508 9T/9T 5 (M [54]) White Negative/N1303K 7T/9T 6 (F [24]) White Negative/S549R 7T/7T 7 (F [30]) AA Negative/3120af9;1G-A 7T/7T Patients: 1 (F [20]) White DF508/N1303K 9T/9T 2 (F [22]) White DF508/DF508 9T/9T 3 (F [33]) White DF508/1898af9;1G-A 7T/9T 4 (F [27]) White DF508/DI507 7T/9T 5 (M [28]) White DF508/DF508 9T/9T 6 (F [31]) White Negative/DF508 7T/9T 7 (M [18]) White DF508/M1101K 7T/9T 8 (M [18]) White DF508/M1101K 7T/9T a Members of the patient group had CF; members of the parent group had offspring with CF who were not necessarily included in the present study. Login to comment

PMID: 11755047 [PubMed] Gomez-Llorente MA et al: "Analysis of 31 CFTR mutations in 55 families from the South of Spain."

No. Sentence Comment

30 T I.5 R553X E.11 1078delT E.7 R560T E.11 R347P E.7 S549R E.11 R347H E.7 S549N E.11 R334W E.7 3849 + 10kbC ! Login to comment

PMID: 14698290 [PubMed] Moncalian G et al: "The rad50 signature motif: essential to ATP binding and biological function."

No. Sentence Comment

5 The S793R mutation is analogous to the mutation S549R in the cystic fibrosis transmembrane conductance regulator (CFTR) that results in cystic fibrosis. Login to comment
33 This S793R in the ABC ATPase signature motif of Rad50 is analogous to a mutation in the ABC ATPase CFTR (S549R) that results in cystic fibrosis.27 - 29 The three-dimensional structure of this S793R mutant was solved at 2.1 A da; , and shows that the arginine residue at position 793 disrupts the ATP binding and forms inappropriate contacts with nearby amino acid residues. Login to comment
163 Strains and symbols are the same as in A. domains (NBD), and a serine to arginine change at residue 549 of NBD1 (equivalent to S793R in pfRad50) generates a non-functional transporter protein and consequently the cystic fibrosis disorder,28 suggesting that the same mutation may have similar effects in other proteins containing ABC domains. Login to comment
189 Given that the analogous mutation in CFTR (S549R) results in cystic fibrosis,27 - 29 the important role of the signature motif in coupling ATP interactions to ABC ATPase functions characterized here may be general to all ABC ATPase proteins. Login to comment

PMID: 15463882 [PubMed] Hubert D et al: "Diagnosis of cystic fibrosis in adults with diffuse bronchiectasis."

No. Sentence Comment

47 We used an oligonucleotide ligation assay using a commercially available kit (Cystic Fibrosis Assay, Applied Biosystems, Foster City, CA, USA) to seek 31 mutations in the CFTR gene (F508del, I507del, Q943X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA) which allowed to detect 82% of the CF alleles in France. Login to comment
129 * 31 mutations: F508del, I507del, Q493X, V520F, 1717y1GࡊA, G542X, G551D, R553X, R560T, S549R, S549 N, 3849q10kbCࡊT, 3849q ** 4AࡊG, R1162X, 3659delC, W1282X, 3905insT, 621q1GࡊT, R117H, Y122X, 711q1GࡊT, 1078delT, R347P, R347H, R334 W, A455E, N1303K, G85E, 1898q1GࡊA, 2183AAࡊG, 2789q5GࡊA. that the laboratory criteria for the diagnosis of CF should be expanded to include identification of CFTR mutations and abnormal bioelectrical properties of the nasal epithelium, in addition to the sweat test w7x. Login to comment

PMID: 16963320 [PubMed] Perez MM et al: "CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent."

