ABCMdb

PMID: 19101985

Byrne JA, Strautnieks SS, Ihrke G, Pagani F, Knisely AS, Linton KJ, Mieli-Vergani G, Thompson RJ
Missense mutations and single nucleotide polymorphisms in ABCB11 impair bile salt export pump processing and function or disrupt pre-messenger RNA splicing.
Hepatology. 2009 Feb;49(2):553-67., [PubMed]

Sentences

No. Mutations Sentence Comment

3 ABCB11 p.Asp482Gly The common ABCB11 missense mutation encoding D482G enhanced aberrant splicing, whereas the common SNP A1028A promoted exon skipping. Login to comment 7 ABCB11 p.Glu297Gly Treatment with glycerol and incubation at reduced temperature overcame processing defects for several mutants, including E297G. Login to comment 8 ABCB11 p.Ala570Thr ABCB11 p.Asn490Asp Taurocholate transport by two assessed mutants, N490D and A570T, was reduced compared with wild-type. Login to comment 67 ABCB11 p.Asp482Gly ABCB11 p.Glu297Gly ABCB11 p.Gly238Val ABCB11 p.Cys336Ser ABCB11 p.Ser194Pro ABCB11 p.Val284Ala ABCB11 p.Gly260Asp ABCB11 p.Arg415Gln ABCB11 p.Glu186Gly ABCB11 p.Arg432Thr ABCB11 p.Ile541Leu ABCB11 p.Ile498Thr ABCB11 p.Lys461Glu ABCB11 p.Val284Leu ABCB11 p.Ala570Thr ABCB11 p.Asn490Asp ABCB11 p.Glu297Lys ABCB11 p.Val481Glu ABCB11 p.Gly562Asp ABCB11 p.Arg517His ABCB11 p.Thr463Ile ABCB11 p.Arg470Gln ABCB11 p.Gly410Asp ABCB11 p.Ala390Pro ABCB11 p.Asn515Thr ABCB11 p.Gln466Lys ABCB11 p.Glu135Lys ABCB11 p.Phe548Tyr ABCB11 p.Glu137Lys ABCB11 p.Ile512Thr ABCB11 p.Gly327Glu ABCB11 p.Gln312His ABCB11 p.Thr242Ile ABCB11 p.Ala167Val ABCB11 p.Leu198Pro ABCB11 p.Leu50Ser ABCB11 p.Arg313Ser ABCB11 Missense Mutations and SNPs Functionally Analyzed in This Study Exon Nucleotide Change Predicted Protein Effect Location in Protein Associated Phenotype Prevalence or Frequency* Any Defect(s) Identified Reference 4 c.149TϾC L50S NH2 term PFIC 1 family (het) Immature protein 31 5 c.270TϾC F90F EC1 SNP 2.7%-7.7% 43, 45 6 c.403GϾA E135K EC1 BRIC 1 family (het) Reduced levels of mature protein † 6 c.409GϾA E137K EC1 BRIC / ICP 1 family (het) Immature protein ‡ 7 c.500CϾT A167V TM2 PFIC 1 family (hom) Mild exon skipping beta 7 c.557AϾG E186G IC1 BRIC 2 families (both het) Moderate exon skipping; greatly reduced levels of mature protein 8, 37 7 c.580TϾC S194P IC1 SNP-PSC 1.1% 43 7 c.593TϾC L198P IC1 BRIC / ICP / DC 1 family (het) Greatly reduced levels of mature protein # 8 c.713GϾT G238V EC2 PFIC 1 family (hom) 29 8 c.725CϾT T242I TM4 PFIC 1 family (het) 31 8 c.779GϾA G260D TM4 SNP-PBC 0.8% 43 9 c.850GϾC V284L IC2 PFIC 1 family (het) No protein 28 9 c.851TϾC V284A IC2 SNP 0.5% Increased levels of mature protein 43, 45† 9 c.889GϾA E297K IC2 Prolonged NNH 1 family (het) Moderate differential splicing; immature protein ‡ 9 c. 890AϾG E297G IC2 PFIC, BRIC PFIC, 45 families (14 hom, 31 het) BRIC, 4 families (2 hom, 2 het) Greatly reduced levels of mature protein 7, 8, 12, 29-32, 35 10 c.936GϾT Q312H IC2 PFIC 1 family (het) ‡ 10 c.937CϾA R313S IC2 PFIC 1 family (het) 31 10 c.957AϾG G319G TM5 SNP 1.5 - 7.5% Mild exon skipping 42, 43, 45 10 c.980GϾA G327E TM5 PFIC 1 family (het) 31 10 c.1007GϾC C336S TM5 PFIC 1 family (het) 29 11 c.1168GϾC A390P NBF PFIC, BRIC 2 families (both het) Immature protein 31; # 12 c.1129GϾA G410D NBF PFIC 1 family (het) 31 12 c.1238TϾG L413W NBF PFIC 1 family (het) Greatly reduced levels of mature protein 31 12 c.1244GϾA R415Q NBF SNP-ICP 1.3% 42 12 c.1295GϾC R432T NBF BRIC 1 family (het) Reduced levels of mature protein 12 13 c.1331CϾT A444V NBF SNP, ICP, CC, DC, BRIC 43-60% Increased levels of mature protein 8, 28, 37, 39-45 13 c.1381AϾG K461E WA PFIC 1 family (hom) Immature protein 7 13 c.1388CϾT T463I WA PFIC 1 family (het) Mild