ABCMdb

ABCG5 p.Gln604Glu

Predicted by SNAP2:	A: D (75%), C: D (85%), D: D (85%), E: D (80%), F: D (85%), G: D (91%), H: D (85%), I: D (85%), K: D (85%), L: D (85%), M: D (85%), N: D (80%), P: D (91%), R: D (91%), S: D (80%), T: D (75%), V: D (80%), W: D (95%), Y: D (85%),
Predicted by PROVEAN:	A: N, C: N, D: N, E: N, F: D, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, R: N, S: N, T: N, V: N, W: D, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Identification of a gene, ABCG5, important in the ... Nat Genet. 2001 Jan;27(1):79-83. Lee MH, Lu K, Hazard S, Yu H, Shulenin S, Hidaka H, Kojima H, Allikmets R, Sakuma N, Pegoraro R, Srivastava AK, Salen G, Dean M, Patel SB
Identification of a gene, ABCG5, important in the regulation of dietary cholesterol absorption.
Nat Genet. 2001 Jan;27(1):79-83., [PMID:11138003]

Abstract [show]
The molecular mechanisms regulating the amount of dietary cholesterol retained in the body, as well as the body's ability to exclude selectively other dietary sterols, are poorly understood. An average western diet will contain about 250-500 mg of dietary cholesterol and about 200-400 mg of non-cholesterol sterols. About 50-60% of the dietary cholesterol is absorbed and retained by the normal human body, but less than 1% of the non-cholesterol sterols are retained. Thus, there exists a subtle mechanism that allows the body to distinguish between cholesterol and non-cholesterol sterols. In sitosterolemia, a rare autosomal recessive disorder, affected individuals hyperabsorb not only cholesterol but also all other sterols, including plant and shellfish sterols from the intestine. The major plant sterol species is sitosterol; hence the name of the disorder. Consequently, patients with this disease have very high levels of plant sterols in the plasma and develop tendon and tuberous xanthomas, accelerated atherosclerosis, and premature coronary artery disease. We previously mapped the STSL locus to human chromosome 2p21 and further localized it to a region of less than 2 cM bounded by markers D2S2294 and D2S2291 (M.-H.L. et al., manuscript submitted). We now report that a new member of the ABC transporter family, ABCG5, is mutant in nine unrelated sitosterolemia patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
62 letter 80 nature genetics • volume 27 • january 2001 A G G A A C T G A A T T Arg Asn stop Ile C G A Arg A G G A A C A T Tnormal proband 25 T G AG T C A G CC G G Arg Val stop Ser C G A Arg C G GG T C A G Cnormal proband 140 100 200 300 400 bp 500 M C2C2+ 146 C1+ 113 132 140 41 46 63 M 100 200 300 400 500 bp M 41 46 63 113 132 140 146 C1+ C2+ C2- M AlwNI CAGNNNCTG 1 272 normal 135 141 proband 25 bp bp Ava I CPyCGPuG normal 199 109 proband 140 166 33 109 100 200 300 400 bp 500 100 200 300 400 500 M 22 23 24 25 26 27 C1+ C2+ M bp C2- 500 22 23 M 155 157 158 159 160 C1+ C2+ C2- M 155 156 4000 C C C G T AG A CC A G Gln Asp Pro Val C G C Arg C A G G A C G T A Proband 157 Normal BstUI CGCG 112 196 probands 41, 132, 157 92 normal 112 104 probands 46, 113, 146 204 104 normal 112 10492 exon 6 R243* exon 9 R408* exon 9 R389H exon 9 R419P BstUI CGCG bp bp bp bp bp bp proband 146 C T TC T CC A TA C G Thr His Leu Leu Arg normal C T TC T CC G TA C G 1 GCTCCGGGAA AACCAC---- CTGGGGACCT T--------- -------CCT 50 wild-type 1 GCTCCGGGAA AACCACGCTG CTGGACGCCA TGTCCGGGAG GCTGGGGCGC 50 51 GGGGGGTCCT TCCTGGGGGA GGTGTATGTG AACGGCCGGG CGCTGCGCCG 100 51 GCGGGGACCT TCCTGGGGGA GGTGTATGTG AACGGCCGGG CGCTGCGCCG 100 proband wild-type proband wild-type proband 101 GGAGCAGTTC CAGGACTGCT TCTCCTACGT CCTGCAG... .......... 150101 GGAGCAGTTC CAGGACTGCT TCTCCTACGT CCTGCAG... .......... 150 M wt+mut 63 64 65 66 67 C1 C2 M 61 62 mut wt wt + mut 200bp 400bp 500bp 1 2 3 4 5 6 7 8 9 10 Table 1 • Frequency of nucleotide changes in unrelated Japanese and North Americans of European descent Nucleotide change Predicted consequences Carrier frequency Restriction endonuclease changes C167T P9P not screened gain of BstNI site ∆20 bp at 402 frameshift & truncated protein no carriers in 55 Japanese controls - C867T R243X not screened gain of AlwNI site G1306A R389H no carriers in 145 Japanese and 156 Caucasians Loss of BstUI site C1362T R408X not screened loss of AvaI site G1396A R419H no carriers in 145 Japanese and 156 Caucasians Loss of BstUI site G1396C R419P no carriers in 145 Japanese and 156 Caucasians Loss of BstUI site C1950G Q604E 36% carriers in Caucasians loss of SmlI site Mutations (R243X, R408X, and R419H/P) or polymorphism Q604E were screened in unrelated Japanese and North Americans of European descent, using the restriction assays described in Fig. 2. Login to comment
91 The polymorphic variant, Q604E (open circle) is also within this loop. Login to comment

[hide] Genetic basis of sitosterolemia. Curr Opin Lipidol. 2001 Apr;12(2):141-9. Lee MH, Lu K, Patel SB
Genetic basis of sitosterolemia.
Curr Opin Lipidol. 2001 Apr;12(2):141-9., [PMID:11264985]

Abstract [show]
The molecular mechanisms regulating the amount of dietary cholesterol retained by the body, as well as the body's ability to exclude other dietary sterols selectively, are poorly understood. An average Western diet will contain approximately 250-500 mg of dietary cholesterol and approximately 200-400 mg of non-cholesterol sterols, of which plant sterols are the major constituents. Approximately 50-60% of dietary cholesterol is absorbed and retained by the normal human body, but less than 1% of the non-cholesterol sterols are retained. There thus exists a subtle mechanism that allows the body to distinguish between cholesterol and non-cholesterol sterols. In sitosterolemia, a rare autosomal recessive disorder, affected individuals hyperabsorb and retain not only cholesterol but also all other sterols, including plant and shellfish sterols from the intestine. Consequently, patients with this disease have very high levels of plant sterols in the plasma, and develop tendon and tuberous xanthomas, accelerated atherosclerosis, and premature coronary artery disease. The STSL locus has been mapped to human chromosome 2p21. Mutations in two tandem ABC genes, ABCG5 and ABCG8, encoding sterolin-1 and -2, respectively, are now known to be mutant in sitosterolemia. The identification of these genes should now lead to a better understanding of the molecular mechanism(s) governing the highly selective absorption and retention of cholesterol by the body. Indeed, it is the very existence of this disease that has given credence to the hypothesis that there is a molecular pathway that regulates dietary cholesterol absorption and sterol excretion by the body.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
131 Polymorphisms in ABCG5 and ABCG8 Gene Amino acid changes Nucleotide changes ABCG5 Pro 9 Pro CCC4CCT Gln 604 Glu CAA4GAA ABCG8 Glu 189 Glu GAA4GAG Gln 340 Glu CAG4GAG Lys 400 Thr AAG4ACG Ala 565 Ala GCC4GCT Ala 632 Val GCC4GTC Intron 9±19C4T Intron10 2bp deletion at +35C Intron10±50C4T In12 +22C4G Polymorphic changes detected in ABCG5 and ABCG8 are as documented. Login to comment

[hide] Mutations in ATP-cassette binding proteins G5 (ABC... Hum Mutat. 2001 Oct;18(4):359-60. Hubacek JA, Berge KE, Cohen JC, Hobbs HH
Mutations in ATP-cassette binding proteins G5 (ABCG5) and G8 (ABCG8) causing sitosterolemia.
Hum Mutat. 2001 Oct;18(4):359-60., [PMID:11668628]

Abstract [show]
Sitosterolemia is an autosomal recessive disorder caused by mutations in two adjacent genes encoding coordinately regulated ATP binding cassette (ABC) half transporters (ABCG5 and ABCG8). In this paper we describe three novel mutations causing sitosterolemia: 1) a frameshift mutation (c.336-337insA) in ABCG5 that results in premature termination of the protein at amino acid 197; 2) a missense mutation that changes a conserved residue c.1311C>G; N437K) in ABCG5 and 3) a splice site mutation in ABCG8 (IVS1-2A>G). This study expands the spectrum of the ABCG5 and ABCG8 mutations that cause sitosterolemia. Nine nonsynonymous polymorphisms are also reported: I523V, C600Y, Q604E, and M622V in ABCG5; and D19H, Y54C, T400K, A632V, and Y641F in ABCG8.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Nine nonsynonymous polymorphisms are also reported: I523V, C600Y, Q604E, and M622V in ABCG5; and D19H, Y54C, T400K, A632V, and Y641F in ABCG8. Login to comment
36 Gene Exon NT change AA change Allele frequency RE ABCG5 ABCG8 ex. 11 ex. 13 ex. 13 ex. 13 ex. 1 ex. 2 ex. 8 ex. 13 ex. 13 c.1567 A>G c.1799 G>A c.1810 C>G c.1864 A>G c.52 G>C c.161 A>G c.1199 C>A c.1895 C>T c.1922 A>T I523V C600Y Q604E M622V D19H Y54C T400K A632V Y641F <1% <1% C=0.80/G=0.20 <1% G=0.94/C=0.06 A=0.61/G=0.39 C=0.80/A=0.20 C=0.83/T=0.17 A=0.99/T=0.01 XmnI TsrpI SexAI MseI NcoI MboII *The polymorphisms were found either in sitosterolemic probands or in genomic DNA from 24 individuals with high plasma cholesterol concentrations. Allele frequencies of the nonsynonymous sequence variants identified were determined in 50 unrelated Caucasians. Login to comment

[hide] Heritability of plasma noncholesterol sterols and ... J Lipid Res. 2002 Mar;43(3):486-94. Berge KE, von Bergmann K, Lutjohann D, Guerra R, Grundy SM, Hobbs HH, Cohen JC
Heritability of plasma noncholesterol sterols and relationship to DNA sequence polymorphism in ABCG5 and ABCG8.
J Lipid Res. 2002 Mar;43(3):486-94., [PMID:11893785]

Abstract [show]
The plasma concentrations of cholesterol precursor sterols and plant sterols vary over a 5- to 10-fold range among normolipidemic individuals, and provide indices of the relative rates of cholesterol synthesis and fractional absorption. In the present study, we examined the relative contributions of genetic and environmental factors to variation in the plasma concentrations and sterol-cholesterol ratios of five noncholesterol sterols, including the 5alpha-saturated derivative of cholesterol (cholestanol), two precursors in the cholesterol biosynthesis pathway (desmosterol and lathosterol), and two phytosterols (campesterol and sitosterol). Plasma sterol concentrations were highly stable in 30 individuals measured over a 48 week period. Regression of offspring sterol levels on the parental values indicated that plasma levels of all five noncholesterol sterols were highly heritable. Analysis of monozygotic and dizygotic twin pairs also indicated strong heritability of all five sterols. Two common sequence variations (D19H and T400K) in ABCG8, an ABC half-transporter defective in sitosterolemia, were associated with lower concentrations of plant sterols in parents, and in their offspring.Taken together, these findings indicate that variation in the plasma concentrations of noncholesterol sterols is highly heritable, and that polymorphism in ABCG8 contributes to genetic variation in the plasma concentrations of plant sterols.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
125 Linkage disequilibrium between polymorphisms in ABCG5 and ABCG8 Locus 1 Locus 2 DЈ P ABCG5 Q604E ABCG8 D19H 0.47 0.001 ABCG8 Y54C 0.29 0.095 ABCG8 T400K 0.31 0.299 ABCG8 A632V 0.06 0.451 ABCG8 D19H ABCG8 Y54C 0.62 0.122 ABCG8 T400K 0.63 0.408 ABCG8 A632V 0.04 0.979 ABCG8 Y54C ABCG8 T400K 0.85 0 ABCG8 A632V 0.04 0.959 ABCG8 T400K ABCG8 A632V 0.69 0.016 Haplotypes were determined in 74 nuclear families. Login to comment
126 Linkage disequilibrium between polymorphisms in ABCG5 and ABCG8 Locus 1 Locus 2 D9 P ABCG5 Q604E ABCG8 D19H 0.47 0.001 ABCG8 Y54C 0.29 0.095 ABCG8 T400K 0.31 0.299 ABCG8 A632V 0.06 0.451 ABCG8 D19H ABCG8 Y54C 0.62 0.122 ABCG8 T400K 0.63 0.408 ABCG8 A632V 0.04 0.979 ABCG8 Y54C ABCG8 T400K 0.85 0 ABCG8 A632V 0.04 0.959 ABCG8 T400K ABCG8 A632V 0.69 0.016 Haplotypes were determined in 74 nuclear families. Login to comment
128 Mean plasma sterol concentrations and sterol-cholesterol ratios in unrelated men and women with different ABCG5 and ABCG8 genotypes ABCG8 D19H ABCG8 Y54C ABCG8 T400K ABCG8 A632V ABCG5 Q604E DD n 5 128 DH/HH n 5 14 YY n 5 54 YC/CC n 5 85 TT n 5 95 TK/KK n 5 48 AA n 5 94 VA/VV n 5 49 QQ n 5 91 QE/EE n 5 51 Plasma sterol concentrations Cholesterol 202 6 41 194 6 33 199 6 39 203 6 40 197 6 38 207 6 42 195 6 38 b 213 6 40 198 6 40 204 6 40 Cholestanol 420 6 110 b 340 6 72 400 6 104 419 6 114 410 6 115 418 6 103 400 6 97 437 6 131 411 6 114 416 6 105 Desmosterol 200 6 70 196 6 79 195 6 66 202 6 74 1916 67 221 6 79 197 6 75 210 6 68 197 6 74 208 6 70 Lathosterol 308 6 135 365 6 252 308 6 120 320 6 168 296 6 136 354 6 171 309 6 165 329 6 116 314 6 154 322 6 145 Sitosterol 257 6 105 b 177 6 53 231 6 93 261 6 109 256 6 114 238 6 83 239 6 87 274 6 130 250 6 107 250 6 104 Campesterol 338 6 147 b 233 6 72 310 6 133 339 6 152 332 6 149 324 6 144 308 6 124 a 375 6 177 328 6 154 332 6 136 Plasma sterol-cholesterol ratios (mg/mg) Cholestanol 2.09 6 0.40 c 1.76 6 0.31 2.02 6 0.37 2.07 6 0.39 2.09 6 0.44 2.01 6 0.31 2.06 6 0.41 2.05 6 0.39 2.08 6 0.40 2.04 6 0.42 Desmosterol 0.99 6 0.26 1.00 6 0.32 0.97 6 0.25 0.99 6 0.28 0.96 6 0.25 a 1.06 6 0.30 1.00 6 0.29 0.98 6 0.23 0.98 6 0.27 1.02 6 0.27 Lathosterol 1.53 6 0.60 1.84 6 1.06 1.57 6 0.60 1.57 6 0.70 1.48 6 0.57 a 1.73 6 0.78 1.57 6 0.70 1.56 6 0.57 1.57 6 0.67 1.58 6 0.63 Sitosterol 1.28 6 0.45 c 0.94 6 0.32 1.18 6 0.45 1.29 6 0.45 1.30 6 0.48 a 1.15 6 0.35 1.24 6 0.42 1.29 6 0.51 1.27 6 0.44 1.23 6 0.48 Campesterol 1.67 6 0.62 c 1.21 6 0.36 1.56 6 0.59 1.66 6 0.63 1.68 6 0.62 1.54 6 0.60 1.58 6 0.59 1.74 6 0.65 1.64 6 0.63 1.61 6 0.59 Values are means 6 SD. Plasma cholesterol concentrations are in mg/dl. Login to comment

[hide] ATP binding cassette transporter G5 and G8 genotyp... J Lipid Res. 2004 Apr;45(4):653-6. Epub 2004 Jan 1. Kajinami K, Brousseau ME, Nartsupha C, Ordovas JM, Schaefer EJ
ATP binding cassette transporter G5 and G8 genotypes and plasma lipoprotein levels before and after treatment with atorvastatin.
J Lipid Res. 2004 Apr;45(4):653-6. Epub 2004 Jan 1., [PMID:14703505]

Abstract [show]
The mechanisms responsible for interindividual variation in response to statin therapy remain uncertain. It has been shown that hepatic cholesterol synthesis is associated with ATP binding cassette transporter G5 and G8 (ABCG5/8) activities. To test the hypothesis that genetic variation in ABCG5/8 might influence the plasma lipid response to statin therapy, we examined five nonsynonymous polymorphisms at the ABCG5/8 loci (Q604E, D19H, Y54C, T400K, and A632V) in 338 hypercholesterolemic patients treated with 10 mg atorvastatin. In carriers of the D19H variant, means of posttreatment values and adjusted percent reductions in LDL cholesterol (LDLC) were significantly lower (P = 0.028) and greater (P = 0.036) (112 mg/dl, 39.7%) than those of noncarriers (119 mg/dl, 36.2%), respectively, while no significant difference was observed in percent reductions in total cholesterol. Stepwise multiple regression analysis revealed significant and independent associations with absolute or percent reduction between D19H genotype and posttreatment LDL cholesterol levels. The other polymorphisms were not significantly associated with treatment effects. These results suggest that, in patients with hypercholesterolemia, the ABCG8 D19H variant is associated with greater LDLC-lowering response to atorvastatin therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 To test the hypothesis that genetic variation in ABCG5/8 might influence the plasma lipid response to statin therapy, we examined five nonsynonymous polymorphisms at the ABCG5/8 loci (Q604E, D19H, Y54C, T400K, and A632V) in 338 hypercholesterolemic patients treated with 10 mg atorvastatin. Login to comment
37 In the present study, five prevalent DNA polymorphisms, one in ABCG5 (Q604E) and four in ABCG8 (D19H, Y54C, T400K, and A632V), were studied using a PCR-restriction length polymorphism method. Login to comment
58 RESULTS Genotype, allele, haplotype frequencies, linkage disequilibrium Genotype distributions (wild-type allele homozygote, variant heterozygote, variant homozygote) in each polymorphism were as follows; Q604E (212, 112, 14), D19H (294, 43, 1), Y54C (138, 146, 54), T400K (196, 130, 12), and A632V (225, 96, 17). Login to comment
60 Allele frequencies (wild-type, variant) were Q604E (0.79, 0.21), D19H (0.93, 0.07), Y54C (0.62, 0.38), T400K (0.77, 0.23), and A632V (0.81, 0.19). Login to comment
63 Significant linkage disequilibrium was found in 5 out of 10 pairs of five polymorphisms: Q604E/D19H (D` ϭ 0.6503, P ?d; 0.0001), Q604E/Y54C (-0.3461, 0.0244), D19H/Y54C (-0.9986, 0.0003), Y54C/T400K (-0.4957, 0.0003), and T400K/A632V (-0.5484, 0.0456). Login to comment
38 For the D19H polymorphism, a 131 bp fragment, including a G to C substitution site at codon 19 of the ABCG8 gene, was amplified using an oligonucleotide primer set (5Ј-GCTGGGTCTAAGAGAGCTGC-3Ј and 5Ј-CTTCCCATTGCT- CACTCACC-3Ј) with 35 cycles of amplification (95ЊC for 30 s, 60ЊC for 30 s, and 72ЊC for 30 s). Login to comment

[hide] Polymorphisms in the ABCG5 and ABCG8 genes associa... J Lipid Res. 2004 Sep;45(9):1660-5. Epub 2004 Jun 1. Gylling H, Hallikainen M, Pihlajamaki J, Agren J, Laakso M, Rajaratnam RA, Rauramaa R, Miettinen TA
Polymorphisms in the ABCG5 and ABCG8 genes associate with cholesterol absorption and insulin sensitivity.
J Lipid Res. 2004 Sep;45(9):1660-5. Epub 2004 Jun 1., [PMID:15175352]

Abstract [show]
The roles of polymorphisms of the sitosterolemia genes ABCG5 and ABCG8 in the regulation of cholesterol metabolism and insulin sensitivity were studied in mildly hypercholesterolemic noncoronary subjects (n = 263, 144 men and 119 women) divided into tertiles by baseline serum cholestanol-to-cholesterol ratio (< or = 118.3 and > or = 147.7 10(2) x mmol/mol cholesterol), a surrogate marker of cholesterol absorption efficiency. The lowest cholestanol tertile was associated with high body mass index (BMI), plasma glucose, serum insulin and triglycerides, and cholesterol synthesis markers (cholestenol, desmosterol, lathosterol) and low HDL cholesterol and cholesterol absorption markers (campesterol, sitosterol) (P < 0.01 for all). The 19H allele of the ABCG8 gene accumulated in the lowest cholestanol tertile (P < 0.001) and was associated with low total and LDL cholesterol and absorption markers and with high synthesis markers (P < 0.05 for all). The 604E allele of the ABCG5 gene in men was associated with high BMI, plasma insulin, low serum sitosterol, and high serum cholestenol levels (P < 0.05 for all). In a subgroup of 71 men, the 604E allele was associated with insulin resistance measured with the hyperinsulinemic euglycemic clamp. In conclusion, low cholesterol absorption efficiency was associated with characteristics of the metabolic syndrome. Low serum cholesterol and cholesterol absorption were linked to the D19H polymorphism of the ABCG8 gene, and characteristics of the insulin resistance syndrome in men were linked with the Q604E polymorphism of the ABCG5 gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Low serum cholesterol and cholesterol absorption were linked to the D19H polymorphism of the ABCG8 gene, and characteristics of the insulin resistance syndrome in men were linked with the Q604E polymorphism of the ABCG5 gene.-Gylling, H., M. Hallikainen, J. Pihlajamäki, J. Ågren, M. Laakso, R. A. Rajaratnam, R. Rauramaa, and T. A. Miettinen. Login to comment
91 Because the D19H polymorphism of the ABCG8 gene and the Q604E polymorphism of the ABCG5 gene, the polymorphisms most strongly associated with cholesterol absorption and insulin action, were in linkage disequilibrium, we analyzed the effect of combined genotypes of these two polymorphisms on the levels of cholestanol (a marker of cholesterol absorption) and fasting insulin (a marker of insulin action). Login to comment
92 Figure 2 demonstrates that the D19H polymorphism of the G8 gene was associated more strongly with cholesterol absorption and the Q604E polymorphism of the G5 gene was associated with fasting insulin. Login to comment
97 The D19H polymorphism of the G8 gene was most strongly associated with cholesterol absorption, and the Q604E polymorphism of the G5 gene was associated with insulin action. Login to comment
122 Effect of the combined genotypes of the D19H and Q604E polymorphisms of the G8 and G5 genes on serum cholestanol-to-cholesterol ratio (102 ϫ mmol/mol cholesterol) and serum insulin level (mU/l) in the study population (n ϭ 262). Login to comment
6 Low serum cholesterol and cholesterol absorption were linked to the D19H polymorphism of the ABCG8 gene, and characteristics of the insulin resistance syndrome in men were linked with the Q604E polymorphism of the ABCG5 gene.-Gylling, H., M. Hallikainen, J. Pihlajam&#e4;ki, J. &#c5;gren, M. Laakso, R. A. Rajaratnam, R. Rauramaa, and T. A. Miettinen. Login to comment
89 Because the D19H polymorphism of the ABCG8 gene and the Q604E polymorphism of the ABCG5 gene, the polymorphisms most strongly associated with cholesterol absorption and insulin action, were in linkage disequilibrium, we analyzed the effect of combined genotypes of these two polymorphisms on the levels of cholestanol (a marker of cholesterol absorption) and fasting insulin (a marker of insulin action). Login to comment
90 Figure 2 demonstrates that the D19H polymorphism of the G8 gene was associated more strongly with cholesterol absorption and the Q604E polymorphism of the G5 gene was associated with fasting insulin. Login to comment
95 The D19H polymorphism of the G8 gene was most strongly associated with cholesterol absorption, and the Q604E polymorphism of the G5 gene was associated with insulin action. Login to comment
120 Effect of the combined genotypes of the D19H and Q604E polymorphisms of the G8 and G5 genes on serum cholestanol-to-cholesterol ratio (102 mmol/mol cholesterol) and serum insulin level (mU/l) in the study population (n 262). Login to comment
96 The D19H polymorphism of the G8 gene was most strongly associated with cholesterol absorption, and the Q604E polymorphism of the G5 gene was associated with insulin action. Login to comment
121 Effect of the combined genotypes of the D19H and Q604E polymorphisms of the G8 and G5 genes on serum cholestanol-to-cholesterol ratio (102 mmol/mol cholesterol) and serum insulin level (mU/l) in the study population (n 262). Login to comment

[hide] ATP-binding cassette (ABC) transporters in human m... Physiol Res. 2004;53(3):235-43. Stefkova J, Poledne R, Hubacek JA
ATP-binding cassette (ABC) transporters in human metabolism and diseases.
Physiol Res. 2004;53(3):235-43., [PMID:15209530]

Abstract [show]
The ATP-binding cassette (ABC) superfamily of active transporters involves a large number of functionally diverse transmembrane proteins. They transport a variety of substrates including amino acids, lipids, inorganic ions, peptides, saccharides, metals, drugs, and proteins. The ABC transporters not only move a variety of substrates into and out of the cell, but also are also involved in intracellular compartmental transport. Energy derived from the hydrolysis of ATP is used to transport the substrate across the membrane against a concentration gradient. The typical ABC transporter consists of two transmembrane domains and two nucleotide-binding domains. Defects in 14 of these transporters cause 13 genetic diseases (cystic fibrosis, Stargardt disease, adrenoleukodystrophy, Tangier disease, etc.). Mutations in three genes affect lipid levels expressively. Mutations in ABCA1 cause severe HDL deficiency syndromes called Tangier disease and familial high-density lipoprotein deficiency, which are characterized by a severe deficiency or absence of high-density lipoprotein in the plasma. Two other ABCG transporters, ABCG5 and ABCG8, mutations of which cause sitosterolemia, have been identified. The affected individuals absorb and retain plant sterols, as well as shellfish sterols.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 The other two polymorphisms (Q604E) in ABCG5 and (Y54C) in ABCG8 were not associated with plasma lipid levels. Login to comment

[hide] Polymorphisms in ABCG5 and ABCG8 transporters and ... Physiol Res. 2004;53(4):395-401. Hubacek JA, Berge KE, Stefkova J, Pitha J, Skodova Z, Lanska V, Poledne R
Polymorphisms in ABCG5 and ABCG8 transporters and plasma cholesterol levels.
Physiol Res. 2004;53(4):395-401., [PMID:15311998]

Abstract [show]
ABCG5 and ABCG8 transporters play an important role in the absorption and excretion of sterols. Missence polymorphisms (Gln604Glu in the ABCG5 and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) in these genes have been described. In 131 males and 154 females whose dietary composition markedly changed and lipid parameters decreased over an 8-year follow-up study (total cholesterol decreased from 6.21+/-1.31 mmol/l in 1988 to 5.43+/-1.06 mmol/l in 1996), these polymorphisms were investigated using PCR. Plasma lipid levels and changes in plasma lipid levels were independent of the Gln604Glu polymorphism in ABCG5 and Asp19His and the Ala632Val polymorphisms in ABCG8. The Tyr54Cys polymorphism influenced the degree of reduction in total plasma cholesterol (delta -0.49 mmol/l in Tyr54 homozygotes vs. delta +0.12 mmol/l in Cys54 homozygotes, p<0.04) and LDL-cholesterol (delta -0.57 mmol/l in Tyr54 homozygotes vs. delta +0.04 mmol/l in Cys54 homozygotes, p<0.03) levels between 1988 and 1996 in females, but not in males. Male Thr400 homozygotes exhibited a greater decrease in total cholesterol (delta -0.90 mmol/l vs. delta -0.30 mmol/l, p<0.02) and LDL-cholesterol (delta -0.62 mmol/l vs. delta -0.19 mmol/l, p<0.04) than Lys400 carriers. No such association was observed in females. We conclude that Tyr54Cys and Thr400Lys variations in the ABCG8 gene may play a role in the genetic determination of plasma cholesterol levels and could possibly influence the gender-specific response of plasma cholesterol levels after dietary changes. These polymorphisms are of potential interest as genetic variants that may influence the lipid profile.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Missence polymorphisms (Gln604Glu in the ABCG5 and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) in these genes have been described. Login to comment
7 Plasma lipid levels and changes in plasma lipid levels were independent of the Gln604Glu polymorphism in ABCG5 and Asp19His and the Ala632Val polymorphisms in ABCG8. Login to comment
22 Another two polymorphisms, Ala632Val (Berge et al. 2002) and Gln604Glu (Weggemans et al. 2002), have been suggested to have an effect on plasma cholesterol levels. Login to comment
23 To evaluate the role of the ABCG5 and ABCG8 variants in the genetic determination of plasma lipids, we analyzed non-synonymous polymorphisms in the ABCG5 (C1810G = Gln604Glu) and ABCG8 (G55C = Asp19His, A161G = Tyr54Cys, C1199A = Thr400Lys and C1895T = Ala632Val) genes, and searched for associations between the polymorphisms and plasma lipid levels, and between the polymorphisms and plasma lipid changes over a 8 years´ follow-up. Login to comment
33 Polymorphism Primer sequence PCR product Enzyme Size Allele ABCG8 5`atggccgggaaggcggcagaggagag 83 bp BamH I 83 C (His) Asp19His 5`acttcccattgctcactcaccgagggat 56 + 27 G (Asp) ABCG8 5`agggcctccaggatagattgttctcctc 128 bp Bgl I 128 A (Tyr) Tyr54Cys 5`ccttgaacccaggcgtgcgcctacctg 102 + 26 G (Cys) ABCG8 5`agatgcctggggcggtgcagcagctt 108 bp Afl II 108 C (Thr) Thr400Lys 5`ggcttaatgtgatatacaaagacttggg 81 + 27 A (Lys) ABCG8 5`atgtctgtgtctccagatcctcaggg 105 bp Hae III 105 T (Val) Ala632Val 5`tacaggaccatgaagccaccgctgacgcc 79 + 26 C (Ala) ABCG5 5`aaccacacctgacactgtcaatcttttcct 117 bp Xho I 117 G (Glu) Gln604Glu 5`gggcaggttttctcaatgaattgaattcctc 86 + 31 C (Gln) DNA analysis Three ml of blood collected into EDTA tubes for DNA isolation were diluted with sterile water at a 1:1 ratio and stored at -20 °C. DNA was isolated by a standard method (Miller et al. 1988). Login to comment
53 ABCG5 polymorphism and lipid parameters No association was found between the Gln604Glu polymorphism in the ABCG5 gene and lipid levels either in the general population or in males or females separately (both in 1988 and 1996). Login to comment
58 Polymorphism 11 12 22 N (%) ABCG8 2 34 249 1- His 38 (6.7 %) Asp19His (0.7) (11.9) (87.4) 2- Asp 532 (93.3 %) ABCG8 97 130 58 1- Tyr 324 (56.8 %) Tyr54Cys (34.0) (45.6) (20.4) 2-Cys 246 (43.2 %) ABCG8 178 85 9 1- Thr 441 (81.1 %) Thr400Lys (65.4) (31.3) (3.3) 2- Lys 103 (18.9 %) ABCG8 24 96 165 1- Val 144 (25.3 %) Ala632Val (8.4) (33.7) (57.9) 2- Ala 426 (74.7 %) ABCG5 200 77 8 1- Glu 477 (83.7 %) Gln604Glu (70.0) (27.0) (2.8) 2- Gln 93 (16.3 %) Results are given as numbers (%). Login to comment
52 ABCG5 polymorphism and lipid parameters No association was found between the Gln604Glu polymorphism in the ABCG5 gene and lipid levels either in the general population or in males or females separately (both in 1988 and 1996). Login to comment
57 Polymorphism 11 12 22 N (%) ABCG8 2 34 249 1- His 38 (6.7 %) Asp19His (0.7) (11.9) (87.4) 2- Asp 532 (93.3 %) ABCG8 97 130 58 1- Tyr 324 (56.8 %) Tyr54Cys (34.0) (45.6) (20.4) 2-Cys 246 (43.2 %) ABCG8 178 85 9 1- Thr 441 (81.1 %) Thr400Lys (65.4) (31.3) (3.3) 2- Lys 103 (18.9 %) ABCG8 24 96 165 1- Val 144 (25.3 %) Ala632Val (8.4) (33.7) (57.9) 2- Ala 426 (74.7 %) ABCG5 200 77 8 1- Glu 477 (83.7 %) Gln604Glu (70.0) (27.0) (2.8) 2- Gln 93 (16.3 %) Results are given as numbers (%). Login to comment

[hide] Common sequence variations in ABCG8 are related to... J Lipid Res. 2005 Jan;46(1):68-75. Epub 2004 Nov 1. Plat J, Bragt MC, Mensink RP
Common sequence variations in ABCG8 are related to plant sterol metabolism in healthy volunteers.
J Lipid Res. 2005 Jan;46(1):68-75. Epub 2004 Nov 1., [PMID:15520451]