No. Sentence Comment

42 Some have concentrated in the search of specific mutations that are Table 1 Mutations found in the Latin American CF patients Exon 1 p.L6VÌe; Exon 3 p.W57X, p.R75X, p.G85E Exon 4 p.R117H Exon 6a p.H199Y, p.V201M, p.L206W, p.Q220X, p.V232D, c.846delTÌe; Exon 6b p.Y275XÌe;, c.935delA Exon 7 p.R334W, p.R347P, p.Y362XÌe;, c.1078delT, c.1215delG Exon 8 c.1323_1324insAÌe; Exon 9 c.1460_1461delATÌe;, c.1353_1354insTÌe;,# Exon 10 p.I506T, p.I507del, p.F508del Exon 11 p.G542X, p.S549N, p.S549R, p.G551D, p.G551S, p.R553X, p.L558S, p.A559T, c.1782delA Exon 12 p.S589I Exon 13 p.H609RÌe;, p.P750L, p.V754M, c.1924_1930del, c.2055_2063del, c.2183AA NG;c.2184delA, c.2184delA, c.2185_2186insC, c.2347delG, c.2566_2567insTÌe;, c.2594_2595delGTÌe; Exon 14a p.R851L, c.2686_2687insTÌe; Exon 15 c.2869_2870insG Exon 16 c.3120+1GNA Exon 17a p.I1027T, c.3171delC, c.3199_3204del Exon 17b p.G1061R, p.R1066C, p.W1069X#, p.W1089X, p.Y1092X, p.W1098CÌe; Exon 19 p.R1162X, p.W1204X, p.Q1238X, c.3617_3618delGAÌe;#, c.3659delC Exon 20 p.W1282X, p.R1283M Exon 21 p.N1303K, c.4016_4017insT Exon 22 c.4160_4161insGGGGÌe; 5' flanking c.-834GNT Intron 2 c.297-1GNAÌe;, c.297-2ANG Intron 3 c.406-1GNA Intron 4 c.621+1GNT Intron 5 c.711+1GNT Intron 8 c.IVS8-5T Intron 10 c.1716GNA, c.1717-1GNA Intron 11 c.1811+1.6KbANG, c.1812-1GNA Intron 12 c.1898+1GNA, c.1898+3ANG Intron 14 c.2789+2_2789+3insA, c.2789+5GNA Intron 17a c.3272-26ANG Intron 17b c.3500-2ANGÌe; Intron 19 c.3849+1GNA, c.3849+10KbCNT Intron 20 c.4005+1GNA, c.4005-1GNA# Mutations are listed according to their position in the gene. Login to comment
51 Table 2 p.I507del p.S549N p.S549R p.G551D p.G551S p.R553X p.L558S p.A559T p.S589I p.H609RÌe; p.P750L p.V754M p.R851L p.I1027T p.G1061R p.R1066C p.W1069X# p.W1089X p.Y1092X p.W1098CÌe; p.W1204X 3 0 1 0 1 1 1 1 1 0 4 1 2 3 1 3 0.24 1 0.08 1 0.08 6 0.48 2 0.16 1 0.08 1 0.08 4 0.32 1 0.08 1 4 1 2 1 1 0 0 0 1 0 0 0 1 1 0 1 0 2 0 1 3 0 0 0 0 0 0 1 0.05 1 0.05 1 0.05 10 0.54 1 0.05 2 0.11 3 0.16 3 0 0 0 1 0 1 1 2 0.79 4 1.58 4 1 1 1 1 4 1.83 1 0.46 1 0.46 1 0.46 1 0.46 0 0 0 0 0 0 0 5 5 1 1 1 1 1 1 1 1 1 1 1 5 1.82 6 2.19 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 0.36 1 1.31 1 1.31 1 1.31 10 6 6 6 1 22 1 1 2 1 1 1 1 1 1 6 1 3 5 1 1 0.23 0.14 0.14 0.14 0.02 0.51 0.02 0.02 0.05 0.02 0.02 0.02 0.02 0.02 0.02 0.14 0.02 0.07 0.11 0.02 0.02 (continued on next page) Table 2 Mutation frequencies in Latin American CF patients Country p.Q1238X p.R1283M c.-834GNT c.297-1GNA* c.297-2ANG c.406-1GNA c.621+1GNT c.711+1GNT c.846delT* c.935delA c.1078delT c.1215delG c.1323_1324insA* c.1353_1354insT*# c.1460_1461delAT* Argentina 1 3 1 1 1 1 1 Subtotal and frequency (%) 1 0.08 1 0.08 4 0.32 1 0.08 1 0.08 1 0.08 Brazil 1 1 1 1 0 0 Subtotal and frequency (%) 1 0.05 2 0.11 1 0.05 Chile 0 0 Subtotal and frequency (%) Colombia 1 1 Subtotal and frequency (%) 1 0.46 1 0.46 Costa Rica Frequency (%) 0 Cuba Frequency (%) Ecuador Subtotal and frequency (%) Mexico 1 3 1 2 1 1 Subtotal and frequency (%) 1 0.36 3 1.09 1 0.36 1 0.36 2 0.73 1 0.36 Uruguay Frequency (%) 1 1.31 Venezuela Subtotal and frequency (%) Total 1 1 1 1 1 3 7 2 1 2 1 1 1 1 1 Frequency (%) 0.02 0.02 0.02 0.02 0.02 0.07 0.16 0.05 0.02 0.05 0.02 0.02 0.02 0.02 0.02 (continued ) Table 2 c.1716GNA c.1717-1GNA c.1782delA c.1811+1,6KbANG c.1812-1GNA c.1898+1GNA c.1898+3ANG c.1924_1930del c.2055_2063del c.2183AANG;c.2184delA c.2184delA c.2185_2186insC 5 1 4 1 1 1 0 1 2 2 6 0.48 1 0.08 6 0.48 2 0.16 1 0.08 1 0.08 1 0.08 1 0 6 5 1 3 0 0 0 0 7 0.37 5 0.27 1 0.05 3 0.16 0 0 12 1 12 5.50 1 0.46 0 0 1 1 2 2 1 0.36 1 0.36 2 0.73 2 0.73 1 1.31 1 14 1 18 5 3 1 1 2 6 1 1 0.02 0.32 0.02 0.41 0.11 0.07 0.02 0.02 0.05 0.14 0.02 0.02 (continued on next page) Table 2 Mutation frequencies in Latin American CF patients Country c.2347delG c.2566_2567insT* c.2594_2595delGT* c.2686_2687insT* c.2789+2_2789+3insA c.2789+5GNA c.2869_2870insG c.3120+1GNA c.3171delC c.3199_3204del c.3272-26ANG c.3500-2ANG* Argentina 2 1 2 2 3 3 1 1 2 Subtotal and frequency (%) 2 0.16 1 0.08 2 0.16 2 0.16 6 0.48 1 0.08 1 0.08 2 0.16 Brazil 2 1 1 1 6 0 0 4 0 Subtotal and frequency (%) 2 0.11 1 0.05 1 0.05 10 0.54 1 0.05 Chile Subtotal and frequency (%) Colombia 1 1 1 Subtotal and frequency (%) 1 0.46 1 0.46 1 0.46 Costa Rica Frequency (%) Cuba Frequency (%) Ecuador Subtotal and frequency (%) Mexico 2 Subtotal and frequency (%) 2 0.73 Uruguay Frequency (%) 1 1.31 Venezuela Subtotal and frequency (%) Total 2 2 1 3 2 9 1 12 1 2 2 1 Frequency (%) 0.05 0.05 0.02 0.07 0.05 0.21 0.02 0.28 0.02 0.05 0.05 0.02 (continued ) Table 2 c.3617_3618delGA*,# c.3659delC c.3849+1GNA c.3849+10kbCNT c.4005+1GNA c.4005-1GNA# c.4016_4017insT c.4160_4161insGGGG* c.IVS8-5T Unknown Authors 37 Aulehla-Scholz [17] 2 4 1 2 4 76 Visich [12] 1 78 Iba&#f1;ez [18] 54 Varela 2004 8 Prieto [19] 2 1 1 1 18 Oller-Ramirez 2004 4 0.32 6 0.48 1 0.08 1 0.08 2 0.16 5 0.40 271 21.75 205 Raskin [20] 32 Chiba [21] 1 89 Bernardino [22] 60 Marostica [23] 69 Parizotto [24] 99 Cabello [25,26] 33 Martins [27] 70 Streit [28] 0 5 120 Raskin [15] 0 0 12 Goloni-Bertollo [29] 1 0.05 5 0.27 789 42.46 48 Rios [30] 22 Molina [31] 1 11 Navarro [32] 0 3 34 Repetto [33] 4 1.58 115 45.63 1 67 Keyeux [14] 17 Restrepo [34] 1 0.46 84 38.53 0 25 52.08 Venegas [35] 95 65.97 Collazo [36] 20 Merino [37] 30 Cassiman 2004 15 Paz-y-Mino [38] 65 63.72 1 1 53 Orozco [13] 2 35 Villalobos [39] 3 1.09 1 0.36 88 32.11 11 14.47 Luzardo [40,41] 36 Restrepo [34] 41 Alvarado [42] 77 56.62 1 4 1 18 1 1 2 1 5 1620 0.02 0.09 0.02 0.41 0.02 0.02 0.05 0.02 0.11 37.21 Mutation frequencies in Latin American CF patients most frequently found in Caucasians, by allele specific polymerase chain reaction (AS-PCR), enzymatic digestion, allele specific oligonucleotide hybridization (ASO), or using mainly commercial kits, whereas other studies used a systematic approach to analyse the promoter, coding and exon/ intron boundaries of the CFTR region in the search for any possible mutation. Login to comment
90 Table 4 Mutations with frequencies between 0.1% and 1% Mutation Frequency Country Number of chromosomes % p.R334W 39 0.90 Argentina, Brazil, Chile, Colombia, Uruguay p.G85E 32 0.73 Argentina, Brazil, Ecuador, Mexico, Uruguay p.R553X 22 0.51 Argentina, Brazil, Chile, Mexico, Uruguay c.1811+1.6KbANG 18 0.41 Argentina, Colombia c.3849+10KbCNT 18 0.41 Argentina, Mexico c.1717-1GNA 14 0.32 Argentina, Brazil, Uruguay c.3120+1GNA 12 0.28 Argentina, Brazil Colombia p.I507del 10 0.23 Brazil, Mexico, Uruguay c.2789+5GNA 9 0.21 Argentina, Brazil, Colombia, Uruguay c.621+1GNT 7 0.16 Argentina, Brazil, Mexico p.S549N 6 0.14 Mexico p.S549R 6 0.14 Argentina, Brazil, Colombia p.G551D 6 0.14 Argentina, Mexico p.R1066C 6 0.14 Argentina, Colombia, Mexico c.2183ANG;c.2184delA 6 0.14 Argentina, Mexico p.Y1092X 5 0.11 Colombia, Mexico c.1812-1GNA 5 0.11 Brazil c.IVS8-5T 5 0.11 Argentina c.3659delC 4 0.09 Argentina Unfortunately, at present not all Latin-American countries have started molecular studies in their patients with a probable Cystic Fibrosis diagnosis. Login to comment
111 As discussed, another way to disclose similarities or differences in the distribution of mutations in the CF patients from Latin Table 6 Screening panel of CFTR mutations Country Total number of mutations Minimum panel Detection power Uruguay 12 6 mutations: p.F508del, p.G542X, p.R1162X, p.N1303K (p.R334W, p.G85E) 78% Argentina 52 7 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.R334W, p.G85E) 71% M&#e9;xico 35 8 mutations: p.F508del, p.G542X, p.N1303K (p.R75X, p.I507del, p.S549N,c.406-1GNA, c.3849+10kbGNA) 58% Colombia 19 7 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.S549R, c.1811+1.6kbANG) 56% Brazil 41 6 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.R334W) 53% The total number of mutations found in each country is indicated in the second column from left. Login to comment

