ABCB11 p.Ser1154Pro
| Reviews: |
p.Ser1154Pro
D
|
| Predicted by SNAP2: | A: N (87%), C: N (66%), D: N (61%), E: N (61%), F: D (59%), G: N (87%), H: N (66%), I: D (53%), K: N (61%), L: D (53%), M: N (61%), N: N (82%), P: D (66%), Q: N (93%), R: N (78%), T: N (72%), V: D (53%), W: D (66%), Y: D (59%), |
| Predicted by PROVEAN: | A: N, C: D, D: D, E: D, F: D, G: N, H: D, I: D, K: D, L: D, M: D, N: N, P: D, Q: D, R: D, T: N, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Missense mutations and single nucleotide polymorph... Hepatology. 2009 Feb;49(2):553-67. Byrne JA, Strautnieks SS, Ihrke G, Pagani F, Knisely AS, Linton KJ, Mieli-Vergani G, Thompson RJ
Missense mutations and single nucleotide polymorphisms in ABCB11 impair bile salt export pump processing and function or disrupt pre-messenger RNA splicing.
Hepatology. 2009 Feb;49(2):553-67., [PMID:19101985]
Abstract [show]
The gene encoding the human bile salt export pump (BSEP), ABCB11, is mutated in several forms of intrahepatic cholestasis. Here we classified the majority (63) of known ABCB11 missense mutations and 21 single-nucleotide polymorphisms (SNPs) to determine whether they caused abnormal ABCB11 pre-messenger RNA splicing, abnormal processing of BSEP protein, or alterations in BSEP protein function. Using an in vitro minigene system to analyze splicing events, we found reduced wild-type splicing for 20 mutations/SNPs, with normal mRNA levels reduced to 5% or less in eight cases. The common ABCB11 missense mutation encoding D482G enhanced aberrant splicing, whereas the common SNP A1028A promoted exon skipping. Addition of exogenous splicing factors modulated several splicing defects. Of the mutants expressed in vitro in CHO-K1 cells, most appeared to be retained in the endoplasmic reticulum and degraded. A minority had BSEP levels similar to wild-type. The SNP variant A444 had reduced levels of protein compared with V444. Treatment with glycerol and incubation at reduced temperature overcame processing defects for several mutants, including E297G. Taurocholate transport by two assessed mutants, N490D and A570T, was reduced compared with wild-type. Conclusion: This work is a comprehensive analysis of 80% of ABCB11 missense mutations and single-nucleotide polymorphisms at pre-mRNA splicing and protein processing/functional levels. We show that aberrant pre-mRNA splicing occurs in a considerable number of cases, leading to reduced levels of normal mRNA. Thus, primary defects at either the protein or the mRNA level (or both) contribute significantly to BSEP deficiency. These results will help to develop mutation-specific therapies for children and adults suffering from intrahepatic cholestasis due to BSEP deficiency.
Comments [show]
None has been submitted yet.
No. Sentence Comment
68 Continued Exon Nucleotide Change Predicted Protein Effect Location in Protein Associated Phenotype Prevalence or frequency* Any Defect(s) Identified Reference BRIC, 1 family (both hom) 15 c.1757CϾT T586I Adj WB BRIC 1 family (het) No splicing † 15 c.1763CϾT A588V Adj WB PFIC 2 families (both het) No protein 31, 32 15 c.1772AϾG N591S Adj WB SNP-ICP 2.6% 42 15 c.1779TϾA S593R NBF1 PFIC 1 family (het) 29 15 c.1791GϾT V597V NBF1 SNP 2.6% 42 16 c.1880TϾC I627T IC3 PFIC 1 family (het) ‡ 16 c.1964CϾT T655I IC3 BRIC / ICP / DC 1 family (het) Reduced levels of mature protein ‡ 17 c.2029AϾG M677V IC3 SNP 1.6-5.6% 39, 42-45 18 c.2093GϾA R698H IC3 SNP 0.3 - 0.8% 43, 45 18 c.2125GϾA E709K IC3 SNP-PFIC 1 family (het) ‡ 18 c.2130TϾC P710P IC3 SNP-PBC 0.5 - 3.1% 43 20-21 c.2412AϾC A804A TM8 SNP 1.1% 45 20-21 c.2453AϾT Y818F IC4 SNP-PFIC 2 families (hom) Reduced levels of mature protein ‡ 20-21 c.2494CϾT R832C IC4 PFIC 2 families (1 het, 1 consanguineous) Moderate differential splicing 31, 32 20-21 c.2576CϾG T859R IC4 PFIC 1 family (het) 31 22 c.2767AϾC T923P IC5 BRIC 1 family (het) 8 22 c.2776GϾC A926P IC5 BRIC 1 family (het) Mild exon skipping 8 23 c.2842CϾT