Abstract [show]
Polymorphisms in the ATP binding cassette (ABC) transporters ABCG5 and ABCG8 are related to plasma plant sterol concentrations. It is not known whether these polymorphisms are also associated with variations in serum plant sterol concentrations during interventions affecting plant sterol metabolism. We therefore decided to study changes in serum plant sterol concentrations with ABCG5/G8 polymorphisms after consumption of plant stanol esters, which decrease plasma plant sterol concentrations. Cholesterol-standardized serum campesterol and sitosterol concentrations were significantly associated with the ABCG8 T400K genotype, as were changes in serum plant sterol concentrations after consumption of plant stanols. The reduction of -57.1 +/- 38.3 10(2) x micromol/mmol cholesterol for sitosterol in TT subjects was significantly greater compared with the -36.0 +/- 18.7 reduction in subjects with the TK genotype (P = 0.021) and the -16.9 +/- 13.0 reduction in subjects with the KK genotype (P = 0.047). Changes in serum campesterol concentrations showed a comparable association. No association with serum LDL cholesterol was found. Genetic variation in ABCG8 not only explains cross-sectional differences in serum plant sterol concentrations but also determines a subject's responsiveness to changes in serum plant sterols during interventions known to affect plant sterol metabolism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 These criteria resulted in the selection of three SNPs: ABCG8 T400K, ABCG8 A632V, and ABCG5 Q604E. Login to comment
54 Statistics Because of the limited number of subjects, and because plant sterol concentrations were not significantly different, heterozygous and homozygous carriers of the genetic variants [ABCG8 T400K (TKϩKK), ABCG8 A632V (VVϩVA), and ABCG5 Q604E (QEϩEE)] were combined before data analysis. Login to comment
61 Frequency distribution of the different genotypes in exons 8 (T400K) and 13 (A632V) of ABCG8 and in exon 13 (Q604E) of ABCG5 Subjects All Control Group Experimental Group All 112 42 70 ABCG8 T400K TT 77 (68.7) 30 (71.4) 47 (67.1) TK 31 (27.7) 11 (26.2) 20 (28.6) KK 4 (3.6) 1 (2.4) 3 (4.3) ABCG8 A632V AA 70 (62.5) 23 (54.8) 47 (67.1) VA 37 (33.0) 17 (40.5) 20 (28.6) VV 5 (4.5) 2 (4.8) 3 (4.3) ABCG5 Q604E QQ 81 (72.3) 33 (78.6) 48 (68.6) QE 29 (25.9) 9 (21.4) 20 (28.6) EE 2 (1.8) 0 (0) 2 (2.9) Values shown are absolute frequencies (with relative frequencies in parentheses). Login to comment
72 RESULTS Frequency distributions for the genotypes in exons 8 (T400K) and 13 (A632V) of ABCG8 and in exon 13 (Q604E) of ABCG5 are shown in Table 2. Login to comment
80 Linkage disequilibrium between genotypes in exons 8 (T400K) and 13 (A632V) of ABCG8 and in exon 13 (Q604E) of ABCG5 Locus 1 Locus 2 DЈ 95% Confidence Interval ABCG8 T400K ABCG8 A632V 0.29 0.03-0.76 ABCG5 Q604E 0.81 0.06-0.97 ABCG8 A632V ABCG5 Q604E 0.0 -0.01-0.22 DЈ and the corresponding 95% confidence intervals were calculated by using all 112 subjects included in the study. Login to comment
81 TABLE 4. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with absolute and cholesterol-standardized serum noncholesterol sterol concentrations Subjects Campesterol Sitosterol Lathosterol Campestanol Sitostanol Absolute concentrations (␮mol/l) All 15.8 Ϯ 5.3 6.0 Ϯ 2.4 5.2 Ϯ 2.1 0.5 Ϯ 0.3 0.4 Ϯ 0.2 ABCG8 T400K TT 16.9 Ϯ 5.5 6.6 Ϯ 2.6 5.0 Ϯ 2.1 0.5 Ϯ 0.4 0.4 Ϯ 0.2 TK/KK 13.5 Ϯ 3.8 4.8 Ϯ 1.4 5.7 Ϯ 2.1 0.5 Ϯ 0.3 0.4 Ϯ 0.2 P value Ͻ0.001 Ͻ0.001 0.070 0.887 0.675 ABCG8 A632V AA 16.3 Ϯ 5.6 6.2 Ϯ 2.6 5.1 Ϯ; 2.0 0.5 Ϯ 0.3 0.4 Ϯ 0.2 VV/VA 15.1 Ϯ 4.8 5.7 Ϯ 2.1 5.4 Ϯ 2.4 0.6 Ϯ 0.4 0.4 Ϯ 0.2 P value 0.280 0.266 0.516 0.349 0.759 ABCG5 Q604E QQ 16.3 Ϯ 5.4 6.3 Ϯ 2.5 5.1 Ϯ 2.1 0.5 Ϯ 0.3 0.4 Ϯ 0.2 QE/EE 14.6 Ϯ 5.0 5.4 Ϯ 2.2 5.4 Ϯ 2.3 0.6 Ϯ 0.4 0.4 Ϯ 0.2 P value 0.125 0.093 0.517 0.043 0.768 Cholesterol-standardized concentrations (102 ϫ ␮mol/mmol cholesterol) All 303.4 Ϯ 98.0 115.0 Ϯ 44.5 97.3 Ϯ 33.5 9.8 Ϯ 6.6 7.6 Ϯ 4.3 ABCG8 T400K TT 324.2 Ϯ 98.5 125.2 Ϯ 45.8 93.2 Ϯ 35.0 9.6 Ϯ 6.8 7.5 ee; 4.4 TK/KK 257.7 Ϯ 80.8 92.4 Ϯ 31.9 106.4 Ϯ 28.4 10.2 Ϯ 6.1 7.7 Ϯ 3.9 P value Ͻ0.001 Ͻ0.001 0.053 0.636 0.862 ABCG8 A632V AA 305.8 Ϯ 95.3 117.3 Ϯ 47.3 95.2 Ϯ 32.2 9.3 Ϯ 6.1 7.6 Ϯ 4.2 VV/VA 299.3 Ϯ 103.3 111.0 Ϯ 39.8 101.0 Ϯ 35.8 10.6 Ϯ 7.2 7.6 Ϯ 4.4 P value 0.736 0.467 0.377 0.332 0.938 ABCG5 Q604E QQ 310.5 Ϯ 98.8 118.3 Ϯ 43.7 95.3 Ϯ 34.8 8.9 Ϯ 5.7 7.6 Ϯ 4.3 QE/EE 284.8 Ϯ 94.9 106.2 Ϯ 46.2 102.7 Ϯ 29.9 11.9 Ϯ 8.1 7.6 Ϯ 4.2 P value 0.216 0.198 0.298 0.029 0.987 Values shown are means Ϯ SD and were analyzed after a 4-week period of consumption of rapeseed oil-based margarine and shortening. Login to comment
87 Subjects with the QQ genotype (ABCG5 Q604E) showed significantly higher serum LDL cholesterol concentrations compared with QE/EE subjects (Table 5). Login to comment
101 TABLE 5. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with serum lipid and lipoprotein concentrations Subjects LDL Cholesterol HDL Cholesterol Triacylglycerol mmol/l All 2.95 Ϯ 0.78 1.59 Ϯ 0.38 0.92 Ϯ 0.52 ABCG8 T400K TT 2.97 Ϯ 0.74 1.59 Ϯ 0.37 0.85 Ϯ 0.47 TK/KK 2.89 Ϯ 0.86 1.60 Ϯ 0.40 1.08 Ϯ 0.58 P value 0.622 0.976 0.025 ABCG8 A632V AA 3.03 Ϯ 0.78 1.58 Ϯ 0.39 0.91 Ϯ 0.48 VV/VA 2.81 Ϯ 0.77 1.61 Ϯ 0.36 0.93 Ϯ 0.58 P value 0.137 0.666 0.883 ABCG5 Q604E QQ 3.04 Ϯ 0.75 1.56 Ϯ 0.35 0.89 Ϯ 0.45 QE/EE 2.70 Ϯ 0.81 1.68 Ϯ 0.43 0.99 Ϯ 0.65 P value 0.039 0.145 0.342 Values shown are means Ϯ SD and were analyzed after a 4-week period of consumption of rapeseed oil-based margarine and shortening. Login to comment
114 However, if ABCG8 transports the same proportion of plant sterols out of the enterocytes and hepatocytes into the lumen and bile, respectively, as before plant stanol ester TABLE 6. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with changes in absolute and cholesterol-standardized serum noncholesterol sterol concentrations after consumption of plant stanol esters Subjects Campesterol Sitosterol Lathosterol Campestanol Sitostanol Absolute concentrations (␮mol/l) Experimental group Control -0.5 Ϯ 2.2 -0.5 Ϯ 1.2 0.0 Ϯ 1.1 -0.0 Ϯ 0.4 0.0 Ϯ 0.2 Stanol -6.3 Ϯ 3.9 -3.0 Ϯ 2.1 0.2 Ϯ 1.4 0.3 Ϯ 0.4 0.3 Ϯ 0.2 P value Ͻ0.001 Ͻ0.001 Ͻ0.001 Ͻ0.001 Ͻ0.001 Genotype group ABCG8 T400K TT -7.0 Ϯ 4.4 -3.4 Ϯ 2.3 0.2 Ϯ 1.2 0.2 Ϯ 0.4 0.3 Ϯ 0.2 TK/KK -4.9 Ϯ 2.4 -2.1 Ϯ 0.9 0.2 Ϯ 1.7 0.3 Ϯ 0.4 0.3 Ϯ 0.2 P value 0.042 0.017 0.989 0.526 0.967 ABCG8 A632V AA -6.5 Ϯ 4.5 -2.9 Ϯ 2.3 0.3 Ϯ 1.1 0.3 Ϯ 0.4 0.3 Ϯ 0.2 VV/VA -6.0 Ϯ 2.7 -3.0 Ϯ 1.6 0.2 Ϯ 1.3 0.2 Ϯ 0.4 0.3 Ϯ 0.2 P value 0.598 0.831 0.836 0.832 0.395 ABCG5 Q604E QQ -6.6 Ϯ 4.3 -3.1 Ϯ 2.3 0.1 Ϯ 1.5 0.2 Ϯ 0.4 0.3 Ϯ 0.2 QE/EE -5.8 Ϯ 3.1 -2.7 Ϯ 1.6 0.6 Ϯ 1.2 0.2 Ϯ 0.4 0.4 Ϯ 0.2 P value 0.448 0.413 0.185 0.956 0.097 Cholesterol-standardized concentrations (102 ϫ ␮mol/mmol cholesterol) Experimental group Control -5.9 Ϯ 39.2 -7.8 Ϯ 22.4 0.5 Ϯ 19.5 -0.6 Ϯ 7.2 0.4 Ϯ 4.0 Stanol -103.1 Ϯ 70.6 -49.3 Ϯ 34.9 17.4 Ϯ 22.2 6.3 Ϯ 8.1 8.2 Ϯ 4.5 P value Ͻ0.001 Ͻ0.001 Ͻ0.001 Ͻ0.001 Ͻ;0.001 Genotype group ABCG8 T400K TT -116.7 Ϯ 76.5 -57.1 Ϯ 38.3 16.5 Ϯ 19.8 6.1 Ϯ 8.3 8.4 Ϯ 4.5 TK/KK -75.4 Ϯ 46.9 -33.5 Ϯ 19.0 19.2 Ϯ 26.7 6.8 Ϯ 7.6 7.7 Ϯ 4.6 P value 0.020 0.007 0.624 0.737 0.541 ABCG8 A632V AA -107.3 Ϯ 75.4 -49.3 Ϯ 38.8 16.0 Ϯ 23.9 6.1 Ϯ 8.3 8.3 Ϯ 4.4 VV/VA -94.6 Ϯ 60.3 -49.4 Ϯ 25.9 20.2 Ϯ 18.3 6.7 Ϯ 7.8 8.0 Ϯ 4.9 P value 0.483 0.998 0.465 0.756 0.780 ABCG5 Q604E QQ -106.3 Ϯ 75.6 -50.9 Ϯ 36.9 14.7 Ϯ 21.3 6.3 Ϯ 8.2 7.6 Ϯ 4.2 QE/EE -96.1 Ϯ 59.2 -46.0 Ϯ 30.6 23.2 Ϯ 23.5 6.3 Ϯ 7.9 9.5 Ϯ 4.9 P value 0.579 0.596 0.140 0.997 0.087 Values shown are means Ϯ SD. Changes in all parameters were calculated as the difference between values at the end of the run-in period (weeks 3 and 4) and the experimental period (weeks 11 and 12). Login to comment
132 Weggemans et al. (30) found that subjects with the ABCG5 Q604E EE genotype had higher serum cholesterol concentrations than carriers with the Q allele. Login to comment
142 TABLE 7. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with changes in lipid and lipoprotein concentrations after consumption of plant stanol esters Subjects LDL Cholesterol HDL Cholesterol Triacylglycerol Control -0.06 Ϯ 0.36 0.01 Ϯ 0.16 0.02 Ϯ 0.23 Stanols -0.42 Ϯ 0.31 0.01 Ϯ 0.12 -0.04 Ϯ 0.30 P value Ͻ0.001 0.903 0.272 ABCG8 T400K TT -0.43 Ϯ 0.32 0.02 Ϯ 0.11 -0.01 Ϯ 0.22 TK/KK -0.38 Ϯ 0.30 -0.01 Ϯ 0.13 -0.09 Ϯ 0.42 P value 0.531 0.345 0.304 ABCG8 A632V AA -0.42 Ϯ 0.32 0.01 Ϯ 0.12 -0.00 Ϯ 0.25 VV/VA -0.41 Ϯ 0.29 -0.00 Ϯ 0.13 -0.10 Ϯ 0.38 P value 0.935 0.588 0.199 ABCG5 Q604E QQ -0.44 Ϯ 0.30 0.01 Ϯ 0.10 -0.01 Ϯ 0.34 QE/EE -0.36 Ϯ 0.34 -0.01 Ϯ 0.16 -0.09 Ϯ 0.18 P value 0.297 0.368 0.357 Values shown are means Ϯ SD. Changes in all parameters were calculated as the difference between values at the end of the run-in period (weeks 3 and 4) and the experimental period (weeks 11 and 12). Login to comment
43 These criteria resulted in the selection of three SNPs: ABCG8 T400K, ABCG8 A632V, and ABCG5 Q604E. Login to comment
53 Statistics Because of the limited number of subjects, and because plant sterol concentrations were not significantly different, heterozygous and homozygous carriers of the genetic variants [ABCG8 T400K (TKKK), ABCG8 A632V (VVVA), and ABCG5 Q604E (QEEE)] were combined before data analysis. Login to comment
60 Frequency distribution of the different genotypes in exons 8 (T400K) and 13 (A632V) of ABCG8 and in exon 13 (Q604E) of ABCG5 Subjects All Control Group Experimental Group All 112 42 70 ABCG8 T400K TT 77 (68.7) 30 (71.4) 47 (67.1) TK 31 (27.7) 11 (26.2) 20 (28.6) KK 4 (3.6) 1 (2.4) 3 (4.3) ABCG8 A632V AA 70 (62.5) 23 (54.8) 47 (67.1) VA 37 (33.0) 17 (40.5) 20 (28.6) VV 5 (4.5) 2 (4.8) 3 (4.3) ABCG5 Q604E QQ 81 (72.3) 33 (78.6) 48 (68.6) QE 29 (25.9) 9 (21.4) 20 (28.6) EE 2 (1.8) 0 (0) 2 (2.9) Values shown are absolute frequencies (with relative frequencies in parentheses). Login to comment
71 RESULTS Frequency distributions for the genotypes in exons 8 (T400K) and 13 (A632V) of ABCG8 and in exon 13 (Q604E) of ABCG5 are shown in Table 2. Login to comment
79 Linkage disequilibrium between genotypes in exons 8 (T400K) and 13 (A632V) of ABCG8 and in exon 13 (Q604E) of ABCG5 Locus 1 Locus 2 D 95% Confidence Interval ABCG8 T400K ABCG8 A632V 0.29 0.03-0.76 ABCG5 Q604E 0.81 0.06-0.97 ABCG8 A632V ABCG5 Q604E 0.0 0.01-0.22 D and the corresponding 95% confidence intervals were calculated by using all 112 subjects included in the study. Login to comment
86 Subjects with the QQ genotype (ABCG5 Q604E) showed significantly higher serum LDL cholesterol concentrations compared with QE/EE subjects (Table 5). Login to comment
100 TABLE 5. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with serum lipid and lipoprotein concentrations Subjects LDL Cholesterol HDL Cholesterol Triacylglycerol mmol/l All 2.95 0.78 1.59 0.38 0.92 0.52 ABCG8 T400K TT 2.97 0.74 1.59 0.37 0.85 0.47 TK/KK 2.89 0.86 1.60 0.40 1.08 0.58 P value 0.622 0.976 0.025 ABCG8 A632V AA 3.03 0.78 1.58 0.39 0.91 0.48 VV/VA 2.81 0.77 1.61 0.36 0.93 0.58 P value 0.137 0.666 0.883 ABCG5 Q604E QQ 3.04 0.75 1.56 0.35 0.89 0.45 QE/EE 2.70 0.81 1.68 0.43 0.99 0.65 P value 0.039 0.145 0.342 Values shown are means SD and were analyzed after a 4-week period of consumption of rapeseed oil-based margarine and shortening. Login to comment
113 However, if ABCG8 transports the same proportion of plant sterols out of the enterocytes and hepatocytes into the lumen and bile, respectively, as before plant stanol ester TABLE 6. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with changes in absolute and cholesterol-standardized serum noncholesterol sterol concentrations after consumption of plant stanol esters Subjects Campesterol Sitosterol Lathosterol Campestanol Sitostanol Absolute concentrations (mol/l) Experimental group Control 0.5 2.2 0.5 1.2 0.0 1.1 0.0 0.4 0.0 0.2 Stanol 6.3 3.9 3.0 2.1 0.2 1.4 0.3 0.4 0.3 0.2 P value 0.001 0.001 0.001 0.001 0.001 Genotype group ABCG8 T400K TT 7.0 4.4 3.4 2.3 0.2 1.2 0.2 0.4 0.3 0.2 TK/KK 4.9 2.4 2.1 0.9 0.2 1.7 0.3 0.4 0.3 0.2 P value 0.042 0.017 0.989 0.526 0.967 ABCG8 A632V AA 6.5 4.5 2.9 2.3 0.3 1.1 0.3 0.4 0.3 0.2 VV/VA 6.0 2.7 3.0 1.6 0.2 1.3 0.2 0.4 0.3 0.2 P value 0.598 0.831 0.836 0.832 0.395 ABCG5 Q604E QQ 6.6 4.3 3.1 2.3 0.1 1.5 0.2 0.4 0.3 0.2 QE/EE 5.8 3.1 2.7 1.6 0.6 1.2 0.2 0.4 0.4 0.2 P value 0.448 0.413 0.185 0.956 0.097 Cholesterol-standardized concentrations (102 mol/mmol cholesterol) Experimental group Control 5.9 39.2 7.8 22.4 0.5 19.5 0.6 7.2 0.4 4.0 Stanol 103.1 70.6 49.3 34.9 17.4 22.2 6.3 8.1 8.2 4.5 P value 0.001 0.001 0.001 0.001 0.001 Genotype group ABCG8 T400K TT 116.7 76.5 57.1 38.3 16.5 19.8 6.1 8.3 8.4 4.5 TK/KK 75.4 46.9 33.5 19.0 19.2 26.7 6.8 7.6 7.7 4.6 P value 0.020 0.007 0.624 0.737 0.541 ABCG8 A632V AA 107.3 75.4 49.3 38.8 16.0 23.9 6.1 8.3 8.3 4.4 VV/VA 94.6 60.3 49.4 25.9 20.2 18.3 6.7 7.8 8.0 4.9 P value 0.483 0.998 0.465 0.756 0.780 ABCG5 Q604E QQ 106.3 75.6 50.9 36.9 14.7 21.3 6.3 8.2 7.6 4.2 QE/EE 96.1 59.2 46.0 30.6 23.2 23.5 6.3 7.9 9.5 4.9 P value 0.579 0.596 0.140 0.997 0.087 Values shown are means SD. Changes in all parameters were calculated as the difference between values at the end of the run-in period (weeks 3 and 4) and the experimental period (weeks 11 and 12). Login to comment
131 Weggemans et al. (30) found that subjects with the ABCG5 Q604E EE genotype had higher serum cholesterol concentrations than carriers with the Q allele. Login to comment
141 TABLE 7. Relationships between genetic polymorphisms in ABCG8 and ABCG5 with changes in lipid and lipoprotein concentrations after consumption of plant stanol esters Subjects LDL Cholesterol HDL Cholesterol Triacylglycerol Control 0.06 0.36 0.01 0.16 0.02 0.23 Stanols 0.42 0.31 0.01 0.12 0.04 0.30 P value 0.001 0.903 0.272 ABCG8 T400K TT 0.43 0.32 0.02 0.11 0.01 0.22 TK/KK 0.38 0.30 0.01 0.13 0.09 0.42 P value 0.531 0.345 0.304 ABCG8 A632V AA 0.42 0.32 0.01 0.12 0.00 0.25 VV/VA 0.41 0.29 0.00 0.13 0.10 0.38 P value 0.935 0.588 0.199 ABCG5 Q604E QQ 0.44 0.30 0.01 0.10 0.01 0.34 QE/EE 0.36 0.34 0.01 0.16 0.09 0.18 P value 0.297 0.368 0.357 Values shown are means SD. Changes in all parameters were calculated as the difference between values at the end of the run-in period (weeks 3 and 4) and the experimental period (weeks 11 and 12). Login to comment

[hide] ATP-binding cassette transporter G8 M429V polymorp... Clin Sci (Lond). 2005 Aug;109(2):183-8. Miwa K, Inazu A, Kobayashi J, Higashikata T, Nohara A, Kawashiri M, Katsuda S, Takata M, Koizumi J, Mabuchi H
ATP-binding cassette transporter G8 M429V polymorphism as a novel genetic marker of higher cholesterol absorption in hypercholesterolaemic Japanese subjects.
Clin Sci (Lond). 2005 Aug;109(2):183-8., [PMID:15816807]

Abstract [show]
The ratio of serum plant sterols to cholesterol is positively correlated with the fractional cholesterol absorption, whereas serum precursors of cholesterol synthesis are positively correlated with cholesterol synthesis. Recently, two ABC (ATP-binding cassette) transporters, ABCG5 and ABCG8, have been described as playing an important role in the absorption and excretion of sterols. In the present study, we tested the hypothesis that genetic variation in ABCG5/ABCG8 influences the levels of serum plant sterol (sitosterol) and cholesterol precursor (lathosterol) in Japanese primary hypercholesterolaemic patients (n = 100). We identified a novel mutation [859T/C (C287R)] and a novel polymorphism [1285A/G (M429V)] at the ABCG5/ABCG8 loci, as well as four polymorphisms reported previously [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1895C/T (A632V)]. In carriers of the novel M429V variant, the serum level of sitosterol and the sitosterol/cholesterol ratio were significantly higher than those in non-carriers (3.64 compared with 2.56 microg/ml, and 1.45 microg/mg compared with 1.00 microg/mg respectively; P < 0.01 for both), and serum lathosterol tended to be lower (1.95 microg/ml compared with 3.03 microg/ml; P = 0.08), whereas no significant difference was observed in other lipid profiles. These four polymorphisms (1810C/G, 161G/A, 1199C/A and 1285A/G) generated six haplotypes, and the C/G/C/G haplotype was significantly associated with a higher sitosterol level and sitosterol/cholesterol ratio compared with the other five haplotypes (P < 0.05 for both). We conclude that, in 8% of patients with hypercholesterolaemia, the novel ABCG8 M429V variant was associated with higher cholesterol absorption efficiency. Future studies should investigate whether these findings have implications for the optimal cholesterol-lowering drug treatment in hypercholesterolaemic patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 We identified a novel mutation [859T/C (C287R)] and a novel polymorphism [1285A/G (M429V)] at the ABCG5/ABCG8 loci, as well as four polymorphisms reported previously [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1895C/T (A632V)]. Login to comment
14 Nucleotide Annealing Position Mutation change* Forward primer (5 → 3 ) Reverse primer (5 → 3 ) temperature (◦ C) Enzyme Size (bp) ABCG5 Exon 7 C287R 859T → C TCACACACTAACTACCTTCTGTTGTC ATGATGGGGAATGTGAAAGAAA 54 BstUI 191 Exon 13 Q604E 1810C → G ATCTAGATTCACAATGAACTTTCTA GTCCCTGCAAGTTGTAAGAG 53 XhoI 193 ABCG8 Exon 2 C54Y 161G → A GGAGGTCAGAGACCTCAAgT GCCCACCCTTTTATTTCCAC 56 RsaI 107 Exon 8 T400K 1199C → A ACACCTGTGTGGAAAGGTAAGGT GCGGGTTCAGTAATAAAATGACAG 57 MseI 216 Exon 9 M429V 1285A → G ATGCTGTTGCCTCAGCATCT AAGCTGTGTTCCTCTGAGCT 56 Tsp45I 306 Exon 13 A632V 1895C → T ATGTCTGTGTCTCCAGATCCTCAGgG TACAGGACCATGAAGCCACCGCTGAcGCC 63 HaeIII 105 sterols to cholesterol are known to be positively related to cholesterol absorption and negatively to cholesterol synthesis [1-4]. Login to comment
21 Indeed, it was previously proposed that common sequence variants in ABCG5 (Q604E) and ABCG8 (D19H and T400K) are associated with plasma plant sterol and lipid levels in normocholesterolaemic or mildly hypercholesterolaemic European-American populations [10-12]. Login to comment
48 Frequency distributions for the genotypes in exon 7 (C287R) and exon 13 (Q604E) of ABCG5, and in exon 2 (C54Y), exon 8 (T400K), exon 9 (M429V) and exon 13 (A632V) of ABCG8 are shown in Table 3. Login to comment
51 Parameters Value Age (years) 62.4 +- 12.1 Gender (men/women) 48/52 BMI (kg/m2 ) 23.0 +- 3.5 Total cholesterol (mg/dl) 261 +- 48 Triacylglycerol (mg/dl) 135 +- 69 HDL-C (mg/dl) 56 +- 16 LDL-C (mg/dl) 179 +- 48 Sitosterol (µg/ml) 2.63 +- 1.0 Lathosterol (µg/ml) 3.00 +- 1.3 Table 3 Genotype distribution and allele frequencies of the polymorphisms in the ABCG5/ABCG8 gene Gene Mutation Nucleotide change Polymorphism Allele frequency ABCG5 Exon 7 C287R 859T → C T 0.99 C 0.01 Exon 13 Q604E 1810C → G C 0.89 G 0.11 ABCG8 Exon 2 C54Y 161G → A G 0.82 A 0.18 Exon 8 T400K 1199C → A C 0.88 A 0.12 Exon 9 M429V 1285A → G A 0.96 G 0.04 Exon 13 A632V 1895C → T C 0.995 T 0.005 found and the A632V variant was rare in our Japanese subjects. Login to comment
57 Sitosterol Lathosterol Sitosterol/chol Polymorphism Genotype n (µg/ml) P value (µg/ml) P value (µg/mg) P value Lathosterol/chol (µg/mg) P value ABCG5 Exon 13 Q604E (1810C → G) QQ 78 2.63 +- 1.06 0.81 2.97 +- 1.36 0.73 1.03 +- 0.3 0.97 1.19 +- 0.55 0.84 QE 21 2.69 +- 0.72 3.09 +- 1.12 1.03 +- 0.40 1.16 +- 0.38 EE 1 1.2 3.2 0.6 1.57 ABCG8 Exon 2 C54Y (161G → A) CC 67 2.69 +- 0.98 0.19 2.82 +- 1.11 0.06 1.05 +- 0.36 0.06 1.12 +- 0.45 0.2 CY 30 2.57 +- 1.06 3.20 +- 1.33 1.02 +- 0.43 1.27 +- 0.57 YY 3 1.93 +- 0.31 4.23 +- 3.17 0.65 +- 0.12 1.38 +- 0.98 ABCG8 Exon 8 T400K (1199C → A) TT 76 2.64 +- 0.98 0.85 2.87 +- 1.10 0.14 1.03 +- 0.37 0.96 1.14 +- 0.45 0.17 TK 24 2.60 +- 1.07 3.34 +- 1.70 1.03 +- 0.44 1.31 +- 0.66 KK 0 ABCG8 Exon 9 M429V (1285A → G) MM 92 2.56 +- 0.94 0.003 3.03 +- 1.30 0.08 1.00 +- 0.36 0.002 1.19 +- 0.51 0.16 MV 8 3.64 +- 1.26 1.95 +- 0.53 1.45 +- 0.56 0.84 +- 0.36 VV 0 Table 5 Effect of the four polymorphism haplotypes in the ABCG5/ABCG8 gene on serum non-cholesterol levels Values are means +- S.D. The haplotype effects on serum non-cholesterol levels were assigned in all individuals using PHASE in 94 individuals. Login to comment
67 Of the 16 possible four-polymorphism haplotypes [1810C/G (Q604E), 161G/A (C54Y), 1199C/A (T400K) and 1285A/G (M429V)], six haplotypes were estimated to be present. Login to comment
75 This result does not appear to be consistent with previous reports that the sequence variants in ABCG5 (Q604E) and ABCG8 (D19H and T400K) are associated with lower serum plant sterol levels in Western countries [10-12]. Login to comment
76 The results of our present study suggest that the frequencies of D19H and A632V variants of ABCG8 are rarer in Japanese than in European-American populations, and that these Q604E and T400K variants may not be as important in the regulation of non-cholesterol sterol levels in Japanese populations. Login to comment

[hide] Stomatocytic haemolysis and macrothrombocytopenia ... Br J Haematol. 2005 Jul;130(2):297-309. Rees DC, Iolascon A, Carella M, O'marcaigh AS, Kendra JR, Jowitt SN, Wales JK, Vora A, Makris M, Manning N, Nicolaou A, Fisher J, Mann A, Machin SJ, Clayton PT, Gasparini P, Stewart GW
Stomatocytic haemolysis and macrothrombocytopenia (Mediterranean stomatocytosis/macrothrombocytopenia) is the haematological presentation of phytosterolaemia.
Br J Haematol. 2005 Jul;130(2):297-309., [PMID:16029460]

Abstract [show]
Phytosterolaemia (sitosterolaemia) is a recessively inherited metabolic condition in which the absorption of both cholesterol and plant-derived cholesterol-like molecules at the gut is unselective and unrestricted. In haematology, Mediterranean stomatocytosis or Mediterranean macrothrombocytopenia is a poorly understood haematological condition that combines stomatocytic haemolysis with the presence of very large platelets. Five pedigrees showing this haematology were identified. Gas chromatography mass spectrometry (GC-MS) showed that all of the patients with this highly specific haematology had grossly elevated levels of phytosterols in the blood, diagnostic of phytosterolaemia. All showed mutations in the ABCG5 and ABCG8 previously linked to phytosterolaemia. Three pedigrees showed five new mutations, while two pedigrees showed the common W361X mutation in ABCG8. We draw the following four conclusions: (i) that Mediterranean stomatocytosis/macrothrombocytopenia is caused by an excess of phytosterols in the blood; (ii) that phytosterolaemia, which does not respond to standard statin treatment, can be diagnosed via the distinctive haematology described here, even when the cholesterol is normal; (iii) that phytosterolaemia should be considered in the differential diagnosis of all patients with large platelets; and (iv) that the platelet size should be noted in patients with hypercholesterolaemia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
174 Family Sitosterol level (lmol/l) ABCG5 ABCG8 A E77X (229G>T) A-I-2 44 m/n A-II-1 1471 m/m A-II-2 17 n/n A-II-3 57 n/n A-II-4 970 m/m A-II-5 625 m/m A-II-9 508 m/m B IVS11+3insT R50C (148C>T) E146X (436G>T), M622V (1864A>G) B-I-1 77 n/n m/n B-I-2 42 m/n n/n B-II-1 2230 m/n m/n B-II-2 2350 m/n m/n B-II-3 137 n/n m/n C Q604E (1810C>G) Q271X (811C>T) IV9-3insT IV8-1G/A C54Y (161G>A) C-I-1 114 m/n n/n m/n m/n C-I-2 29 m/m m/n n/n m/m C-II-1 2100 m/n m/n m/n m/n C-II-2 2580 m/n m/n m/n m/n D W361X (1083G>A) D-I-1 22 m/n D-II-1 715 m/m E W361X (1083G>A) E-I-1 23 m/n E-II-1 1844 m/m E-II-2 21 n/n Mutations are shown in bold and large font. Login to comment
175 Polymorphisms (R50C and Q604E in ABCG5, C54Y in ABCG8) are shown in italics. Login to comment

[hide] A detailed Hapmap of the Sitosterolemia locus span... BMC Med Genet. 2006 Feb 28;7:13. Pandit B, Ahn GS, Hazard SE, Gordon D, Patel SB
A detailed Hapmap of the Sitosterolemia locus spanning 69 kb; differences between Caucasians and African-Americans.
BMC Med Genet. 2006 Feb 28;7:13., [PMID:16507104]