PMID: 22043142 [PubMed] Lilley M et al: "Newborn screening for cystic fibrosis in Alberta: Two years of experience."

No. Sentence Comment

46 These include the following mutations: delF508, I507del, G542X, G85E, R117H, 621+1G࢐T, 711+1G࢐T, G551D, R334W, R347P, A455E, 1717-1G࢐A, R560T, R553X, N1303K, 1898+1G࢐A, 2184delA, 2789+5G࢐A, 3120+1G࢐A, R1162X, 3659delC, 3849+10kbC࢐T, W1282X, 1078delT, 394delTT, Y122X, R347H, V520F, A559T, S549N, S549R, 1898+5G࢐T, 2183AA࢐G, 2307insA, Y1092X, M1101K, S1255X, 3876delA and 3905insT. Login to comment
84 TAbLe 1 Mutation frequency Mutation name Number of times detected (247 total mutations) Frequency, % expected, % (reference) delF508* 156 63.2 68.6 (1) R117H* 36 14.6 0.7 (1) G551D* 11 4.5 2.1 (1) 3849+10kbC࢐T* 6 2.4 0.7 (1) M1101K 5 2.0 Undetermined (1) G542X* 4 1.6 2.4 (1) 1717-1G࢐A* 4 1.6 0.7 (1) 621+1G࢐T* 3 1.2 0.9 (1) 3120+1G࢐A* 3 1.2 1.5 (1) G85E* 2 0.8 0.3 (1) A455E* 2 0.8 0.2 (1) R553X* 2 0.8 0.9 (1) 2789+5G࢐A* 2 0.8 0.3 (1) ƊI507* 1 0.4 0.3 (1) 711+1G࢐T* 1 0.4 0.1 (1) R334W* 1 0.4 0.2 (1) N1303K* 1 0.4 1.3 (1) 1898+1G࢐A* 1 0.4 Undetermined (1) 2184delA* 1 0.4 0.1 (1) 394delTT 1 0.4 Undetermined (1) R347H 1 0.4 0.2 (4) V520F 1 0.4 0.2 (4) S549N 1 0.4 0.1 (1) 2307insA 1 0.4 0.2 (1) R347P* 0 0 0.2 (1) R560T* 0 0 0.2 (1) R1162X* 0 0 0.2 (1) 3659delC* 0 0 0.2 (1) W1282X* 0 0 1.4 (1) 1078delT 0 0 0.03 (2) Y122X 0 0 Undetermined (3) A559T 0 0 0.2 (1) S549R 0 0 Undetermined (1) 1898+5G࢐T 0 0 Undetermined (1) 2183AA࢐G 0 0 0.1 (1) Y1092X 0 0 Undetermined (1) S1255X 0 0 0.2 (1) 3876delA 0 0 Undetermined (4) 3905insT 0 0 0.12 (1) *American College of Medical Genetics-recommended mutations TAbLe 2 Positive cystic fibrosis newborn screen summary Screen result Unaffected Affected Further follow-up required Lost to follow-up Total Probable screen 0 23 0 0 23 Inconclusive screen One mutation 179 8 2 2 191 Markedly elevated IRT 2 0 0 0 2 R117H/F508del 0 0 5 0 5 Total 181 31 7 2 221 Data presented as n. IRT Immunoreactive trypsinogen TAbLe 3 F508del/R117H cases ID number Mutation status Sweat test result(s), &#b5;mol/L Other clinical information 24827 F508del/R117H 28 None 23726 F508del/R117H 36/insufficient/20 Fecal elastase normal 22578 F508del/R117H 10 None 24500 F508del/R117H 34/insufficient None 18527 F508del/R117H 29 None 23317 F508del/R117H+5T 47/62 Affected sibling 5T 5 thymine There were 23 newborns with probable screens. Login to comment

PMID: 23199563 [PubMed] Leonard A et al: "[Mucoviscidosis: CFTR mutation-specific therapy: a ray of sunshine in a cloudy sky]."

No. Sentence Comment

178 De re &#b4;centes donne &#b4;es in vitro sugge `rent que cette me &#b4;dication soit e &#b4;galement efficace sur 9 autres mutations de la me c6;me classe (G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, G1349D) [50,51]. Login to comment

PMID: 23454013 [PubMed] Denny RA et al: "Recent developments in targeting protein misfolding diseases."

No. Sentence Comment

58 Examples of class II LOF mutations are F508del, I507del, and S549R. Login to comment

PMID: 23470247 [PubMed] Giordano S et al: "Molecular and functional analysis of the large 5' promoter region of CFTR gene revealed pathogenic mutations in CF and CFTR-related disorders."

No. Sentence Comment

177 On the other hand, a mutation that enhances CFTR expression and mitigates the effect of the S549R mutation has been described.26 c.-5914A>G was identified in an adult patient with a CFTR-RD with both undetected mutations who had only bronchiectasis and a borderline sweat chloride level. Login to comment

PMID: 23775370 [PubMed] Abou Tayoun AN et al: "A comprehensive assay for CFTR mutational analysis using next-generation sequencing."