exon skipping 31 13 c.1396CϾA Q466K Adj WA PFIC 1 family (het) 31 13 c.1409GϾA R470Q Adj WA PFIC 2 families (1 het, 1 consanguineous) Immature protein 31 14 c.1442TϾA V481E NBF1 PFIC 1 family (het) 31 14 c.1445AϾG D482G NBF1 PFIC 22 families (16 het, 6 hom) Severe differential splicing; immature protein 7, 30-32 14 c.1468AϾG N490D NBF1 PFIC 1 family (het) Greatly reduced levels of mature protein; reduction in bile salt transport 31 14 c.1493TϾC I498T NBF1 PFIC / BRIC 1 family (het) 38 14 c.1530CϾA T510T NBF1 SNP-PBC 0.7% 43 14 c.1535TϾC I512T NBF1 PFIC 1 family (het) 31 14 c.1544AϾC N515T NBF1 PFIC 1 family (het) 31, 32 14 c.1440GϾA R517H NBF1 PFIC 1 family (het) No protein 31, 32 14 c.1605CϾT A535A NBF1 SNP 0.3% Slightly reduced levels mature protein 39, 45 14 c.1621AϾC I541L NBF1 PFIC 3 families (1 het, 2 consanguineous) No protein 31-33 15 c.1643TϾA F548Y Adj ABCm PFIC 1 family (het) 31, 32 15 c.1685GϾA G562D ABCm PFIC 1 family (het) 31 15 c.1708GϾA A570T Adj ABCm/WB PFIC, BRIC PFIC, 1 family Greatly reduced levels of mature protein; reduction in bile salt transport 8, 31 Table 1. Login to comment 68 ABCB11 p.Arg1153Cys ABCB11 p.Gly982Arg ABCB11 p.Met677Val ABCB11 p.Arg698His ABCB11 p.Ala1228Val ABCB11 p.Asn591Ser ABCB11 p.Arg1050Cys ABCB11 p.Arg1128His ABCB11 p.Ala926Pro ABCB11 p.Ser593Arg ABCB11 p.Gly1004Asp ABCB11 p.Thr923Pro ABCB11 p.Glu1186Lys ABCB11 p.Thr586Ile ABCB11 p.Glu709Lys ABCB11 p.Arg1128Cys ABCB11 p.Thr1210Pro ABCB11 p.Thr859Arg ABCB11 p.Ile627Thr ABCB11 p.Leu1242Ile ABCB11 p.Ser1154Pro ABCB11 p.Ala588Val ABCB11 p.Arg1153His ABCB11 p.Ser1144Arg ABCB11 p.Gly1116Arg ABCB11 p.Asn1211Asp ABCB11 p.Tyr818Phe ABCB11 p.Ala1110Glu ABCB11 p.Thr655Ile ABCB11 p.Glu1223Asp ABCB11 p.Leu1197Gly ABCB11 p.Arg948Cys ABCB11 p.Asn979Asp Continued Exon Nucleotide Change Predicted Protein Effect Location in Protein Associated Phenotype Prevalence or frequency* Any Defect(s) Identified Reference BRIC, 1 family (both hom) 15 c.1757CϾT T586I Adj WB BRIC 1 family (het) No splicing † 15 c.1763CϾT A588V Adj WB PFIC 2 families (both het) No protein 31, 32 15 c.1772AϾG N591S Adj WB SNP-ICP 2.6% 42 15 c.1779TϾA S593R NBF1 PFIC 1 family (het) 29 15 c.1791GϾT V597V NBF1 SNP 2.6% 42 16 c.1880TϾC I627T IC3 PFIC 1 family (het) ‡ 16 c.1964CϾT T655I IC3 BRIC / ICP / DC 1 family (het) Reduced levels of mature protein ‡ 17 c.2029AϾG M677V IC3 SNP 1.6-5.6% 39, 42-45 18 c.2093GϾA R698H IC3 SNP 0.3 - 0.8% 43, 45 18 c.2125GϾA E709K IC3 SNP-PFIC 1 family (het) ‡ 18 c.2130TϾC P710P IC3 SNP-PBC 0.5 - 3.1% 43 20-21 c.2412AϾC A804A TM8 SNP 1.1% 45 20-21 c.2453AϾT Y818F IC4 SNP-PFIC 2 families (hom) Reduced levels of mature protein ‡ 20-21 c.2494CϾT R832C IC4 PFIC 2 families (1 het, 1 consanguineous) Moderate differential splicing 31, 32 20-21 c.2576CϾG T859R IC4 PFIC 1 family (het) 31 22 c.2767AϾC T923P IC5 BRIC 1 family (het) 8 22 c.2776GϾC A926P IC5 BRIC 1 family (het) Mild exon skipping 8 23 c.2842CϾT R948C IC5 PFIC 2 families (both het) Immature protein 31 23 c.2935AϾG N979D TM11 PFIC 1 family (consanguineous) 31 23 c.2944GϾA G982R TM11 PFIC 4 families (1 hom, 1 consanguineous, 2 het) Immature protein 7, 29, 31 23 c.3011GϾA G1004D EC6 PFIC 1 family (hom) 28 24 c.3084AϾG A1028A TM12 SNP-PBC 39.86 - 56.3% Severe exon skipping 8, 43, 45 24 c.3148CϾT R1050C C term BRIC 2 familes (1 hom, 1 het) Immature protein 8 25 c.3329CϾA A1110E Adj WA PFIC 2 familes (both het) Mild exon skipping; immature protein 31 25 c.3346GϾC G1116R WA PFIC / BRIC 1 family (consanguineous) Mild exon skipping ‡ 25 c.3382CϾT R1128C NBF2 PFIC 1 family (consanguineous) Mild exon skipping; immature protein 31 25 c.3383GϾA R1128H NBF2 BRIC 1 