Abstract [show]
BACKGROUND: Sitosterolemia is an autosomal recessive disorder that maps to the sitosterolemia locus, STSL, on human chromosome 2p21. Two genes, ABCG5 and ABCG8, comprise the STSL and mutations in either cause sitosterolemia. ABCG5 and ABCG8 are thought to have evolved by gene duplication event and are arranged in a head-to-head configuration. We report here a detailed characterization of the STSL in Caucasian and African-American cohorts. METHODS: Caucasian and African-American DNA samples were genotypes for polymorphisms at the STSL locus and haplotype structures determined for this locus RESULTS: In the Caucasian population, 13 variant single nucleotide polymorphisms (SNPs) were identified and resulting in 24 different haplotypes, compared to 11 SNPs in African-Americans resulting in 40 haplotypes. Three polymorphisms in ABCG8 were unique to the Caucasian population (E238L, INT10-50 and G575R), whereas one variant (A259V) was unique to the African-American population. Allele frequencies of SNPs varied also between these populations. CONCLUSION: We confirmed that despite their close proximity to each other, significantly more variations are present in ABCG8 compared to ABCG5. Pairwise D' values showed wide ranges of variation, indicating some of the SNPs were in strong linkage disequilibrium (LD) and some were not. LD was more prevalent in Caucasians than in African-Americans, as would be expected. These data will be useful in analyzing the proposed role of STSL in processes ranging from responsiveness to cholesterol-lowering drugs to selective sterol absorption.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Only two loci in ABCG5, R50C and Q604E showed variations in our study population, the remaining 4 SNPs were invariant in all subjects and are not depicted in the haplotype analyses. Login to comment
106 and INT1-7, and to a lesser extent between INT1-7 and both 5'UTR-19 and Q604E (Table 4). Login to comment
132 The only cSNP we could estimate by this methodology in ABCG5 was Q604E (~4,000 y old). Login to comment
144 A number of studies have been implicated this locus in disease (or physiologi- Table 4: Results of pair-wise LD analyses Population M1 M2 ChiSq Pval ∆2 D' Caucasian INT1-21 INT1-7 20.01 1E-05 0.545 0.866 5'UTR-19 INT1-7 9.61 0.002 0.256 0.594 Q604E INT1-7 7.14 0.008 0.239 0.489 T400K A632V 6.13 0.013 0.125 1.000 5'UTR-19 T400K 5.84 0.016 0.153 1.000 Q604E D19H 5.02 0.025 0.174 1.000 INT1-7 T400K 4.94 0.026 0.111 1.000 R50C D19H 4.79 0.029 0.234 0.484 INT1-21 T400K 4.45 0.035 0.153 1.000 E238L INT10-50 4.42 0.036 0.238 1.000 INT1-7 C54Y 4.41 0.036 0.138 0.739 5'UTR-19 C54Y 4.24 0.040 0.134 0.619 T400K INT10-50 3.92 0.048 0.040 1.000 5'UTR-19 A565A 3.86 0.049 0.127 1.000 Q604E INT1-21 3.66 0.056 0.128 0.420 INT10-50 A632V 3.29 0.070 0.132 0.641 5'UTR-19 INT1-21 2.86 0.091 0.071 0.267 C54Y T400K 2.74 0.098 0.082 0.433 African-American 5'UTR-19 T400K 11.01 9E-04 0.080 1.000 INT1-7 A565A 8.09 0.004 0.085 0.587 R50C D19H 6.96 0.008 0.205 1.000 T400K A565A 6.56 0.010 0.088 0.557 Q604E INT1-21 5.82 0.016 0.119 0.505 5'UTR-19 A565A 5.10 0.024 0.059 0.460 C54Y A565A 3.93 0.047 0.053 0.270 5'UTR-19 C54Y 3.49 0.062 0.047 0.481 R50C INT1-7 3.05 0.081 0.044 1.000 INT1-7 A632V 3.05 0.081 0.044 1.000 Q604E D19H 3.01 0.083 0.038 1.000 M1 = 1st marker in pair of SNPs, M2 = 2nd marker in pair of SNPs, ChiSq = Value of chi-square test of association, Pval = Two-sided P-value corresponding to chi-square value in ChiSq column assuming 1 degree of freedom. Login to comment
166 SNPs in intron 1 of ABCG8 show some linkage to a common non-synonymous SNP, Q604E, in ABCG5, but present in exon 13 (almost 20 kb apart). Login to comment
177 SNP Allele Number of Disease Chromosomes* Number of Healthy Chromosomes* Frequency (disease chromosome) Frequency (healthy chromosome) Recombination Fraction Age Estimate (generations) R50C C 12 12 1 1 NA Q604E G 2 1 0.167 0.083 0.058833 17.7 5'UTR-19 T 11 10 0.917 0.833 0.033059 9.1 D19H G 12 12 1 1 NA NA INT1-21 C 12 7 1 0.583 0.005 0 INT1-7 C 11 11 0.917 0.917 NA C54Y A 9 5 0.75 0.417 0.02749 8.8 E238L G 12 12 1 1 NA T400K A 10 3 0.833 0.25 0.0002 2387 INT10-50 T 12 12 1 1 NA A565A C 12 12 1 1 NA G575R G 12 12 1 1 NA A632V C 11 10 0.917 0.833 0.005692 52.9 *Out of a total of 12 disease and 12 normal chromosomes, see Methods and ABCG8 are proposed to function as obligate heterodimers [54], and complete mutations in either gene seems to result in an identical phenotype [8], these genetic findings posit an enigma. Login to comment

[hide] Messenger RNA levels of genes involved in dysregul... Diabetologia. 2006 May;49(5):1008-16. Epub 2006 Mar 4. Lally S, Tan CY, Owens D, Tomkin GH
Messenger RNA levels of genes involved in dysregulation of postprandial lipoproteins in type 2 diabetes: the role of Niemann-Pick C1-like 1, ATP-binding cassette, transporters G5 and G8, and of microsomal triglyceride transfer protein.
Diabetologia. 2006 May;49(5):1008-16. Epub 2006 Mar 4., [PMID:16518588]

Abstract [show]
AIMS/HYPOTHESIS: The aim of the present study was to examine the relationship between chylomicron composition and expression of genes that regulate chylomicron production in the intestine. We examined expression of the following: (1) Niemann-Pick C1-like 1 (NPC1L1), which regulates cholesterol absorption; (2) ATP-binding cassette transporters G5 and G8 (ABCG5, ABCG8), which regulate cholesterol homeostasis through their ability to excrete enterocyte cholesterol back into the lumen of the intestine; and (3) microsomal triglyceride transfer protein (MTTP), which packages the chylomicron particle by assembling cholesterol, triglyceride, phospholipids and apolipoprotein B48. SUBJECTS, MATERIALS AND METHODS: Type 2 diabetic (26) and non-diabetic (21) patients were examined. Levels of NPC1L1, ABCG5 and ABCG8 and MTTP mRNA were measured in duodenal biopsies by real-time PCR. Lipoproteins were isolated by sequential ultracentrifugation. RESULTS: Diabetic patients had more NPC1L1 mRNA than the control subjects (p<0.02). Expression of ABCG5 and ABCG8 mRNA was lower in the diabetic patients (p<0.05) and MTTP expression was increased (p<0.05). There was a positive correlation between NPLC1L1 and MTTP mRNA (p<0.01) and a negative correlation between NPC1L1 and ABCG5 mRNA (p<0.001). Diabetic patients on statin therapy had increased ABCG5 and ABCG8 mRNA compared to those not on statin (p<0.02 and p<0.05) and less MTTP mRNA than those not on statin (p<0.05). CONCLUSIONS/INTERPRETATION: This study demonstrates that in type 2 diabetes there are important alterations to the expression of intestinal genes that regulate cholesterol absorption and chylomicron synthesis. In diabetic patients statin therapy is associated with reduced MTTP expression and increased ABCG5 and ABCG8 mRNA. The study suggests new mechanisms to explain postprandial diabetic dyslipidaemia and the beneficial effect of statins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
182 It is interesting to see that polymorphisms in the Q604E allele of the ABCG5 gene in men were associated with insulin resistance [32]. Login to comment
181 It is interesting to see that polymorphisms in the Q604E allele of the ABCG5 gene in men were associated with insulin resistance [32]. Login to comment

[hide] Cholesterol and saturated fat intake determine the... Genet Med. 2006 Sep;8(9):594-9. Viturro E, de Oya M, Lasuncion MA, Gorgojo L, Moreno JM, Benavente M, Cano B, Garces C
Cholesterol and saturated fat intake determine the effect of polymorphisms at ABCG5/ABCG8 genes on lipid levels in children.
Genet Med. 2006 Sep;8(9):594-9., [PMID:16980816]

Abstract [show]
PURPOSE: Analysis of mutations in genes of the cholesterol metabolic pathway has not completely explained the interindividual variability of blood cholesterol concentrations attributed to gene-nutrient interactions. Thus, we analyzed polymorphisms in the ABCG5 and ABCG8 genes, involved in the regulation of intestinal cholesterol absorption, with special interest in a potential interaction with diet to determine lipid levels. METHODS: The polymorphisms ABCG5 C1950G (Gln604Glu) and ABCG8 C1895T (Ala640Val) were determined by polymerase chain reaction and restriction analysis in 1227 healthy school children, aged 6 to 8 years. RESULTS: No significant differences were found in blood lipid levels between subjects with different genotypes of the two analyzed polymorphisms. However, important differences appeared when separating subjects by their different lipid intake. The presence of the ABCG8 C1895T and ABCG5 C1950G polymorphisms was associated with different plasma total cholesterol, low-density lipoprotein cholesterol complex, and apolipoprotein B levels only in low-cholesterol consumers (significantly for the C1895T polymorphism), and among children within the lower tertile of saturated fat intake (significantly for the C1950G polymorphism). CONCLUSION: Polymorphisms at the half-transporter ABCG5 and ABCG8 genes affect blood cholesterol concentrations in prepubertal children by influencing dietary responsiveness. This highly significant gene-nutrient interaction could explain the great individual differences in the plasma lipid response to cholesterol and fat intake.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 Methods: The polymorphisms ABCG5 C1950G (Gln604Glu) and ABCG8 C1895T (Ala640Val) were determined by polymerase chain reaction and restriction analysis in 1227 healthy school children, aged 6 to 8 years. Login to comment
11 Studies undertaken to determine the relationship between dietary cholesterol absorption and plasma lipoprotein levels showed large individual differences in dietary cholesterol absorption, suggesting a genetic variation among humans in the regulation of this process.8,9 When cholesterol absorption was studied, two members of the human adenosine triphosphate (ATP) Binding Cassette (ABC) transporter family,10 ABCG5 and ABCG8, seem to play a capital role.10,11 These two ATP-dependent half-transporters join to form a transport unit that regulates the absorption of cholesterol from the diet (intestine) and its excretion in the bile (liver).11 Their discovery came from the study of a rare genetic disease, sitosterolemia, characterized by abnormal sterol levels in the blood, caused by the genetic disruption of the ABCG5/G8 transport unit.12 Several mutations in the ABCG5 and ABCG8 genes were identified at this time in sitosterolemic patients.13-15 In addition, common polymorphic variants of these genes have been hypothesized to be related to plasma lipid level differences in the general population, although this association is not clear yet.16,17 Thus, in this study we examined the influence of two of those polymorphisms in the ABCG5 and ABCG8 genes (C1950G [Gln604Glu] and C1895T [Ala640Val], respectively), on determining plasma lipid levels in a sample-based population of 1227 healthy Spanish children, with special attention to the potential effect of dietetic parameters in this determination. Login to comment

[hide] Plasma concentrations of plant sterols: physiology... Nutr Rev. 2006 Sep;64(9):385-402. Chan YM, Varady KA, Lin Y, Trautwein E, Mensink RP, Plat J, Jones PJ
Plasma concentrations of plant sterols: physiology and relationship with coronary heart disease.
Nutr Rev. 2006 Sep;64(9):385-402., [PMID:17002235]

Abstract [show]
Recently, it has been questioned whether elevated levels of circulating plant sterols increase the risk of coronary heart disease (CHD). To date, no definitive conclusions regarding such a relationship have been reached, nor have there been any studies summarizing the factors that contribute to the observed elevations in plant sterol concentrations in plasma. Thus, the purpose of this review is to systematically compare the plant sterol levels of subjects from the general population and to describe factors that contribute to the variations observed. The question of whether elevated plasma concentrations of plant sterols are associated with an increased risk of CHD was also assessed. Results indicate that the key factors accounting for variations in circulating plant sterol concentrations include: apolipoprotein E phenotypes, ATP-binding cassette transporter polymorphisms, use of statin drugs, presence of metabolic syndrome, dietary intake of plant sterols, gender, and analytical techniques used in the measurement of plant sterols in the plasma. An analysis of the studies examining the relationship between circulating levels of plant sterols and CHD risk in non-sitosterolemic populations revealed no clear associations. Furthermore, it was shown that the above-mentioned factors play an important role in determining the levels of plant sterols in plasma. Since these factors may act as potential confounders, they must be controlled for before more solid conclusions can be reached.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Aside from the rare mutation of a homozygous form resulting in sitosterolemia, several common sequence variations have been described.71 Different studies have shown independently that the cross-sectional plant sterol-to-cholesterol ratio is associated with different ABCG5 and ABCG8 polymorphisms.10,27,72 Out of the five polymorphisms analyzed in relation to concentrations of plant sterols, D19H, Y54C, T400K, A632V, and Q604E, the polymorphisms D19H in exon 1 and T400K in exon 8 of ABCG8 show the most pronounced association. Login to comment
72 Carriers of the H allele of the D19H polymorphism in ABCG8 were found to have a lower plasma campesterol-to-cholesterol ratio10,27 and sitosterol-to-cholesterol ratio,10 suggesting a higher activity of this variant. Login to comment

[hide] Single nucleotide polymorphisms in ABCG5 and ABCG8... J Lipid Res. 2007 Dec;48(12):2607-13. Epub 2007 Sep 7. Santosa S, Demonty I, Lichtenstein AH, Ordovas JM, Jones PJ
Single nucleotide polymorphisms in ABCG5 and ABCG8 are associated with changes in cholesterol metabolism during weight loss.
J Lipid Res. 2007 Dec;48(12):2607-13. Epub 2007 Sep 7., [PMID:17827468]

Abstract [show]
The purpose of this study was to examine whether changes in cholesterol metabolism after weight loss were affected by single nucleotide polymorphisms (SNPs) in ABCG5 and ABCG8 genes. Thirty-five hypercholesterolemic women lost 11.7 +/- 2.5 kg (P < 0.001). Cholesterol kinetics were assessed using stable isotope techniques. TaqMan PCR was used to detect SNPs in ABCG5/G8. Homozygous Q604E variants in ABCG5 had larger (P < 0.05) reductions in cholesterol absorption and greater increases (P < 0.05) in synthesis in contrast to heterozygous and homozygous wild-type carriers. Heterozygous C54Y carriers had smaller declines (P = 0.047) in synthesis compared with homozygous variant individuals. The presence of at least one Y54 variant was associated with higher (P = 0.042) post-weight-loss synthesis compared with carriers of the C54 genotype. The direction of the results is consistent with cross-sectional studies on the effects of Q604E and C54Y polymorphisms on plasma cholesterol. SNPs in ABCG5/G8 were found to be associated with the response of cholesterol metabolism to weight loss. The evidence for associations between SNPs in ABCG5/G8 and various parameters of cholesterol metabolism indicates the potential effectiveness of establishing genetic screening tools to determine optimal lipid-lowering treatment routes for individuals during weight reduction.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 Homozygous Q604E variants in ABCG5 had larger (P , 0.05) reductions in cholesterol absorption and greater increases (P , 0.05) in synthesis in contrast to heterozygous and homozygous wild-type carriers. Login to comment
7 The direction of the results is consistent with cross-sectional studies on the effects of Q604E and C54Y polymorphisms on plasma cholesterol. Login to comment
32 More specifically, these SNPs include Q604E (RS6720173), I18427 (RS4148189), I7892 (RS4131229), and M216 (RS3806471) in ABCG5 and C54Y (RS4148211), D19H (RS11887534), T400K (RS4148217), and I14222 (RS6709904) in ABCG8 (11, 13, 16, 17). Login to comment
36 In a cross-sectional study, Weggemans et al. (19) reported that individuals homozygous for the wild type of the Q604E SNP of ABCG5 had TC concentrations that were lower than those of carriers of at least one mutant allele. Login to comment
82 SNPs Q604E, I18429, I7892, and M216 in ABCG5 and C54Y, D19H, I14222, and T400K in ABCG8 were determined using PCR-based TaqMan allele discrimination assays (Applied Biosystems, Foster City, CA) (29). Login to comment
113 Effects of genotype on cholesterol metabolism Changes in cholesterol absorption were related to the Q604E SNP in ABCG5 (Table 3). Login to comment
115 Individuals who were homozygous for the Q604E SNP also had higher initial (P 5 0.026 and P 5 0.039) cholesterol absorption (86.5 6 13.3%) compared with heterozygous (57.2 6 11.8%) and homozygous wild-type (59.7 6 18.5%) subjects. Login to comment
119 When individuals who were heterozygous were grouped with individuals who were homozygous for the Q604E SNP variant, no significant differences were identified in indicators of cholesterol metabolism. Login to comment
126 The results indicate that homozygous variant carriers of the Q604E SNP in ABCG5 experienced larger decreases in cholesterol absorption and increased FSR after weight loss. Login to comment
132 Individual subject genotypes for each SNP in ABCG5 and ABCG8 ABCG5 ABCG8 Q604E I18429 I7892 M216 C54Y D19H I14222 T400K 11 11 12 12 12 11 11 11 11 11 11 11 11 11 11 12 12 12 11 11 11 12 12 12 11 11 12 12 12 11 11 12 11 11 22 22 22 11 11 11 11 11 22 12 12 11 12 11 12 12 11 11 11 11 11 12 11 11 11 11 11 11 11 22 22 12 11 11 11 12 12 11 11 11 12 12 12 12 12 12 11 11 22 22 22 11 11 11 12 12 12 12 22 11 11 11 12 12 11 11 11 12 12 12 11 11 11 11 12 11 11 11 12 12 11 11 11 12 12 11 22 12 11 11 11 12 12 11 11 11 12 12 12 11 11 11 11 11 12 11 11 12 12 11 11 11 12 12 22 11 11 11 12 12 11 11 11 11 11 12 12 11 11 11 11 11 11 12 12 12 22 22 12 11 11 12 11 12 11 11 11 11 11 22 11 11 22 22 22 11 11 11 11 11 12 12 12 11 11 11 12 12 12 11 11 12 12 11 22 12 12 11 11 11 12 11 12 11 12 12 12 11 11 12 11 11 22 22 22 11 11 11 12 11 22 22 22 11 11 11 11 11 11 11 12 11 11 11 11 11 12 22 12 11 11 11 12 11 11 11 11 12 11 11 11 11 11 11 11 11 11 11 12 12 12 12 12 11 11 12 SNP, single nucleotide polymorphism. Login to comment
138 The Q604E SNP is located on exon 13 of the ABCG5 gene and is encoded on a loop that faces the luminal or cell surface (16). Login to comment
147 A novel finding of this trial is that changes in cholesterol absorption and synthesis after weight loss, measured by stable isotopes, were affected by the Q604E and C54Y SNPs. Login to comment
150 Cholesterol metabolism and change according to exon SNPs in ABCG5 and ABCG8 Cholesterol Biosynthesis Cholesterol Absorption Cholesterol Turnover SNP Initial Final Change Initial Final Change Initial Final Change %/day %/day %/day % % % % % % Q604E QQ 8.48 6 6.76 6.16 6 5.66 22.32 6 8.86 59.7 6 18.5a 65.7 6 13.7 5.94 6 18.3c 39.1 6 5.99 36.5 6 8.14 22.45 6 9.76 QE 13.9 6 9.05 6.48 6 3.95 27.39 6 9.36a 57.2 6 11.8b 64.5 6 18.0 7.33 6 15.6d 37.5 6 9.27 39.5 6 6.31 1.93 6 8.59 EE 7.91 6 4.91 9.60 6 5.09 1.69 6 10.0a 86.5 6 13.3a,b 55.7 6 13.5 230.8 6 1.90c,d 40.8 6 3.72 45.3 6 8.63 4.47 6 12.1 QE 1 EE 12.8 6 8.63 7.07 6 4.18 25.69 6 9.84 62.6 6 16.6 62.8 6 17.2 0.18 6 20.7 38.2 6 8.44 40.6 6 6.86 2.43 6 8.94 C54Y CC 9.96 6 8.83 5.18 6 4.88a 24.78 6 9.62 64.9 6 15.4 67.5 6 16.4 2.67 6 22.0 37.0 6 8.43 38.1 6 7.68 1.13 6 10.6 CY 8.95 6 5.34 8.79 6 5.35 20.17 6 7.60a 54.2 6 13.5 65.4 6 12.2 11.2 6 12.9 38.3 6 5.00 40.1 6 8.42 1.77 6 8.67 YY 14.1 6 9.07 5.99 6 3.74 28.09 6 10.3a 64.1 6 25.6 55.3 6 15.6 28.80 6 17.9 43.3 6 6.57 36.2 6 7.00 27.03 6 6.42 CY 1 YY 10.8 6 7.16 7.76 6 4.90a 23.08 6 9.28 57.9 6 18.8 61.7 6 14.0 3.85 6 17.5 40.0 6 5.87 38.8 6 8.00 21.17 6 8.89 D19H DD 10.1 6 6.68 6.54 6 5.28 23.55 6 8.28 58.8 6 15.9 61.8 6 13.3 3.00 6 17.2 39.1 6 6.00 38.2 6 7.59 20.70 6 8.41 DH 11.4 6 11.0 6.68 6 4.35 24.76 6 12.4 67.5 6 21.2 71.7 6 18.8 4.19 6 25.9 37.5 6 10.2 39.1 6 8.57 1.45 6 12.3 T400K TT 10.4 6 8.91 6.91 6 5.51 23.53 6 10.9 64.4 6 19.4 63.6 6 17.2 20.76 6 20.2 40.4 6 5.15 38.9 6 7.39 21.61 6 9.46 TK 1 KK 10.4 6 5.99 6.01 6 4.12 24.42 6 6.29 55.4 6 12.2 65.6 6 11.6 10.2 6 16.5 35.8 6 9.10 37.7 6 8.52 2.24 6 9.64 a,b Significant difference between groups (P , 0.05). Login to comment
153 Genotype distribution and frequency of SNPs in introns and exons of ABCG5 and ABCG8 in the studied population Homozygous Wild Type Heterozygous Homozygous Variant SNP n Age BMI n Age BMI n Age BMI % years kg/m2 % years kg/m2 % years kg/m2 ABCG5 Q604E 19 (54.3) 48.6 6 6.56 31.0 6 2.92 13 (37.1) 50.2 6 7.24 32.0 6 2.79 3 (8.6) 51.0 6 6.56 30.6 6 2.45 I18429 22 (62.9) 49.1 6 6.91 31.2 6 2.81 13 (37.1) 49.9 6 6.51 31.7 6 2.91 0 (0) I7892 15 (42.9) 50.1 6 7.09 30.6 6 2.55 13 (37.1) 46.9 6 6.59 32.1 6 3.02 7 (20.0) 52.3 6 4.96 31.5 6 2.98 M216 18 (51.4) 50.3 6 6.89 30.6 6 2.33a 10 (28.6) 45.0 6 5.19b 33.2 6 2.99a 7 (20.0) 53.1 6 5.21b 30.6 6 2.85 ABCG8 C54Y 16 (45.7) 50.4 6 7.10 30.8 6 2.42 12 (34.3) 46.9 6 6.33 31.5 6 2.28 7 (20.0) 51.3 6 5.88 32.5 6 4.26 D19H 26 (74.3) 48.9 6 7.06 31.7 6 3.00 9 (25.7) 50.8 6 5.89 30.3 6 2.01 0 (0) I14222 25 (71.4) 48.6 6 7.16 31.5 6 3.06 10 (28.6) 51.2 6 5.18 31.0 6 2.17 0 (0) T400K 22 (62.9) 50.6 6 5.67 31.2 6 3.03 11 (31.4) 46.6 6 8.43 31.9 6 2.40 2 (5.7) 50.5 6 3.54 31.0 6 3.82 BMI, body mass index. Login to comment
146 A trial by Chan et al. (35) that included 47 overweight men, however, resulted in observations consistent with those of the present investigation, in that they found no differences in sterol indicators of cholesterol absorption with respect to the D19H SNP. Login to comment
112 Effects of genotype on cholesterol metabolism Changes in cholesterol absorption were related to the Q604E SNP in ABCG5 (Table 3). Login to comment
114 Individuals who were homozygous for the Q604E SNP also had higher initial (P 5 0.026 and P 5 0.039) cholesterol absorption (86.5 6 13.3%) compared with heterozygous (57.2 6 11.8%) and homozygous wild-type (59.7 6 18.5%) subjects. Login to comment
118 When individuals who were heterozygous were grouped with individuals who were homozygous for the Q604E SNP variant, no significant differences were identified in indicators of cholesterol metabolism. Login to comment
125 The results indicate that homozygous variant carriers of the Q604E SNP in ABCG5 experienced larger decreases in cholesterol absorption and increased FSR after weight loss. Login to comment
131 Individual subject genotypes for each SNP in ABCG5 and ABCG8 ABCG5 ABCG8 Q604E I18429 I7892 M216 C54Y D19H I14222 T400K 11 11 12 12 12 11 11 11 11 11 11 11 11 11 11 12 12 12 11 11 11 12 12 12 11 11 12 12 12 11 11 12 11 11 22 22 22 11 11 11 11 11 22 12 12 11 12 11 12 12 11 11 11 11 11 12 11 11 11 11 11 11 11 22 22 12 11 11 11 12 12 11 11 11 12 12 12 12 12 12 11 11 22 22 22 11 11 11 12 12 12 12 22 11 11 11 12 12 11 11 11 12 12 12 11 11 11 11 12 11 11 11 12 12 11 11 11 12 12 11 22 12 11 11 11 12 12 11 11 11 12 12 12 11 11 11 11 11 12 11 11 12 12 11 11 11 12 12 22 11 11 11 12 12 11 11 11 11 11 12 12 11 11 11 11 11 11 12 12 12 22 22 12 11 11 12 11 12 11 11 11 11 11 22 11 11 22 22 22 11 11 11 11 11 12 12 12 11 11 11 12 12 12 11 11 12 12 11 22 12 12 11 11 11 12 11 12 11 12 12 12 11 11 12 11 11 22 22 22 11 11 11 12 11 22 22 22 11 11 11 11 11 11 11 12 11 11 11 11 11 12 22 12 11 11 11 12 11 11 11 11 12 11 11 11 11 11 11 11 11 11 11 12 12 12 12 12 11 11 12 SNP, single nucleotide polymorphism. Login to comment
137 The Q604E SNP is located on exon 13 of the ABCG5 gene and is encoded on a loop that faces the luminal or cell surface (16). Login to comment
149 Cholesterol metabolism and change according to exon SNPs in ABCG5 and ABCG8 Cholesterol Biosynthesis Cholesterol Absorption Cholesterol Turnover SNP Initial Final Change Initial Final Change Initial Final Change %/day %/day %/day % % % % % % Q604E QQ 8.48 6 6.76 6.16 6 5.66 22.32 6 8.86 59.7 6 18.5a 65.7 6 13.7 5.94 6 18.3c 39.1 6 5.99 36.5 6 8.14 22.45 6 9.76 QE 13.9 6 9.05 6.48 6 3.95 27.39 6 9.36a 57.2 6 11.8b 64.5 6 18.0 7.33 6 15.6d 37.5 6 9.27 39.5 6 6.31 1.93 6 8.59 EE 7.91 6 4.91 9.60 6 5.09 1.69 6 10.0a 86.5 6 13.3a,b 55.7 6 13.5 230.8 6 1.90c,d 40.8 6 3.72 45.3 6 8.63 4.47 6 12.1 QE 1 EE 12.8 6 8.63 7.07 6 4.18 25.69 6 9.84 62.6 6 16.6 62.8 6 17.2 0.18 6 20.7 38.2 6 8.44 40.6 6 6.86 2.43 6 8.94 C54Y CC 9.96 6 8.83 5.18 6 4.88a 24.78 6 9.62 64.9 6 15.4 67.5 6 16.4 2.67 6 22.0 37.0 6 8.43 38.1 6 7.68 1.13 6 10.6 CY 8.95 6 5.34 8.79 6 5.35 20.17 6 7.60a 54.2 6 13.5 65.4 6 12.2 11.2 6 12.9 38.3 6 5.00 40.1 6 8.42 1.77 6 8.67 YY 14.1 6 9.07 5.99 6 3.74 28.09 6 10.3a 64.1 6 25.6 55.3 6 15.6 28.80 6 17.9 43.3 6 6.57 36.2 6 7.00 27.03 6 6.42 CY 1 YY 10.8 6 7.16 7.76 6 4.90a 23.08 6 9.28 57.9 6 18.8 61.7 6 14.0 3.85 6 17.5 40.0 6 5.87 38.8 6 8.00 21.17 6 8.89 D19H DD 10.1 6 6.68 6.54 6 5.28 23.55 6 8.28 58.8 6 15.9 61.8 6 13.3 3.00 6 17.2 39.1 6 6.00 38.2 6 7.59 20.70 6 8.41 DH 11.4 6 11.0 6.68 6 4.35 24.76 6 12.4 67.5 6 21.2 71.7 6 18.8 4.19 6 25.9 37.5 6 10.2 39.1 6 8.57 1.45 6 12.3 T400K TT 10.4 6 8.91 6.91 6 5.51 23.53 6 10.9 64.4 6 19.4 63.6 6 17.2 20.76 6 20.2 40.4 6 5.15 38.9 6 7.39 21.61 6 9.46 TK 1 KK 10.4 6 5.99 6.01 6 4.12 24.42 6 6.29 55.4 6 12.2 65.6 6 11.6 10.2 6 16.5 35.8 6 9.10 37.7 6 8.52 2.24 6 9.64 a,b Significant difference between groups (P , 0.05). Login to comment
152 Genotype distribution and frequency of SNPs in introns and exons of ABCG5 and ABCG8 in the studied population Homozygous Wild Type Heterozygous Homozygous Variant SNP n Age BMI n Age BMI n Age BMI % years kg/m2 % years kg/m2 % years kg/m2 ABCG5 Q604E 19 (54.3) 48.6 6 6.56 31.0 6 2.92 13 (37.1) 50.2 6 7.24 32.0 6 2.79 3 (8.6) 51.0 6 6.56 30.6 6 2.45 I18429 22 (62.9) 49.1 6 6.91 31.2 6 2.81 13 (37.1) 49.9 6 6.51 31.7 6 2.91 0 (0) I7892 15 (42.9) 50.1 6 7.09 30.6 6 2.55 13 (37.1) 46.9 6 6.59 32.1 6 3.02 7 (20.0) 52.3 6 4.96 31.5 6 2.98 M216 18 (51.4) 50.3 6 6.89 30.6 6 2.33a 10 (28.6) 45.0 6 5.19b 33.2 6 2.99a 7 (20.0) 53.1 6 5.21b 30.6 6 2.85 ABCG8 C54Y 16 (45.7) 50.4 6 7.10 30.8 6 2.42 12 (34.3) 46.9 6 6.33 31.5 6 2.28 7 (20.0) 51.3 6 5.88 32.5 6 4.26 D19H 26 (74.3) 48.9 6 7.06 31.7 6 3.00 9 (25.7) 50.8 6 5.89 30.3 6 2.01 0 (0) I14222 25 (71.4) 48.6 6 7.16 31.5 6 3.06 10 (28.6) 51.2 6 5.18 31.0 6 2.17 0 (0) T400K 22 (62.9) 50.6 6 5.67 31.2 6 3.03 11 (31.4) 46.6 6 8.43 31.9 6 2.40 2 (5.7) 50.5 6 3.54 31.0 6 3.82 BMI, body mass index. Login to comment

[hide] Significant association of ABCG5 604Q and ABCG8 D1... Br J Surg. 2008 Aug;95(8):1005-11. Kuo KK, Shin SJ, Chen ZC, Yang YH, Yang JF, Hsiao PJ
Significant association of ABCG5 604Q and ABCG8 D19H polymorphisms with gallstone disease.
Br J Surg. 2008 Aug;95(8):1005-11., [PMID:18457353]

Abstract [show]
BACKGROUND: Adenosine triphosphate-binding cassette (ABC) transporters ABCG5 and ABCG8 are sterol export pumps regulating biliary cholesterol excretion. The formation of gallstones, supersaturated with cholesterol in bile, is determined by genetic and environmental factors. The interaction of susceptible gene polymorphisms with age, sex and body mass index in gallstone disease is unclear. METHODS: In a cross-sectional study, 979 subjects (880 men and 99 women, mean(s.d.) age 47.7(10.4) years) were recruited from a hospital-based population. Of these, 74 were diagnosed with gallstone disease by abdominal ultrasonography. Five non-synonymous polymorphisms, E604Q (ABCG5), D19H, C54Y, T400K and A632V (ABCG8), were analysed using the TaqMan genotyping assay. RESULTS: The serum total cholesterol and both low- and high-density lipoprotein cholesterol levels were significantly lower in subjects with gallstones than in those without. 604Q (CC) and D19H (GC) genotypes were significantly associated with gallstone disease, even when adjusted for age, sex and body mass index. The genetic risk of developing gallstone disease was further stratified by age. The risk was greatly increased in subjects younger than 50 years with the D19H genotype and those of 50 years or more with the 604Q genotype. CONCLUSION: Carriers of ABCG5 604Q or ABCG8 D19H polymorphisms have an increased risk of gallstone disease independent of age, sex and body mass index.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
125 Acalovschi and co-workers17 found that polymorphisms at D19H and Q604E were significantly associated with a lithogenic plasma lipid profile in siblings with gallstone disease. Login to comment

[hide] Polymorphisms in ABCG5/G8 transporters linked to h... Nutr Rev. 2008 Jun;66(6):343-8. Rudkowska I, Jones PJ
Polymorphisms in ABCG5/G8 transporters linked to hypercholesterolemia and gallstone disease.
Nutr Rev. 2008 Jun;66(6):343-8., [PMID:18522623]