No. Sentence Comment

53 of cases af9;/af9; c.1521_1523delCTT; c.1521_1523delCTT èc;F508; èc;F508 CF Yes 97 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.350Gb0e;A èc;F508; R117H CF Yes 53; 50 Dartmouth 1 af9;/af9; c.350Gb0e;A; c.1477Cb0e;T R117H; Q493*b CF Yes 52; 49 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.1000Cb0e;T èc;F508; R334W CF Yes 49; 54 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.489af9;1Gb0e;T èc;F508; 621af9;1Gb0e;T CF Yes 48; 47 Dartmouth 1 af9;/af9; c.1521_1523delCTT; c.1364Cb0e;A èc;F508; A455E CF Yes 51; 46 Dartmouth 1 af9;/af9; c.489af9;1Gb0e;T; c.2988af9;1Gb0e;A 621af9;1Gb0e;T; 3120af9;1Gb0e;A CF Yes 48; 49 Coriell 1 af9;/af9; c.1521_1523delCTT; c.1657Cb0e;T èc;F508; R553* CF Yes 44; 49c Coriell 2 af9;/af9; c.1521_1523delCTT; c.3528delC èc;F508; 3659delC CF Yes 46; 46 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.579af9;1Gb0e;T 621af9;1Gb0e;T; 711af9;1Gb0e;T CF Yes 50; 51 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.254Gb0e;A 621af9;1Gb0e;T; G85E CF Yes 50; 45 Coriell 1 af9;/af9; c.1521_1523delCTT; c.1679Gb0e;C èc;F508; R560T CF Yes 44; 52 Coriell 1 af9;/af9; c.489af9;1Gb0e;T; c.1364Cb0e;A 621af9;1Gb0e;T; A455E CF Yes 50; 49 Coriell 1 af9;/af9; c.3909Cb0e;G; c.4046Gb0e;A N1303K; G1349D CF Yes 47; 52 Coriell 1 af9;/af9; c.2657af9;5Gb0e;A; c.2657af9;5Gb0e;A 2789af9;5Gb0e;A; 2789af9;5Gb0e;A CF Yes 100 Coriell 1 af9;/af9; c.1040Gb0e;C; c.1652Gb0e;A R347P; G551D CF Yes 51; 49 Coriell 1 af9;/af9; c.1000Cb0e;T; c.3368-2Ab0e;T R334W; 3500-2Ab0e;G CF Yes 53; 45 Coriell 1 af9;/af9; c.254Gb0e;A; c.3454Gb0e;C G85E; D1152H CF Yes 44; 47 Coriell 1 af9;/af9; c.1521_1523delCTT; c.350Gb0e;A èc;F508; R117H CF Yes 49; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.54-5940_273af9;10250del21kb èc;F508; CFTRdel2,3 CF Yes 47; N/Ad Coriell 1 af9;/af9; c.1521_1523delCTT; c.1766af9;1Gb0e;A èc;F508; 1898af9;1Gb0e;A CF Yes 47; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.2051_2052delAAinsG èc;F508; K684Sfs CF Yes 47; 50 Coriell 1 af9;/af9; c.1521_1523delCTT; c.2052del èc;F508; K684Nfs*38 CF Yes 51; 55 Coriell 1 af9;/afa; c.1521_1523delCTT èc;F508 Carrier Yes 50c Dartmouth 16 af9;/afa; c.1652Gb0e;A G551D Carrier Yes 50c Dartmouth 5 af9;/afa; c.1519_1521delATC èc;I507 Carrier Yes 46 Dartmouth 1 af9;/afa; c.3454Gb0e;C D1152H Carrier Yes 50 Dartmouth 1 af9;/afa; c.1657Cb0e;T R553* Carrier Yes 51 Dartmouth 1 af9;/afa; c.178Gb0e;T E60* Carrier Yes 51 Dartmouth 1 af9;/afa; c.3846Gb0e;A W1282* Carrier Yes 45c Dartmouth 3 af9;/afa; c.1000Cb0e;T R334W Carrier Yes 51 Dartmouth 1 af9;/afa; c.1624Gb0e;T G542* Carrier Yes 47c Dartmouth 4 af9;/afa; c.3484Cb0e;T R1162* Carrier Yes 43 Dartmouth 1 af9;/afa; c.1766af9;1Gb0e;A 1898af9;1Gb0e;A Carrier Yes 57 Dartmouth 1 af9;/afa; c.3773_3774insT 3905insT (L1258Ffs*7) Carrier Yes 37 Dartmouth 1 af9;/afa; c.350Gb0e;A R117H Carrier Yes 50c Dartmouth 3 af9;/afa; c.1645Ab0e;C S549R Ab0e;C Carrier No N/A Dartmouth 1 af9;/afa; c.1040Gb0e;A R347H Carrier Yes 47 Dartmouth 1 af9;/afa; c.3909Cb0e;G N1303K Carrier Yes 46 Dartmouth 1 af9;/afa; c.3718-2477Cb0e;T 3849af9;10kbCb0e;T Carrier Yes 51 Coriell 1 af9;/afa; c.2988af9;1Gb0e;A 3120af9;1Gb0e;A Carrier Yes 49 Coriell 1 af9;/afa; c.489af9;1Gb0e;T 621af9;1Gb0e;T Carrier Yes 50 Coriell 1 af9;/afa; c.1585-1Gb0e;A 1717-1Gb0e;A Carrier Yes 51 Coriell 1 afa;/afa;e N/Af N/A Normal N/A N/A Dartmouth 9 a af9;/af9;, 2 pathogenic mutations; af9;/afa;, carrier of a single pathogenic mutation; afa;/afa;, absence of any pathogenic mutations. Login to comment
96 The missed mutation (S549R; Ab0e;C, c.1645Ab0e;C; Table 1) was expected, because it was masked by one of the primers in our design, a limitation that will be addressed in the Fig. 1. Login to comment

PMID: 23866907 [PubMed] Landaburu I et al: "Genetic testing of sperm donors for cystic fibrosis and spinal muscular atrophy: evaluation of clinical utility."

No. Sentence Comment

51 The panel of mutations studied was: S549N, S549R, R553X, G551D, V520F, I507del, F508del, 3876delA, 1717-1G->A, G542X, R560T, 3120+1G->A, A455E, R117H, 394delTT, 2183AA- >G, 2184delA, 2789+5G->A, 1898+1G->A, 621+1G->T, 711+1G- >T, G85E, R347P, R347H, W1282X, R334W, 1078delT, 3849+10kbC->T, R1162X, N1303K, 3659delC, 3905insT. Login to comment

PMID: 23891399 [PubMed] Van Goor F et al: "Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function."

No. Sentence Comment

28 These include the most common CFTR gating mutation, G551D, as well as the G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D mutations [12]. Login to comment

PMID: 24357848 [PubMed] Zvereff VV et al: "Cystic fibrosis carrier screening in a North American population."

No. Sentence Comment

44 RESULTS The 32-mutation panel is composed of the 23 variants from the ACMG/ACOG screening panel combined with 9 additional mutations, namely, 3876delA, R347H, S549N, 3905insT, 1078delT, V520F, 394delTT, S549R, and 2183AA>G. Login to comment
47 Even the 1078delT mutation that was removed from the ACMG/ ACOG screening panel achieved 0.1% prevalence.8 Only the S549R variant was observed at a lower frequency (0.07%). Login to comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment
80 The Table 3ߒ Frequency of 5T/7T/9T genotypes as a result of R117H reflex testing Poly-T alleles Number of detected alleles (%) CF32 panel CF69 panel 5T/5T 23 (0.44) 2 (0.73) 5T/7T 430 (8.27) 26 (9.49) 5T/9T 38 (0.73) 1 (0.37) 7T/7T 4,103 (78.93) 219 (79.92) 7T/9T 604 (11.61) 26 (9.49) 9T/9T 1 (0.02) 0 Total 5,198 (100) 274 (100) 394delTTd c.262_263delTT 3 0.10 G178Rd p.G178R 3 0.10 V520Fd p.V520F 3 0.10 2143delTd c.2012delT 2 0.06 935delAe c.803delA 2 0.06 A455Eb p.A455E 2 0.06 Q890Xd p.Q890X 2 0.06 S549Rd p.S549R 2 0.06 2869insGd c.2737insG 1 0.03 405ߙ+ߙ3A>Ce c.273ߙ+ߙ3A>C 1 0.03 G480Ce p.G480C 1 0.03 M1101Kd p.M1101K 1 0.03 Y122Xd p.Y122X 1 0.03 Total 3,088 100 a 1898ߙ+ߙ5G>Te , 444delA, G330X, S364Pe , K710X, and S1196X mutations were not detected in the target population. Login to comment

PMID: 24440181 [PubMed] De Boeck K et al: "The relative frequency of CFTR mutation classes in European patients with cystic fibrosis."