family (hom) Mild exon skipping; greatly reduced levels of mature protein 8 26 c.3432CϾA S1144R NBF2 PFIC 1 family (het) Severe differential splicing 29 26 c.3457CϾT R1153C NBF2 PFIC 4 families (2 consanguineous, 2 het) Immature protein 7, 31, 36 26 c.3458GϾA R1153H NBF2 PFIC 4 families (2 consanguineous, 2 het) Severe differential splicing; immature protein 31 26 c.3460TϾC S1154P NBF2 PFIC 1 family (het) Severe differential splicing 31 26 c.3556GϾA E1186K NBF2 SNP 1%-10% Mild exon skipping ‡ 26 c.3589_3590 delCTinsGG L1197G NBF2 BRIC 1 family (het) † 27 c.3628AϾC T1210P Adj ABCm PFIC 1 family (hom) Immature protein 31 27 c.3631AϾG N1211D Adj ABCm SNP-PFIC 1 family (het) ‡ 27 c.3669GϾC E1223D ABCm Prolonged NNH 1 family (het) ‡ 27 c.3683CϾT A1228V Adj ABCm/WB SNP-PBC 0.8% 43 27 c.3691CϾT R1231W Adj ABCm/WB PFIC 1 family (het) Severe exon skipping; immature protein 30, 31 27 c.3692GϾA R1231Q Adj ABCm/WB PFIC 2 families (1 consanguineous, 1 het) No splicing; immature protein 31, 34 27 c.3724CϾA L1242I WB PFIC 1 family (het) 31 28 c.3892GϾA R1268Q¶ NBF2 PFIC 1 family (hom) Immature protein 7 *Prevalence or frequency is quoted depending on how data were presented in the original publication(s). Login to comment 72 ABCB11 p.Arg1268Gln ¶Exon 28 and hence R1268Q (c.3892GϾA) was not included in the splicing system studies. Login to comment 88 ABCB11 p.Glu186Gly ABCB11 p.Ala167Val Notably, exon 7 nucleotide sequences encoding the predicted mutations A167V (c.500CϾT) and E186G (c.557AϾG) resulted, respectively, in only 80% and 60% wild-type splicing (Fig. 2A). Login to comment 89 ABCB11 p.Arg1231Trp ABCB11 p.Arg1128His ABCB11 p.Ala926Pro ABCB11 p.Thr463Ile ABCB11 p.Arg1128Cys ABCB11 p.Gly1116Arg ABCB11 p.Ala1110Glu To varying degrees, exon skipping was also seen for the nucleotide changes associated with other missense mutations: T463I (c.1388CϾT; 90% wild-type splicing; Fig. 2C), A926P (c.2776GϾC; 90%; Fig. 2E), A1110E (c.3329CϾA; 90%), G1116R (c.3346GϾC; 80%), R1128C (c.3382CϾT; 85%), R1128H (c.3383GϾA; 90%), and R1231W (c.3691CϾT; 5%; Fig. 2F). Login to comment 90 ABCB11 p.Glu1186Lys A small amount of exon skipping was also seen for the SNPs G319G (c.957AϾG; 95%; Fig. 2B) and E1186K (c.3556GϾA; 90%; Fig. 2F). Login to comment 93 ABCB11 p.Asp482Gly ABCB11 p.Glu297Lys ABCB11 p.Ser1154Pro ABCB11 p.Arg1153His ABCB11 p.Ser1144Arg ABCB11 p.Arg832Cys Differential splice products were seen for six predicted ABCB11 missense mutations, leading to very low levels of wild-type splicing (indicated in parentheses): E297K (c.889GϾA; 50%; Fig. 2B), D482G (c.1445AϾG; 5%; Fig. 2C), R832C (c.2494CϾT; 50%; Fig. 2E), and S1144R (c.3432CϾA; 3%), R1153H (c.3458GϾA; 3%), and S1154P (c.3460TϾC; 3%; Fig. 2F). Login to comment 100 ABCB11 p.Arg1231Gln ABCB11 p.Thr586Ile No spliced ABCB11 PCR product was generated for the nucleotide changes associated with T586I (c.1757CϾT; 0%; Fig. 2D) and R1231Q (c.3692GϾA; 0%; Fig. 2F). Login to comment 103 ABCB11 p.Glu297Gly On changing the wild-type exon 9 nucleotide sequence to the sequence of E297G (c.890AϾG), the cryptic donor splice site disappears. Login to comment 104 ABCB11 p.Glu297Lys However, for the nucleotide change that results in E297K (c.889GϾA), the score for the cryptic donor splice site rises to 0.99, with the normal donor splice site being maintained at 0.62. Login to comment 105 ABCB11 p.Glu297Lys Indeed, it can be seen that the normal and the cryptic splice sites are equally used by the E297K-containing exon 9 (Fig. 2B). Login to comment 106 ABCB11 p.Glu297Gly ABCB11 p.Glu297Lys Additional analysis of the exon 9 variant sequences to identify changes to ESE or ESS