Abstract [show]
ATP-binding cassette (ABC) transporters function in the homeostasis of lipids. Dysfunction of ABC transporters is frequently associated with disease. This review examines links between polymorphisms of ABC G5 (ABCG5) and G8 (ABCG8) transporter genes to hypercholesterolemia and to gallstone disease risk. Various polymorphisms (A632V, T400K, D19H, M429V, and C54Y) in the ABCG8 and ABCG5 (Q604E) gene have been found to be associated with several facets of cholesterol metabolism, including baseline cholesterol level, cholesterol kinetics, individual responsiveness of plasma cholesterol to dietary and pharmaceutical interventions for hypercholesterolemia, and increased risk of gallstones. Clearly, the ABCG5 and ABCG8 genes play an important role in cholesterol homeostasis. However, more research is needed to establish how specific polymorphisms of these genes confer to higher risk of these diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Various polymorphisms (A632V, T400K, D19H, M429V, and C54Y) in the ABCG8 and ABCG5 (Q604E) gene have been found to be associated with several facets of cholesterol metabolism, including baseline cholesterol level, cholesterol kinetics, individual responsiveness of plasma cholesterol to dietary and pharmaceutical interventions for hypercholesterolemia, and increased risk of gallstones. Login to comment
10 The heterogeneity of the effect of dietary changes on plasma lipid concentrations among individuals is well known.5 Plasma lipids in certain persons are relatively unresponsive to dietary interventions, whereas others have enhanced sensitivity.5 For example, Weggemans et al.6 demonstrated that carriers of the ABCG5 Q604E Affiliations: I Rudkowska is with the School of Dietetics and Human Nutrition, Faculty of Agricultural and Environmental Sciences, McGill University, Ste-Anne-de-Bellevue, Quebec, Canada. Login to comment
16 However, the response to diets either low or high in cholesterol on plasma TC and plasma low-density lipoprotein cholesterol (LDL-C) concentrations were shown not to be related to this genotype.Contrary to these results, Herron et al.7 found that a shift from a low- to a high-dietary-cholesterol diet in individuals with the ABCG5 Q604E mutant allele was associated with a greater increase in plasma LDL-C compared to subjects who were heterozygous or who carried only the wild-type allele. Login to comment
17 Other studies8-10 failed to observe associations between the ABCG5 Q604E polymorphism and plasma lipid concentrations following dietary or drug intervention. Login to comment
18 In addition, no differences in plasma TC and LDL-C were found in yet another study, which investigated associations of blood lipids in genotypes of healthy children with the polymorphisms ABCG5 Q604E and ABCG8 A640V.11 Since 55% of the children studied had at least one mutation in ABCG5 Q604E or ABCG8 A640V, a subanalysis was performed separating subjects according to their dietary cholesterol and saturated fat intakes. Login to comment
19 In this subanalysis, the researchers found that the presence of the mutant alleles was associated with higher plasma TC, LDL-C, and apolipoprotein B, but only in children with low cholesterol intake for ABCG8 A640V and low saturated fat intake for ABCG5 Q604E.11 These findings led to speculation that a gene-nutrient interaction could explain the individual variations in plasma lipid in response to changes in cholesterol and fat intake. Login to comment
21 Hubacek et al.12 reported that none of the polymorphisms examined, including ABCG5 Q604E, ABCG8 D19H and A632V, were related to plasma lipid levels or changes in plasma lipid levels in subjects after "evolutionary" dietary changes from a traditional high-fat Eastern European diet to a lower-fat diet based on nutritional advice. Login to comment
27 In addition, these investigators also observed that carriers of the T400K and A632V polymorphisms in the ABCG8 gene exhibited higher cholesterol synthesis and higher plasma TC, respectively.8 Gylling et al.9 failed to show an association between cholesterol kinetics and T400K and A632V polymorphisms in the ABCG8 gene, but found that carriers of the mutant Q604E allele of the ABCG5 gene had high cholesterol absorption and thus had higher characteristics of the insulin resistance syndrome. Login to comment
28 In accordance, Santosa et al.14 found that women with the Q604E mutation in the ABCG5 gene had greater reductions in cholesterol absorption, along with higher increases in cholesterol synthesis, in contrast to wild-type allele carriers after a weight loss intervention.Additionally,among female subjects, heterozygous ABCG8 C54Y carriers had smaller decreases in cholesterol synthesis compared to homozygous allele carriers.14 These data correspond with evidence from the study mentioned above12 in which the Nutrition Reviews® Vol. 66():343-348344 Cys54 allele carriers possessed lower TC and LDL-C reductions. Login to comment
29 ROLE OF RACE-RELATED DIFFERENCES IN ABC GENOTYPES Miwa et al.,15 studying a Japanese population, concluded that carriers of a novel ABCG8 M429V allele or a specific haplotype (wild-type allele of Q604E ABCG5, and wild-type allele of C54Y, wild-type allele of T400K, mutant allele of M429V in the ABCG8 gene), were associated with higher cholesterol absorption efficiency, as well as lower cholesterol synthesis rates. Login to comment
30 These findings in the Japanese group are not without exception; no difference was observed in lipid profiles in relation to common polymorphisms studied previously [ABCG8 (A632V, T400K, D19H, and C54Y) and ABCG5 (Q604E)],6,7,11,12 which might be explained by the fact that carriers of ABCG8 D19H and A632A polymorphisms are rare in the Japanese population compared to Western populations. Login to comment
31 Also, polymorphisms of Q604E and T400K alleles may not be as important in the regulation of non-cholesterol-sterol levels in the Japanese population.15 In a more recent trial, no detection of this SNP (ABCG8 M429V allele) was recorded in either the Caucasian or the African-American population studied, thereby potentially demonstrating a race-specific polymorphism.16 In general, these studies demonstrate the benefits of using an intermediate phenotype, such as cholesterol absorption and synthesis, to determine the link between SNPs and blood lipids in relation to a dietary treatment. Login to comment
38 Other ABCG5 and G8 polymorphisms (Q604E, C54Y, T400K, and A632V) and CYP7A1 in hypercholesterolemic patients had no apparent association with responsiveness to statin treatment. Login to comment
41 In addition, carriers of the mutant allele ABCG5 Q604E, compared to wild type, were found to have higher baseline plasma LDL-C. Login to comment
47 Knowing this, it may be of interest to first determine if a relationship exists between cholesterol in the blood and cholesterol gallstones.Acalovschi et al.18 found that circulatory TC and triglyceride levels in gallstone patients were higher in carriers of the wild-type allele of the ABCG5 Q604E and ABCG8 D19H compared with mutant allele carriers. Login to comment
51 On the other hand, Wang et al.24 investigated a possible association between three polymorphisms, including C54Y, T400K alleles of ABCG8, and Q604E of ABCG5 gene, and gallstone formation in a Chinese population. Login to comment
61 Overall, these studies identify a variety of polymorphisms in ABCG8 (A632V, T400K, D19H, and C54Y) and in ABCG5 (Q604E) that have been linked with baseline cholesterol levels, cholesterol absorption, or responsiveness to dietary intervention.3-12,15-17 In addition, genetic variations in the ABCG8 gene (D19H and T400K) may increase the risk of gallstone disease in certain populations.22-24 Table 1 summarizes potential SNPs and the effects of the mutant allele on baseline blood lipid concentrations, cholesterol kinetics, responsiveness to interventions, and gallstone disease risk. Login to comment

[hide] Significant association of ABCG8:D19H gene polymor... J Hum Genet. 2008;53(8):757-63. Epub 2008 Jun 26. Chen ZC, Shin SJ, Kuo KK, Lin KD, Yu ML, Hsiao PJ
Significant association of ABCG8:D19H gene polymorphism with hypercholesterolemia and insulin resistance.
J Hum Genet. 2008;53(8):757-63. Epub 2008 Jun 26., [PMID:18581044]

Abstract [show]
The absorption efficiency of cholesterol is closely correlated to dietary phytosterol content and determined by genetic factors. The ATP-binding cassette (ABC) transporters ABCG5 and ABCG8 act as a sterol efflux pump to regulate the absorption of cholesterol and phytosterol. The levels of cholesterol and phytosterol associated with a Chinese diet are very different from those associated with a Western diet. This study aims to explore the association between serum total cholesterol/LDL-C levels and ABCG5/ABCG8 polymorphisms in a Taiwanese population consuming an ordinary Chinese diet. A total of 1,046 subjects (894 men and 152 women) were recruited in a hospital-based health check-up center in Kaohsiung Medical University Hospital. Five nonsynonymous polymorphisms of Q604E (ABCG5), D19H, C54Y, T400 K and A632 V (ABCG8) were analyzed by TaqMan genotyping assay. Analysis showed that the D19H polymorphism of the ABCG8 gene was significantly associated with serum total cholesterol, LDL-C levels and HOMA-IR index. Adjusting for sex and age, subjects with the D19H (GC) genotype were significantly associated with a threefold higher risk of high cholesterol and LDL-C levels than subjects with D19 (GG). These results suggest that the D19H polymorphism of ABCG8 could be considered a susceptible gene marker indicating an increased likelihood of developing high cholesterol and LDL-C levels in Taiwanese consuming an ordinary Chinese diet. It is supposed that the coexistence of higher insulin resistance and hypercholesterolemia for carriers of the D19H polymorphism may result in a greater risk of cardiovascular disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Five nonsynonymous polymorphisms of Q604E (ABCG5), D19H, C54Y, T400 K and A632 V (ABCG8) were analyzed by TaqMan genotyping assay. Login to comment
42 Five nonsynonymous polymorphisms, including Q604E (rs6720173) of the ABCG5 gene and D19H (rs11887534), C54Y (rs4148211), T400K (rs4148217) and A632V (rs6544718) of the ABCG8 gene, were chosen for genotyping (http://www.ncbi.nlm.nih.gov/). Login to comment
62 Five nonsynonymous polymorphisms (ABCG5: Q604E; ABCG8:D19H, C54Y, T400K, A632V) were genotyped in our population. Login to comment
64 The minor allele frequencies (MAFs) of Q604E (C:G); D19H (G:C), C54Y (G:A) and T400K (C:A) were 10.5, 1.4, 9.7 and 8.0%, respectively. Login to comment
69 Subjects with genotype Q604 (CC) had significantly higher serum total cholesterol levels than those of genotypes Q604E (CG) or 604E (GG). Login to comment
72 This exhibited a significant trend with an increasing frequency of the C allele in Q604 (ABCG5) and D19H (ABCG8) genotypes from the Table 1 Serum cholesterol and LDL levels for the genotypes of ABCG5/ABCG8 Cholesterol (mg/dl) P LDL-C (mg/dl) P ABCG5: Q604E (C1810G) Genotype CC (n = 9) 225.9 ± 48.5 0.008 133.7 ± 40.0 0.733 CG (n = 203) 189.6 ± 37.6 130.1 ± 32.7 GG (n = 833) 187.2 ± 38.1 127.9 ± 35.9 ABCG8:D19H (G55C) Genotype GG (n = 1,016) 187.2 ± 37.9 0.005 127.8 ± 35.2 0.023 GC (n = 30) 207.1 ± 45.1 145.1 ± 40.6 CC (n = 0) - - ABCG8:C54Y (G161A) Genotype GG (n = 853) 187.3 ± 37.8 0.297 127.8 ± 35.4 0.671 GA (n = 189) 190.4 ± 40.0 130.0 ± 35.2 AA (n = 8) 171.6 ± 24.0 118.0 ± 23.8 ABCG8:T400 K (C1199A) Genotype CC (n = 885) 188.0 ± 38.2 0.869 128.3 ± 35.4 0.997 CA (n = 164) 186.9 ± 38.2 128.3 ± 34.3 AA (n = 2) 194.0 ± 22.6 131.0 ± 10.2 P values were obtained from a one-way ANOVA and the t test desirable to the moderately high and then to the high cholesterol category. Login to comment
83 In addition, subjects with the D19H variant were associated with an almost threefold higher risk of developing high total cholesterol and LDL-C levels Table 2 Genotype frequency of ABCG5/ABCG8 versus categorized cholesterol level Serum cholesterol (mg/dl) Desirable (\200) Moderately high (200-239) High (C240) P ABCG5: Q604E (C1810G) Genotype CC 3 (0.43%) 2 (0.84%) 4 (3.5%) 0.004 CG+GG 692 (99.6%) 235 (99.2%) 109 (96.5%) ABCG8:D19H (G55C) Genotype GG 682 (98.0%) 227 (96.6%) 104 (92.9%) 0.009 GC 14 (2.0%) 8 (3.4%) 8 (7.1%) ABCG8:C54Y (G161A) Genotype GG 576 (82.1%) 190 (80.5%) 87 (77.7%) 0.517 GA+AA 126 (17.9%) 46 (19.5%) 25 (22.3%) ABCG8:T400 K (C1199A) Genotype CC 592 (84.3%) 197 (83.5%) 96 (85.0%) 0.927 CA+AA 110 (15.7%) 39 (16.5%) 17 (15.0%) P values were obtained from the chi-square test Table 3 Comparison of the biochemical characteristics of subjects with D19 (GG) and D19H (GC) genotypes GG GC P Number 1,016 30 Sex (M:F) 870:146 24:6 0.39 Age (years) 49.1 ± 9.2 49.8 ± 11.4 0.09 BMI (kg/m2 ) 24.4 ± 3.3 25.4 ± 4.2 0.09 SBP (mmHg) 125.4 ± 16.5 124.3 ± 13.8 0.76 DBP (mmHg) 77.6 ± 11.1 78.6 ± 7.0 0.64 CHOL (mg/dl) 187.2 ± 37.9 207.1 ± 45.1 0.005 TG (mg/dl) 139.8 ± 146.3 124.5 ± 46.8 0.57 LDL-C (mg/dl) 127.8 ± 35.2 145.1 ± 40.6 0.023 HDL-C (mg/dl) 52.2 ± 13.2 53.1 ± 10.1 0.77 F-glucose (mg/dl) 96.7 ± 28.7 98.4 ± 25.2 0.76 HOMA-IR 1.12 ± 2.00 3.21 ± 7.84 0.026 Data are shown as as mean ± SD Student`s t test was used for statistical analysis and the Mann-Whitney U test was used for HOMA-IR BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; CHOL, cholesterol; TG, triglyceride; LDL-C, low-density lipoprotein; HDL-C, high-density lipoprotein; F-glucose, fasting glucose; HOMA-IR, homeostatic model assessment insulin resistance Table 4 Risk stratification for the ABCG8 genotypes (D19H vs. D19) in terms of serum cholesterol and LDL-C levels D19 D19H P Moderately high versus desirable cholesterol Crude odds ratio 1 1.72 (0.71-4.14) 0.23 Adjusted odds ratio 1 1.54 (0.62-3.83) 0.35 High versus desirable cholesterol Crude odds ratio 1 3.75 (1.53-9.15) 0.004 Adjusted odds ratio 1 3.44 (1.32-8.97) 0.012 Moderately high versus desirable LDL-C Crude odds ratio 1 1.92 (0.67-5.54) 0.227 Adjusted odds ratio 1 1.65 (0.55-4.89) 0.37 High versus desirable LDL-C Crude odds ratio 1 3.51 (1.25-9.85) 0.017 Adjusted odds ratio 1 3.29 (1.10-9.82) 0.033 Desirable cholesterol indicates \200 mg/dl; moderately high cholesterol indicates 200-239 mg/dl; high cholesterol indicates C240 mg/dl Desirable LDL-C indicates \130 mg/dl; moderately high LDL-C indicates 130-159 mg/dl; high LDL-C indicates C160 mg/dl Logistic regression analysis was used to estimate the odds ratio, by adjusting for age and sex. Login to comment
114 In a study of hypercholesterolemic subjects, Q604E polymorphism was linked to insulin resistance in men (Gylling et al. 2004). Login to comment
70 The serum total cholesterol and the LDL-C level were significantly higher in subjects with the D19H (GC) genotype than those with D19 (GG). Login to comment
43 Five nonsynonymous polymorphisms, including Q604E (rs6720173) of the ABCG5 gene and D19H (rs11887534), C54Y (rs4148211), T400K (rs4148217) and A632V (rs6544718) of the ABCG8 gene, were chosen for genotyping (http://www.ncbi.nlm.nih.gov/). Login to comment
63 Five nonsynonymous polymorphisms (ABCG5: Q604E; ABCG8:D19H, C54Y, T400K, A632V) were genotyped in our population. Login to comment
65 The minor allele frequencies (MAFs) of Q604E (C:G); D19H (G:C), C54Y (G:A) and T400K (C:A) were 10.5, 1.4, 9.7 and 8.0%, respectively. Login to comment
73 This exhibited a significant trend with an increasing frequency of the C allele in Q604 (ABCG5) and D19H (ABCG8) genotypes from the Table 1 Serum cholesterol and LDL levels for the genotypes of ABCG5/ABCG8 Cholesterol (mg/dl) P LDL-C (mg/dl) P ABCG5: Q604E (C1810G) Genotype CC (n = 9) 225.9 &#b1; 48.5 0.008 133.7 &#b1; 40.0 0.733 CG (n = 203) 189.6 &#b1; 37.6 130.1 &#b1; 32.7 GG (n = 833) 187.2 &#b1; 38.1 127.9 &#b1; 35.9 ABCG8:D19H (G55C) Genotype GG (n = 1,016) 187.2 &#b1; 37.9 0.005 127.8 &#b1; 35.2 0.023 GC (n = 30) 207.1 &#b1; 45.1 145.1 &#b1; 40.6 CC (n = 0) - - ABCG8:C54Y (G161A) Genotype GG (n = 853) 187.3 &#b1; 37.8 0.297 127.8 &#b1; 35.4 0.671 GA (n = 189) 190.4 &#b1; 40.0 130.0 &#b1; 35.2 AA (n = 8) 171.6 &#b1; 24.0 118.0 &#b1; 23.8 ABCG8:T400 K (C1199A) Genotype CC (n = 885) 188.0 &#b1; 38.2 0.869 128.3 &#b1; 35.4 0.997 CA (n = 164) 186.9 &#b1; 38.2 128.3 &#b1; 34.3 AA (n = 2) 194.0 &#b1; 22.6 131.0 &#b1; 10.2 P values were obtained from a one-way ANOVA and the t test desirable to the moderately high and then to the high cholesterol category. Login to comment
84 In addition, subjects with the D19H variant were associated with an almost threefold higher risk of developing high total cholesterol and LDL-C levels Table 2 Genotype frequency of ABCG5/ABCG8 versus categorized cholesterol level Serum cholesterol (mg/dl) Desirable (\200) Moderately high (200-239) High (C240) P ABCG5: Q604E (C1810G) Genotype CC 3 (0.43%) 2 (0.84%) 4 (3.5%) 0.004 CG+GG 692 (99.6%) 235 (99.2%) 109 (96.5%) ABCG8:D19H (G55C) Genotype GG 682 (98.0%) 227 (96.6%) 104 (92.9%) 0.009 GC 14 (2.0%) 8 (3.4%) 8 (7.1%) ABCG8:C54Y (G161A) Genotype GG 576 (82.1%) 190 (80.5%) 87 (77.7%) 0.517 GA+AA 126 (17.9%) 46 (19.5%) 25 (22.3%) ABCG8:T400 K (C1199A) Genotype CC 592 (84.3%) 197 (83.5%) 96 (85.0%) 0.927 CA+AA 110 (15.7%) 39 (16.5%) 17 (15.0%) P values were obtained from the chi-square test Table 3 Comparison of the biochemical characteristics of subjects with D19 (GG) and D19H (GC) genotypes GG GC P Number 1,016 30 Sex (M:F) 870:146 24:6 0.39 Age (years) 49.1 &#b1; 9.2 49.8 &#b1; 11.4 0.09 BMI (kg/m2 ) 24.4 &#b1; 3.3 25.4 &#b1; 4.2 0.09 SBP (mmHg) 125.4 &#b1; 16.5 124.3 &#b1; 13.8 0.76 DBP (mmHg) 77.6 &#b1; 11.1 78.6 &#b1; 7.0 0.64 CHOL (mg/dl) 187.2 &#b1; 37.9 207.1 &#b1; 45.1 0.005 TG (mg/dl) 139.8 &#b1; 146.3 124.5 &#b1; 46.8 0.57 LDL-C (mg/dl) 127.8 &#b1; 35.2 145.1 &#b1; 40.6 0.023 HDL-C (mg/dl) 52.2 &#b1; 13.2 53.1 &#b1; 10.1 0.77 F-glucose (mg/dl) 96.7 &#b1; 28.7 98.4 &#b1; 25.2 0.76 HOMA-IR 1.12 &#b1; 2.00 3.21 &#b1; 7.84 0.026 Data are shown as as mean &#b1; SD Student`s t test was used for statistical analysis and the Mann-Whitney U test was used for HOMA-IR BMI, body mass index; SBP, systolic blood pressure; DBP, diastolic blood pressure; CHOL, cholesterol; TG, triglyceride; LDL-C, low-density lipoprotein; HDL-C, high-density lipoprotein; F-glucose, fasting glucose; HOMA-IR, homeostatic model assessment insulin resistance Table 4 Risk stratification for the ABCG8 genotypes (D19H vs. D19) in terms of serum cholesterol and LDL-C levels D19 D19H P Moderately high versus desirable cholesterol Crude odds ratio 1 1.72 (0.71-4.14) 0.23 Adjusted odds ratio 1 1.54 (0.62-3.83) 0.35 High versus desirable cholesterol Crude odds ratio 1 3.75 (1.53-9.15) 0.004 Adjusted odds ratio 1 3.44 (1.32-8.97) 0.012 Moderately high versus desirable LDL-C Crude odds ratio 1 1.92 (0.67-5.54) 0.227 Adjusted odds ratio 1 1.65 (0.55-4.89) 0.37 High versus desirable LDL-C Crude odds ratio 1 3.51 (1.25-9.85) 0.017 Adjusted odds ratio 1 3.29 (1.10-9.82) 0.033 Desirable cholesterol indicates \200 mg/dl; moderately high cholesterol indicates 200-239 mg/dl; high cholesterol indicates C240 mg/dl Desirable LDL-C indicates \130 mg/dl; moderately high LDL-C indicates 130-159 mg/dl; high LDL-C indicates C160 mg/dl Logistic regression analysis was used to estimate the odds ratio, by adjusting for age and sex. Login to comment
115 In a study of hypercholesterolemic subjects, Q604E polymorphism was linked to insulin resistance in men (Gylling et al. 2004). Login to comment

[hide] Genetic variation in ABC G5/G8 and NPC1L1 impact c... Lipids. 2008 Dec;43(12):1155-64. Epub 2008 Oct 11. Zhao HL, Houweling AH, Vanstone CA, Jew S, Trautwein EA, Duchateau GS, Jones PJ
Genetic variation in ABC G5/G8 and NPC1L1 impact cholesterol response to plant sterols in hypercholesterolemic men.
Lipids. 2008 Dec;43(12):1155-64. Epub 2008 Oct 11., [PMID:18850127]

Abstract [show]
ATP-binding cassette hetero-dimeric transporters G5 and G8 (ABCG5/G8) have been postulated to mediate intestinal cholesterol efflux, whereas Niemann-Pick C1 Like 1 (NPC1L1) protein is believed to be essential for intestinal cholesterol influx. The individual or combined genetic markers, such as single nuclear polymorphisms (SNPs), of these two transporter genes may explain inter-individual variations in plasma cholesterol response following plant sterol (PS) intervention. The present study was aimed at investigating the association between ABCG5/G8 and NPC1L1 genotype SNPs with sterol absorption and corresponding plasma concentrations. The study used a 4-week crossover design with 82 hypercholesterolemic men characterized by high vs. low basal plasma PS concentrations consuming spreads with or without 2 g/day of PS. For the ABCG8 1289 C > A (T400 K) polymorphism, the A allele carriers with high basal plasma PS concentrations demonstrated a 3.9-fold greater reduction (p < 0.05) in serum low density lipoprotein cholesterol (LDL-C) than their low basal plasma PS counterparts. For the NPC1L1 haplotype of 872 C > G (L272L) and 3929 G > A (Y1291Y), individuals carrying mutant alleles showed a 2.4-fold greater (p < 0.05) reduction in LDL-C levels, compared to wild type counterparts. Results suggest that genetic and metabolic biomarkers together may predict inter-individual lipid level responsiveness to PS-intervention, and thus could be useful in devising individualized cholesterol lowering strategies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 Analyses of ABCG5/G8 and NPC1L1 Genotype SNPs The ABCG5/G8 polymorphisms, 1950 G [ C (Q604E), 145 G [ C (D19H), 1289 C [ A (T400 K) and 1572 (A632 V), as well as the NPC1L1 polymorphisms, 872 C [ G (L272L) and 3929 G [ A (Y1291Y), were screened from the published SNP data demonstrating an established functional significance for cholesterol modulation. Login to comment
51 Analyses of ABCG5/G8 and NPC1L1 Genotype SNPs The ABCG5/G8 polymorphisms, 1950 G [ C (Q604E), 145 G [ C (D19H), 1289 C [ A (T400 K) and 1572 (A632 V), as well as the NPC1L1 polymorphisms, 872 C [ G (L272L) and 3929 G [ A (Y1291Y), were screened from the published SNP data demonstrating an established functional significance for cholesterol modulation. Login to comment
48 Analyses of ABCG5/G8 and NPC1L1 Genotype SNPs The ABCG5/G8 polymorphisms, 1950 G [ C (Q604E), 145 G [ C (D19H), 1289 C [ A (T400 K) and 1572 (A632 V), as well as the NPC1L1 polymorphisms, 872 C [ G (L272L) and 3929 G [ A (Y1291Y), were screened from the published SNP data demonstrating an established functional significance for cholesterol modulation. Login to comment

[hide] The effects of ABCG5/G8 polymorphisms on plasma HD... J Lipid Res. 2009 Mar;50(3):565-73. Epub 2008 Nov 12. Junyent M, Tucker KL, Smith CE, Garcia-Rios A, Mattei J, Lai CQ, Parnell LD, Ordovas JM
The effects of ABCG5/G8 polymorphisms on plasma HDL cholesterol concentrations depend on smoking habit in the Boston Puerto Rican Health Study.
J Lipid Res. 2009 Mar;50(3):565-73. Epub 2008 Nov 12., [PMID:19005228]

Abstract [show]
Low HDL-cholesterol (HDL-C) is associated with an increased risk for atherosclerosis, and concentrations are modulated by genetic factors and environmental factors such as smoking. Our objective was to assess whether the association of common single-nucleotide polymorphisms (SNPs) at ABCG5/G8 (i18429G>A, i7892T>C, Gln604GluC>G, 5U145A>C, Tyr54CysA>G, Asp19HisG>C, i14222A>G, and Thr400LysC>A) genes with HDL-C differs according to smoking habit. ABCG5/G8 SNPs were genotyped in 845 participants (243 men and 602 women). ABCG5/G8 (i7892T>C, 5U145A>C, Tyr54CysA>G, Thr400LysC>A) SNPs were significantly associated with HDL-C concentrations (P < 0.001-0.013) by which carriers of the minor alleles at the aforementioned polymorphisms and homozygotes for the Thr400 allele displayed lower HDL-C. A significant gene-smoking interaction was found, in which carriers of the minor alleles at ABCG5/G8 (Gln604GluC>G, Asp19HisG>C, i14222A>G) SNPs displayed lower concentrations of HDL-C only if they were smokers (P = 0.001-0.025). Also, for ABCG8_Thr400LysC>A SNP, smokers, but not nonsmokers, homozygous for the Thr400 allele displayed lower HDL-C (P = 0.004). Further analyses supported a significant haplotype global effect on lowering HDL-C (P = 0.002) among smokers. In conclusion, ABCG5/G8 genetic variants modulate HDL-C concentrations, leading to an HDL-C-lowering effect and thereby a potential increased risk for atherosclerosis only in smokers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 Some of these studies reported significant associations between ABCG5/G8 SNPs (Gln604Glu, Thr400Lys, and Tyr54Cys) and total cholesterol and LDL-C, including 154 females undergoing weight loss (13), 112 subjects after consumption of plant stanol esters (14), and 263 mildly hypercholesterolemic patients (17). Login to comment
30 Only two studies in patients with gallstone disease reported significant associations with HDL-C (16) and triglyceride (TG) concentrations (16, 18), but not with total cholesterol and LDL-C, for ABCG5 Gln604Glu and ABCG8 Thr400Lys SNPs, respectively. Login to comment
27 Some of these studies reported significant associations between ABCG5/G8 SNPs (Gln604Glu, Thr400Lys, and Tyr54Cys) and total cholesterol and LDL-C, including 154 females undergoing weight loss (13), 112 subjects after consumption of plant stanol esters (14), and 263 mildly hypercholesterolemic patients (17). Login to comment
29 Only two studies in patients with gallstone disease reported significant associations with HDL-C (16) and triglyceride (TG) concentrations (16, 18), but not with total cholesterol and LDL-C, for ABCG5 Gln604Glu and ABCG8 Thr400Lys SNPs, respectively. Login to comment

[hide] Gallstone disease in Swedish twins: risk is associ... J Intern Med. 2010 Sep;268(3):279-85. Epub 2010 Apr 28. Katsika D, Magnusson P, Krawczyk M, Grunhage F, Lichtenstein P, Einarsson C, Lammert F, Marschall HU
Gallstone disease in Swedish twins: risk is associated with ABCG8 D19H genotype.
J Intern Med. 2010 Sep;268(3):279-85. Epub 2010 Apr 28., [PMID:20497293]

Abstract [show]
OBJECTIVE: Recently, variants of the hepatocanalicular cholesterol hemitransporters ABCG5/8 were linked to gallstone disease; ABCG8 D19H in Caucasians and ABCG5 Q604E in Chinese. We investigated these polymorphisms in Swedish twins by merging the Swedish Twin Registry with the Hospital Discharge and Causes of Death Registries for gallstone disease-related diagnoses. DESIGN: All monozygotic (MZ) twins with gallstone disease alive in the Stockholm area were invited to participate. Gallstone disease was defined by entry in all above mentioned registries, questionnaire or abdominal ultrasound. SUBJECTS: ABCG5 Q604E and ABCG8 D19H genotyping was performed in 24 unique MZ and eight dizygotic (DZ) twins from concordant pairs. Screening of the TwinGene database for gallstone disease resulted in an additional 20 concordant MZ and 54 twins from concordant DZ pairs. We included 109 concordantly stone-free MZ and 126 stone-free independent DZ twins as controls. RESULTS: Amongst the 341 twins, 20.8% carried at least one D19H allele as compared to 9.4% of stone-free controls. The association analysis showed that D19H positivity significantly increased the risk of gallstone disease [odds ratio (OR), 2.54; 95% confidence interval (CI), 1.33-4.82; P = 0.004]. We also found a trend for a positive association between gallstone disease and the Q604E variant (OR, 1.47; 95% CI, 1.00-2.16; P = 0.052). CONCLUSION: Twins carrying a heterozygous or homozygous ABCG8 D19H genotype have a significantly increased risk of gallstone disease. Our study confirms the ABCG8 D19H genotype as a major risk factor for gallstone disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 ABCG5 Q604E and ABCG8 D19H genotyping was performed in 24 unique MZ and eight dizygotic (DZ) twins from concordant pairs. Login to comment
17 We also found a trend for a positive association between gallstone disease and the Q604E variant (OR, 1.47; 95% CI, 1.00-2.16; P = 0.052). Login to comment
30 In Chinese populations, another nonsynonymous polymorphism, Q604E on the ABCG5 gene, was found to be associated with GD [16]. Login to comment
31 To further validate the contribution of the lithogenic ABCG5 Q604E and ABCG8 D19H variants to GD, we tested for these alleles in a twin-based association study after selected sampling from the Swedish Twin Registry(STR). Login to comment
74 Results The ABCG5 Q604E and ABCG8 D19H variants were successfully genotyped in all samples. Login to comment
76 Table 2 summarizes the allele and genotype distributions for the ABCG5 Q604E and ABCG8 D19H variants. Login to comment
78 Seven and six MZ twin pairs were heterozygous Q604E and D19H carriers, respectively. Login to comment
79 Concordance for GD was found in five twin pairs with Q604E or D19H variants, respectively. Login to comment
81 Discordant MZ twins were disregarded from further calculations, as they cannot be Table 2 Alleles and genotypes (count / frequency) for ABCG8 D19H (A) and ABCG5 Q604E (B) in all unique monozygotic, dizygotic andcontrolgenomesforSwedishtwins MZ DZ NoGD GD NoGD GD n % n % n % n % (A)AllelefrequenciesofABCG8 D19HinSwedishtwins Allele / genotype Totalscreeningpopulation GG 99 90.8 36 81.8 114 90.5 48 77.4 GC 9 8.3 8 18.2 11 8.7 13 21.0 CC 1 0.9 0 0 1 0.8 1 1.6 StockholmCountyscreeningpopulation GG 7 87.5 19 79.2 0 4 50.0 GC 1 12.5 5 20.8 0 3 37.5 CC 0 0 0 0 0 1 12.5 Nationwidescreeningpopulation GG 99 90.9 17 85.0 114 90.5 44 81.5 GC 9 8.3 3 15.0 11 8.7 10 18.5 CC 1 0.9 0 0 1 0.8 0 0.0 (B)AllelefrequenciesofABCG5Q604EinSwedishtwins Allele / genotype Totalscreeningpopulation GG 74 67.9 32 72.7 85 67.5 26 41.9 GC 32 29.4 11 25.0 33 26.2 32 51.6 CC 3 2.7 1 2.3 8 6.3 4 6.5 StockholmCountyscreeningpopulation GG 6 75.0 18 75.0 0 0 1 12.5 GC 2 25.0 5 20.8 0 0 7 87.5 CC 0 0 1 4.2 0 0 0 0 Nationwidescreeningpopulation GG 74 67.9 14 70.0 85 67.5 25 46.3 GC 32 29.4 6 30.0 33 26.2 25 46.3 CC 3 2.7 0 0 8 6.3 4 7.4 MZ,uniquegenomesinconcordantMZpairswithGDandstone-freeuniqueMZgenomes;DZ,twinsinconcordantDZpairswith GDandnonrelated stone-freeDZtwins. Login to comment
93 Of the 108 heterozygous Q604E carriers, 43 had GD and 65 did not. There were only 16 homozygous Q604E carriers, five of whom had GD. Login to comment
95 Amongst the MZ cases, 27.3% were Q604E carriers compared to 32.1% of MZ controls. Amongst the DZ cases, 58.1% were Q604E carriers comparedto32.5%ofDZcontrols.Overall,45.3%(48 of 106) of cases were positive for the Q604E allele, compared to 32.3% (76 of 235) of controls. Login to comment
105 In the same study, the ABCG5 Q604E polymorphism was also found to be associated with GD, with an OR of 6.4 in (male) patients above 50 years of age [16]. Login to comment
122 Moreover, such misclassification would be expected to bias the estimates to the null, which means that the relationship between D19H (and Q604E) and GD would be, if anything, underestimated. Login to comment

[hide] Current therapy for patients with sitosterolemia--... J Atheroscler Thromb. 2010 Sep 30;17(9):891-900. Epub 2010 Jun 11. Tsubakio-Yamamoto K, Nishida M, Nakagawa-Toyama Y, Masuda D, Ohama T, Yamashita S
Current therapy for patients with sitosterolemia--effect of ezetimibe on plant sterol metabolism.
J Atheroscler Thromb. 2010 Sep 30;17(9):891-900. Epub 2010 Jun 11., 2010-09-30 [PMID:20543520]