No. Sentence Comment

56 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations Large deletions and insertions 1078delT; 1717-1G࢐A; 3659delC; 621+1G࢐T Class II Defective protein processing G85E, F508del, I507del, R560T, N1303K Class III Defective protein regulation ('gating`) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R117H, R334W, R347P Class V Reduced amount of functioning protein 2789+5G࢐A, 3849+10KbC࢐T, A455E Unclassified All other mutations, including those unknown. Login to comment

PMID: 24517344 [PubMed] Raju SV et al: "Impact of heterozygote CFTR mutations in COPD patients with chronic bronchitis."

No. Sentence Comment

81 As expected based on genotype-phenotype correlations in the disease [33], HBE cells derived from a F508del CFTR heterozygote had slightly lower CFTR activity at baseline than wild type monolayers as measured by Table 1 List of CFTR mutations analyzed F508del R117H 1717-1G > A R117C G85E R334W 1898 + 1G > A Y122X A455E R347P 2184delA G178R I507del R553X 2789 + 5G > A G314E G542X R560T 3120 + 1G > A G330X G551D W1282X 3659delC R347H N1303K 621 + 1G > T K710X 406-1G > A R1162X 711 + 1G > T E60X G480C R1066C W1089X V520F A559T S1196X Q1238X S1251N S1255X 663delT 935delA 1161delC 1288insTA 2184insA 2307insA 2711delT 2869insG R709X R764X R1158X 574delA Q493X 1898 + 5G > T 3905insT I506T 3849 + 10kbC > T 712-1G > T Q98R Q552X S549N 1078delT H199Y 444delA S549R (T > G) 2143delT P205S 2043delG 1811 + 1.6kbA > G 3272-26A > G L206W 3791delC Y1092X (C > G) 3199del6 F508C 2108delA Y1092X (C > A) D1152H V520I 3667del4 394delTT 3876delA M1101K 1677delTA W1098X (TGA) 1812-1G > A 4016insT 1609delCA 3171delC response to forskolin stimulation (49.3 &#b1; 11.5 bc;A/cm2 in CFTR (+/+) vs. 40.5 &#b1; 5.3 bc;A/cm2 in CFTR (+/-), although this was not statistically significant (Figure 1A,B). Login to comment

PMID: 24932877 [PubMed] Bell SC et al: "New pharmacological approaches for cystic fibrosis: promises, progress, pitfalls."

No. Sentence Comment

547 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations: G542X, R1162X, RW1282X Deletions and insertions: CFTRdele2,3; 1078delT; 1717-1G ࢐ A; 3659delC; 621+1G N T Class II Defective protein processing G85E, F508del, I507del, R560T, A561E, R1066C, N1303K Class III Defective protein regulation (gating) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R334W, R347P, R117H Class V Reduced amount of functioning protein 2789+5G ࢐ A, 3272-26ANG, 3849+10KbC ࢐ T, A455E Class VI Reduced cell surface stability Rescued F508del, c.120del23 Unclassified All other mutations, including those unknown a F508del-CFTR pocket (at NBD1:ICL4 interface) (Farinha et al., 2013). Login to comment

PMID: 25083129 [PubMed] Pettit RS et al: "CFTR Modulators for the Treatment of Cystic Fibrosis."

No. Sentence Comment

36 At 48 weeks, 67% of patients in the ivacaftor group had not had a pulmonary exacerbation compared with 41% in the Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Ramsey(2011)30 STRIVE: Randomized, double-blind, placebo-controlled G551D Age 12-53 years N = 161 FEV1 40-90% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Percent change in FEV1 from baseline to 24 wks (P < 0.001): IVA, 10.4%; PBO, -0.2% ߦ Percent change in FEV1 from baseline to 48 wks compared with PBO (P < 0.001): IVA, 10.5% ߦ Percent of patients pulmonary exacerbation-free at 48 wks: IVA, 67%; PBO, 41% ߦ Change in body weight from baseline to 48 wks: IVA, 3.1 kg; PBO, 0.4 kg ߦ Sweat chloride change from baseline to 48 wks compared with PBO (P < 0.001): IVA, -48.1 mmol/L ߦ Change in CFQ-R respiratory domain from baseline to 48 wks (P < 0.001): IVA, 5.9 pts; PBO, -2.7 pts Davies (2013)29 ENVISION: Randomized, double-blind, placebo-controlled G551D Age 6-11 years N = 52 FEV1 40-105% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Absolute change in FEV1 percentage from baseline at 48 wks compared with PBO (P < 0.001): IVA, 10% ߦ Absolute change in FEV1 percentage from baseline at 24 wks (P < 0.001): IVA, 12.6%; PBO, 0.1% ߦ Mean change in sweat chloride from baseline to 48 wks compared with PBO (P < 0.001): IVA, -54.3 mmol/L ߦ Body weight change from baseline to 48 wks compared with PBO (P < 0.001): IVA, 2.8 kg ߦ Absolute CFQ-R change from baseline to 24 wks compared with PBO (P = 0.109): IVA, 6.1 pts McKone (2013)31 PERSIST: Open-label extension G551D Age ࣙ 6 years Patients had completed 48 wks of either ENVISION or STRIVE IVA 150 mg b.i.d. 96 wks (patients received 96 wks or 144 wks of IVA depending on ENVISION or STRIVE randomization) ߦ Absolute change in percent predicted FEV1: &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 9.4 &#b1; 8.3 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 9.4 &#b1; 10.8 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: -1.2 &#b1; 7.8 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 9.5 &#b1; 11.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 10.2 &#b1; 15.7 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 10.3 &#b1; 12.4 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: -0.6 &#b1; 10.1 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.5 &#b1; 11.5 ߦ Absolute change in weight (kg): &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 3.4 &#b1; 4.9 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 4.1 &#b1; 7.1 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: 0.3 &#b1; 2.2 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 3 &#b1; 4.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 6.1 &#b1; 2.9 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 14.8 &#b1; 5.7 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: 2.9 &#b1; 1.8 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.1 &#b1; 4.1 ߦ Absolute change in CFQ-R respiratory domain: &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 6.4 &#b1; 16.8 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 6.8 &#b1; 19.6 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: -3.6 &#b1; 14.1 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 9.8 &#b1; 16.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 7.4 &#b1; 17.4 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 10.6 &#b1; 18.9 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: 0.8 &#b1; 18.4 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.8 &#b1; 12.8 CFTR Modulators for the Treatment of Cystic Fibrosis Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Davies (2013)32 Placebo-controlled, double-blind, crossover study G551D Age > 6 years N = 17 FEV1 > 90% LCI > 7.4 Sequence 1: PBO ࢐ WO ࢐ IVA 150 mg b.i.d. Sequence 2: IVA 150 mg b.i.d. ࢐ WO ࢐ PBO 28-day treatment and WO periods ߦ Average change in LCI from baseline compared with PBO (P < 0.0001): IVA, -2.16 (95% CI, -2.88 to -1.44) ߦ Average change in FEV1 from baseline compared with PBO (P = 0.0103): IVA, 8.67 (95% CI, 2.36 to 14.97) ߦ Average change in FEF25-75 from baseline compared with PBO (P = 0.0237): IVA, 16.56 (95% CI, 2.30 to 27.71) Barry (2013)34 Retrospective review G551D Age 20-31 in IVA group N = 21 FEV1 < 40% IVA 150 mg b.i.d. (n = 21); matched controls (n = 35) Median duration, 237 days ߦ Absolute FEV1 change from baseline (P = 0.0075): IVA, 0.125 L; CON, 0.01 L ߦ Percent predicted FEV1 change from baseline (P = 0.0092): IVA, 12.7%, CON, 2.2% ߦ Median weight increase from baseline: IVA, 1.8 kg; CON, 0.1 kg ߦ Median inpatient days per year decreased from 23 days to 0 days in the IVA group (P = 0.001) ߦ Median total intravenous antibiotic days per year decreased from 74 days to 38 days in the IVA group (P = 0.002) De Boeck (2013)37 KONNECTION: Randomized, double-blind, crossover, placebo-controlled Non-G551D gating mutations G178R, G551S, S549N, S549R, G970R, G1244E, S1251N, S1255P, G1349D Age ࣙ 6 years N = 39 FEV1 ࣙ 40% Treatment sequence 1: IVA 150 mg b.i.d. ࢐ WO ࢐ PBO ࢐ open-label Treatment sequence 2: PBO ࢐ WO ࢐ IVA 150 mg b.i.d. ࢐ open-label 8 wks of IVA or PBO; 4-8 wks WO period; 16 wks open label ߦ Absolute change from baseline percent predicted FEV1 (P < 0.0001): IVA, 7.49%; PBO, -3.19% ߦ Absolute change from baseline BMI (P < 0.0001): IVA, 0.68; PBO, 0.02 ߦ Absolute change from baseline in CFQ-R respiratory domain (P = 0.0004): IVA, 8.94 pts; PBO, -0.67 pts ߦ Absolute change from baseline in sweat chloride (mmol/L): IVA, -52.28; PBO, -3.11 Flume (2011)35 Randomized, double-blind, placebo-controlled, parallel group with open-label extension Homozygous F508del Age ࣙ 12 years Part 1: N = 140 Part 2: N = 33 42 patients were eligible for part 2 if change in FEV1 ࣙ 10% or sweat chloride decreased by at least 15 mmol/L at day 15 and week 8 Part 1: IVA 150 mg b.i.d. or PBO 16 wks Part 2: Open label IVA 150 mg b.i.d. Login to comment
56 These promising results led to an FDA label expansion to include CF patients with the following eight mutations in addition to G551D: G178R, S549R, S549N, G551S, G1244E, S1251N, S1255P, and G1349D.38 Clinical Considerations Ivacaftor was well tolerated in clinical trials. Login to comment