motifs was performed using RESCUE-ESE and ESE FINDER 2.0 or the FAS-ESS programme, respectively.47-49,52,53 An SC35 site was identified, which was maintained irrespective of which nucleotide form was analyzed, but the presence of sequence coding for either E297K or E297G resulted in the introduction of an ESS hexamer. Login to comment 107 ABCB11 p.Asp482Gly ABCB11 p.Val481Glu Scanning of exon 14 with the ESS prediction programme FAS-ESS52,53 indicates that the mutant D482G (c.1445AϾG) nucleotide sequence causes the introduction of two additional ESS hexamers, whereas the adjacent V481E (c.1442TϾA) does not. Login to comment 109 ABCB11 p.Ser1154Pro ABCB11 p.Arg1153His ABCB11 p.Ser1144Arg The cryptic acceptor splice site in exon 26 has a score of 0.23, according to the Splice Site Prediction by Neural Network program.50,51 The mutations S1144R (c.3432CϾA), R1153H (c.3458GϾA), and S1154P (c.3460TϾC) do not alter the predicted score for use of this site. Login to comment 111 ABCB11 p.Asp482Gly ABCB11 p.Glu297Lys ABCB11 p.Ser1154Pro ABCB11 p.Arg1153His ABCB11 p.Ser1144Arg ABCB11 p.Arg832Cys ABCB11 p.Arg832Cys Positive-acting and negative-act- Exon 14 D482G Aberrant product Exon 14Minigene Cryptic acceptor splice Exon 14 CTACCACCATTGCAGAAAATATTCGCTATG ATACCATCATCCCAGAAAATATTCGCTATG ATCTCTTTTCACCCAATTTCTACAGGGCAATGCTGGGGCAAGAT Exon 21Exon 20 R832C Aberrant product AAGGCTACGTAAATTTGGTTTCAGGGCAATGCTGGGGCAAGAT AAGGCTATGTAAATTTGGTTTCAGGGCAATGCTGGGGCAAGAT Exon 21 R832C Exon 21 Cryptic acceptor splice Exon 9 E297K Aberrant product CTGCTTTTGGTGGTGAGAAAAGAGAGGTTGAAAGgttggtta Normal donor splice siteCryptic donor splice site CTGCTTTTGGTGGTAAGAAAAGAGAGGTTGAAAGgttggttaE297K Exon 9 CTGCTTTTGGTGCTGTTCCTCCTCCCACTGACCTGCGATT MinigeneExon 9 Intron 9 Intron 9 S1144R, R1153H, S1154P Aberrant product Exon 26 ATACCATCATCCCAGGAACCAGTGTTGTTTGCCT Exon 26Minigene AATTGTTTCCCAGGAACCAGTGTTGTTTGCCTCAG Cryptic acceptor splice D Fig. 3. Login to comment 112 ABCB11 p.Asp482Gly ABCB11 p.Glu297Lys ABCB11 p.Ser1154Pro ABCB11 p.Arg1153His ABCB11 p.Ser1144Arg ABCB11 p.Arg832Cys (A-D) Illustration of variant splice forms associated with ABCB11 mutations (A) E297K, (B) D482G, (C) R832C, and (D) S1144R, R1153H, and S1154P. Login to comment 119 ABCB11 p.Glu1186Lys The potential to modulate a selection of aberrant ABCB11 pre-mRNA splicing was assessed through the addition of the splicing factors SC35, hnRNPA2, and hnRNPH.25 The effect on the nucleotide change predicted to cause E1186K (c.3556GϾA) was also assessed, as the role of this SNP in the development of disease is unclear. Login to comment 121 ABCB11 p.Glu186Gly Figure 4A illustrates that the addition of splicing factor SC35 increased the inclusion of ABCB11 exon 7 containing nucleotide sequence for E186G (c.557AϾG) to the same level as wild-type exon 7, whereas that of the unspliced product remained constant. Login to comment 122 ABCB11 p.Glu297Lys Additionally, the differential splicing associated with E297K (c.889GϾA) was abolished on the addition of SC35, but on quantitative analysis was slightly enhanced with hnRNPA2 (2.5-fold) and hnRNPH (eightfold). Login to comment 123 ABCB11 p.Asp482Gly No added splicing factor substantially altered the cryptic splicing pattern associated with the D482G (c.1445AϾG) nucleotide substitution (Fig. 4A). Login to comment 124 ABCB11 p.Thr463Ile SC35 resulted in a twofold reduction of T463I (c.1388CϾT) splicing (Fig. 4B). Login to comment 125 ABCB11 p.Gly1116Arg Splicing of exon 25 containing the nucleotide sequence encoding G1116R (c.3346GϾC) was improved on the addition of SC35, with a reciprocal reduction in unspliced product, but no