Abstract [show]
Sitosterolemia is a rare, autosomal recessive inherited sterol storage disease associated with high tissue and serum plant sterol concentrations, caused by mutations in the adenosine triphosphate-bind-ing cassette (ABC) transporter ABCG5 or ABCG8 genes. Markedly increased serum concentration of plant sterols. such as sitosterol and campesterol, cause premature atherosclerosis and massive xanthomas. Hitherto known treatments for sitosterolemia, including a low-sterol diet, bile-salt binding resins, ileal bypass surgery and low density lipoprotein (LDL) apheresis have not yielded sufficient reduction of serum plant sterol levels and many patients show a sustained elevation of plant sterol levels, subsequently developing premature atherosclerotic cardiovascular diseases. Ezetimibe, an inhibitor of intestinal cholesterol absorption through its binding to Niemann-Pick C1-like 1 (NPC1L1), has been widely used for decreasing serum LDL-cholesterol levels in patients with hypercholesterolemia. Ezetimibe also reduces the gastrointestinal absorption of plant sterols, thereby also lowering the serum concentrations of plant sterols. This pharmacological property of ezetimibe shows its potential as a novel effective therapy for sitosterolemia. In the current review, we discuss the current therapy for patients with sitosterolemia and present two Japanese adolescent patients with this disease, one of whom underwent percutaneous coronary intervention for accelerated coronary atherosclerosis. Ezetimibe administration in addition to conventional drug therapy successfully reduced serum sitosterol levels by 51.3% and 48.9%, respectively, in the two patients, demonstrating ezetimibe as a novel and potent treatment agent for sitosterolemia that could work additively with conventional drug therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 Location of the gene mutation and hematological/ biochemical laboratory data in case 1 (at the time of PCI) and case 2 (at the first visit) Case 1 Case 2 ABCG5 mutation WBC (/ L) RBC ( 104 / L) Hemoglobin (g/dL) Platelet ( 104 / L) AST (IU/L) ALT (IU/L) CRP (mg/dL) Total Cholesterol (mg/dL) LDL Cholesterol (mg/dL) HDL Cholesterol (mg/dL) Triglyceride (mg/dL) Sitosterol ( g/mL) Campesterol ( g/mL) Stigmasterol ( g/mL) A1756C (R550S) G1362A (R419H) 7,610 382 9.8 18.5 14 16 0.3 172 87 67 121 87.8 48.8 4.0 G1306A (R389H) C1949 (Q604E) 6,370 385 10.9 12.5 29 26 1.0 289 229 85 172 88.5 84.5 7.2 Fig.3. Login to comment

[hide] ABCG5/G8 polymorphisms and markers of cholesterol ... J Lipid Res. 2010 Oct;51(10):3016-23. Epub 2010 Jun 25. Jakulj L, Vissers MN, Tanck MW, Hutten BA, Stellaard F, Kastelein JJ, Dallinga-Thie GM
ABCG5/G8 polymorphisms and markers of cholesterol metabolism: systematic review and meta-analysis.
J Lipid Res. 2010 Oct;51(10):3016-23. Epub 2010 Jun 25., [PMID:20581104]

Abstract [show]
Genetic variation at the ABCG5/G8 locus has been associated with markers of cholesterol homeostasis. As data originate from small-scale studies, we performed a meta-analysis to study these associations in a large dataset. We first investigated associations between five common ABCG5/G8 polymorphisms (p.Q604E, p.D19H, p.Y54C, p.T400K, and p.A632V) and plasma sterol levels in 245 hypercholesterolaemic individuals. No significant associations were found. Subsequently, our data were pooled into a meta-analysis that comprised 3,364 subjects from 16 studies (weighted mean age, 46.7 +/- 10.5 years; BMI, 23.9 +/- 3.5 kg/m(2)). Presence of the minor 632V allele correlated with reduced LDL-C concentrations (n = 367) compared with homozygosity for the 632A variant [n = 614; -0.11 mmol/l (95% CI, range: -0.20 to -0.02 mmol/l); P = 0.01]. The remaining polymorphisms were not associated with plasma lipid levels. Carriers of the 19H allele exhibited lower campesterol/TC (n = 83; P < 0.001), sitosterol/TC (P < 0.00001), and cholestanol/TC (P < 0.00001), and increased lathosterol/TC ratios (P = 0.001) compared with homozygous 19D allele carriers (n = 591). The ABCG8 632V variant was associated with a clinically irrelevant LDL-C reduction, whereas the 19H allele correlated with decreased cholesterol absorption and increased synthesis without affecting the lipid profile. Hence, associations between frequently studied missense ABCG5/G8 polymorphisms and markers of cholesterol homeostasis are modest at best.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
141 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (␮g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 ± 0.76 4.05 ± 0.61 1.54 ± 0.40 1.09 [0.29-3.56] 1.45 ± 0.64 1.12 ± 0.53 1.49 ± 0.33 1.24 ± 0.49 QE/EE 72 6.23 ± 0.73 4.11 ± 0.63 1.49 ± 0.36 1.19 [0.47-3.93] 1.47 ± 0.88 1.16 ± 0.63 1.46 ± 0.38 1.28 ± 0.57 D19H DD 219 6.19 ± 0.75 4.08 ± 0.61 1.52 ± 0.40 1.10 [0.29-3.93] 1.49 ± 0.69 1.16 ± 0.55 1.49 ± 0.34 1.24 ± 0.49 DH/HH 24 6.04 ± 0.81 3.90 ± 0.63 1.60 ± 0.38 1.15 [0.47-1.97] 1.24 ± 0.82 0.92 ± 0.53 1.38 ± 0.34 1.35 ± 0.64 Y54C YY 73 6.32 ± 0.73 4.14 ± 0.64 1.58 ± 0.37 1.09 [0.45-3.93] 1.59 ± 0.76 1.22 ± 0.60 1.53 ± 0.33 1.24 ± 0.53 YC/CC 171 6.12 ± 0.76 4.03 ± 0.61 1.51 ± 0.41 1.11 [0.29-3.56] 1.41 ± 0.68 1.09 ± 0.53 1.46 ± 0.34 1.26 ± 0.50 T400K TT 183 6.16 ± 0.75 4.03 ± 0.60 1.55 ± 0.40 1.10 [0.29-3.93] 1.48 ± 0.69 1.14 ± 0.55 1.49 ± 0.35 1.25 ± 0.48 TK/KK 61 6.24 ± 0.76 4.19 ± 0.66 1.47 ± 0.37 1.14 [0.47-2.61] 1.38 ± 0.76 1.09 ± 0.59 1.45 ± 0.31 1.27 ± 0.59 A632V AA 139 6.22 ± 0.72 4.12 ± 0.60 1.51 ± 0.37 1.12 [0.33-2.90] 1.49 ± 0.72 1.16 ± 0.58 1.51 ± 0.37 1.21 ± 0.49 AV/VV 105 6.14 ± 0.79 3.99 ± 0.63 1.57 ± 0.43 1.07 [0.29-3.93] 1.42 ± 0.70 1.09 ± 0.52 1.44 ± 0.30 1.31 ± 0.52 Values shown are means ± SD. Triglycerides are shown as median [range]. Login to comment
145 TABLE3.Characteristicsofstudiesincludedinthemeta-analysis Reference Number of SubjectsAge Male/ Female BodyMass IndexEthnicitySingleNucleotidePolymorphismsLipidsNon-CholesterolSterols nyearsnkg/m 2 Berge,2002(5)14855±1174/74NotreportedCaucasianD19H,T400K,Y54C,Q604E,A632VTCCAMP,SITO,CHOLST,LATHO Weggemans,2002(7)48626.3±11.6257/22921.7±3.0CaucasianQ604ETC- Gylling,2004(13)26253.1±8.1143/11926.4±6.5CaucasianD19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TGCAMP,SITO,CHOLST,LATHO Plat,2005(11)a 11233±1641/7122.9±3.6CaucasianT400K,Q604E,A632VLDL-C,HDL-C,TGCAMP,SITO,LATHO Acalovschi,2006(27)72 e 56.3(36-80)30/4230.1±4.9CaucasianD19H,T400K,Y54C,Q604E,A632VTC,HDL-C,TG- Jakulj,etal. b 24558.4±7.5189/4825.8±3.0CaucasianD19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TGCAMP,SITO,CHOLST,LATHO Miwa,2005(28)10062.4±12.148/5223.0±3.5AsianT400K,Y54C,Q604E-SITO,LATHO Wang,2007(29) a,c 13454.1±8.1134/023.2±2.3AsianT400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Chen,2008(8) a 104647.0±;9.3894/15224.9±2.4AsianD19H,T400K,Y54C,Q604E i TC,LDL-C,HDL-C,TG- Caamano,2008(30) d 10440±;1058/4625.5±3.3HispanicY54C,Q604ETC,LDL-C,HDL-C,TG- 11844±771/4727.6±4.9HispanicY54C,Q604ETC,LDL-C,HDL-C,TG- Santosa,2007(31) a 3549.4±6.70/3531.4±2.8Mixed f D19H,T400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Rudkowska,2008(32)2659.6±9.615/1126.4±2.7Mixed f D19H,T400K,Y54C,Q604ETC,LDL-C,HDL-C,TG- Chan,2004(33) a 4754.5±8.447/032±3.6Notreported g D19H,T400KTC,LDL-C,HDL-C,TGCAMP,SITO,LATHO Kajinami,2004(12) a 33858±11203/13527.0±3.0Notreported h D19H,T400K,Y54C,Q604E,A632VTC,LDL-C,HDL-C,TG- Herron,2006(9) a 9131.1±9.240/5124.8±4.7Notreported h Q604ETC,LDL-C,HDL-C- Total(WM)336446.7±10.52251/111323.9±3.5 Numberandcharacteristicsofstudiesincludedinthemeta-analysis.CAMP,campesterol/TCratio;CHOLST,cholestanol/TCratio;HDL-C,HDL-cholesterol;LATHO,lathosterol/TCratio;LDL-C, LDL-cholesterol;SITO,sitosterol/TCratio;TC,totalcholesterol;TG,triglyceride;WM,weightedmean. Login to comment
12 We first investigated associations between five common ABCG5/G8 polymorphisms (p.Q604E, p.D19H, p.Y54C, p. T400K, and p.A632V) and plasma sterol levels in 245 hypercholesterolaemic individuals. Login to comment
68 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
66 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
139 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (òe;g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 &#b1; 0.76 4.05 &#b1; 0.61 1.54 &#b1; 0.40 1.09 [0.29-3.56] 1.45 &#b1; 0.64 1.12 &#b1; 0.53 1.49 &#b1; 0.33 1.24 &#b1; 0.49 QE/EE 72 6.23 &#b1; 0.73 4.11 &#b1; 0.63 1.49 &#b1; 0.36 1.19 [0.47-3.93] 1.47 &#b1; 0.88 1.16 &#b1; 0.63 1.46 &#b1; 0.38 1.28 &#b1; 0.57 D19H DD 219 6.19 &#b1; 0.75 4.08 &#b1; 0.61 1.52 &#b1; 0.40 1.10 [0.29-3.93] 1.49 &#b1; 0.69 1.16 &#b1; 0.55 1.49 &#b1; 0.34 1.24 &#b1; 0.49 DH/HH 24 6.04 &#b1; 0.81 3.90 &#b1; 0.63 1.60 &#b1; 0.38 1.15 [0.47-1.97] 1.24 &#b1; 0.82 0.92 &#b1; 0.53 1.38 &#b1; 0.34 1.35 &#b1; 0.64 Y54C YY 73 6.32 &#b1; 0.73 4.14 &#b1; 0.64 1.58 &#b1; 0.37 1.09 [0.45-3.93] 1.59 &#b1; 0.76 1.22 &#b1; 0.60 1.53 &#b1; 0.33 1.24 &#b1; 0.53 YC/CC 171 6.12 &#b1; 0.76 4.03 &#b1; 0.61 1.51 &#b1; 0.41 1.11 [0.29-3.56] 1.41 &#b1; 0.68 1.09 &#b1; 0.53 1.46 &#b1; 0.34 1.26 &#b1; 0.50 T400K TT 183 6.16 &#b1; 0.75 4.03 &#b1; 0.60 1.55 &#b1; 0.40 1.10 [0.29-3.93] 1.48 &#b1; 0.69 1.14 &#b1; 0.55 1.49 &#b1; 0.35 1.25 &#b1; 0.48 TK/KK 61 6.24 &#b1; 0.76 4.19 &#b1; 0.66 1.47 &#b1; 0.37 1.14 [0.47-2.61] 1.38 &#b1; 0.76 1.09 &#b1; 0.59 1.45 &#b1; 0.31 1.27 &#b1; 0.59 A632V AA 139 6.22 &#b1; 0.72 4.12 &#b1; 0.60 1.51 &#b1; 0.37 1.12 [0.33-2.90] 1.49 &#b1; 0.72 1.16 &#b1; 0.58 1.51 &#b1; 0.37 1.21 &#b1; 0.49 AV/VV 105 6.14 &#b1; 0.79 3.99 &#b1; 0.63 1.57 &#b1; 0.43 1.07 [0.29-3.93] 1.42 &#b1; 0.70 1.09 &#b1; 0.52 1.44 &#b1; 0.30 1.31 &#b1; 0.52 Values shown are means &#b1; SD. Triglycerides are shown as median [range]. Login to comment
144 Characteristics of studies included in the meta-analysis Reference Number of Subjects Age Male/ Female Body Mass Index Ethnicity Single Nucleotide Polymorphisms Lipids Non-Cholesterol Sterols n years n kg/m 2 Berge, 2002 (5) 148 55 &#b1; 11 74/74 Not reported Caucasian D19H, T400K, Y54C, Q604E, A632V TC CAMP, SITO, CHOLST, LATHO Weggemans, 2002 (7) 486 26.3 &#b1; 11.6 257/229 21.7 &#b1; 3.0 Caucasian Q604E TC - Gylling, 2004 (13) 262 53.1 &#b1; 8.1 143/119 26.4 &#b1; 6.5 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG CAMP, SITO, CHOLST, LATHO Plat, 2005 (11) a 112 33 &#b1; 16 41/71 22.9 &#b1; 3.6 Caucasian T400K, Q604E, A632V LDL-C, HDL-C, TG CAMP, SITO, LATHO Acalovschi, 2006 (27) 72 e 56.3 (36-80) 30/42 30.1 &#b1; 4.9 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, HDL-C, TG - Jakulj, et al. b 245 58.4 &#b1; 7.5 189/48 25.8 &#b1; 3.0 Caucasian D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG CAMP, SITO, CHOLST, LATHO Miwa, 2005 (28) 100 62.4 &#b1; 12.1 48/52 23.0 &#b1; 3.5 Asian T400K, Y54C, Q604E - SITO, LATHO Wang, 2007 (29) a , c 134 54.1 &#b1; 8.1 134/0 23.2 &#b1; 2.3 Asian T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Chen, 2008 (8) a 1046 47.0 &#b1; 9.3 894/152 24.9 &#b1; 2.4 Asian D19H, T400K, Y54C, Q604E i TC, LDL-C, HDL-C, TG - Caamano, 2008 (30) d 104 40 &#b1; 10 58/46 25.5 &#b1; 3.3 Hispanic Y54C, Q604E TC, LDL-C, HDL-C, TG - 118 44 &#b1; 7 71/47 27.6 &#b1; 4.9 Hispanic Y54C, Q604E TC, LDL-C, HDL-C, TG - Santosa, 2007 (31) a 35 49.4 &#b1; 6.7 0/35 31.4 &#b1; 2.8 Mixed f D19H, T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Rudkowska, 2008 (32) 26 59.6 &#b1; 9.6 15/11 26.4 &#b1; 2.7 Mixed f D19H, T400K, Y54C, Q604E TC, LDL-C, HDL-C, TG - Chan, 2004 (33) a 47 54.5 &#b1; 8.4 47/0 32 &#b1; 3.6 Not reported g D19H, T400K TC, LDL-C, HDL-C, TG CAMP, SITO, LATHO Kajinami, 2004 (12) a 338 58 &#b1; 11 203/135 27.0 &#b1; 3.0 Not reported h D19H, T400K, Y54C, Q604E, A632V TC, LDL-C, HDL-C, TG - Herron, 2006 (9) a 91 31.1 &#b1; 9.2 40/51 24.8 &#b1; 4.7 Not reported h Q604E TC, LDL-C, HDL-C - Total (WM) 3364 46.7 &#b1; 10.5 2251/ 1113 23.9 &#b1; 3.5 Number and characteristics of studies included in the meta-analysis. Login to comment
67 We genotyped five nonsynonymous polymorphisms in ABCG5/G8 [ABCG5: p.Q604E (rs6720173); ABCG8: p.D19H (rs11887534), p.Y54C (rs4148211), p.T400K (rs4148217), and p.A632V (rs6544718)] using allelic discrimination. Login to comment
140 Associations between ABCG5/G8 polymorphisms and plasma lipids and non-cholesterol sterol ratios Lipids and Lipoproteins (mmol/l) Non-Cholesterol Sterol Ratios (òe;g/mg) SNP N TC LDL-C HDL-C Triglycerides Campesterol/TC Sitosterol/TC Cholestanol/TC Lathosterol/TC Q604E QQ 171 6.16 &#b1; 0.76 4.05 &#b1; 0.61 1.54 &#b1; 0.40 1.09 [0.29-3.56] 1.45 &#b1; 0.64 1.12 &#b1; 0.53 1.49 &#b1; 0.33 1.24 &#b1; 0.49 QE/EE 72 6.23 &#b1; 0.73 4.11 &#b1; 0.63 1.49 &#b1; 0.36 1.19 [0.47-3.93] 1.47 &#b1; 0.88 1.16 &#b1; 0.63 1.46 &#b1; 0.38 1.28 &#b1; 0.57 D19H DD 219 6.19 &#b1; 0.75 4.08 &#b1; 0.61 1.52 &#b1; 0.40 1.10 [0.29-3.93] 1.49 &#b1; 0.69 1.16 &#b1; 0.55 1.49 &#b1; 0.34 1.24 &#b1; 0.49 DH/HH 24 6.04 &#b1; 0.81 3.90 &#b1; 0.63 1.60 &#b1; 0.38 1.15 [0.47-1.97] 1.24 &#b1; 0.82 0.92 &#b1; 0.53 1.38 &#b1; 0.34 1.35 &#b1; 0.64 Y54C YY 73 6.32 &#b1; 0.73 4.14 &#b1; 0.64 1.58 &#b1; 0.37 1.09 [0.45-3.93] 1.59 &#b1; 0.76 1.22 &#b1; 0.60 1.53 &#b1; 0.33 1.24 &#b1; 0.53 YC/CC 171 6.12 &#b1; 0.76 4.03 &#b1; 0.61 1.51 &#b1; 0.41 1.11 [0.29-3.56] 1.41 &#b1; 0.68 1.09 &#b1; 0.53 1.46 &#b1; 0.34 1.26 &#b1; 0.50 T400K TT 183 6.16 &#b1; 0.75 4.03 &#b1; 0.60 1.55 &#b1; 0.40 1.10 [0.29-3.93] 1.48 &#b1; 0.69 1.14 &#b1; 0.55 1.49 &#b1; 0.35 1.25 &#b1; 0.48 TK/KK 61 6.24 &#b1; 0.76 4.19 &#b1; 0.66 1.47 &#b1; 0.37 1.14 [0.47-2.61] 1.38 &#b1; 0.76 1.09 &#b1; 0.59 1.45 &#b1; 0.31 1.27 &#b1; 0.59 A632V AA 139 6.22 &#b1; 0.72 4.12 &#b1; 0.60 1.51 &#b1; 0.37 1.12 [0.33-2.90] 1.49 &#b1; 0.72 1.16 &#b1; 0.58 1.51 &#b1; 0.37 1.21 &#b1; 0.49 AV/VV 105 6.14 &#b1; 0.79 3.99 &#b1; 0.63 1.57 &#b1; 0.43 1.07 [0.29-3.93] 1.42 &#b1; 0.70 1.09 &#b1; 0.52 1.44 &#b1; 0.30 1.31 &#b1; 0.52 Values shown are means &#b1; SD. Triglycerides are shown as median [range]. Login to comment

[hide] ABCG8 D19H polymorphism: a basis for the genetic p... J Gastroenterol Hepatol. 2010 Nov;25(11):1713-4. doi: 10.1111/j.1440-1746.2010.06484.x. Yoon JH, Kuver R, Choi HS
ABCG8 D19H polymorphism: a basis for the genetic prediction of cholesterol gallstone disease.
J Gastroenterol Hepatol. 2010 Nov;25(11):1713-4. doi: 10.1111/j.1440-1746.2010.06484.x., [PMID:21039829]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 Other studies have identified a variety of polymorphisms in ABCG8 (A632V, T400K, D19H, and C54Y) and in ABCG5 (Q604E) that have been linked to baseline plasma cholesterol levels, cholesterol absorption, or responsiveness to dietary intervention. Login to comment
13 Hubacek et al.10 reported that none of the polymorphisms examined, including ABCG5 Q604E, ABCG8 D19H, and ABCG8 A632V, were related to plasma lipid levels in patients after 'evolutionary`dietary changes from a traditional, high-fat Eastern European diet to a lower-fat diet based on nutritional advice. Login to comment
15 Wang et al.11 examined five common polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H,Y54C, T400K, A632V) genes in 287 patients with gallstone disease. Login to comment

[hide] Interactions between CYP7A1 A-204C and ABCG8 C1199... J Clin Pharm Ther. 2010 Dec 3. doi: 10.1111/j.1365-2710.2010.01227.x. Wei KK, Zhang LR, Zhang Y, Hu XJ
Interactions between CYP7A1 A-204C and ABCG8 C1199A polymorphisms on lipid lowering with atorvastatin.
J Clin Pharm Ther. 2010 Dec 3. doi: 10.1111/j.1365-2710.2010.01227.x., 2010-12-03 [PMID:21128988]

Abstract [show]
What is known and Objective: Cholesterol excretion by ATP binding cassette transporters G5 and G8 (ABCG5/G8) and bile acid biosynthesis by 7a-hydroxylase (CYP7A1) are major pathways for the removal of cholesterol into bile. This suggests that variations in the CYP7A1 and ABCG8 genes may influence the statin response. We aimed to investigate the effect of CYP7A1 A-204C and ABCG8 C1199A polymorphisms and their interactions on the lipid-lowering response to atorvastatin in a Chinese population. Methods: Genotypes were determined by using polymerase chain reaction-restrict fragment length polymorphism (PCR-RFLP) in 185 hyperlipidaemic patients treated with atorvastatin, 20 mg once daily for 4 weeks. Serum levels of triglycerides (TGs), total cholesterol (TC), low-density lipoprotein cholesterol (LDL-C), and high-density lipoprotein cholesterol (HDL-C) were determined before and after treatment. Results and Discussion: For 181 patients (89 males), variant allele frequencies of CYP7A1 -204C and ABCG8 1199A were 0.347 and 0.128, respectively. Among all patients, homozygotes for the -204A allele showed a slightly significant mean percentage reduction from baseline in TG level after treatment than heterozygotes and homozygotes for the -204C allele (-25.49 +/- 8.12%vs. -22.80 +/- 8.72%, P = 0.054, and -25.49 +/- 8.12%vs.-22.51 +/- 8.82%, P = 0.048, respectively). For patients with the ABCG8 C1199A variant allele, the difference in percentage reduction from baseline in TG level was increased between the CYP7A1 A-204C wild-type allele homozygotes and variant allele homozygotes after atorvastatin treatment (-28.35%vs.-19.28%, P = 0.001), and increased differences were found between the CYP7A1 A-204C wild-allele homozygotes and variant allele homozygotes (-18.95%vs.-15.61%, P = 0.009) and between the CYP7A1 A-204C variant allele heterozygotes and homozygotes (-18.69%vs.-15.61%, P = 0.012, respectively). What is new and Conclusion: The CYP7A1 -204A and ABCG8 1199A alleles appear to interact to affect lipid-lowering response to atorvastatin. However, given the relatively small number of subjects with the influential variant allele combinations, and the heterogeneity in response, even in the selected sub-populations, testing would be of little clinical utility in the Chinese population sampled.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 Several previous studies have found that 5 nonsynonymous single-nucleotide polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) coding sequences may affect plasma plant sterol or cholesterol levels (16-19). Login to comment

[hide] Phytosterols and phytosterolemia: gene-diet intera... Genes Nutr. 2011 Feb;6(1):17-26. Epub 2010 Aug 28. Izar MC, Tegani DM, Kasmas SH, Fonseca FA
Phytosterols and phytosterolemia: gene-diet interactions.
Genes Nutr. 2011 Feb;6(1):17-26. Epub 2010 Aug 28., [PMID:21437027]

Abstract [show]
Phytosterol intake is recommended as an adjunctive therapy for hypercholesterolemia, and plant sterols/stanols can reduce cholesterol absorption at the intestinal lumen through the Niemann-Pick C1 Like 1 (NPC1L1) transporter pathway by competitive solubilization in mixed micelles. Phytosterol absorption is of less magnitude than cholesterol and is preferably secreted in the intestinal lumen by ABCG5/G8 transporters. Therefore, plasma levels of plant sterols/stanols are negligible compared with cholesterol, under an ordinary diet. The mechanisms of cholesterol and plant sterols absorption and the whole-body pool of sterols are discussed in this chapter. There is controversy about treatment with statins inducing further increase in plasma non-cholesterol sterols raising concerns about the safety of supplementation of plant sterols to such drugs. In addition, increase in plant sterols has also been reported upon consumption of plant sterol-enriched foods, regardless of other treatments. Rare mutations on ABCG5/G8 transporters affecting cholesterol/non-cholesterol extrusion, causing sitosterolemia with xanthomas and premature atheroslerotic disease are now known, and cholesterol/plant sterols absorption inhibitor, ezetimibe, emerges as the drug that reduces phytosterolemia and promotes xanthoma regression. On the other hand, common polymorphisms affecting the NPC1L1 transporter can interfere with the action of ezetimibe. Gene-diet interactions participate in this intricate network modulating the expression of genetic variants on specific phenotypes and can also affect the individual response to the hypolipidemic treatment. These very interesting aspects promoted a great deal of research in the field.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 Missense polymorphisms (Gln604Glu in the ABCG5, and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) were examined, and the Thr400Lys in the ABCG8 gene was associated with changes in lipid levels in response to reduced dietary animal fat and cholesterol intake. Login to comment
129 Missense polymorphisms (Gln604Glu in the ABCG5, and Asp19His, Tyr54Cys, Thr400Lys, and Ala632Val in the ABCG8) were examined, and the Thr400Lys in the ABCG8 gene was associated with changes in lipid levels in response to reduced dietary animal fat and cholesterol intake. Login to comment

[hide] Pathogenesis of cholesterol and pigment gallstones... Clin Res Hepatol Gastroenterol. 2011 Apr;35(4):281-7. Epub 2011 Feb 25. Van Erpecum KJ
Pathogenesis of cholesterol and pigment gallstones: an update.
Clin Res Hepatol Gastroenterol. 2011 Apr;35(4):281-7. Epub 2011 Feb 25., [PMID:21353662]

Abstract [show]
Phase separation of cholesterol crystals from supersaturated bile is still considered the key event in cholesterol gallstone formation. In this review, we will first provide a basal framework of the interactions between the sterol, bile salts and phospholipids in aqueous solutions and then summarize new developments. The hepatocytic apical membrane harbours specific transport proteins for these lipids. Polymorphisms in the gene encoding the cholesterol transporter ABCG5-G8 have been found to increase overall gallstone risk, whereas functional mutations in the gene encoding the phospholipid floppase ABCB4 lead to the rare clinical syndrome of low phospholipid associated cholelithiasis. Expression of bile salt and phospholipid transport proteins is regulated bij the bile salt nuclear receptor Farnesoid X receptor (FXR), while the Liver X Receptor (LXR) alpha regulates ABCG5-G8. Although data from murine experiments suggest a critical role of FXR in gallstone formation, its role in human lithogenesis remains controversial. Variants of the gene encoding UGT1A1 (uridine 5'-diphosphate (UDP)-glucuronosyltransferase 1A1) responsible for bilirubin conjugation were recently associated with risk of gallstones as well as stone bilirubin content, suggesting common factors in cholesterol and pigment gallstone pathogenesis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
91 Recently, variants of ABCG5/8 were linked to gallstone disease; ABCG8 D19H in Caucasians and ABCG5 Q604E in Chinese populations [35,36]. Login to comment
90 Recently, variants of ABCG5/8 were linked to gallstone disease; ABCG8 D19H in Caucasians and ABCG5 Q604E in Chinese populations [35,36]. Login to comment

[hide] The genetic background of gallstone formation: an ... Biochem Biophys Res Commun. 2010 May 21;396(1):58-62. Marschall HU, Katsika D, Rudling M, Einarsson C
The genetic background of gallstone formation: an update.
Biochem Biophys Res Commun. 2010 May 21;396(1):58-62., [PMID:20494111]

Abstract [show]
Gallstone disease is one of the most prevalent gastrointestinal diseases with a substantial burden to health care systems that is expected to increase in ageing populations at risk. This review summarizes recent data on the genetic background of cholesterol gallstones and the role of biliary lipid composition. Three previously unknown non-synonymous mutations in the ABCB4 gene encoding the hepatobiliary phospholipid-flippase MDR3 are presented.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 In Chinese gallstone populations, also other non-synonymous polymorphisms, Q604E on the ABCG5 gene [14], and T400 K on the ABCG8 gene [15] were associated with increased risk (OR, 6.4; CI, 1.3-30.7 [14] and 2.3; CI, 1.12-4.76 [15], respectively) but only in male patients older than 50 years of age. Login to comment
39 We also found a trend (p = 0.052) for a positive association with the Q604E variant of the ABCG5 gene in this particular Swedish population (OR, 1.5; CI, 1.00-2.16) [16]. Login to comment
41 Lower total cholesterol and triglyceride levels were also found in another study in Caucasian gallstone siblings, in this case both for carriers of the ABCG5 Q604E or ABCG8 D19H variants [19]. Login to comment

[hide] Genetic and functional identification of the likel... Hepatology. 2012 Aug 16. doi: 10.1002/hep.26009. von Kampen O, Buch S, Nothnagel M, Azocar L, Molina H, Brosch M, Erhart W, von Schonfels W, Egberts J, Seeger M, Arlt A, Balschun T, Franke A, Lerch MM, Mayerle J, Kratzer W, Boehm BO, Huse K, Schniewind B, Tiemann K, Jiang ZY, Han TQ, Mittal B, Srivastava A, Fenger M, Jorgensen T, Schirin-Sokhan R, Tonjes A, Wittenburg H, Stumvoll M, Kalthoff H, Lammert F, Tepel J, Puschel K, Becker T, Schreiber S, Platzer M, Volzke H, Krawczak M, Miquel JF, Schafmayer C, Hampe J
Genetic and functional identification of the likely causative variant for cholesterol gallstone disease at the ABCG5/8 lithogenic locus.
Hepatology. 2012 Aug 16. doi: 10.1002/hep.26009., [PMID:22898925]

Abstract [show]
BACKGROUND & AIMS: The sterolin locus (ABCG5/ABCG8) has been solidly shown to confer susceptibility for cholesterol gallstone disease in humans. Both the responsible variant and the molecular mechanism causing an increased incidence of gallstones in these patients have as yet not been identified. METHODS: Genetic mapping utilized patient samples from Germany (2808 cases, 2089 controls), Chile (680 cases, 442 controls), Denmark (366 cases, 766 controls), India (247 cases, 224 controls) and China (280 cases, 244 controls). Analysis of allelic imbalance in cDNA samples from human liver (N=22) was performed using pyrosequencing. Transiently transfected HEK293 cells were used for [3H]-cholesterol export assays, analysis of protein expression and localisation of allelic constructs. RESULTS: Through fine mapping in German and Chilean samples, a approximately 250kB disease-associated interval could be defined for this locus. Lack of allelic imbalance or allelic splicing of the ABCG5 and ABCG8 transcripts in human liver limited the search to coding SNPs. Subsequent mutation detection and genotyping yielded two disease-associated variants ABCG5-R50C (p=4.94x10(-9) ) and ABCG8-D19H (p=1.74x10(-10) ) in high pair-wise LD (r(2) =0.95). [3H]-cholesterol export assays of allelic constructs harbouring these genetic candidate variants demonstrated increased transport activity (3.2-fold, p=0.003) only for the ABCG8-19H variant, which was also superior in nested logistic regression models in German (p=0.018), Chilean (p=0.030) and Chinese (p=0.040) patient samples. CONCLUSION: This variant thus provides a molecular basis for biliary cholesterol hypersecretion as the mechanism for cholesterol gallstone formation thereby drawing a link between "post-genomic" and "pre-genomic" pathophysiological knowledge about this common complex disorder. (HEPATOLOGY 2012.).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 The significance of their disease associations was approximately seven orders of magnitude higher than that of the next "best" SNP (rs6720173, ABCG5-Q604E, pallelic=0.0024) which, moreover, is located well outside the disease-associated region defined above. Login to comment

[hide] Phytosterol and cholesterol precursor levels indic... Hepatology. 2012 May;55(5):1507-17. doi: 10.1002/hep.25563. Epub 2012 Apr 4. Krawczyk M, Lutjohann D, Schirin-Sokhan R, Villarroel L, Nervi F, Pimentel F, Lammert F, Miquel JF
Phytosterol and cholesterol precursor levels indicate increased cholesterol excretion and biosynthesis in gallstone disease.
Hepatology. 2012 May;55(5):1507-17. doi: 10.1002/hep.25563. Epub 2012 Apr 4., [PMID:22213168]

Abstract [show]
In hepatocytes and enterocytes sterol uptake and secretion is mediated by Niemann-Pick C1-like 1 (NPC1L1) and ATP-binding cassette (ABC)G5/8 proteins, respectively. Whereas serum levels of phytosterols represent surrogate markers for intestinal cholesterol absorption, cholesterol precursors reflect cholesterol biosynthesis. Here we compare serum and biliary sterol levels in ethnically different populations of patients with gallstone disease (GSD) and stone-free controls to identify differences in cholesterol transport and synthesis between these groups. In this case-control study four cohorts were analyzed: 112 German patients with GSD and 152 controls; two distinct Chilean ethnic groups: Hispanics (100 GSD, 100 controls), and Amerindians (20 GSD, 20 controls); additionally an 8-year follow-up of 70 Hispanics was performed. Serum sterols were measured by gas chromatography / mass spectrometry. Gallbladder bile sterol levels were analyzed in cholesterol GSD and controls. Common ABCG5/8 variants were genotyped. Comparison of serum sterols showed lower levels of phytosterols and higher levels of cholesterol precursors in GSD patients than in controls. The ratios of phytosterols to cholesterol precursors were lower in GSD patients, whereas biliary phytosterol and cholesterol concentrations were elevated as compared with controls. In the follow-up study, serum phytosterol levels were significantly lower even before GSD was detectable by ultrasound. An ethnic gradient in the ratios of phytosterols to cholesterol precursors was apparent (Germans > Hispanics > Amerindians). ABCG5/8 variants did not fully explain the sterol metabolic trait of GSD in any of the cohorts. CONCLUSION: Individuals predisposed to GSD display increased biliary output of cholesterol in the setting of relatively low intestinal cholesterol absorption, indicating enhanced whole-body sterol clearance. This metabolic trait precedes gallstone formation and is a feature of ethnic groups at higher risk of cholesterol GSD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 All studied individuals were genotyped for the ABCG5 p.Q604E (rs6720173, c__29001998_10) and ABCG8 p.D19H (rs11887534, c__26135643_10), Address reprint requests to: Prof. Dr. Frank Lammert, Department of Medicine II, Saarland University Medical Center, Saarland University, Kirrberger Str. Login to comment