PMID: 25088968 [PubMed] Chen JH et al: "A cocktail drug therapy for patients with cystic fibrosis?"

No. Sentence Comment

6 More recently, VX-770 has been approved by the FDA (NDA 203188, www.fda.gov) and recommended by the EMA (EMA/CHMP/365663/2014) for use with an additional eight CF gating (class III) mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D), although, including G551D, these mutations still just occur in ~5% of CF patients worldwide. Login to comment

PMID: 25097766 [PubMed] Fass UW et al: "Defining a mutational panel and predicting the prevalence of cystic fibrosis in oman."

No. Sentence Comment

7 Results: S549R and F508del were the major mutations, accounting for 89% of mutations in the patient population. Login to comment
9 Two carriers, one for F508del and another for S549R, were identified by screening of the volunteer cohort, resulting in a predicted prevalence for Oman of 1 in 8,264. Login to comment
12 Conclusion: The mutational panel for the NAB region and the high proportion of S549R mutations emphasises the need for specific screening for CF in Oman. Login to comment
17 S549R is the predominant disease-causing mutation. Login to comment
20 Application to Patient Care - The predominance of only two major disease-causing CF mutations in the population (S549R and F508del) allows for economically efficient detection methods and a fast confirmation of a clinical CF diagnosis in 89% of cases. Login to comment
52 Restriction digest analysis was used for the screening of the substitution S549R in the volunteer cohort. Login to comment
59 For the estimation of CF prevalence, the allele Table 1: Mutational panel of cystic fibrosis transmembrane conductance regulator (CFTR) mutations of unrelated patients in the North Al Batinah region (N = 14) cDNA name Protein name Legacy name Location at exon # (legacy nomenclature exon #) Number of alleles Allelic frequency c.1647T>G p.Ser549Arg S549R (T>G) 12 (11) 21 0.75 c.1521-1523delCTT p.Phe508del F508del 11 (10) 4 0.14 ߤc.1733-1734delTA p.Leu578Argfs*10 - 13 (12) 2 0.07 c.1175T>G p.Val392Gly V392G 9 (8) 1 0.04 cDNA = complementary deoxyribonucleic acid. Login to comment
63 However, detailed information about CF allele frequencies are available for the NAB region, as determined by the current study, as well as in the neighbouring UAE.11 These findings allow the prediction of CF prevalence in Oman based on the most commonly observed mutations, S549R and F508del. Login to comment
73 The substitution S549R and the three base pair deletion F508del mutations accounted for 89.2% of all disease-causing mutations in the patient cohort [Table 1]. Login to comment
74 S549R was the predominant mutation followed by F508del, with an allele frequency of 0.75 and 0.14, respectively [Table 1]. Login to comment
75 One individual was a compound heterozygote with S549R on one allele and the reported but not yet clinically described alteration c.1175T>G (p.Val392Gly) at exon 9 (or exon 8 using legacy nomenclature) on the other allele.27 The substitution of thymine to guanine results in the amino acid valine being changed to glycine at the position 392. Login to comment
82 The joined allele frequency for F508del and S549R in the NAB region was 0.89, which is very similar to the reported allele frequency of 0.95 for these two mutations in the UAE.11 The total CF allele frequency for F508del and S549R for the whole of Oman is unknown. Login to comment
85 One individual was identified as a carrier for F508del and another individual as a carrier for S549R. Login to comment
86 Applying the average allele frequency for F508del and S549R, the identified mutations accounted for 92% of CF mutations in the population. Login to comment
94 e327 Discussion The substitution S549R and three base pair deletion F508del were found to be the two most common CF mutations in the NAB region of Oman. Login to comment
96 The clinical characteristics were in accordance with recorded homozygote mutations of S549R and F508del in CFTR2, including sweat chloride concentrations above 100 mmol/L, pancreatic insufficiency and diminished pulmonary function.27 The disease liability of S549R was recently confirmed.28 The predominant and characteristic mutation of the current CF cohort was the substitution S549R with an allele frequency of 0.75 [Table 1]. Login to comment
97 The high coverage of CF cases by only two mutations was similar to findings in the UAE, where S549R and F508del were reported to be disease-causing in 95% of the investigated CF cases.27 Concordantly, in all investigated alleles of CF patients in the UAE, the substitution S549R occurred with the highest allele frequency (0.68).29 An explanation for the observed similarity might be the territorial proximity of the two countries and the cultural and historical ties between extended families which may go beyond administrative borders. Login to comment
98 The allele frequency of S549R in an analysis of 27,177 chromosomes from 23 European and three North African countries only accounts for 12 identified chromosomes with S549R, resulting in an allele frequency of 4.4 x 10-4 .15 In addition, to the best of the authors` knowledge, S549R has been reported in six chromosomes of CF patients of Moroccan descent in Israel but in no other Arab epidemiological study of CF.29-31 Therefore, the high allele frequency of S549R in Oman and the UAE might suggest a specific geographical cluster for this substitution. Login to comment
101 Other regional mutations occur with higher frequencies, such as 1548delG in Saudi Arabia18 and E1104X in Libya.19 The observed frequency for S549R in Oman follows exactly this pattern. Login to comment
105 The CF patient in the cohort who was compound heterozygote for c.1175G>T and S549R had mild pancreatic insufficiency and sweat chloride levels of above 100 mmol/L. Login to comment
108 It is significant to note that the mutational panel established in this study, with the predominance of the mutations S549R and F508del, emphasises the need for the development of regional laboratory strategies for fast and effective CF mutational screening and molecular genetic diagnoses. Login to comment
109 For S549R, the disruption of the restriction site of the DraIII enzyme can be considered a fast and cost-efficient screening tool. Login to comment
111 The strategy of screening for potential S549R carrier status in volunteer samples was successfully applied in this study and can be readily adapted for clinical use. In addition, this strategy does not exclude other private mutations which might be identified during the screening of future CF patients. Login to comment
112 However, it appears unlikely that the predominance of S549R identified in the Omani mutational panel of this study, with an allele frequency of 0.75, will be replaced by another as yet unidentified mutation because of the very close similarity to the S549R frequency reported in the UAE. Login to comment
123 Third, the CF mutations S549R and F508del were the major mutations in the area and have also been reported in the UAE which shares a border with the NAB region. Login to comment
124 Therefore, the identification of two carriers in the NAB region but not in any other sample might indicate an increased allele frequency for the CF mutations S549R and F508del in the area. Login to comment
126 From these results, it appears that the major CFTR mutations S549R and F508del follow a spatial north-to-south pattern within the Omani population. Login to comment
131 Conclusion The two predominant CF mutations of S549R and F508del define the mutational panel in Oman. Login to comment
132 The mutation S549R appears to be clustered in one region and occurs with a higher prevalence in the NAB region of Oman. Login to comment