change was associated with hnRNPA2 and hnRNPH (Fig. 4B). Login to comment 126 ABCB11 p.Arg1128Cys The wild-type splicing of R1128C (c.3382CϾT) was enhanced by these latter factors, however (Fig. 4B). Login to comment 127 ABCB11 p.Arg1231Trp ABCB11 p.Ala167Val None of the factors altered the splicing of A167V (c.500CϾT; Fig. 4A), or R1231W (c.3691CϾT; Fig. 4C). Login to comment 128 ABCB11 p.Glu1186Lys Finally, the splicing of the SNP E1186K (c.3556GϾA) was maintained at 90% of wild-type levels on the addition of hnRNPA2 and hnRNPH, but was inhibited by SC35 (Fig. 4C). Login to comment 140 ABCB11 p.Asn591Ser ABCB11 p.Ile498Thr ABCB11 p.Thr586Ile ABCB11 p.Glu709Lys ABCB11 p.Leu1242Ile ABCB11 p.Asn1211Asp Variant BSEP forms found in this study to have the same molecular weight and about the same abundance as the wild-type protein are I498T (c.1493TϾC; Fig. 5A), N1211D (c.3631AϾG), L1242I (c.3724CϾA), E709K (c.2125GϾA; Fig. 5C), , T586I (c.1757CϾT; Fig. 5E), as well as the SNP N591S (c.1772AϾG; Fig. 5F). Login to comment 141 ABCB11 p.Arg432Thr ABCB11 p.Glu135Lys ABCB11 p.Tyr818Phe ABCB11 p.Thr655Ile Mature BSEP, but at somewhat reduced levels, was detected for E135K (c.403GϾA; Fig. 5B), T655I (c.1964CϾT; Fig. 5C), R432T (c.1295GϾC; Fig. 5.e), the PFIC-associated SNP Y818F (c.2453AϾT; Fig. 5E), and the SNP A535A (c.1605CϾT; Fig. 5F). Login to comment 142 ABCB11 p.Glu297Gly ABCB11 p.Glu186Gly ABCB11 p.Arg1128His ABCB11 p.Ala570Thr ABCB11 p.Asn490Asp ABCB11 p.Leu198Pro The mutations N490D (c.1468AϾG; Fig. 5A), R1128H (c.3383GϾA; Fig. 5B), E297G (c. 890AϾG), and A570T (c.1708GϾA; Fig. 5D), and E186G (c.557AϾG; Fig. 5E) resulted in significantly reduced levels of mature protein, and the L198P (c.593TϾC) variant was barely detectable (Fig. 5C). Login to comment 144 ABCB11 p.Ile541Leu ABCB11 p.Val284Leu ABCB11 p.Ala588Val No BSEP protein, mature or immature, was observed for the mutations V284L (c.850GϾC) and A588V (c.1763CϾT; Fig. 5A) and I541L (c.1621AϾC; Fig. 5B), indicating that these variants were rapidly degraded. Login to comment 147 ABCB11 p.Val284Ala The SNP V284A (c.851TϾC) led to increased amounts of protein compared with wild-type BSEP (Fig. 5A). Login to comment 150 ABCB11 p.Glu297Gly ABCB11 p.Arg948Cys The addition of glycerol and incubation at a reduced temperature are conditions that promote, in cultured cells, the correct processing of membrane proteins trapped in the ER or Golgi.54-56 In an initial experiment, the effects of glycerol alone, incubation at 28°C alone, or glycerol and 28°C in combination on wild-type BSEP, R948C (c.2842CϾT), and E297G (c. 890AϾG) were assessed. Login to comment 152 ABCB11 p.Glu297Gly ABCB11 p.Arg948Cys There was no such effect by any treatment for R948C, but for E297G, incubation at 28°C alone or in combination with 10% glycerol gave the same levels of 160 kDa BSEP as the wild-type protein. Login to comment 154 ABCB11 p.Arg1268Gln ABCB11 p.Arg1231Gln ABCB11 p.Arg1050Cys ABCB11 p.Arg1128His ABCB11 p.Ala570Thr ABCB11 p.Glu297Lys ABCB11 p.Arg1128Cys ABCB11 p.Arg1153His The following mutations showed an enrichment of mature BSEP: R1153H (c.3458GϾA; Fig. 6B), R1128C (c.3382CϾT), R1128H (c.3383GϾA), R1231Q (c.3692GϾA), R1050C (c.3148CϾT; Fig. 6C) and R1268Q (c.3892GϾA), A570T (c.1708GϾA), and E297K (c.889GϾA; Fig. 6D). Login to comment 155 ABCB11 p.Asp482Gly D482G (c.1445AϾG) showed an improvement on treatment, but mature protein levels were lower than those for wild-type BSEP (Fig. 6D). Login to comment 163 ABCB11 p.Ala570Thr ABCB11 p.Ala570Thr ABCB11 p.Asn490Asp ABCB11 p.Asn490Asp Wild-type and variant ABCB11 baculoviruses with the mutations N490D (c.1468AϾG) and A570T (c.1708GϾA) were created, and, after infection of Hi5 insect cells, inside-out membrane vesicles were prepared to perform taurocholate transport assays.3 The mutant N490D was chosen because it generated a mature form of BSEP, although in reduced abundance (Fig. 5A), and because the associated disease was severe,30 whereas A570T was amenable to glycerol and reduced temperature: these enhanced the abundance of a mature form of BSEP (Fig. 6D). Login to comment 167 ABCB11 p.Ala570Thr ABCB11 p.Asn490Asp The N490D mutation was associated with 27% and the A570T mutation with 60% of normal activity. Login to comment 170 ABCB11 p.Asp482Gly Of the ABCB11 nucleotide changes assayed for pre-mRNA splicing defects, the introduction into exon 14 of the one predicted to generate D482G (c.1445AϾG) resulted in the predominant use of a cryptic splice site within this exon (Figs. Login to comment 172 ABCB11 p.Asp482Gly D482G is one of the most common PFIC missense mutations in European patients, and in vitro studies have differed in their conclusions on Fig. 7. Login to comment 174 ABCB11 p.Ala570Thr ABCB11 p.Asn490Asp (A) Baculoviruses were created that contained either the wild-type ABCB11 cDNA, that encoding N490D (c.1468AϾG), or A570T (c.1708GϾA) and were used, along with a mock baculovirus, to transduce Hi5 insect cells. Login to comment 179 ABCB11 p.Glu297Gly ABCB11 p.Arg948Cys (A) ABCB11 cDNA constructs encoding the mutants R948C (c.2842CϾT) and E297G (c.890AϾG) were transfected into CHO-K1 cells and assessed for the effect of 5% or 10% glycerol, incubation at 28°C, or incubation with 10% glycerol at 28°C for the appearance of mature 160 kDa BSEP form. Login to comment 183 ABCB11 p.Asp482Gly Therefore, if such splicing predominates in vivo, D482G-containing BSEP, per se, may only exist at very low levels in hepatocytes. Login to comment 185 ABCB11 p.Asp482Gly Of BSEP deficiency patients who developed malignancy, 16% have the D482G mutation,30,31,35 putatively making it a more severe disease-causing mutation than previously recognized. Login to comment 187 ABCB11 p.Asp482Gly ABCB11 p.Asp482Gly ABCB11 p.Asp482Gly Additionally, D482G-containing mRNA in vivo appears to be unstable, because in a previous small study from our group, liver from a patient heterozygous for D482G yielded no PCR-amplifiable ABCB11 exon 13 to exon 15 (indicating that the second mutation also resulted in deficiency of ABCB11 mRNA).61 The fact that the D482G-associated cryptic splicing could not be modulated by the addition of exogenous SC35 splicing factor (Fig. 4A) may make it more difficult to develop novel treatments to overcome this particular defect. Login to comment 188 ABCB11 p.Glu297Lys ABCB11 p.Glu297Lys By contrast, the aberrant splice product associated with E297K (c.889GϾA) was completely abolished on addition of the splicing factor SC35, whereas higher levels of hnRNPA2 and hnRNPH had a negative effect on the normal splicing of E297K (Fig. 4A). Login to comment 189 ABCB11 p.Glu297Lys Therefore, the actual levels of positive and negative splicing factors in patients could potentially affect the levels of aberrant splicing associated with E297K in affected hepatocytes. Login to comment 191 ABCB11 p.Glu297Lys Differences may be further exacerbated by the fact that the maturation of E297K protein can be modulated by conditions that facilitate protein folding by chaperones and thus increase protein release from the ER (Fig. 6D). Login to comment 194 ABCB11 p.Glu297Lys If a patient`s allele contained the variant G as well as the nucleotide change resulting in E297K, for example, a double-negative effect