[hide] Macrothrombocytopenia/Stomatocytosis specially ass... Clin Appl Thromb Hemost. 2012 Nov;18(6):582-7. doi: 10.1177/1076029611435090. Epub 2012 Jan 31. Wang G, Cao L, Wang Z, Jiang M, Sun X, Bai X, Ruan C
Macrothrombocytopenia/Stomatocytosis specially associated with phytosterolemia.
Clin Appl Thromb Hemost. 2012 Nov;18(6):582-7. doi: 10.1177/1076029611435090. Epub 2012 Jan 31., [PMID:22297561]

Abstract [show]
Phytosterolemia is a rare autosomal recessive disease of plant sterol metabolism, the pathophysiological features of which are high plasma levels of plant sterols and xanthomatosis caused by mutations of ABCG5 and ABCG8 genes, and the combination of hemolysis and macrothrombocytopenia is an unusual clinical manifestation. All the patients of the 3 unrelated phytosterolemia first presented with prominent macrothrombocytopenia and stomatocytosis. They were either homozygous or compound heterozygous for ABCG5/ABCG8 gene mutations and had significantly elevated serum plant sterols levels quantified using high-performance liquid chromatography. The in vitro study demonstrated that sitosterol can cause changes in shape and osmotic fragility of red blood cells. These findings suggest that macrothrombocytopenia and stomatocytosis could be initial and main features in some patients with phytosterolemia and that serum phytosterols and relevant genes should be analyzed in patients whose macrothrombocytopenia and/or stomatocytosis are unexplained, especially whose parents are of consanguineous marriage.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 In addition, several neutral polymorphisms, such as Q604E of ABCG5, C54Y, T400K, and A632V of ABCG8 which had been previously described were also found in this study (not shown). Login to comment
71 In addition, several neutral polymorphisms, such as Q604E of ABCG5, C54Y, T400K, and A632V of ABCG8 which had been previously described were also found in this study (not shown). Login to comment

[hide] ATP-binding cassette transporter G5 and G8 polymor... PLoS One. 2012;7(5):e37972. Epub 2012 May 24. Li Q, Yin RX, Wei XL, Yan TT, Aung LH, Wu DF, Wu JZ, Lin WX, Liu CW, Pan SL
ATP-binding cassette transporter G5 and G8 polymorphisms and several environmental factors with serum lipid levels.
PLoS One. 2012;7(5):e37972. Epub 2012 May 24., [PMID:22655090]

Abstract [show]
BACKGROUND: The association of ATP-binding cassette (ABC) transporter single nucleotide polymorphisms (SNPs) and serum lipid profiles is inconsistent. The present study was undertaken to detect the association of ABCG5/G8 SNPs and several environmental factors with serum lipid levels. METHODOLOGY/PRINCIPAL FINDINGS: Genotyping of the ABCG5 (rs4131229 and rs6720173) and ABCG8 (rs3806471 and rs4148211) SNPs was performed in 719 unrelated subjects of Mulao nationality and 782 participants of Han nationality. There were no differences in the genotypic and allelic frequencies of four SNPs between the two ethnic groups besides the genotypic frequencies of rs4131229 SNP in Han. The levels of triglyceride (TG), apolipoprotein (Apo) A1, and ApoA1/ApoB ratio (rs4131229); low-density lipoprotein cholesterol (LDL-C) and ApoB (rs6720173); high-density lipoprotein cholesterol (HDL-C), ApoA1, ApoB, and ApoA1/ApoB ratio (rs3806471); and HDL-C, ApoA1, and ApoA1/ApoB ratio (rs4148211) in Han were different among their genotypes (P<0.05-0.001). The levels of LDL-C (rs6720173) and ApoA1 (rs3806471) in Mulao were also different among their genotypes (P<0.05 for each). The levels of TC, TG, HDL-C, ApoA1, and ApoA1/ApoB ratio (rs4131229); LDL-C and ApoB (rs6720173); HDL-C, ApoA1, and ApoA1/ApoB ratio (rs3806471); and TG, HDL-C, ApoA1, and ApoA1/ApoB ratio (rs4148211) in Han males; and ApoA1/ApoB ratio (rs4131229); LDL-C, ApoB, and ApoA1/ApoB ratio (rs3806471); HDL-C, ApoA1, and ApoA1/ApoB ratio (rs4148211) in Han females were different between the genotypes (P<0.05-0.001). The levels of LDL-C in Mulao females were also different between GG and GC/CC genotypes of rs6720173 (P<0.05). The correlation between serum lipid parameters and genotypes of four SNPs was observed in Han, especially in Han males. Serum lipid parameters were also correlated with several environmental factors. CONCLUSIONS: The associations of four ABCG5/G8 SNPs and serum lipid levels are different between the Mulao and Han populations, or between males and females, suggesting that there may be a racial/ethnic- and/or sex-specific association between ABCG5/G8 SNPs and some serum lipid parameters.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Therefore, the aim of the present study was to explore the association of ABCG5 (rs4131229, i7892 T.C and rs6720173, Q604E G.C) and ABCG8 (rs3806471, 5U145 A.C and rs4148211, Y54C A.G) SNPs and several environmental factors with serum lipid profiles in the Mulao and Han populations. Login to comment
192 Weggemans et al. [29] found that subjects with the EE genotype of ABCG5 Q604E had higher serum cholesterol concentrations than carriers with the wild-type Q allele. Login to comment
193 Herron et al. [30] found that a shift from a low to a high-dietary- cholesterol diet in individuals with the ABCG5 Q604E mutant allele was associated with a greater increase in plasma LDL-C compared to subjects who were heterozygous or who carried only the wild-type allele. Login to comment
203 On the other hand, nonsmokers carriers of the minor alleles at ABCG5 (i18429C.T and Gln604Glu C.G) SNPs had significantly lower TG concentrations (P = 0.012 and P = 0.035) compared with homozygous for the major allele. Login to comment
217 The other ABCG5/G8 SNPs (Q604E, Y54C, T400K and A632V) did not show any significant interactions with the CYP7A1 polymorphism. Login to comment
226 The remaining SNPs (Q604E, D19H, Y54C, and T400K) were not associated with plasma lipid levels [60]. Login to comment
241 020 0.062 2.509 0.012 Systolic blood pressure 0.001 0.001 0.066 2.590 0.010 ApoA1/ApoB Waist circumference 20.019 0.002 20.198 27.862 0.000 Age 20.005 0.001 20.089 23.544 0.000 Han TC Waist circumference 0.019 0.005 0.131 3.767 0.000 Age 0.009 0.003 0.126 3.443 0.001 Alcohol consumption 0.302 0.057 0.179 5.286 0.000 Diastolic blood pressure 0.017 0.004 0.168 4.661 0.000 Blood glucose 0.066 0.024 0.095 2.723 0.007 TG Waist circumference 0.075 0.013 0.254 5.661 0.000 Cigarette smoking 0.805 0.165 0.185 4.889 0.000 Blood glucose 0.265 0.049 0.186 5.407 0.000 Diastolic blood pressure 0.030 0.007 0.147 4.120 0.000 Age 20.017 0.005 20.113 23.114 0.002 Alcohol consumption 0.269 0.132 0.078 2.040 0.042 Body mass index 20.065 0.030 20.096 22.157 0.031 HDL-C Waist circumference 20.011 0.002 20.155 24.279 0.000 Gender 0.130 0.046 0.120 2.825 0.005 Alcohol consumption 0.111 0.034 0.138 3.317 0.001 LDL-C Age 0.012 0.002 0.212 6.219 0.000 Body mass index 0.026 0.012 0.101 2.222 0.027 Waist circumference 0.013 0.005 0.115 2.471 0.014 Cigarette smoking 20.310 0.072 20.187 24.227 0.000 hypercholesterolaemic Japanese subjects, Miwa et al. [42] reported that carriers of the ABCG8 M429V or a specific haplotype (wild-type allele of ABCG5 Q604E, and wild-type alleles of ABCG8 C54Y, T400K, and M429V) had higher cholesterol absorption efficiency than non-carriers. Login to comment
242 However, no difference was observed in serum lipid profiles in relation to common SNPs studied previously in Caucasian populations (ABCG5 Q604E and ABCG8 A632V, T400K, D19H and C54Y). Login to comment
254 Recently, in 845 self-identified Puerto Ricans from Boston, Junyent et al. [38] reported that ABCG5/G8 (i7892T.C, rs4131229; 5U145A.C, rs3806471; Y54C; T400K) SNPs were significantly associated with HDL-C concentrations. Login to comment
257 Carriers of the minor alleles at ABCG5/G8 (Q604E, D19H, i14222 A.G, rs6709904) SNPs displayed lower levels of HDL-C only if they were smokers. Login to comment
41 Therefore, the aim of the present study was to explore the association of ABCG5 (rs4131229, i7892 T.C and rs6720173, Q604E G.C) and ABCG8 (rs3806471, 5U145 A.C and rs4148211, Y54C A.G) SNPs and several environmental factors with serum lipid profiles in the Mulao and Han populations. Login to comment
190 Weggemans et al. [29] found that subjects with the EE genotype of ABCG5 Q604E had higher serum cholesterol concentrations than carriers with the wild-type Q allele. Login to comment
191 Herron et al. [30] found that a shift from a low to a high-dietary-cholesterol diet in individuals with the ABCG5 Q604E mutant allele was associated with a greater increase in plasma LDL-C compared to subjects who were heterozygous or who carried only the wild-type allele. Login to comment
201 On the other hand, nonsmokers carriers of the minor alleles at ABCG5 (i18429C.T and Gln604Glu C.G) SNPs had significantly lower TG concentrations (P = 0.012 and P = 0.035) compared with homozygous for the major allele. Login to comment
215 The other ABCG5/G8 SNPs (Q604E, Y54C, T400K and A632V) did not show any significant interactions with the CYP7A1 polymorphism. Login to comment
216 No association was observed between ABCG8 T400K and total and LDL-C levels [32-34,36,38-41]. Login to comment
224 The remaining SNPs (Q604E, D19H, Y54C, and T400K) were not associated with plasma lipid levels [60]. Login to comment
239 020 0.062 2.509 0.012 Systolic blood pressure 0.001 0.001 0.066 2.590 0.010 ApoA1/ApoB Waist circumference 20.019 0.002 20.198 27.862 0.000 Age 20.005 0.001 20.089 23.544 0.000 Han TC Waist circumference 0.019 0.005 0.131 3.767 0.000 Age 0.009 0.003 0.126 3.443 0.001 Alcohol consumption 0.302 0.057 0.179 5.286 0.000 Diastolic blood pressure 0.017 0.004 0.168 4.661 0.000 Blood glucose 0.066 0.024 0.095 2.723 0.007 TG Waist circumference 0.075 0.013 0.254 5.661 0.000 Cigarette smoking 0.805 0.165 0.185 4.889 0.000 Blood glucose 0.265 0.049 0.186 5.407 0.000 Diastolic blood pressure 0.030 0.007 0.147 4.120 0.000 Age 20.017 0.005 20.113 23.114 0.002 Alcohol consumption 0.269 0.132 0.078 2.040 0.042 Body mass index 20.065 0.030 20.096 22.157 0.031 HDL-C Waist circumference 20.011 0.002 20.155 24.279 0.000 Gender 0.130 0.046 0.120 2.825 0.005 Alcohol consumption 0.111 0.034 0.138 3.317 0.001 LDL-C Age 0.012 0.002 0.212 6.219 0.000 Body mass index 0.026 0.012 0.101 2.222 0.027 Waist circumference 0.013 0.005 0.115 2.471 0.014 Cigarette smoking 20.310 0.072 20.187 24.227 0.000 hypercholesterolaemic Japanese subjects, Miwa et al. [42] reported that carriers of the ABCG8 M429V or a specific haplotype (wild-type allele of ABCG5 Q604E, and wild-type alleles of ABCG8 C54Y, T400K, and M429V) had higher cholesterol absorption efficiency than non-carriers. Login to comment
240 However, no difference was observed in serum lipid profiles in relation to common SNPs studied previously in Caucasian populations (ABCG5 Q604E and ABCG8 A632V, T400K, D19H and C54Y). Login to comment
255 Carriers of the minor alleles at ABCG5/G8 (Q604E, D19H, i14222 A.G, rs6709904) SNPs displayed lower levels of HDL-C only if they were smokers. Login to comment
202 On the other hand, nonsmokers carriers of the minor alleles at ABCG5 (i18429C.T and Gln604Glu C.G) SNPs had significantly lower TG concentrations (P = 0.012 and P = 0.035) compared with homozygous for the major allele. Login to comment
225 The remaining SNPs (Q604E, D19H, Y54C, and T400K) were not associated with plasma lipid levels [60]. Login to comment

[hide] Genetic variations at ABCG5/G8 genes modulate plas... Atherosclerosis. 2010 Jun;210(2):486-92. Epub 2010 Jan 22. Garcia-Rios A, Perez-Martinez P, Fuentes F, Mata P, Lopez-Miranda J, Alonso R, Rodriguez F, Garcia-Olid A, Ruano J, Ordovas JM, Perez-Jimenez F
Genetic variations at ABCG5/G8 genes modulate plasma lipids concentrations in patients with familial hypercholesterolemia.
Atherosclerosis. 2010 Jun;210(2):486-92. Epub 2010 Jan 22., [PMID:20172523]

Abstract [show]
OBJECTIVE: To investigate the association of four common single nucleotide polymorphisms (SNPs) at ABCG5 (i7892A>G, i18429C>T, Gln604GluC>G, i11836G>A) and five at ABCG8 (5U145T>G, Tyr54CysA>G, Asp19HisG>C, i14222T>C, and Thr400LysG>T) with plasma lipids concentrations and to explore the interaction between those SNPs and smoking in patients with FH. METHODS AND RESULTS: ABCG5/G8 SNPs were genotyped in 500 subjects with genetic diagnosis of FH. Carriers of the minor A allele at the ABCG5_i11836G>A SNP displayed significantly higher HDL-C concentrations (P=0.023) than G/G subjects. In addition, carriers of the minor G allele at the ABCG5_Gln604GluC>G SNP had significantly lower VLDL-C (P=0.011) and lower TG (P=0.017) concentrations than homozygous C/C. Interestingly, a significant gene-smoking interaction was found, in which carriers of the minor alleles at ABCG5 (i7892A>G, i18429C>T, i11836G>A) SNPs displayed significantly lower HDL-C, higher TC and higher TG respectively, only in smokers. On the other hand, nonsmokers carriers of the minor alleles at ABCG5 (i18429C>T and Gln604GluC>G) SNPs had significantly lower TG concentrations (P=0.012 and P=0.035) compared with homozygous for the major allele. CONCLUSIONS: Our data support the notion that ABCG5/G8 genetic variants modulate plasma lipids concentrations in patients with FH and confirm that this effect could be influenced by smoking. Therefore, these results suggest that gene-environmental interactions can affect the clinical phenotype of FH.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 (A) ABCG5 i11836 (HDL-C; P = 0.023) (B) ABCG5 Q604E (TG; P = 0.017). Login to comment
119 G5 i7892 Nonsmokers Smokers P A/A (n = 139) A/G + G/G (n = 198) A/A (n = 53) A/G + G/G (n = 75) TC 266.3 ± 5.9 266.4 ± 4.8 266.2 ± 9.5 289.5 ± 8.0 0.112 TG 4.55 ± 0.03 4.47 ± 0.02 4.56 ± 0.05 4.68 ± 0.04 0.013 LDL-C 197.4 ± 5.7 198.5 ± 4.7 199.1 ± 9.3 223.9 ± 7.8 0.095 HDL-C 46.6 ± 1.0 48.6 ± 0.8 44.6 ± 1.6 41.2 ± 1.3 0.030 VLDL-C 20.1 ± 0.7 18.9 ± 0.5 20.8 ± 1.1 23.6 ± 0.9 0.022 G5 i18429 C/C (n = 259) C/T + T/T (n = 78) C/C (n = 85) C/T + T/T (n = 43) TC 266.9 ± 4.2 264.1 ± 7.8 270.2 ± 7.5 299.5 ± 10.6 0.042 TG 4.53 ± 0.02 4.41 ± 0.04 4.61 ± 0.04 4.67 ± 0.06 0.047 LDL-C 198.0 ± 4.1 198.1 ± 7.6 204.6 ± 7.3 232.0 ± 10.3 0.077 HDL-C 47.9 ± 0.7 47.3 ± 1.3 43.5 ± 1.2 40.8 ± 1.8 0.472 VLDL-C 19.9 ± 0.5 17.6 ± 0.9 22.4 ± 0.9 22.8 ± 1.3 0.173 G5 i11836 G/G (n = 208) A/G + A/A (n = 129) G/G (n = 84) A/G + A/A (n = 44) TC 264.2 ± 4.8 269.8 ± 6.0 275.1 ± 7.6 289.3 ± 10.4 0.574 TG 4.53 ± 0.02 4.47 ± 0.03 4.59 ± 0.04 4.70 ± 0.05 0.039 LDL-C 196.4 ± 4.7 200.7 ± 5.9 209.9 ± 7.4 220.9 ± 10.2 0.646 HDL-C 46.3 ± 0.8 50.1 ± 1.0 42.9 ± 1.3 42.3 ± 1.7 0.092 VLDL-C 20.0 ± 0.5 18.4 ± 0.7 21.4 ± 0.9 24.3 ± 1.2 0.014 G5 Q604E C/C (n = 248) C/G + G/G (n = 89) C/C (n = 84) C/G + G/G (n = 44) TC 268.4 ± 4.3 260.4 ± 7.3 278.2 ± 7.6 283.4 ± 10.5 0.400 TG 4.55 ± 0.02 4.39 ± 0.04 4.62 ± 0.04 4.65 ± 0.05 0.038 LDL-C 199.0 ± 4.2 195.1 ± 7.2 211.3 ± 7.4 218.2 ± 10.2 0.477 HDL-C 48.0 ± 0.7 47.2 ± 1.2 43.3 ± 1.3 41.3 ± 1.8 0.637 VLDL-C 20.1 ± 0.5 17.3 ± 0.8 22.8 ± 0.9 22.0 ± 1.2 0.265 All values are mean ± standard error. P for interaction. Login to comment
141 (A) Interaction ABCG5 i7892-smoking for HDL-C (B) Interaction ABCG5 i11836-smoking for TG (C) Interaction ABCG5 i18429-smoking for TG (D) Interaction ABCG5 Gln604Glu-smoking for TG. Login to comment
150 On the other hand, Miwa et al. [11] reported no significant associations between three ABCG5/G8 (Q604E, C54Y and T400K) SNPs and serum lipid concentrations in 100 Japanese primary hypercholesterolaemic patients. Login to comment
151 Consistent with both studies [11,12] we did not find associations between D19H, T400K and C54Y SNPs and plasma lipid concentrations. Login to comment
152 However, in contrast to Miwa et al. our data showed association between Q604E SNP and VLDL-C and TG concentrations. Login to comment
154 Additionally, Santosa et al. [10] examined the association of four SNPs at ABCG5 (Q604E, i7892, i18429 and M216) and four ABCG8 (C54Y, D19H, i14222 and T400K) with plasma lipids concentrations in 35 young women with mildly hypercholesterolemia. Login to comment
155 They found that C54Y and Q604E SNPs were associated with the response of cholesterol metabolism to weight loss. Login to comment
120 G5 i7892 Nonsmokers Smokers P A/A (n = 139) A/G + G/G (n = 198) A/A (n = 53) A/G + G/G (n = 75) TC 266.3 &#b1; 5.9 266.4 &#b1; 4.8 266.2 &#b1; 9.5 289.5 &#b1; 8.0 0.112 TG 4.55 &#b1; 0.03 4.47 &#b1; 0.02 4.56 &#b1; 0.05 4.68 &#b1; 0.04 0.013 LDL-C 197.4 &#b1; 5.7 198.5 &#b1; 4.7 199.1 &#b1; 9.3 223.9 &#b1; 7.8 0.095 HDL-C 46.6 &#b1; 1.0 48.6 &#b1; 0.8 44.6 &#b1; 1.6 41.2 &#b1; 1.3 0.030 VLDL-C 20.1 &#b1; 0.7 18.9 &#b1; 0.5 20.8 &#b1; 1.1 23.6 &#b1; 0.9 0.022 G5 i18429 C/C (n = 259) C/T + T/T (n = 78) C/C (n = 85) C/T + T/T (n = 43) TC 266.9 &#b1; 4.2 264.1 &#b1; 7.8 270.2 &#b1; 7.5 299.5 &#b1; 10.6 0.042 TG 4.53 &#b1; 0.02 4.41 &#b1; 0.04 4.61 &#b1; 0.04 4.67 &#b1; 0.06 0.047 LDL-C 198.0 &#b1; 4.1 198.1 &#b1; 7.6 204.6 &#b1; 7.3 232.0 &#b1; 10.3 0.077 HDL-C 47.9 &#b1; 0.7 47.3 &#b1; 1.3 43.5 &#b1; 1.2 40.8 &#b1; 1.8 0.472 VLDL-C 19.9 &#b1; 0.5 17.6 &#b1; 0.9 22.4 &#b1; 0.9 22.8 &#b1; 1.3 0.173 G5 i11836 G/G (n = 208) A/G + A/A (n = 129) G/G (n = 84) A/G + A/A (n = 44) TC 264.2 &#b1; 4.8 269.8 &#b1; 6.0 275.1 &#b1; 7.6 289.3 &#b1; 10.4 0.574 TG 4.53 &#b1; 0.02 4.47 &#b1; 0.03 4.59 &#b1; 0.04 4.70 &#b1; 0.05 0.039 LDL-C 196.4 &#b1; 4.7 200.7 &#b1; 5.9 209.9 &#b1; 7.4 220.9 &#b1; 10.2 0.646 HDL-C 46.3 &#b1; 0.8 50.1 &#b1; 1.0 42.9 &#b1; 1.3 42.3 &#b1; 1.7 0.092 VLDL-C 20.0 &#b1; 0.5 18.4 &#b1; 0.7 21.4 &#b1; 0.9 24.3 &#b1; 1.2 0.014 G5 Q604E C/C (n = 248) C/G + G/G (n = 89) C/C (n = 84) C/G + G/G (n = 44) TC 268.4 &#b1; 4.3 260.4 &#b1; 7.3 278.2 &#b1; 7.6 283.4 &#b1; 10.5 0.400 TG 4.55 &#b1; 0.02 4.39 &#b1; 0.04 4.62 &#b1; 0.04 4.65 &#b1; 0.05 0.038 LDL-C 199.0 &#b1; 4.2 195.1 &#b1; 7.2 211.3 &#b1; 7.4 218.2 &#b1; 10.2 0.477 HDL-C 48.0 &#b1; 0.7 47.2 &#b1; 1.2 43.3 &#b1; 1.3 41.3 &#b1; 1.8 0.637 VLDL-C 20.1 &#b1; 0.5 17.3 &#b1; 0.8 22.8 &#b1; 0.9 22.0 &#b1; 1.2 0.265 All values are mean &#b1; standard error. P for interaction. Login to comment
142 (A) Interaction ABCG5 i7892-smoking for HDL-C (B) Interaction ABCG5 i11836-smoking for TG (C) Interaction ABCG5 i18429-smoking for TG (D) Interaction ABCG5 Gln604Glu-smoking for TG. Login to comment
153 However, in contrast to Miwa et al. our data showed association between Q604E SNP and VLDL-C and TG concentrations. Login to comment
156 They found that C54Y and Q604E SNPs were associated with the response of cholesterol metabolism to weight loss. Login to comment
71 (A) ABCG5 i11836 (HDL-C; P = 0.023) (B) ABCG5 Q604E (TG; P = 0.017). Login to comment
117 G5 i7892 Nonsmokers Smokers P A/A (n = 139) A/G + G/G (n = 198) A/A (n = 53) A/G + G/G (n = 75) TC 266.3 &#b1; 5.9 266.4 &#b1; 4.8 266.2 &#b1; 9.5 289.5 &#b1; 8.0 0.112 TG 4.55 &#b1; 0.03 4.47 &#b1; 0.02 4.56 &#b1; 0.05 4.68 &#b1; 0.04 0.013 LDL-C 197.4 &#b1; 5.7 198.5 &#b1; 4.7 199.1 &#b1; 9.3 223.9 &#b1; 7.8 0.095 HDL-C 46.6 &#b1; 1.0 48.6 &#b1; 0.8 44.6 &#b1; 1.6 41.2 &#b1; 1.3 0.030 VLDL-C 20.1 &#b1; 0.7 18.9 &#b1; 0.5 20.8 &#b1; 1.1 23.6 &#b1; 0.9 0.022 G5 i18429 C/C (n = 259) C/T + T/T (n = 78) C/C (n = 85) C/T + T/T (n = 43) TC 266.9 &#b1; 4.2 264.1 &#b1; 7.8 270.2 &#b1; 7.5 299.5 &#b1; 10.6 0.042 TG 4.53 &#b1; 0.02 4.41 &#b1; 0.04 4.61 &#b1; 0.04 4.67 &#b1; 0.06 0.047 LDL-C 198.0 &#b1; 4.1 198.1 &#b1; 7.6 204.6 &#b1; 7.3 232.0 &#b1; 10.3 0.077 HDL-C 47.9 &#b1; 0.7 47.3 &#b1; 1.3 43.5 &#b1; 1.2 40.8 &#b1; 1.8 0.472 VLDL-C 19.9 &#b1; 0.5 17.6 &#b1; 0.9 22.4 &#b1; 0.9 22.8 &#b1; 1.3 0.173 G5 i11836 G/G (n = 208) A/G + A/A (n = 129) G/G (n = 84) A/G + A/A (n = 44) TC 264.2 &#b1; 4.8 269.8 &#b1; 6.0 275.1 &#b1; 7.6 289.3 &#b1; 10.4 0.574 TG 4.53 &#b1; 0.02 4.47 &#b1; 0.03 4.59 &#b1; 0.04 4.70 &#b1; 0.05 0.039 LDL-C 196.4 &#b1; 4.7 200.7 &#b1; 5.9 209.9 &#b1; 7.4 220.9 &#b1; 10.2 0.646 HDL-C 46.3 &#b1; 0.8 50.1 &#b1; 1.0 42.9 &#b1; 1.3 42.3 &#b1; 1.7 0.092 VLDL-C 20.0 &#b1; 0.5 18.4 &#b1; 0.7 21.4 &#b1; 0.9 24.3 &#b1; 1.2 0.014 G5 Q604E C/C (n = 248) C/G + G/G (n = 89) C/C (n = 84) C/G + G/G (n = 44) TC 268.4 &#b1; 4.3 260.4 &#b1; 7.3 278.2 &#b1; 7.6 283.4 &#b1; 10.5 0.400 TG 4.55 &#b1; 0.02 4.39 &#b1; 0.04 4.62 &#b1; 0.04 4.65 &#b1; 0.05 0.038 LDL-C 199.0 &#b1; 4.2 195.1 &#b1; 7.2 211.3 &#b1; 7.4 218.2 &#b1; 10.2 0.477 HDL-C 48.0 &#b1; 0.7 47.2 &#b1; 1.2 43.3 &#b1; 1.3 41.3 &#b1; 1.8 0.637 VLDL-C 20.1 &#b1; 0.5 17.3 &#b1; 0.8 22.8 &#b1; 0.9 22.0 &#b1; 1.2 0.265 All values are mean &#b1; standard error. P for interaction. Login to comment
139 (A) Interaction ABCG5 i7892-smoking for HDL-C (B) Interaction ABCG5 i11836-smoking for TG (C) Interaction ABCG5 i18429-smoking for TG (D) Interaction ABCG5 Gln604Glu-smoking for TG. Login to comment
148 On the other hand, Miwa et al. [11] reported no significant associations between three ABCG5/G8 (Q604E, C54Y and T400K) SNPs and serum lipid concentrations in 100 Japanese primary hypercholesterolaemic patients. Login to comment

[hide] The potential influence of genetic variants in gen... Atherosclerosis. 2010 May;210(1):14-27. Epub 2009 Nov 5. Lu Y, Feskens EJ, Boer JM, Muller M
The potential influence of genetic variants in genes along bile acid and bile metabolic pathway on blood cholesterol levels in the population.
Atherosclerosis. 2010 May;210(1):14-27. Epub 2009 Nov 5., [PMID:19932478]

Abstract [show]
The liver is currently known to be the major organ to eliminate excess cholesterol from our body. It accomplishes this function in two ways: conversion of cholesterol molecules into bile acids (BAs) and secretion of unesterified cholesterol molecules into bile. BAs are synthesized in the hepatocytes, secreted into bile and delivered to the lumen of the small intestine where they act as detergents to facilitate absorption of fats and fat-soluble vitamins. About 95% of BAs are recovered in the ileum during each cycle of the enterohepatic circulation. Five percent are lost and replaced by newly synthesized BAs, which amounts to approximately 500 mg/day in adult humans. In contrast to the efficiency of the BAs' enterohepatic circulation, 50% of the 1000 mg of cholesterol secreted daily into bile is lost in feces. It is known that rare human mutations in certain genes in bile acid and bile metabolic pathway influence blood cholesterol levels. With the recent success of genome-wide association studies, we are convinced that common genetic variants also play a role in the genetic architecture of plasma lipid traits. In this review, we summarized the current state of knowledge about genetic variations in bile acid and bile metabolic pathway, and assessed their impact on blood cholesterol levels and cholesterol metabolic kinetics in the population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1748 Several polymorphisms in ABCG5 (Q604E, rs6720173) and ABCG8 (T400K, rs4148217; D19H, rs11887534; A632V, rs6544718; and Y54C, rs4148211) have been found to be associated with several facets of cholesterol metabolism, including cholesterol level, cholesterol kinetics, and individual responsiveness of blood cholesterol to dietary and pharmaceutical intervention [41]. Login to comment
1749 Regarding Q604E of ABCG5, Weggemans et al. [42] demonstrated that EE homozygotes had higher plasma total cholesterol levels than carriers of the wild-type allele. Login to comment
1759 No modulating effect was observed from Q604E on cholesterol lowering response to atorvastatin [25,26]. Login to comment
1760 Overall, the various studies reviewed on effects of Q604E of ABCG5 gene on blood cholesterol levels and cholesterol metabolic kinetics suggest that the rare E allele is consistently associated with lower cholesterol absorption and higher cholesterol synthesis. Login to comment
1795 In 100 hypercholesterolaemic Japanese subjects, Miwa et al. [56] reported that carriers of the M429V variant of ABCG8 or a specific haplotype (wild-type allele of Q604E ABCG5, and wild-type allele of C54Y, wild-type allele of T400K, mutant allele of M429V ABCG8) had higher cholesterol absorption efficiency than non-carriers. Login to comment
1796 However, no difference was observed in serum lipid profiles in relation to common polymorphisms studied previously in Caucasian populations [ABCG5 (Q604E) and ABCG8 (A632V, T400K, D19H and C54Y)]. Login to comment
1805 Carriers of the minor alleles at ABCG5/G8 (Q604E; D19H; i14222A > G, rs6709904) SNPs displayed lower levels of HDL cholesterol only if they were smokers. Login to comment
1859 Hubacek et al. [29] 114 Czech males More reductions in TC and LDL-C in C allele carriers (p < 0.01 and p = 0.07, respectively) CYP7A1 rs1023649, rs1023651 Klos et al. [23] 2054 whites and 1939 blacks Two SNPs associated with TC and LDL-C in black with increased levels in carriers of the rare alleles, no association observed in white ABCG5 Q604E (rs6720173, C > G) Weggemans et al. [42] 486 Dutch subjects Higher TC in EE than wild-type allele carriers Viturro et al. [43] 1227 healthy Spanish school children Heterozygotes (CG) higher in TC, LDL-C and apoB levels than CC, but only observed in the 70 boys of lowest tertile of saturated fat intake Berge et al. [44] 142 healthy American Caucasians No difference in TC Gylling et al. [45] 262 mildly to moderately hypercholesterolemic Finnish subjects No association between E allele carriers and wild-type homozygotes in TC, LDL-C and HDL-C Hubacek et al. [46] 285 Czech participants No difference in TC, LDL-C and HDL-C Junyent et al. [47] 845 self-identified Puerto Ricans No difference in TC, LDL-C and HDL-C Santosa et al. [48] 42 overweight/obese Canadian women No difference in TC and LDL-C Acalovschi et al. [49] 68 Romanian siblings with gallstone disease Lower TC and higher HDL-C in E allele carriers than QQ Plat et al. [50] 112 healthy Dutch volunteers Lower LDL-C in E allele carriers than QQ, no difference in HDL-C Gylling et al. [45] 262 mildly to moderately hypercholesterolemic Finnish subjects Lower cholesterol absorption (lower level of serum cholesterol adjusted campesterol and sitosterol) and higher cholesterol synthesis (high levels of serum cholesterol adjusted cholestenol) in E allele carriers than QQ Santosa et al. [48] 35 hypercholesterolemic Canadian women. Login to comment
1860 Larger reduction in cholesterol absorption and greater increase in synthesis in EE than Q carriers during weight loss Herron et al. [51] 91 Caucasian subjects (40 men and 51 premenopausal women) E allele carriers responded less compared to QQ in TC and LDL-C after 1 more egg consumption/day over 30 days, no difference in HDL-C Kajinami et al. [25] 337 hypercholesterolemic subjects, mainly Caucasians No modulating effect from Q604E on cholesterol lowering response to atorvastatin Y.Luetal./Atherosclerosis210(2010)14-2721 Table 1(Continued). Login to comment

[hide] Association between non-responsiveness to plant st... Appl Physiol Nutr Metab. 2008 Aug;33(4):728-34. Rudkowska I, AbuMweis SS, Nicolle C, Jones PJ
Association between non-responsiveness to plant sterol intervention and polymorphisms in cholesterol metabolism genes: a case-control study.
Appl Physiol Nutr Metab. 2008 Aug;33(4):728-34., [PMID:18641716]