PMID: 25287046 [PubMed] Mornon JP et al: "Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics."

No. Sentence Comment

359 Third, at the level of the NBD1:NBD2 heterodimer, CF-causing mutations are concentrated within the canonical ATP-binding site (S549N, S549R, G551D/G551S, G1244E, S1251N, and S1255P) (Fig. 7d). Login to comment

PMID: 25304080 [PubMed] Dell'Edera D et al: "Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study."

No. Sentence Comment

59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17]. Login to comment

PMID: 25685524 [PubMed] El-Falaki MM et al: "Profile of cystic fibrosis in a single referral center in Egypt."

No. Sentence Comment

130 In some cases, these more frequent mutations may be specific for a subset of the people in the Middle East defined by a common ethnic or religious background, e.g., the 1548delG mutation in Saudi Arabia [18,26], Bedouin tribes in the case of I1234V [27], the S549R (T > G) mutation in Bedouins from the United Arab Emirates and Oman [21], and the 548A > T mutation in Bahrain [28]. Login to comment

PMID: 25867140 [PubMed] Eckford PD et al: "Functional reconstitution and channel activity measurements of purified wildtype and mutant CFTR protein."

No. Sentence Comment

30 While the correctors VX-809 and VX-661 (are not yet approved for use in patients, the potentiator Kalydeco (ivacaftor; VX-770) is being used at 150 mg every 12 hr in CF patients >6 years with at least one G551D-CFTR mutation, and more recently for patients with one of G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D. Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

300 These patients had the following mutations on the other allele: F508del (p.Phe508del) (1 CF-PS, 4 CFTR-RD and 1 CBAVD, including 2 siblings), G85E (p.Gly85Glu) (1 CF-PS), W1282X (p.Trp1282*) (2 CFTR-RD siblings), L320V (p.Leu320Val) (1 CFTR-RD), S549R(A>C) (p.Ser549Arg) (1 CFTR-RD), 711+5G>A (c.579+5G>A) (1 CBAVD) and unknown (1 CBAVD). Login to comment
318 These patients had the following mutations on the other allele: F508del (p.Phe508del) (3 CF-PS, 5 CFTR-RD and 10 CBAVD), N1303K (p.Asn1303Lys) (1 CF-PS, 3 CFTR-RD and 1 CBAVD), 1717-1G>A (c.1585-1G>A) (3 CF-PS and 1 CFTR-RD), W1282X (p.Trp1282*) (3 CFTR-RD), G542X (p.Gly542*) (1 CF-PS, 1 CFTR-RD and 1 CBAVD), Y849X (p.Tyr849*) (1 CFTR-RD), 3849+10kbC>T (c.3717+12191C>T) (1 CFTR-RD), R1162X (p.Arg1162*) (1 CBAVD), S549R(A>C) (p.Ser549Arg) (1 CFTR-RD) and unknown (1 CF-PS and 3 CBAVD). Login to comment
381 [Glu479*;Val754Met] F508del c.1521_1523delCTT CF-PI CF-causing p.Phe508del 1717-8G>A c.1585-8G>A CF-PI CF-causing 1717-1G>A c.1585-1G>A CF-PI CF-causing D529N c.1585G>A CF-PI nd p.Asp529Asn G542X c.1624G>T CF-PI CF-causing p.Gly542* S549R(A>C) c.1645A>C CF-PI CF-causing p.Ser549Arg S549N c.1646G>A CF-PI CF-causing p.Ser549Asn S549R(T>G) c.1647T>G CF-PI CF-causing p.Ser549Arg G551D c.1652G>A CF-PI CF-causing p.Gly551Asp Q552X c.1654C>T CF-PI CF-causing p.Gln552* R553X c.1657C>T CF-PI CF-causing p.Arg553* L558S c.1673T>C CF-PI unknown significance p.Leu558Ser Y569D c.1705T>G CFTR-RD,CBAVD unknown significance p.Tyr569Asp Continued on next page 2 0 | L U C A R E L L I E T A L . Login to comment

PMID: 25940043 [PubMed] Corvol H et al: "Translating the genetics of cystic fibrosis to personalized medicine."

No. Sentence Comment

155 Furthermore, Kalydeco has been tested in patients carrying other class III mutations, or targeted class IVand V mutations (sharing functional similarities with the class III).58 The new trials led to an extension of the FDA and European Medical Agency approval to 8 additional gating mutations: p.Gly178Arg (p.G178R), p.Ser549Asn (p.S549N), p.Ser549Arg (p.S549R), p.Gly551Ser (p.G551S), p.Gly1244Glu (p.G1244E), p.Ser1251Asn (p.S1251N), p.Ser1255Pro (pS1255P), and p.Gly1349Asp (p.G1349D).59 Recently, ivacaftor has also been shown to benefit patients carrying the c.350G . Login to comment

PMID: 26014425 [PubMed] Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."

No. Sentence Comment

79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment

PMID: 26021452 [PubMed] Corvol H et al: "[Challenges of personalized medicine for cystic fibrosis]."