on ABCB11 pre-mRNA splicing would be more severe. Login to comment 197 ABCB11 p.Glu186Gly E186G (c.557AϾG) was associated with the moderate skipping of exon 7 when the corresponding nucleotide substitution was introduced (Fig. 2A). Login to comment 199 ABCB11 p.Glu186Gly The fact that the addition of the splicing factor SC35 could modulate the exon 7 skipping associated with E186G may mean that splicing of pre-mRNA containing the nucleotide change is a fluid situation in cells. Login to comment 200 ABCB11 p.Glu186Gly Such splicing would depend on the activity of these splicing factors in the local environment of the mutant E186G ABCB11 pre-mRNA. Login to comment 201 ABCB11 p.Glu186Gly Indeed, there is much evidence for pre-mRNAs associating with specific but numerous RNA-binding proteins that escort them to the cytoplasm.63 One patient was noted to have reduced canalicular membrane BSEP staining.37 Expression of E186G did indeed result in very low levels of mature BSEP (Fig. 5E), and thus a combination of reduced mRNA and protein levels could contribute to the clinical phenotype. Login to comment 202 ABCB11 p.Val444Ala Interestingly, the patient in question was also heterozygous for the SNP V444A (c.1331TϾC). Login to comment 207 ABCB11 p.Ile498Thr ABCB11 p.Leu1242Ile ABCB11 p.Asn1211Asp Normal levels of mature BSEP were seen for the predicted missense mutations I498T (c.1493TϾC; Fig. 5A), L1242I (c.3724CϾA; Fig. 5C), and N1211D (c.3631AϾG; Fig. 5C). Login to comment 208 ABCB11 p.Ile498Thr ABCB11 p.Ile498Thr Mutation I498 is located within the first nucleotide binding fold (NBF) between the Walker A and ABC signature motifs, which are domains highly conserved among ABC transporter superfamily members.2 The mutation I498T is associated with the less severe, intermittent BRIC clinical phenotype.38 Intermittent episodes of cholestasis may arise when any functional activity of I498T is compromised within a patient`s liver. Login to comment 209 ABCB11 p.Leu1242Ile ABCB11 p.Asn1211Asp The second NBF harbors N1211D and L1242I: the former is located eight amino acids upstream of the ABC signature motif and is only conserved among BSEP orthologs, whereas the latter is within the Walker B motif and is totally conserved across BSEP, multidrug resistance (MDR) 1 (MDR1), MDR3, MDR-associated protein 2, and CFTR. Login to comment 210 ABCB11 p.Asn1211Asp Both mutations have been found in patients with PFIC, but N1211D may be a rare SNP (S Strautnieks, unpublished data). Login to comment 211 ABCB11 p.Asn1211Asp The lack of conservation among ABC transporters calls into question the importance of N1211, but functional studies are needed to confirm the effect of N1211D. Login to comment 212 ABCB11 p.Val284Leu ABCC7 p.Leu1242Ile ABCB4 p.Ala588Val With respect to L1242I, disruption of a Walker B motif is predicted to cause severe functional consequences.64 No detectable protein was observed for the predicted missense mutations V284L (c.850GϾC) and A588V (c.1763CϾT; Fig. 5A). Login to comment 213 ABCB11 p.Val284Ala ABCB11 p.Val284Leu V284A enhances, whereas V284L abolishes, BSEP protein levels. Login to comment 219 ABCB11 p.Glu297Gly ABCB11 p.Arg1268Gln ABCB11 p.Arg1231Gln ABCB11 p.Arg1050Cys ABCB11 p.Arg1128His ABCB11 p.Ala570Thr ABCB11 p.Glu297Lys ABCB11 p.Arg1128Cys These include the PFIC-associated mutations E297G (c.890AϾG; Fig. 6A), R1128C (c.3382CϾT) and R1231Q (c.3692GϾA; Fig. 6C), and R1268Q (c.3892GϾA; Fig. 6.d), the BRIC-associated mutations R1128H (c.3383GϾA) and R1050C (c.3148CϾT; Fig. 6C), and E297K (c.889GϾA; Fig. 6D), as well as A570T (c.1708GϾA), which can be associated with either form of