Abstract [show]
Plant sterol (PS) consumption decreases low-density lipoprotein cholesterol (LDL-C) levels; however, high variability of responsiveness of lipid levels to PS intervention has been observed. We hypothesized that common single-nucleotide polymorphisms (SNPs) in the genes for the ATP binding cassette proteins G5 (ABCG5) and G8 (ABCG8), Niemann-Pick C1-like 1 (NPC1L1), or other proteins of the cholesterol pathway, would underline inter-individual variations in response to PS. Twenty-six hyperlipidemic subjects completed a randomized trial of 3 PS phases and a control phase. Three non-responders were identified who failed on 3 consecutive occasions to decrease either total cholesterol or LDL-C level vs. control. It was observed that after 3 PS phases compared with a control phase, cholesterol absorption changed to a lesser degree (-7.7% +/- 10.8%) in the non-responders than in the top 3 responders (-22.1% +/- 8.8%); however, cholesterol synthesis rates did not differ between sub-groups. No common polymorphisms in ABCG8, ABCG5, or NPC1L1 were demonstrated between the 3 top responders and the non-responders. Yet, 1 non-responsive subject did demonstrate a rare SNP in NPC1L1. Results indicate PS intake did not decrease cholesterol absorption rates to the same degree in certain subjects, possibly clarifying the inter-individual variability in the cholesterol-lowering effect; hence, this work should be expanded.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
119 In addition, a previous study by Weggemans et al. (2002), determined that subjects with the ABCG5 Q604E (rs6720173) mutant allele genotype had higher baseline TC levels than subjects with the wild-type allele, even if the response to dietary interventions was not related to this specific genotype. Login to comment
121 In agreement with our study, the previous investigations (Kajinami et al. 2004b; Weggemans et al. 2002; Gylling et al. 2004) failed to identify any associations between ABCG5 Q604E and plasma lipid responses to PS intervention. Login to comment

[hide] ATP binding cassette G8 T400K polymorphism may aff... Clin Chim Acta. 2007 Sep;384(1-2):80-5. Epub 2007 Jun 16. Wang Y, Jiang ZY, Fei J, Xin L, Cai Q, Jiang ZH, Zhu ZG, Han TQ, Zhang SD
ATP binding cassette G8 T400K polymorphism may affect the risk of gallstone disease among Chinese males.
Clin Chim Acta. 2007 Sep;384(1-2):80-5. Epub 2007 Jun 16., [PMID:17612515]

Abstract [show]
BACKGROUND: Supersaturation of bile with cholesterol is a primary step in the formation of cholesterol gallstones. ATP binding cassette (ABC) G5 and G8 play an important role in regulating sterol absorption and secretion. To investigate a possible association between transporter gene polymorphism and gallstone formation, we examined five common polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) genes in patients with gallstone disease (GS). METHODS: Study subjects included 287 patients with GS and 219 gallstone free controls (GSF). Polymorphisms were determined using PCR-RFLP analysis or the Taqman MGB assay. Plasma and biliary lipid levels were measured. RESULTS: 2 SNPs of ABCG8 gene (Y54C and T400K) showed strong linkage disequilibrium (D'=0.824, r2=0.579). Male carriers of the less frequent K allele of ABCG8 T400K had a 2.31-fold elevated risk [95% confidence interval (CI) 1.12 approximately 4.76, P=0.023] for gallstone disease compared to male with the common genotype after the adjustment for age, body mass index. Males with the K allele had lower plasma triglyceride (P=0.044) and biliary phospholipid (P=0.035) levels than TT homozygotes. No such association was found in female or other 4 SNPs. CONCLUSIONS: These findings indicate that the T400K polymorphism in ABCG8 may be associated with the incidence of gallstone disease in males.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 To investigate a possible association between transporter gene polymorphism and gallstone formation, we examined five common polymorphisms in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) genes in patients with gallstone disease (GS). Login to comment
24 Of these variants, it is suggested that 5 non-synonymous single nucleotide polymorphisms (SNPs) in the ABCG5 (Q604E) and ABCG8 (D19H, Y54C, T400K, A632V) coding sequences may effect plasma plant sterol or cholesterol levels [11-14]. Login to comment
41 Four SNP sites in ABCG5 Q604E, ABCG8 Y54C, ABCG8 T400K, and ABCG8 A632V were assayed by PCR amplification and RFLP analysis, as previously described [10,11]. Login to comment
72 Table 2 Linkage disequilibrium in 5 common polymorphisms of ABCG5 and ABCG8 genes D' Locus Q604E D19H Y54C T400K A632V r2 Q604E - 0.368 0.007 0.477 0.087 D19H 0.009 - 0.843 0.718 1.000 Y54C 0.000 0.045 - 0.824 0.211 T400K 0.003 0.000 0.579 - 1.000 A632V 0.000 0.000 0.000 0.001 - D' and r2 were calculated from all 506 subjects in the study. Login to comment
82 No differences were observed when the frequencies of ABCG5 Q604E, ABCG8 D19H, and Y54C and A632V were compared between GS and Table 3 Frequency distribution of the different genotypes and alleles of 5 common ABCG5 and ABCG8 polymorphisms in GS and GSF Polymorphism All (%) Men (%) Women (%) GS GSF GS GSF GS GSF (n=287) (n=219) (n=121) (n=105) (n=166) (n=114) ABCG5:Q604E QQ 78.7 80.4 78.5 78.1 78.9 82.5 QE 20.9 18.7 21.5 20.0 20.5 17.5 EE 0.3 0.9 0 1.9 0.6 0 E allele 10.8 10.3 10.7 11.9 10.8 8.8 OR [95% CI]a 0.95 [0.63~1.42] 1.12 [0.63~2.01] 0.79 [0.45~1.41] ABCG8:D19H DD 98.3 98.6 99.2 99.0 97.6 98.2 DH 1.7 1.4 0.8 1.0 2.4 1.8 HH 0 0 0 0 0 0 H allele 0.9 0.7 0.4 0.5 1.2 0.9 OR [95% CI] 1.27 [0.30~5.36] 0.87 [0.05~13.95] 1.38 [0.25~7.59] ABCG8:Y54C YY 77.4 79.9 76.0 83.8 78.3 76.3 YC 22.3 18.3 24.0 14.3 21.1 21.9 CC 0.3 1.8 0 1.9 0.6 1.8 C allele 11.5 11.0 12.0 9.0 11.1 12.7 OR [95% CI] 1.06 [0.71~1.57] 1.369 [0.74~2.52] 0.861 [0.51~1.45] ABCG8:T400K TT 79.1 83.1 75.2 87.6 81.9 78.9 TK 20.6 16.4 24.8b 12.4 17.5 20.2 KK 0.3 0.5 0 0 0.6 0.9 K allele 10.6 8.7 12.4c 6.2 9.3 11.0 OR [95% CI] 1.25 [0.82~1.92] 2.14 [1.09~4.23] 0.83 [0.48~1.46] ABCG8:A632V AA 99.0 99.1 99.2 100.0 98.8 98.2 AV 1.0 0.9 0.8 0 1.2 1.8 VV 0 0 0 0 0 0 V allele 0.5 0.5 0.4 0 2(0.6) 0.9 OR [95% CI] 0.87 [0.14~5.27] 0.382 [0.02~9.44]d 1.46 [0.20~10.44] a Odds ratio (OR) statistics and 95% confidence intervals (95% CI) were calculated from allele distributions. Login to comment
99 Due to limited number of subjects, heterozygous and homozygous carriers of the genetic variants were combined as follows: ABCG5 Q604E (QE+EE), ABCG8 Y54C (YC+CC), and ABCG8 (TK+KK). Login to comment
102 However, no significant differences were found in the plasma and biliary lipid levels or biliary CSI of subjects with different genotypes of ABCG5 Q604E and ABCG8 Y54C. Login to comment
73 Table 2 Linkage disequilibrium in 5 common polymorphisms of ABCG5 and ABCG8 genes D' Locus Q604E D19H Y54C T400K A632V r2 Q604E - 0.368 0.007 0.477 0.087 D19H 0.009 - 0.843 0.718 1.000 Y54C 0.000 0.045 - 0.824 0.211 T400K 0.003 0.000 0.579 - 1.000 A632V 0.000 0.000 0.000 0.001 - D' and r2 were calculated from all 506 subjects in the study. Login to comment
83 No differences were observed when the frequencies of ABCG5 Q604E, ABCG8 D19H, and Y54C and A632V were compared between GS and Table 3 Frequency distribution of the different genotypes and alleles of 5 common ABCG5 and ABCG8 polymorphisms in GS and GSF Polymorphism All (%) Men (%) Women (%) GS GSF GS GSF GS GSF (n=287) (n=219) (n=121) (n=105) (n=166) (n=114) ABCG5:Q604E QQ 78.7 80.4 78.5 78.1 78.9 82.5 QE 20.9 18.7 21.5 20.0 20.5 17.5 EE 0.3 0.9 0 1.9 0.6 0 E allele 10.8 10.3 10.7 11.9 10.8 8.8 OR [95% CI]a 0.95 [0.63~1.42] 1.12 [0.63~2.01] 0.79 [0.45~1.41] ABCG8:D19H DD 98.3 98.6 99.2 99.0 97.6 98.2 DH 1.7 1.4 0.8 1.0 2.4 1.8 HH 0 0 0 0 0 0 H allele 0.9 0.7 0.4 0.5 1.2 0.9 OR [95% CI] 1.27 [0.30~5.36] 0.87 [0.05~13.95] 1.38 [0.25~7.59] ABCG8:Y54C YY 77.4 79.9 76.0 83.8 78.3 76.3 YC 22.3 18.3 24.0 14.3 21.1 21.9 CC 0.3 1.8 0 1.9 0.6 1.8 C allele 11.5 11.0 12.0 9.0 11.1 12.7 OR [95% CI] 1.06 [0.71~1.57] 1.369 [0.74~2.52] 0.861 [0.51~1.45] ABCG8:T400K TT 79.1 83.1 75.2 87.6 81.9 78.9 TK 20.6 16.4 24.8b 12.4 17.5 20.2 KK 0.3 0.5 0 0 0.6 0.9 K allele 10.6 8.7 12.4c 6.2 9.3 11.0 OR [95% CI] 1.25 [0.82~1.92] 2.14 [1.09~4.23] 0.83 [0.48~1.46] ABCG8:A632V AA 99.0 99.1 99.2 100.0 98.8 98.2 AV 1.0 0.9 0.8 0 1.2 1.8 VV 0 0 0 0 0 0 V allele 0.5 0.5 0.4 0 2(0.6) 0.9 OR [95% CI] 0.87 [0.14~5.27] 0.382 [0.02~9.44]d 1.46 [0.20~10.44] a Odds ratio (OR) statistics and 95% confidence intervals (95% CI) were calculated from allele distributions. Login to comment
100 Due to limited number of subjects, heterozygous and homozygous carriers of the genetic variants were combined as follows: ABCG5 Q604E (QE+EE), ABCG8 Y54C (YC+CC), and ABCG8 (TK+KK). Login to comment
103 However, no significant differences were found in the plasma and biliary lipid levels or biliary CSI of subjects with different genotypes of ABCG5 Q604E and ABCG8 Y54C. Login to comment

[hide] Cholesterol synthesis prevails over absorption in ... Transl Res. 2007 Jun;149(6):310-6. Epub 2007 May 23. Gylling H, Hallikainen M, Kolehmainen M, Toppinen L, Pihlajamaki J, Mykkanen H, Agren JJ, Rauramaa R, Laakso M, Miettinen TA
Cholesterol synthesis prevails over absorption in metabolic syndrome.
Transl Res. 2007 Jun;149(6):310-6. Epub 2007 May 23., [PMID:17543849]

Abstract [show]
The objective of this study was to investigate cholesterol metabolism and its association with glucose metabolism and genetic regulation in metabolic syndrome. Overall, 74 subjects with clinically defined metabolic syndrome and sex and age-matched controls (n=74) were recruited. Cholesterol metabolism was assayed with serum non-cholesterol sterols, surrogate markers of synthesis, and fractional absorption of cholesterol and was related to variables of glucose and insulin action and to the common polymorphisms of the ABCG5 and ABCG8 genes. Serum squalene and non-cholesterol sterols were analyzed with gas-liquid chromatography (GLC) and presented as ratios to cholesterol. Also, synthesis marker/absorption marker ratios were calculated. The subjects with metabolic syndrome had higher cholesterol synthesis marker ratios, including squalene, and lower absorption marker ratios than controls. When adjusted with body mass index (BMI) and waist circumference, differences in some of the absorption markers (plant sterols), but not in the synthesis markers, disappeared. Plasma glucose, serum triglycerides, and homeostasis model assessment (HOMA) index were positively associated with cholesterol synthesis/absorption marker ratios (r=0.264 to 0.353, P<0.05 for all). In multivariate analysis, the serum squalene ratio was the best variable of those of cholesterol metabolism explaining the presence of metabolic syndrome. The polymorphisms of ABCG5 and ABCG8 genes did not differ between the cases and controls. In conclusion, cholesterol synthesis prevails over absorption in metabolic syndrome. The high serum squalene ratio turned out to be associated with the prevalence of metabolic syndrome. The perturbations of cholesterol metabolism seem to be related to abdominal obesity, and weight reduction might normalize cholesterol metabolism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 Polymorphisms of the different genes tested were evenly distributed between MBO and controls (heterozygotesϩhomozygotes/wild type: ABCG8: D19H, MBO 16/56, controls 13/61; T400K, MBO 29/ 43, controls 26/48; A632V, MBO 27/45, controls 27/ 47; ABCG5: Q604E, MBO 16/56, controls 16/58). Login to comment
110 Polymorphisms of the different genes tested were evenly distributed between MBO and controls (heterozygotesaf9;homozygotes/wild type: ABCG8: D19H, MBO 16/56, controls 13/61; T400K, MBO 29/ 43, controls 26/48; A632V, MBO 27/45, controls 27/ 47; ABCG5: Q604E, MBO 16/56, controls 16/58). Login to comment

[hide] Are plasma lipid levels related to ABCG5/ABCG8 pol... Eur J Intern Med. 2006 Nov;17(7):490-4. Acalovschi M, Ciocan A, Mostean O, Tirziu S, Chiorean E, Keppeler H, Schirin-Sokhan R, Lammert F
Are plasma lipid levels related to ABCG5/ABCG8 polymorphisms? A preliminary study in siblings with gallstones.
Eur J Intern Med. 2006 Nov;17(7):490-4., [PMID:17098593]

Abstract [show]
BACKGROUND: The role of ABCG5 and ABCG8 genes in the determination of plasma lipid levels is currently under intensive investigation. The aim of this study was to evaluate plasma lipid levels in sibling pairs with gallstones and to assess their correlation with common gene polymorphisms in the ABCG5/ABCG8 genes. METHODS: Plasma levels of cholesterol, HDL-cholesterol, and triglycerides were measured in 68 patients belonging to 34 sibling pairs with gallstones (affected sibling pairs, mean age 56.3 years) and in 68 gallstone carriers with stone-free siblings (age/gender-matched controls in a ratio of 2:1 with the index patients of the study group). Four and one non-synonymous sequence variants in ABCG8 and ABCG5 genes, respectively, were determined in the affected sibling pairs, employing allelic discrimination with 5' nuclease assays. RESULTS: Plasma triglyceride levels were higher and HDL-cholesterol levels lower in the index patients than in controls. Plasma lipid levels were correlated in the members of the affected sibling pairs. Triglyceride levels were higher in carriers of the common alleles for ABCG5 Q604E and ABCG8 D19H sequence variants, and HDL-cholesterol was lower in carriers of the common alleles for ABCG5 Q604E than in carriers of the rare alleles. CONCLUSIONS: The significantly different plasma lipid levels in siblings with gallstones versus controls, as well as the correlation of plasma lipids in affected sibling pairs, confirm the genetic influence in gallstone disease. Polymorphisms in ABCG5/ABCG8 genes might contribute to the genetic variation in plasma lipid levels and in cholesterol saturation of the bile.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Triglyceride levels were higher in carriers of the common alleles for ABCG5 Q604E and ABCG8 D19H sequence variants, and HDL-cholesterol was lower in carriers of the common alleles for ABCG5 Q604E than in carriers of the rare alleles. Login to comment
54 Genotype analysis The patients were genotyped for the ABCG5 single nucleotide polymorphism (SNP) Q604E and the ABCG8 SNPs D19H, Y54C, T400K, and A632V [5,11,12] by TaqMan allelic discrimination. Login to comment
78 Triglyceride levels in the carriers of the common alleles were higher than in the carriers of the rare alleles for the ABCG5 Q604E ( p=0.002), ABCG8 D19H ( p=0.058), and ABCG8 Y54C ( p=0.050) sequence variants (Table 4). Login to comment
79 The cholesterol levels, although within normal ranges, were higher in carriers of the common versus rare alleles for the ABCG5 Q604E polymorphism ( p=0.011) and for the ABCG8 D19H polymorphism ( p=0.052). Login to comment
80 Furthermore, the HDL-cholesterol level was significantly ( p=0.007) lower in carriers of the common allele for the ABCG5 Q604E polymorphism. Login to comment
109 Variation in plasma concentrations of non-cholesterol sterols has been demonstrated to be highly heritable, and D19H and T400K polymorphisms in ABCG8 have been found to contribute to genetic variations in the plasma concentrations of plant sterols [10]. Login to comment
110 Other polymorphisms in ABCG8 (A632V [10], T400K, and Y54C [27]) and in ABCG5 (Q604E [28]) have been suggested to be associated with plasma cholesterol levels. Login to comment
111 In our siblings with gallstones we found significantly higher plasma triglyceride levels in carriers of the common alleles for the polymorphisms Q604E in ABCG5 and D19H and Y54C in ABCG8 than in carriers of the rare alleles. Login to comment
112 HDL-cholesterol levels were lower in carriers of the common alleles of the Q604E polymorphism in ABCG5. Login to comment
113 Cholesterol levels were higher in carriers of the common alleles of the Q604E polymorphism in ABCG5 and the D19H variant in ABCG8. Login to comment
114 Because the Q604E polymorphism in the ABCG5 gene was associated with the most significant plasma lipid changes in the affected siblings, our results suggest that this polymorphism might be responsible for an altered function of the ABCG5 transporter in gallstone patients. Login to comment
119 Plasma lipids in affected siblings Table 4 Plasma triglycerides, cholesterol, and HDL-cholesterol in the 68 siblings with gallstones in relation to ABCG5/G8 genotypes (bold indicates pb0.05) Triglycerides (mg/dl) Cholesterol (mg/dl) HDL cholesterol (mg/dl) ABCG8 A632V CT/TT=28 155.5±57.3 205.7±32.6 48.1±13.2 CC=44 154.1±67.3 204.6±39.2 45.6±18.2 T400K CA/AA=30 168.5±76.9 209.9±37.5 46.0±17.3 CC=42 144.7±50.1 201.5±35.8 48.2±14.4 Y54C AG/GG=44 144.5±58.4 202.7±39.6 44.9±17.0 AA=28 170.6±68.3 210.3±32.8 48.0±15.6 D19H GC/CC=12 130.9±52.6 192.5±27.3 49.0±19.5 GG=60 159.4±64.5 208.3±38.4 46.0±16.0 ABCG5 Q604E CG/GG=24 127.4±51.9 191.7±35.1 55.9±12.9 CC=48 168.2±64.5 212.7±36.3 42.7±15.7 did not correlate with those in controls. Login to comment
121 In the affected siblings, the Q604E polymorphism in ABCG5 was associated with the most significant plasma lipid changes. Login to comment
53 Genotype analysis The patients were genotyped for the ABCG5 single nucleotide polymorphism (SNP) Q604E and the ABCG8 SNPs D19H, Y54C, T400K, and A632V [5,11,12] by TaqMan allelic discrimination. Login to comment
77 Triglyceride levels in the carriers of the common alleles were higher than in the carriers of the rare alleles for the ABCG5 Q604E ( p=0.002), ABCG8 D19H ( p=0.058), and ABCG8 Y54C ( p=0.050) sequence variants (Table 4). Login to comment
118 Plasma lipids in affected siblings Table 4 Plasma triglycerides, cholesterol, and HDL-cholesterol in the 68 siblings with gallstones in relation to ABCG5/G8 genotypes (bold indicates pb0.05) Triglycerides (mg/dl) Cholesterol (mg/dl) HDL cholesterol (mg/dl) ABCG8 A632V CT/TT=28 155.5&#b1;57.3 205.7&#b1;32.6 48.1&#b1;13.2 CC=44 154.1&#b1;67.3 204.6&#b1;39.2 45.6&#b1;18.2 T400K CA/AA=30 168.5&#b1;76.9 209.9&#b1;37.5 46.0&#b1;17.3 CC=42 144.7&#b1;50.1 201.5&#b1;35.8 48.2&#b1;14.4 Y54C AG/GG=44 144.5&#b1;58.4 202.7&#b1;39.6 44.9&#b1;17.0 AA=28 170.6&#b1;68.3 210.3&#b1;32.8 48.0&#b1;15.6 D19H GC/CC=12 130.9&#b1;52.6 192.5&#b1;27.3 49.0&#b1;19.5 GG=60 159.4&#b1;64.5 208.3&#b1;38.4 46.0&#b1;16.0 ABCG5 Q604E CG/GG=24 127.4&#b1;51.9 191.7&#b1;35.1 55.9&#b1;12.9 CC=48 168.2&#b1;64.5 212.7&#b1;36.3 42.7&#b1;15.7 did not correlate with those in controls. Login to comment
120 In the affected siblings, the Q604E polymorphism in ABCG5 was associated with the most significant plasma lipid changes. Login to comment

[hide] Pharmacogenetics of HMG-CoA reductase inhibitors: ... Atherosclerosis. 2004 Dec;177(2):219-34. Kajinami K, Takekoshi N, Brousseau ME, Schaefer EJ
Pharmacogenetics of HMG-CoA reductase inhibitors: exploring the potential for genotype-based individualization of coronary heart disease management.
Atherosclerosis. 2004 Dec;177(2):219-34., [PMID:15530894]

Abstract [show]
Despite the benefit of statin therapy in the prevention of coronary heart disease, a considerable inter-individual variation exists in its response. It is well recognized that genetic variation can contribute to differences in drug disposition and, consequently, clinical efficacy at the population level. Pharmacogenetics, exploring genetic polymorphisms that influence response to drug therapy, may one day allow the clinician to customize treatment strategies for patients in order to improve the success rate of drug therapies. To date, 41 studies have investigated the relationships between common genetic variants and response to statin therapy in terms of lipid effects and clinical outcomes; 16 candidate genes involved in lipoprotein metabolism and 3 in pharmacokinetics. APOE is the most extensively studied locus, and absolute difference in LDL cholesterol reduction across genotypes remained 3-6%. Moreover, none of the associations was striking enough to justify genetic analysis in clinical practice. Reported data have suggested that larger studies (>1000 participants) or combination analyses with >2 different polymorphisms would enable us to find clinically or biologically meaningful difference, which could be assumed as >10% absolute difference, and that genes influencing cholesterol biosynthesis in the liver, such as ABCG5/G8, CYP7A1, HMGCR, would be good candidates for future studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1308 (year/type) Locus Polymorphisma (amino acid changes) No. of patients Country (trial) Drug Baseline LDLC (mmol/l) Reduction of LDLC (%) P-value for difference Ojala et al. [44] (1991/P) APOE E3/3 34 Finland Lova 20 mg 5.3 28 0.043†† E3/4 13 5.3 20 Ordovas et al. [53] (1995/C) APOE E3/2 + E2/2 12 USA Prava 40 mg 3.98 36 <0.05‡‡ E3/3 66 4.29 27 (ANOVA) E3/4 + E4/4 19 4.42 26 APOA4 Wild 125 USA Prava 40 mg 4.29 28 n.s. Variant 17 4.27 30 Nestel et al. [54] (1997/C) APOE ␧3/2 + ␧2/2 49 Australia Simva 20 mg 5.60 as a whole 33 as a whole Responder was more prevalent in E2 ␧3/3 69 ␧3/4 + ␧4/4 59 Sanllehy et al. [55] (1998/C) APOE E3/2 15 Spain Lova 40 mg 5.72 31 n.s.‡‡ E3/3 62 5.53 34 (ANOVA) E3/4 29 5.72 33 Sing et al. [56] (1999/P) LPL (N291S) 184 as a whole USA Fluva 40 mg 3.74 as a whole n.s. (S447X) Salazar et al. [57] (2000/P) LDLR AvaII 55 as a whole Brazil Fluva 5.83 as a whole 23-27 <0.05§ HincII 40-80 mg <0.05§ PvuII <0.05§ Guzman et al. [58] (2000/P) APOB ins/del 54 as a whole Brazil Fluva 5.42 as a whole 28-34 0.044§ XbaI 40-80 mg n.s.§ EcoRI n.s.§ Ballantyne et al. [59] (2000/C) APOE ␧3/2 10 USA Fluva 40 mg 3.59 24 0.02† ␧3/3 102 (LCAS) 3.85 29 (ANOVA) ␧3/4 + ␧4/4 49 3.70 23 Mulder et al. [60] (2001/P) CYP2D6 88 as a whole Netherlands Simva n.a. ** 10-40 mg Pedro-Botet et al. [61] (2001/C) APOE ␧3/2 + ␧2/2 20 USA Atorva 10 mg 5.04 39 0.01 in men ␧3/3 187 4.86 38 n.s. in women ␧3/4 + ␧4/4 121 4.81 36 (ANOVA) Fan et al. [62] (2001/P) SCAP MslI 22 as a whole Finland Prava 40 mg 3.8 as a whole n.s. Malin et al. [63] (2001/P) PON (M55L) 25 as a whole Finland Prava 40 mg 3.61 as a whole n.s. (R192Q) 0.095 in HDLC# Pena et al. [64] (2002/C) APOE ␧3/2 13 Spain Prava 20 mg 4.75 17 n.s.‡ ␧3/3 293 5.24 22 ␧3/4 + ␧4/4 92 5.12 18 Lahoz et al. [65] (2003/P) APOA1 Promoter 397 as a whole Spain Prava 20 mg n.s. in LDLC 0.04 in HDLC‡‡ Ruano et al. [66] (2003/P) ABCA1 Haplotype 425 as a whole USA Various n.a. <0.0001$ HMGCR Haplotype n.s.$ van Venrooij et al. [67] (2003/P) CETP TaqI B 217 as a whole Netherlands Atorva 10-80 mg 3.7 as a whole <0.05 in HDLC A-629C (DALI) <0.05 in HDLC Kajinami et al. [68] (2004/P) ABCG5/G8 (Q604E) 338 as a whole USA Atorva 10 mg 4.86 as a whole n.s. (D19H) 36 vs. 40 0.036§ (Y54C) n.s. (T400K) n.s. Table 3 (Continued ) Author [Ref. Login to comment
1307 (year/type) Locus Polymorphisma (amino acid changes) No. of patients Country (trial) Drug Baseline LDLC (mmol/l) Reduction of LDLC (%) P-value for difference Ojala et al. [44] (1991/P) APOE E3/3 34 Finland Lova 20 mg 5.3 28 0.043ߤߤ E3/4 13 5.3 20 Ordovas et al. [53] (1995/C) APOE E3/2 + E2/2 12 USA Prava 40 mg 3.98 36 <0.05ߥߥ E3/3 66 4.29 27 (ANOVA) E3/4 + E4/4 19 4.42 26 APOA4 Wild 125 USA Prava 40 mg 4.29 28 n.s. Variant 17 4.27 30 Nestel et al. [54] (1997/C) APOE ॻ3/2 + ॻ2/2 49 Australia Simva 20 mg 5.60 as a whole 33 as a whole Responder was more prevalent in E2 ॻ3/3 69 ॻ3/4 + ॻ4/4 59 Sanllehy et al. [55] (1998/C) APOE E3/2 15 Spain Lova 40 mg 5.72 31 n.s.ߥߥ E3/3 62 5.53 34 (ANOVA) E3/4 29 5.72 33 Sing et al. [56] (1999/P) LPL (N291S) 184 as a whole USA Fluva 40 mg 3.74 as a whole n.s. (S447X) Salazar et al. [57] (2000/P) LDLR AvaII 55 as a whole Brazil Fluva 5.83 as a whole 23-27 <0.05&#a7; HincII 40-80 mg <0.05&#a7; PvuII <0.05&#a7; Guzman et al. [58] (2000/P) APOB ins/del 54 as a whole Brazil Fluva 5.42 as a whole 28-34 0.044&#a7; XbaI 40-80 mg n.s.&#a7; EcoRI n.s.&#a7; Ballantyne et al. [59] (2000/C) APOE ॻ3/2 10 USA Fluva 40 mg 3.59 24 0.02ߤ ॻ3/3 102 (LCAS) 3.85 29 (ANOVA) ॻ3/4 + ॻ4/4 49 3.70 23 Mulder et al. [60] (2001/P) CYP2D6 88 as a whole Netherlands Simva n.a. ** 10-40 mg Pedro-Botet et al. [61] (2001/C) APOE ॻ3/2 + ॻ2/2 20 USA Atorva 10 mg 5.04 39 0.01 in men ॻ3/3 187 4.86 38 n.s. in women ॻ3/4 + ॻ4/4 121 4.81 36 (ANOVA) Fan et al. [62] (2001/P) SCAP MslI 22 as a whole Finland Prava 40 mg 3.8 as a whole n.s. Malin et al. [63] (2001/P) PON (M55L) 25 as a whole Finland Prava 40 mg 3.61 as a whole n.s. (R192Q) 0.095 in HDLC# Pena et al. [64] (2002/C) APOE ॻ3/2 13 Spain Prava 20 mg 4.75 17 n.s.ߥ ॻ3/3 293 5.24 22 ॻ3/4 + ॻ4/4 92 5.12 18 Lahoz et al. [65] (2003/P) APOA1 Promoter 397 as a whole Spain Prava 20 mg n.s. in LDLC 0.04 in HDLCߥߥ Ruano et al. [66] (2003/P) ABCA1 Haplotype 425 as a whole USA Various n.a. <0.0001$ HMGCR Haplotype n.s.$ van Venrooij et al. [67] (2003/P) CETP TaqI B 217 as a whole Netherlands Atorva 10-80 mg 3.7 as a whole <0.05 in HDLC A-629C (DALI) <0.05 in HDLC Kajinami et al. [68] (2004/P) ABCG5/G8 (Q604E) 338 as a whole USA Atorva 10 mg 4.86 as a whole n.s. (D19H) 36 vs. 40 0.036&#a7; (Y54C) n.s. (T400K) n.s. Table 3 (Continued ) Author [Ref. Login to comment

[hide] Interactions between common genetic polymorphisms ... Atherosclerosis. 2004 Aug;175(2):287-93. Kajinami K, Brousseau ME, Ordovas JM, Schaefer EJ
Interactions between common genetic polymorphisms in ABCG5/G8 and CYP7A1 on LDL cholesterol-lowering response to atorvastatin.
Atherosclerosis. 2004 Aug;175(2):287-93., [PMID:15262185]

Abstract [show]
Cholesterol excretion by ATP binding cassette transporters G5 and G8 (ABCG5/G8) and bile acid biosynthesis by cholesterol 7alpha-hydroxylase (CYP7A1) are major pathways for the removal of cholesterol into bile. To investigate the interactions between common polymorphisms in ABCG5/G8 and CYP7A1 and statin response, we examined the relationships between five non-synonymous polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and a promoter variant in CYP7A1 (A-204C) in 337 hypercholesterolemic patients treated with atorvastatin 10mg. The ABCG8 H19 allele was significantly associated with a greater LDL cholesterol reduction relative to the wild type D19 allele (39.6% versus 36.6%, P = 0.043). This difference was enhanced in non-carriers of the CYP7A1 promoter polymorphism (42.7% versus 38.2%, P = 0.048), and was diminished in accordance with the number of CYP7A1 variant alleles (1.8% in heterozygotes and 0.2% in homozygotes). Combination analysis of these polymorphisms explained a greater percentage of LDL cholesterol response variation (8.5% difference across subgroups) than did single polymorphism analysis (4.2% in CYP7A1 and 3.0% in ABCG8 D19H). The other ABCG5/G8 polymorphisms did not show any significant interactions with the CYP7A1 polymorphism. We conclude that the ABCG8 H19 and CYP7A1 C-204 alleles appear to interact in a dose-dependent manner on atorvastatin response.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 To investigate the interactions between common polymorphisms in ABCG5/G8 and CYP7A1 and statin response, we examined the relationships between five non-synonymous polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and a promoter variant in CYP7A1 (A-204C) in 337 hypercholesterolemic patients treated with atorvastatin 10 mg. Login to comment
43 The set of polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and CYP7A1 (A-204C) was examined in 337 subjects from the atorvastatin (10 mg per day) arm. The means (±S.D.) of age and BMI were 58 ± 11 years old and 27.0 ± 3.0 kg/m2, respectively [15]. Login to comment
76 K.Kajinamietal./Atherosclerosis175(2004)287-293291 Table 3 Associations between ABCG5 Q604E, ABCG8 T400K, ABCG8 A632V/CYP7A1 A-204C and the LDL-lowering response to atorvastatin* ABCG5/G8 All subjects CYP7A1 P-values among CYP7A1 genotype† Unadjusted Adjusted AA AC CC Additive Dominant Recessive ABCG5 Q604E QQ 36.9 ± 10.1 37.0, 35.7-38.2 (212) 39.4, 37.0-41.8 (57) 36.6, 34.8-38.4 (104) 35.0, 32.4-37.5 (51) 0.055 0.031 0.080 QE 37.1 ± 9.5 36.9, 35.1-38.6 (111) 37.6, 34.7-40.5 (39) 37.3, 34.8-39.9 (54) 33.9, 29.6-38.2 (18) 0.321 0.646 0.131 EE 36.9 ± 9.3 37.8, 32.9-42.7 (14) 44.3, 35.1-53.4 (4) 36.9, 30.0-43.7 (7) 31.0, 20.5-41.5 (3) 0.159 0.081 0.164 ABCG8 T400K TT 37.3 ± 10.3 37.4, 36.2-38.8 (197) 37.5, 34.4-40.6 (62) 36.4, 34.4-38.4 (92) 34.1, 30.4-37.7 (43) 0.022 0.030 0.019 TK 36.5 ± 8.6 36.2, 34.6-37.9 (128) 38.7, 36.2-41.3 (33) 36.4, 34.1-38.8 (67) 35.4, 32.5-38.4 (28) 0.611 0.726 0.320 KK 35.8 ± 13.5 36.0, 30.7-41.3 (12) 42.4, 37.9-46.9 (5) 39.1, 35.7-42.5 (6) 31.9, 26.1-37.6 (1) 0.157 0.046 0.988 ABCG8 A632V AA 36.5 ± 10.0 36.4, 35.2-37.6 (224) 39.8, 37.4-42.1 (65) 37.4, 35.6-39.3 (116) 34.3, 31.4-37.1 (43) 0.005 0.004 0.020 AV 38.0 ± 9.6 38.3, 36.4-40.2 (97) 36.7, 33.5-39.8 (28) 36.6, 34.4-38.8 (41) 34.9, 31.6-38.3 (28) 0.288 0.794 0.126 VV 36.9 ± 7.3 36.2, 31.7-40.8 (16) 42.4, 34.3-50.5 (7) 30.4, 23.0-37.8 (8) 37.0, 18.9-55.1 (1) 0.697 0.992 0.397 In testing the effects of ABCG5 (Q604E) or ABCG8 (T400K and A632V) genotype on LDL-lowering response, none of P-values reached statistical significance. Login to comment
77 P-values in testing genotype interaction between ABCG5 Q604E and CYP7A1 using two-way ANOVA were 0.584 when additive model of both genotypes were used; 0.568 when a dominant model of ABCG5 Q604E and recessive model of CYP7A1 were used, and 0.359 when a recessive model for each genotype was used. Login to comment
78 Corresponding values between ABCG8 T400K and CYP7A1 were 0.439, 0.709, and 0.641, and those between ABCG8 A632V and CYP7A1 were 0.267, 0.593, and 0.279, respectively. Login to comment
44 The set of polymorphisms in ABCG5/G8 (Q604E, D19H, Y54C, T400K, and A632V) and CYP7A1 (A-204C) was examined in 337 subjects from the atorvastatin (10 mg per day) arm. The means (&#b1;S.D.) of age and BMI were 58 &#b1; 11 years old and 27.0 &#b1; 3.0 kg/m2, respectively [15]. Login to comment
79 P-values in testing genotype interaction between ABCG5 Q604E and CYP7A1 using two-way ANOVA were 0.584 when additive model of both genotypes were used; 0.568 when a dominant model of ABCG5 Q604E and recessive model of CYP7A1 were used, and 0.359 when a recessive model for each genotype was used. Login to comment