No. Sentence Comment

135 Compte tenu de l`efficacite &#b4; de KalydecoW chez ces patients, le laboratoire VertexW a ensuite teste &#b4;, puis de &#b4;montre &#b4; son efficacite &#b4; chez des patients porteurs d`autres mutations de classe III, ce qui a permis cette anne &#b4;e une extension d`autorisation de mise sur le marche &#b4; (AMM) pour 8 mutations supple &#b4;mentaires : G1244E, G1349D, G178R, G551S, S1251N, S1255P, S549N et S549R [37]. Login to comment

PMID: 26087176 [PubMed] Dupuis A et al: "Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene."

No. Sentence Comment

76 Using the US and Italian data, we calculated equally low MIP scores for G178R (0.09, n = 22), S549N (0.12, n = 39), S1251N (0.07, n = 14), and G1244E (0.0, n = 3), but not for S549R (0.21, n = 14) (Supplementary Table S1 online). Login to comment

PMID: 26115565 [PubMed] Mall MA et al: "Targeting ion channels in cystic fibrosis."

No. Sentence Comment

604 When tested in clinical trials, the potentiator ivacaftor (also known as VX-770) showed a marked clinical benefit, with substantial improvement of lung function, reduction of pulmonary exacerbations, and increase in body weight in CF patients with G551D and 8 additional Class III mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D) [32-35]. Login to comment

PMID: 26210165 [PubMed] Kotha K et al: "Concentration of fractional excretion of nitric oxide (FENO): A potential airway biomarker of restored CFTR function."

No. Sentence Comment

53 Patients enrolled in Cohort 2 (Fig. 1B) included five CF patients with rare CFTR gating mutations (S549N/S549N in three subjects, G178R/F508del in one subject, and S549R/ F508del in one subject) who were candidates for ivacaftor therapy. Login to comment
154 Genotypes of the five individual subjects were S549N/S549N (CF01-03), S549R/F508del (CF04), and G178R/F508del (CF05). Login to comment

PMID: 26386752 [PubMed] Stafler P et al: "The impact of a national population carrier screening program on cystic fibrosis birth rate and age at diagnosis: Implications for newborn screening."

No. Sentence Comment

55 Mutation DF508 G542X W1282X N1303K 3849 + 10kbC- N T D1152H 405 + 1G࢐A G85E S549R W1089X 1717 + 1G࢐A I1234Va Y1092Xb 3121-1G N Ab 3120 + 1kbdel8.6 kbc 2183AA N Gc 4010delTATTc The first 14 mutations served as the panel used for Jewish population carrier screening program during the study period. Login to comment

PMID: 26474553 [PubMed] Lenherr N et al: "Ivacaftor in a young boy with the rare gating mutation S549R--use of lung clearance index to track progress: a case report."

No. Sentence Comment

0 CASE REPORT Open Access Ivacaftor in a young boy with the rare gating mutation S549R - use of lung clearance index to track progress: a case report Nina Lenherrߤ , Marco Lur&#e0;ߤ , Daniel Trachsel, Philipp Latzin and Juerg Hammer* Abstract Background: Ivacaftor acts as a potentiator of the cystic fibrosis transmembrane conductance regulator (CFTR) and increases the transepithelial chloride transport of CFTR in 9 of 10 known gating mutations causing cystic fibrosis. Login to comment
1 S549R is a rare gating mutation considered to be less sensitive to potentiators than all other gating mutations. Login to comment
2 Case presentation: We report our first experience with ivacaftor in an 8-year-old boy with the rare S549R gating mutation. Login to comment
5 Keywords: Cystic fibrosis, Ivacaftor, S549R, Gating mutation, N2MBW, LCI Background Ivacaftor acts as a potentiator of the cystic fibrosis transmembrane conductance regulator (CFTR) and increases the transepithelial chloride (Cl- ) transport of CFTR in 9 of 10 known gating mutations and in R117H mutation (class IV) causing cystic fibrosis. Login to comment
7 In 2014 the approval was extended for 8 additional gating mutations, including S549R. Login to comment
8 S549R is a rare gating mutation (41 described patients in CFTR2 [2]) primarily described in the Bedouin population of the United Arab Emirates, in Saudi Arabia and in North Africa. Login to comment
9 The clinical phenotype seen with the homozygous S549R mutation is generally severe and similar to homozygous deltaF508 mutation [3, 4]. Login to comment
16 We report our first experience with ivacaftor and the usefulness of LCI in a young Swiss patient with the S549R mutation to demonstrate improvements in lung function in response to this therapy when FEV1 is within normal limits. Login to comment
19 Lenherr et al. BMC Pulmonary Medicine (2015) 15:123 DOI 10.1186/s12890-015-0120- Case presentation Case report An 8-year-old boy with S549R/1717-1G > A genotype was started on ivacaftor (150 mg b.i.d.) on compassionate use. Login to comment
32 However, the weakest drug effect was described for the S549R mutation [5]. Login to comment
33 S549R was initially considered a class II mutation leading to defective CFTR protein processing [12]. Login to comment
34 Recent electrophysiological studies using Fischer rat thyroid cells have suggested the presence of a predominant gating defect besides a mild processing defect of CFTR in S549R [5]. Login to comment
36 Against this background, the impressive clinical and functional improvement in our patient with the S549R mutation was better than expected. Login to comment
37 These results are in line with a recently published clinical trial study including four patients with S549R mutation [6]. Login to comment
45 Conclusion This report provides anecdotal evidence of benefit of ivacafor in S549R mutation. Login to comment

PMID: 26526359 [PubMed] Amaral MD et al: "Hallmarks of therapeutic management of the cystic fibrosis functional landscape."

No. Sentence Comment

656 The FDA approval of Ivacaftor for multiple G551D like phenotypic variants including G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D [159,160] found at the cell surface with gating defects [161,162], and the FDA-approval of a combination of Lumacaftor and Ivacaftor for treatment of F508del [156] are examples of successful application of these technologies. Login to comment

PMID: 26547591 [PubMed] Tsabari R et al: "CFTR potentiator therapy ameliorates impaired insulin secretion in CF patients with a gating mutation."

No. Sentence Comment

1 Methods: A standard OGTT was performed before and after 16 weeks of treatment with ivacaftor in 2 sibling patients with CF carrying the S549R gating mutation. Login to comment
58 Further support for our observation is based on an additional case at another CF center where a 13.5 y girl with CF (W1282X/S549R) and BMI of 24.4 was diagnosed with CFRD based on blood glucose level of 206 mg/dl at 120 min during OGTT. Login to comment
66 Improving this specific parameter in the S549R mutation may account for the improvement of the OGTT which may slow down the pathophysiologic cascade leading to overt CFRD. Login to comment
70 The insulin secretion in response to ivacaftor enables early phase insulin action and early normalization or improvement of the OGTT in patients with CFRD In conclusion, we describe the beneficial effect of 4 month ivacaftor treatment on the pathologic OGTT of 2 patients with CF carrying the S549R gating mutation. Login to comment

PMID: 9092029 [PubMed] Durieu I et al: "[Male infertility caused by bilateral agenesis of the vas deferens: a new clinical form of cystic fibrosis?]."

No. Sentence Comment

46 Vingt-deux mutations du gene CFTR ont Cte recher- chtes : les cinq plus frequentes (AF508, G542X, N1303K, 1717-G--A, G85E) et les 17 suivantes : R117H, 556delA, R334W, R347H, R347P, S549N, S5491, S549R, G551D, R553X,R560T,G1244E3,S1255X,W1282X,R1283K,3898 ins C, D1270N. Login to comment