disease. Login to comment 220 ABCB11 p.Asp482Gly ABCB11 p.Glu297Gly A recent study introduced E297G and D482G into human BSEP and assessed their trafficking in MDCK cells.66 The addition of sodium 4-phenylbutyrate prolonged the half-life of both mutant BSEP forms and resulted in increased functional expression of the proteins. Login to comment 221 ABCB11 p.Asp482Gly ABCB11 p.Glu297Gly This concurs with the data presented here, which show reduced levels of mature BSEP when E297G and D482G were expressed in vitro (Fig. 5D). Login to comment 222 ABCB11 p.Asp482Gly ABCB11 p.Glu297Gly Furthermore, the addition of 10% glycerol and incubation at 28°C resulted in a substantial and a marginal increase in mature E297G and D482G protein, respectively (Fig. 6A, D). Login to comment 223 ABCB11 p.Asp482Gly For D482G, we found significant splicing defects (see previous discussion). Login to comment 224 ABCB11 p.Asp482Gly Neither this treatment nor sodium 4-phenylbutyrate could have any clinical effect if normal D482G mRNA processing were almost completely disrupted by aberrant splicing in patients, as suggested by our results in vitro. Login to comment 225 ABCB11 p.Glu297Gly However, if there were some wild-type splicing present, these agents could allow a partial rescue of phenotype, taking into account the slight defect in protein function previously determined for this mutant protein.15 Because there are no observed splicing defects associated with the nucleotide change associated with E297G, such therapies are possible in the future for this mutation. Login to comment 226 ABCB11 p.Ala570Thr ABCB11 p.Asn490Asp Two mutations, N490D (c.1468AϾG) and A570T (c.1708GϾA), were expressed in insect cells and then assessed for their ability to transport taurocholate (Fig. 7A, B). Login to comment 228 ABCB11 p.Ala570Thr ABCB11 p.Asn490Asp Despite equal expression of both mutants in these cells, N490D had only 27% and A570T had 60% of the activity of the wild-type protein, respectively. Login to comment 229 ABCB11 p.Val284Ala ABCB11 p.Asn490Asp The phenotype of the patient with N490D was very severe, with death before the age of 1 year.30 A second mutation in ABCB11 has not been found but heterozygosity for V284A is present (c.851TϾC; M. Jirsa, unpublished data). Login to comment 230 ABCB11 p.Ala570Thr ABCB11 p.Ala570Thr ABCB11 p.Ala570Thr ABCB11 p.Asn490Asp ABCB11 p.Asn490Asp A570T was identified on both alleles in a patient with BRIC who required a partial external biliary diversion to treat progressive cholestasis at the age of 18 years.8 Both N490D and A570T are situated in the first NBF of BSEP; N490D is conserved across the MDR family, whereas A570T is also conserved in MDR-associated protein 2 and CFTR. Login to comment 231 ABCB11 p.Ala570Thr ABCB11 p.Asn490Asp However, the substitution N490D is more functionally detrimental and apparently more clinically severe than A570T. Login to comment 232 ABCB11 p.Ala570Thr The recent expression of rat Bsep with A570T in MDCK cells gave comparable results to our study with respect to levels of mature protein.14 These authors attributed an approximately 50% reduction of taurocholate transport solely to reduced BSEP protein expression levels, whereas our data suggest an additional defect in transport activity. Login to comment 238 ABCB11 p.Ala588Val For ABCB11, several missense mutations` nucleotide context was predicted to cause aberrant splicing, such as A588V (c.1763CϾT; data not shown). Login to comment 240 ABCB11 p.Asp482Gly Similarly, nucleotide changes not predicted to cause any abnormalities, such as D482G (c.1445AϾG), did disrupt splicing. Login to comment