[hide] Two genes that map to the STSL locus cause sitoste... Am J Hum Genet. 2001 Aug;69(2):278-90. Epub 2001 Jul 9. Lu K, Lee MH, Hazard S, Brooks-Wilson A, Hidaka H, Kojima H, Ose L, Stalenhoef AF, Mietinnen T, Bjorkhem I, Bruckert E, Pandya A, Brewer HB Jr, Salen G, Dean M, Srivastava A, Patel SB
Two genes that map to the STSL locus cause sitosterolemia: genomic structure and spectrum of mutations involving sterolin-1 and sterolin-2, encoded by ABCG5 and ABCG8, respectively.
Am J Hum Genet. 2001 Aug;69(2):278-90. Epub 2001 Jul 9., [PMID:11452359]

Abstract [show]
Sitosterolemia is a rare autosomal recessive disorder characterized by (a) intestinal hyperabsorption of all sterols, including cholesterol and plant and shellfish sterols, and (b) impaired ability to excrete sterols into bile. Patients with this disease have expanded body pools of cholesterol and very elevated plasma plant-sterol species and frequently develop tendon and tuberous xanthomas, accelerated atherosclerosis, and premature coronary artery disease. In previous studies, we have mapped the STSL locus to human chromosome 2p21. Recently, we reported that a novel member of the ABC-transporter family, named "sterolin-1" and encoded by ABCG5, is mutated in 9 unrelated families with sitosterolemia; in the remaining 25 families, no mutations in sterolin-1 could be identified. We identified another ABC transporter, located <400 bp upstream of sterolin-1, in the opposite orientation. Mutational analyses revealed that this highly homologous protein, termed "sterolin-2" and encoded by ABCG8, is mutated in the remaining pedigrees. Thus, two highly homologous genes, located in a head-to-head configuration on chromosome 2p21, are involved as causes of sitosterolemia. These studies indicate that both sterolin-1 and sterolin-2 are indispensable for the regulation of sterol absorption and excretion. Identification of sterolin-1 and sterolin-2 as critical players in the regulation of dietary-sterol absorption and excretion identifies a new pathway of sterol transport.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
169 OF IDENTIFIED POLYMORPHISMS HARDY-WEINBERG EQUILIBRIUM?ϩ/ϩ ϩ/- -/- ABCG5: 167CrT (Pro9Pro) Gain of BstNI … … … … 1950CrG (Gln604Glu) Loss of SmlI 46 25 1 Yes ABCG8: Exon 1 141CrT (Pro17Pro) … 49 1 0 Yes Exon 1 145GrC (Asp19His) Loss of BaeI 74 3 1 No Exon 2 251GrA (Cys54Tyr) Gain of SexAI 21 23 23 No Exon 6 802GrA (Glu238Lys) … 10 1 0 Yes Exon 6 866CrT (Ala259Val) Loss of HaeIII 0 5 0 … Exon 8 1289CrA (Thr400Lys) Gain of MseI 116 53 4 Yes Exon 11 1785CrT (Ala565Ala) Loss of MnlI 20 7 1 Yes Exon 11 1813GrC (Gly575Arg) Gain of HhaI 188 6 4 No Exon 13 1984CrT (Ala632Val) Loss of StyI 107 50 13 No 5 UTR -15ArC Gain of BstEII 47 4 0 Yes 5 UTR -19TrG Loss of Tsp451 38 42 29 No 5 UTR -41CrT Loss of DdeI 7 2 4 No Intron 1 -7CrT Loss of BsmAI 21 23 4 Yes Intron 1 -21CrA Loss of MnlI 20 23 4 Yes Intron 9 -19CrT … 1 3 4 … Intron 10 IVS10 ϩ34delCC … 3 1 4 … Intron 10 -50CrT … 4 4 2 … cohort of patients with sitosterolemia. Login to comment
170 af9;/af9; af9;/afa; afa;/afa; ABCG5: 167CrT (Pro9Pro) Gain of BstNI ߪ ߪ ߪ ߪ 1950CrG (Gln604Glu) Loss of SmlI 46 25 1 Yes ABCG8: Exon 1 141CrT (Pro17Pro) ߪ 49 1 0 Yes Exon 1 145GrC (Asp19His) Loss of BaeI 74 3 1 No Exon 2 251GrA (Cys54Tyr) Gain of SexAI 21 23 23 No Exon 6 802GrA (Glu238Lys) ߪ 10 1 0 Yes Exon 6 866CrT (Ala259Val) Loss of HaeIII 0 5 0 ߪ Exon 8 1289CrA (Thr400Lys) Gain of MseI 116 53 4 Yes Exon 11 1785CrT (Ala565Ala) Loss of MnlI 20 7 1 Yes Exon 11 1813GrC (Gly575Arg) Gain of HhaI 188 6 4 No Exon 13 1984CrT (Ala632Val) Loss of StyI 107 50 13 No 5 UTR afa;15ArC Gain of BstEII 47 4 0 Yes 5 UTR afa;19TrG Loss of Tsp451 38 42 29 No 5 UTR afa;41CrT Loss of DdeI 7 2 4 No Intron 1 afa;7CrT Loss of BsmAI 21 23 4 Yes Intron 1 afa;21CrA Loss of MnlI 20 23 4 Yes Intron 9 afa;19CrT ߪ 1 3 4 ߪ Intron 10 IVS10 af9;34delCC ߪ 3 1 4 ߪ Intron 10 afa;50CrT ߪ 4 4 2 ߪ cohort of patients with sitosterolemia. Login to comment
171 af9;/af9; af9;/afa; afa;/afa; ABCG5: 167CrT (Pro9Pro) Gain of BstNI ߪ ߪ ߪ ߪ 1950CrG (Gln604Glu) Loss of SmlI 46 25 1 Yes ABCG8: Exon 1 141CrT (Pro17Pro) ߪ 49 1 0 Yes Exon 1 145GrC (Asp19His) Loss of BaeI 74 3 1 No Exon 2 251GrA (Cys54Tyr) Gain of SexAI 21 23 23 No Exon 6 802GrA (Glu238Lys) ߪ 10 1 0 Yes Exon 6 866CrT (Ala259Val) Loss of HaeIII 0 5 0 ߪ Exon 8 1289CrA (Thr400Lys) Gain of MseI 116 53 4 Yes Exon 11 1785CrT (Ala565Ala) Loss of MnlI 20 7 1 Yes Exon 11 1813GrC (Gly575Arg) Gain of HhaI 188 6 4 No Exon 13 1984CrT (Ala632Val) Loss of StyI 107 50 13 No 5 UTR afa;15ArC Gain of BstEII 47 4 0 Yes 5 UTR afa;19TrG Loss of Tsp451 38 42 29 No 5 UTR afa;41CrT Loss of DdeI 7 2 4 No Intron 1 afa;7CrT Loss of BsmAI 21 23 4 Yes Intron 1 afa;21CrA Loss of MnlI 20 23 4 Yes Intron 9 afa;19CrT ߪ 1 3 4 ߪ Intron 10 IVS10 af9;34delCC ߪ 3 1 4 ߪ Intron 10 afa;50CrT ߪ 4 4 2 ߪ cohort of patients with sitosterolemia. Login to comment

[hide] ATP-binding cassette sterol transporters are diffe... Dig Dis Sci. 2013 Feb;58(2):431-9. doi: 10.1007/s10620-012-2481-0. Epub 2012 Nov 22. Yoon JH, Choi HS, Jun DW, Yoo KS, Lee J, Yang SY, Kuver R
ATP-binding cassette sterol transporters are differentially expressed in normal and diseased human gallbladder.
Dig Dis Sci. 2013 Feb;58(2):431-9. doi: 10.1007/s10620-012-2481-0. Epub 2012 Nov 22., [PMID:23179156]

Abstract [show]
BACKGROUND AND AIMS: Gallbladder epithelial cells (GBEC) are exposed to high cholesterol concentrations in bile, and export cholesterol via an ATP-binding cassette (ABC) transporter-mediated pathway in vitro. These findings suggest that aberrant expression and/or function of ABC sterol transporters may be associated with cholesterol-related gallbladder diseases (CAGD). In this study, we investigated the relative levels of the sterol transporters ABCA1, ABCG5, and ABCG8 in human gallbladders in CAGD, and the relationship between ABCA1 and inflammation. METHODS: Expression of ABCA1, ABCG5, and ABCG8 was evaluated in 31 gallbladders with CAGD and 6 normal gallbladders by western blotting and immunohistochemistry. RT-PCR was used to measure ABCA1 mRNA expression. To investigate the relationship between ABCA1 and inflammation, wWestern blots were performed on cultured dog GBEC treated with lipopolysaccharide (LPS) using an anti-ABCA1 antibody. RESULTS: Immunohistochemistry showed ABCA1 to be localized predominantly to the basolateral membrane, while ABCG8 formed a diffuse intracellular pattern at the apical pole of human GBEC. ABCA1 and ABCG8 expression was more prominent in GBEC that were surrounded by cholesterol-laden macrophages. ABCA1 and ABCG8 expression was increased in gallbladders with CAGD. Western blots showed increased ABCA1, ABCG5, and ABCG8 expression in CAGD. ABCA1 mRNA levels were increased in all gallbladders with CAGD. LPS treatment of cultured dog GBEC enhanced ABCA1 expression. CONCLUSIONS: The sterol transporters ABCA1, ABCG5, and ABCG8 may play a role in the pathogenesis of human CAGD. Inflammation appears to be a key factor that increases ABCA1 expression and activity in the human gallbladder.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 Other studies have identified a variety of polymorphisms in ABCG8 (A632 V, T400 K, D19H, and C54Y) and in ABCG5 (Q604E) that have been linked to baseline plasma cholesterol levels, cholesterol absorption, or responsiveness to dietary intervention [23-25]. Login to comment

[hide] Genetics of biliary lithiasis from an ethnic persp... Clin Res Hepatol Gastroenterol. 2013 Apr;37(2):119-25. doi: 10.1016/j.clinre.2012.09.002. Epub 2013 Jan 20. Krawczyk M, Miquel JF, Stokes CS, Zuniga S, Hampe J, Mittal B, Lammert F
Genetics of biliary lithiasis from an ethnic perspective.
Clin Res Hepatol Gastroenterol. 2013 Apr;37(2):119-25. doi: 10.1016/j.clinre.2012.09.002. Epub 2013 Jan 20., [PMID:23340007]

Abstract [show]
Gallstone disease represents one of the most common gastroenterological disorders worldwide. Gallstones affect over 15% of adults in Europe and 25-30% of Hispanic populations in Central and South America. The heritability of gallstones varies considerably according to ethnicity, with Native Americans and Hispanics with Amerindian admixture being the most susceptible populations. Genetic factors have been shown to account for 25-30% of total gallstone risk in Europe, however, in Hispanic populations, this risk percentage may increase to 45-65%. Recent genome-wide association and candidate gene studies have identified common polymorphisms in enterohepatic transporters (ABCG5/8, SLC10A2) and the Gilbert syndrome UGT1A1 variant as genetic determinants of gallstone formation. Together, these polymorphisms cover a significant proportion of the previously predicted genetic background of gallstones in European populations. New lithogenic genes need to be discovered in future studies in high-risk populations. In this review, we address the latest developments in the genetic analysis of gallstones and discuss the ethnic background of this condition in European, Central and South American and Asian populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 For this study, common ABCG5 (p.Q604E) and ABCG8 (p.D19H, p.Y54C, p.T400K, p.A632V) variants were selected and the nonparametric linkage (NPL) as well as case-control analyses were performed. Login to comment

[hide] The ABCG5/8 cholesterol transporter and myocardial... J Am Coll Cardiol. 2014 May 27;63(20):2121-8. doi: 10.1016/j.jacc.2013.12.055. Epub 2014 Mar 19. Stender S, Frikke-Schmidt R, Nordestgaard BG, Tybjaerg-Hansen A
The ABCG5/8 cholesterol transporter and myocardial infarction versus gallstone disease.
J Am Coll Cardiol. 2014 May 27;63(20):2121-8. doi: 10.1016/j.jacc.2013.12.055. Epub 2014 Mar 19., [PMID:24657701]

Abstract [show]
OBJECTIVES: The study sought to test the hypothesis that genetic variation in ABCG5/8, the transporter responsible for intestinal and hepatobiliary cholesterol efflux, may simultaneously influence plasma and biliary cholesterol levels, and hence risk of myocardial infarction (MI) and gallstone disease in opposite directions. BACKGROUND: High plasma levels of low-density lipoprotein (LDL) cholesterol are a causal risk factor for MI, whereas high levels of biliary cholesterol promote gallstone formation. METHODS: A total of 60,239 subjects from Copenhagen were included, including 5,647 with MI and 3,174 with symptomatic gallstone disease. Subjects were genotyped for 6 common, nonsynonymous and functional variants in ABCG5/8, and a combined weighted genotype score was calculated. RESULTS: Combined, weighted genotype scores were associated with stepwise decreases in LDL cholesterol of up to 5.9% (0.20 mmol/l) for individuals with a score >/=8.0 (prevalence = 11%) versus <2.0 (prevalence = 9%; p for trend across 5 groups = 2 x 10E-35). The cumulative incidences of MI and gallstone disease as a function of age and increasing genotype score were decreased and increased (log-rank ps for trend: 6 x 10E-4 and 9 x 10E-45), respectively. The multifactorially adjusted odds ratios were 0.83 (95% confidence interval: 0.73 to 0.94) for MI and 2.85 (95% confidence interval: 2.39 to 3.39) for symptomatic gallstone disease for individuals with a genotype score >/=8.0 versus <2.0. CONCLUSIONS: Genetic variation in ABCG5/8, which associates with decreased levels of plasma LDL cholesterol protects against MI, but increases the risk of symptomatic gallstone disease. These results suggest that MI and gallstones, 2 seemingly unrelated diseases, are intrinsically linked via the function of the ABCG5/8 cholesterol transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 We genotyped all common nonsynonymous variants (minor allelefrequency >5%) inABCG5/ 8 (ABCG8D19H, Y54C, T400K, A632V; ABCG5 Q604E) and a functional intronic variant (ABCG8 IVS3&#fe;981) in 2 prospective studies of the Danish general population, CGPS (Copenhagen General Population Study) and CCHS (Copenhagen City Heart Study), and in a case-control study, CIHDS (Copenhagen Ischemic Heart Disease Study), totaling 60,239 participants, including 5,647 with MI and 3,174 with symptomatic gallstone disease. Login to comment
60 For all genotypes except ABCG5 Q604E, there were stepwise decreases in total and LDL cholesterol levels as a function of genotypes from 0.8% (0.04 mmol/l) to 4.1% (0.24 mmol/l) for total cholesterol and 1.1% (0.04 mmol/l) to 5.8% (0.19 mmol/l) for LDL cholesterol, in homozygotes versus noncarriers (p for trend: 0.08 to 1 10-28 ). Login to comment
137 Although 3 smaller studies (287 gallstone cases) have reported associations for ABCG5 Q604E and ABCG8 T400K with risk of gallstone disease, the large genome-wide association study (n &#bc; 2,280 cases) that initially identified ABCG8 D19H did not report other risk variants in ABCG5/8 (27-30). Login to comment
138 However, re-evaluating the thorough fine-mapping of variants in the ABCG5/8-region performed in this genome-wide association study revealed that ABCG8 IVS&#fe;981 and T400K, as well as ABCG5 Q604E, were indeed associated with gallstone disease, but that the associations did not reach the stringent requirements for statistical significance and/or replication (30). Login to comment
139 We found that ABCG8 IVS&#fe;981 and T400K, as well as ABCG5 Q604E, were individually associated with risk of symptomatic gallstone disease independent of D19H genotype. Login to comment
145 ABCG5 Q604E was associated with an increased risk of symptomatic gallstone disease in heterozygotes, but in contrast to the ABCG8 alleles that increased the risk of gallstones in the present study, Q604E did not associate with low LDL cholesterol. Login to comment

[hide] Lipids, obesity and gallbladder disease in women: ... Eur J Hum Genet. 2016 Jan;24(1):106-12. doi: 10.1038/ejhg.2015.63. Epub 2015 Apr 29. Rodriguez S, Gaunt TR, Guo Y, Zheng J, Barnes MR, Tang W, Danish F, Johnson A, Castillo BA, Li YR, Hakonarson H, Buxbaum SG, Palmer T, Tsai MY, Lange LA, Ebrahim S, Davey Smith G, Lawlor DA, Folsom AR, Hoogeveen R, Reiner A, Keating B, Day IN
Lipids, obesity and gallbladder disease in women: insights from genetic studies using the cardiovascular gene-centric 50K SNP array.
Eur J Hum Genet. 2016 Jan;24(1):106-12. doi: 10.1038/ejhg.2015.63. Epub 2015 Apr 29., [PMID:25920552]

Abstract [show]
Gallbladder disease (GBD) has an overall prevalence of 10-40% depending on factors such as age, gender, population, obesity and diabetes, and represents a major economic burden. Although gallstones are composed of cholesterol by-products and are associated with obesity, presumed causal pathways remain unproven, although BMI reduction is typically recommended. We performed genetic studies to discover candidate genes and define pathways involved in GBD. We genotyped 15 241 women of European ancestry from three cohorts, including 3216 with GBD, using the Human cardiovascular disease (HumanCVD) BeadChip containing up to ~53 000 single-nucleotide polymorphisms (SNPs). Effect sizes with P-values for development of GBD were generated. We identify two new loci associated with GBD, GCKR rs1260326:T>C (P=5.88 x 10(-7), ss=-0.146) and TTC39B rs686030:C>A (P=6.95x10(-7), ss=0.271) and detect four independent SNP effects in ABCG8 rs4953023:G>A (P=7.41 x 10(-47), ss=0.734), ABCG8 rs4299376:G(>)T (P=2.40 x 10(-18), ss=0.278), ABCG5 rs6544718:T>C (P=2.08 x 10(-14), ss=0.044) and ABCG5 rs6720173:G>C (P=3.81 x 10(-12), ss(=)0.262) in conditional analyses taking genotypes of rs4953023:G>A as a covariate. We also delineate the risk effects among many genotypes known to influence lipids. These data, from the largest GBD genetic study to date, show that specific, mainly hepatocyte-centred, components of lipid metabolism are important to GBD risk in women. We discuss the potential pharmaceutical implications of our findings.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
140 Two further independent SNPs were identified in ABCG5, rs10439467:C4T in intron 10 and rs6720173:G4C NM_022436.2 (ABCG5)c.1810C4G (p.Gln604Glu). Login to comment

[hide] ABCG5 and ABCG8 gene polymorphisms in type 2 diabe... Can J Diabetes. 2015 Oct;39(5):405-10. doi: 10.1016/j.jcjd.2015.04.004. Epub 2015 Jun 16. Gok O, Karaali ZE, Acar L, Kilic U, Ergen A
ABCG5 and ABCG8 gene polymorphisms in type 2 diabetes mellitus in the Turkish population.
Can J Diabetes. 2015 Oct;39(5):405-10. doi: 10.1016/j.jcjd.2015.04.004. Epub 2015 Jun 16., [PMID:26088706]

Abstract [show]
OBJECTIVE: The aim of the present study was to investigate the relationship between ABCG5 and ABCG8 gene polymorphisms and plasma lipid concentrations in Turkish patients with type 2 diabetes mellitus. METHODS: Included in this study were 80 patients with type 2 diabetes and 73 healthy controls. Two selected single nucleotide polymorphisms in ABC transporter genes, ABCG5 (rs6720173) and ABCG8 (rs4148211), were genotyped by using the polymerase chain reaction-restriction fragment length polymorphism technique. RESULTS: The rate of having the ABCG8 AA genotype (p=0.001) was significantly higher in the patients than in the control subjects. Correspondingly, the rates of having the AG genotype (p=0.001) and the G allele (p=0.001) were significantly lower in the patients than in controls. Upon comparing the groups regarding ABCG5, the frequencies of occurrence of the GG genotype (p=0.031) and G allele (p=0.003) were considerably higher in patients than in control subjects. In the patients, the rates of having the CC genotype (p=0.003) and the C allele (p=0.031) were also significantly lower than those in control subjects. There was no significant difference between G5 and G8 polymorphism and lipid levels in the study groups. The ABCG8 AA genotype carriers had higher triglyceride (p=0.045) and very low-density-cholesterol (p=0.045) levels than the ABCG8 GG genotype carriers in all study populations. CONCLUSIONS: These results indicate that the AA genotype for ABCG8 and the GG genotype and G allele for ABCG5 are risk factors for diabetes. This study reveals the first data concerning the ABCG5 and ABCG8 gene polymorphisms in Turkish patients with diabetes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 There is no investigation related to ABCG5 Gln604Glu and ABCG8 Tyr54Cys single nucleotide polymorphisms (SNPs) and lipid levels in patients with diabetes. According to this knowledge, we aimed to investigate the association between ABCG5 and ABCG8 gene polymorphisms and lipid levels in Turkish patients with type 2 diabetes as compared to controls. Login to comment
55 Determination of ABCG5 Gln604Glu and ABCG8 Tyr54Cys polymorphisms ABCG5 and ABCG8 gene polymorphisms were analyzed using the PCR-restriction fragment length polymorphism (RFLP) method, as described previously (21). Login to comment
56 A segment of the ABCG5 gene encompassing the Gln604Glu polymorphic site was amplified with the help of PCR by using the forward (5`-AAC CAC ACC TGA CAC TGT CAA TCT TTT CCT-3`) and reverse primers (5`-GGG CAG GTT TTC TCA ATG AAT TGA ATT CCT C-3`), and a segment of the ABCG8 gene encompassing the Tyr54Cys polymorphic site was amplified using the forward (5`-AGG GCC TCC AGG ATA GAT TGT TCT CCT C-3`) and reverse primers (5`CCT TGA ACC CAG GCG TGC GCC TAC CTG-3`) (21). Login to comment
73 * p<0.05. Table 2 Distribution of ABCG5 Gln604Glu and ABCG8 Tyr54Cys genotypes and alleles in study groups Patients (n&#bc;80) Controls (n&#bc;135) p % n % n ABCG5 Gln604Glu genotype CC 36.2* 29 60.3 44 0.003 GG 22.5* 18 9.6 7 0.031 CG 41.2 33 30.1 22 NS Allele C 56.8* 91 75.4 110 0.031 G 43.2* 69 24.6 36 0.003 ABCG8 Tyr54Cys genotype AA 55.0* 44 21.9 16 0.001 GG 12.5 10 12.3 9 NS AG 32.5* 26 65.8 48 0.001 Allele A 71.2 114 54.80 80 NS G 28.8* 46 45.20 66 0.001 n, Number of individuals; NS, not significant. Login to comment
75 * p<0.05. Table 3 Distribution of ABCG5 Gln604Glu and ABCG8 Tyr54Cys genotypes and alleles by gender in study groups Patients (n&#bc;80) Controls (n&#bc;73) Female (n&#bc;59) Male (n&#bc;21) Female (n&#bc;26) Male (n&#bc;47) % n % n % n % n ABCG5 Gln604Glu genotype CC 33.9 20 42.9 9 61.5 16 59.6 28 GG 25.4 15 14.3 3 19.2 5 4.2 2 CG 40.7 24 42.9 9 19.2 5 36.2 17 Allele C 54.2 64 64.28 27 71.1 37 77.7 73 G 45.8 54 35.72 15 28.85 15 22.3 21 ABCG8 Tyr54Cys genotype AA 62.7* 37 33.3 7 19.2 5 23.4 4 GG 13.6 8 9.5 2 7.7 2 14.9 7 AG 23.7 14 57.2* 12 73.1 19 61.7 29 Allele A 74.6 88 61.9 26 55.7 29 54.3 51 G 25.4 30 38.1* 16 44.3 23 45.7 43 n, Number of individuals. Login to comment
79 Frequencies of ABCG5 and ABCG8 gene polymorphisms The frequencies of genotypes and alleles in ABCG5 Gln604Glu and ABCG8 Tyr54Cys genes in both control and patient groups are shown in Table 2. Login to comment
84 The distributions of genotypes and alleles in ABCG5 Gln604Glu and ABCG8 Tyr54Cys genes bygenderare showninTable 3. Login to comment
89 Some frequencies of genotypes were not in the Hardy-Weinberg equilibrium (frequency of the ABCG8 Tyr54Cys genotype in control subjects, frequency of the ABCG8 Tyr54Cys genotype in female patients, frequency of the ABCG5 Gln604Glu genotype and Tyr54Cys genotypes in female control subjects, and frequency of the ABCG5 Tyr54Cys genotype in male control subjects). Login to comment
94 Discussion Type 2 diabetes mellitus is associated with gene-environment interactions due to epigenetic factors, such as defects in lipid metabolism, hyperlipidemia, hypertension, obesity, smoking and Table 4 Comparison of ABCG5 Gln604Glu and ABCG8 Tyr54Cys genotypes with lipid/anthropometric parameters in study groups ABCG5 Gln604Glu genotype ABCG8 Tyr54Cys genotype Patients (n&#bc;80) Controls (n&#bc;73) Patients (n&#bc;80) Controls (n&#bc;73) CC (n&#bc;29) GG (n&#bc;18) CG (n&#bc;33) P CC (n&#bc;29) GG (n&#bc;18) CG (n&#bc;33) P AA (n&#bc;44) GG (n&#bc;10) AG (n&#bc;21) P AA (n&#bc;44) GG (n&#bc;10) AG (n&#bc;21) p Triglyceride (mg/dL) 176.8382.37 176.6166.59 162.2175.04 NS 139.5949.75 123.5742.26 136.7356.21 NS 177.2383.33 137.4050.36 172.6267.88 NS 147.5068.90 130.4431.14 135.0246.99 NS Total cholesterol (mg/dL) 231.5755.85 231.3248.58 214.1459.23 NS 195.5831.07 202.7178.85 204.7135.56 NS 221.7056.57 216.0839.72 231.9560.41 NS 200.6956.77 207.9846.73 196.7829.13 NS HDL cholesterol (mg/dL) 40.6912.36 36.229.441 36.188.36 NS 36.597.01 39.575.15 34.689.15 NS 37.778.66 41.5014.50 36.5011.14 NS 38.758.59 33.568.81 36.006.96 NS LDL cholesterol (mg/dL) 155.5253.72 159.7848.56 145.5253.34 NS 131.0730.32 138.4371.95 142.6837.32 NS 148.4852.78 147.1043.52 160.9254.81 NS 132.4452.19 148.3350.33 133.7728.81 NS VLDL cholesterol (mg/dL) 35.3716.47 35.3213.31 32.4415.00 NS 27.929.95 24.718.45 27.3511.24 NS 35.4516.66 27.4810.07 34.5213.57 NS 29.5013.78 26.096.22 27.009.39 NS Total cholesterol/ HDL cholesterol (mg/dL) 6.252.77 6.932.66 6.222.33 NS 5.581.80 5.101.68 6.362.33 NS 6.312.70 5.872.64 6.742.32 NS 5.381.66 6.873.53 5.691.65 NS BMI (kg/m 2 ) 26.084.65 26.823.55 26.423.83 NS 26.532.81 * 23.363.30 26.583.91 0.018 26.784.13 24.745.15 26.353.41 NS 25.693.18 25.803.27 26.503.40 NS HDL, High density lipoprotein; LDL, low density lipoprotein; n, number of individuals; NS, not significant; SD, standard deviation; VLDL, very low-density lipoprotein; BMI, body mass index. Statistical evaluation was made by using the Student t test and the 1-way ANOVA test. The results are shown as mean SD. Login to comment
109 We observed that the frequencies of the ABCG5 Gln604Glu GG genotype (p&#bc;0.031) and G allele (p&#bc;0.003) were significantly higher in patients than in the control group. Login to comment
117 In addition, they observed no association between lipid profiles and genotype distribution and allele frequencies for ABCG5 Gln604Glu polymorphism in both genders of the study population (131 male and 154 female). Login to comment
124 Junyent et al (39) genotyped ABCG5 Gln604Glu and ABCG8 Tyr54Cys genetic variants in 845 subjects and observed that minor alleles in these SNPs had a lowering effect on HDL cholesterol concentrations. Login to comment
130 Table 5 Comparison of ABCG5 Gln604Glu and ABCG8 Tyr54Cys genotypes with lipid/anthropometric parameters in all study populations ABCG5 Gln604Glu genotype ABCG8 Tyr54Cys genotype CC (n&#bc;73) CG (n&#bc;25) CG (n&#bc;55) p AA (n&#bc;60) GG (n&#bc;19) AG (n&#bc;74) p Triglyceride (mg/dL) 154.3866.74 161.7664.64 152.0268.73 NS 169.3080.27* 134.1141.37 148.2357.67 0.045 Total cholesterol (mg/dL) 209.8845.87 223.3158.29 210.3750.92 NS 216.0956.92 212.2442.15 209.1345.63 NS HDL cholesterol (mg/dL) 38.229.64 37.168.49 35.588.63 NS 38.038.58 37.7412.50 36.188.59 NS LDL cholesterol (mg/dL) 140.7842.62 153.8053.32 144.3847.22 NS 144.2052.66 147.6845.52 143.3141.64 NS VLDL cholesterol (mg/dL) 30.8813.34 32.3512.92 30.4013.74 NS 33.8616.05* 26.828.27 29.6511.53 0.045 Total cholesterol /HDL cholesterol (mg/dL) 5.852.24 6.422.53 6.282.31 NS 6.062.48 6.343.05 6.061.96 NS BMI (kg/m2 ) 26.353.63 25.853.76 26.483.83 NS 26.493.90 25.244.28 26.453.38 NS HDL, High density lipoprotein; LDL, low density lipoprotein; n, number of individuals; NS, not significant; SD, standard deviation; VLDL, very low-density lipoprotein; BMI, body mass index. Statistical evaluation was made by using the Student t test and the 1-way ANOVA test. The results are shown as mean SD. Login to comment
132 Conclusions This study reports the first data about ABCG5 Gln604Glu and ABCG8 Tyr54Cys gene polymorphisms and lipid parameters in diabetes. Login to comment
136 Therefore, future studies with larger sample sizes in differing races will help us to understand the relationship between ABCG5 Gln604Glu and ABCG8 Tyr54Cys polymorphisms and lipid profiles in diabetes mellitus. Login to comment

[hide] Future therapeutic targets for the treatment and p... Eur J Pharmacol. 2015 Oct 15;765:366-74. doi: 10.1016/j.ejphar.2015.08.045. Epub 2015 Sep 7. Castro-Torres IG, Cardenas-Vazquez Rde J, Velazquez-Gonzalez C, Ventura-Martinez R, De la O-Arciniega M, Naranjo-Rodriguez EB, Martinez-Vazquez M
Future therapeutic targets for the treatment and prevention of cholesterol gallstones.
Eur J Pharmacol. 2015 Oct 15;765:366-74. doi: 10.1016/j.ejphar.2015.08.045. Epub 2015 Sep 7., [PMID:26358204]

Abstract [show]
The formation of cholesterol gallstones involves very complex imbalances, such as alterations in the secretion of biliary lipids (which involves the ABCG5, ABCG8, ABCB4 and ABCB11 transporters), biochemical and immunological reactions in the gallbladder that produce biliary sludge (mucins), physicochemical changes in the structure of cholesterol (crystallization), alterations in gallbladder motility, changes in the intestinal absorption of cholesterol (ABCG5/8 transporters and Niemann-Pick C1L1 protein) and alterations in small intestine motility. Some of these proteins have been studied at the clinical and experimental levels, but more research is required. In this review, we discuss the results of studies on some molecules involved in the pathophysiology of gallstones that may be future therapeutic targets to prevent the development of this disease, and possible sites for treatment based mainly on the absorption of intestinal cholesterol (Niemann-Pick C1L1 and ABCG5/8 proteins).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1440 An experiment assessed the association of genetic alterations with biliary lithiasis and with elevated levels of blood lipids; it determined that some alleles of these transporters present in subjects with gallstones (Q604E for ABCG5 and D19H for ABCG8) are associated with increased levels of plasma lipids (cholesterol and triglycerides), as well as with a decrease in HDL cholesterol (Acalovschi et al., 2006). Login to comment