R948C IC5 PFIC 2 families (both het) Immature protein 31 23 c.2935AϾG N979D TM11 PFIC 1 family (consanguineous) 31 23 c.2944GϾA G982R TM11 PFIC 4 families (1 hom, 1 consanguineous, 2 het) Immature protein 7, 29, 31 23 c.3011GϾA G1004D EC6 PFIC 1 family (hom) 28 24 c.3084AϾG A1028A TM12 SNP-PBC 39.86 - 56.3% Severe exon skipping 8, 43, 45 24 c.3148CϾT R1050C C term BRIC 2 familes (1 hom, 1 het) Immature protein 8 25 c.3329CϾA A1110E Adj WA PFIC 2 familes (both het) Mild exon skipping; immature protein 31 25 c.3346GϾC G1116R WA PFIC / BRIC 1 family (consanguineous) Mild exon skipping ‡ 25 c.3382CϾT R1128C NBF2 PFIC 1 family (consanguineous) Mild exon skipping; immature protein 31 25 c.3383GϾA R1128H NBF2 BRIC 1 family (hom) Mild exon skipping; greatly reduced levels of mature protein 8 26 c.3432CϾA S1144R NBF2 PFIC 1 family (het) Severe differential splicing 29 26 c.3457CϾT R1153C NBF2 PFIC 4 families (2 consanguineous, 2 het) Immature protein 7, 31, 36 26 c.3458GϾA R1153H NBF2 PFIC 4 families (2 consanguineous, 2 het) Severe differential splicing; immature protein 31 26 c.3460TϾC S1154P NBF2 PFIC 1 family (het) Severe differential splicing 31 26 c.3556GϾA E1186K NBF2 SNP 1%-10% Mild exon skipping ‡ 26 c.3589_3590 delCTinsGG L1197G NBF2 BRIC 1 family (het) † 27 c.3628AϾC T1210P Adj ABCm PFIC 1 family (hom) Immature protein 31 27 c.3631AϾG N1211D Adj ABCm SNP-PFIC 1 family (het) ‡ 27 c.3669GϾC E1223D ABCm Prolonged NNH 1 family (het) ‡ 27 c.3683CϾT A1228V Adj ABCm/WB SNP-PBC 0.8% 43 27 c.3691CϾT R1231W Adj ABCm/WB PFIC 1 family (het) Severe exon skipping; immature protein 30, 31 27 c.3692GϾA R1231Q Adj ABCm/WB PFIC 2 families (1 consanguineous, 1 het) No splicing; immature protein 31, 34 27 c.3724CϾA L1242I WB PFIC 1 family (het) 31 28 c.3892GϾA R1268Q¶ NBF2 PFIC 1 family (hom) Immature protein 7 *Prevalence or frequency is quoted depending on how data were presented in the original publication(s).
X
ABCB11 p.Ser1154Pro 19101985:68:2486
status: NEW93 Differential splice products were seen for six predicted ABCB11 missense mutations, leading to very low levels of wild-type splicing (indicated in parentheses): E297K (c.889GϾA; 50%; Fig. 2B), D482G (c.1445AϾG; 5%; Fig. 2C), R832C (c.2494CϾT; 50%; Fig. 2E), and S1144R (c.3432CϾA; 3%), R1153H (c.3458GϾA; 3%), and S1154P (c.3460TϾC; 3%; Fig. 2F).
X
ABCB11 p.Ser1154Pro 19101985:93:344
status: NEW109 The cryptic acceptor splice site in exon 26 has a score of 0.23, according to the Splice Site Prediction by Neural Network program.50,51 The mutations S1144R (c.3432CϾA), R1153H (c.3458GϾA), and S1154P (c.3460TϾC) do not alter the predicted score for use of this site.
X
ABCB11 p.Ser1154Pro 19101985:109:207
status: NEW111 Positive-acting and negative-act- Exon 14 D482G Aberrant product Exon 14Minigene Cryptic acceptor splice Exon 14 CTACCACCATTGCAGAAAATATTCGCTATG ATACCATCATCCCAGAAAATATTCGCTATG ATCTCTTTTCACCCAATTTCTACAGGGCAATGCTGGGGCAAGAT Exon 21Exon 20 R832C Aberrant product AAGGCTACGTAAATTTGGTTTCAGGGCAATGCTGGGGCAAGAT AAGGCTATGTAAATTTGGTTTCAGGGCAATGCTGGGGCAAGAT Exon 21 R832C Exon 21 Cryptic acceptor splice Exon 9 E297K Aberrant product CTGCTTTTGGTGGTGAGAAAAGAGAGGTTGAAAGgttggtta Normal donor splice siteCryptic donor splice site CTGCTTTTGGTGGTAAGAAAAGAGAGGTTGAAAGgttggttaE297K Exon 9 CTGCTTTTGGTGCTGTTCCTCCTCCCACTGACCTGCGATT MinigeneExon 9 Intron 9 Intron 9 S1144R, R1153H, S1154P Aberrant product Exon 26 ATACCATCATCCCAGGAACCAGTGTTGTTTGCCT Exon 26Minigene AATTGTTTCCCAGGAACCAGTGTTGTTTGCCTCAG Cryptic acceptor splice D Fig. 3.
X
ABCB11 p.Ser1154Pro 19101985:111:660
status: NEW112 (A-D) Illustration of variant splice forms associated with ABCB11 mutations (A) E297K, (B) D482G, (C) R832C, and (D) S1144R, R1153H, and S1154P.
X
ABCB11 p.Ser1154Pro 19101985:112:137
status: NEW[hide] Severe bile salt export pump deficiency: 82 differ... Gastroenterology. 2008 Apr;134(4):1203-14. doi: 10.1053/j.gastro.2008.01.038. Epub 2008 Jan 18. Strautnieks SS, Byrne JA, Pawlikowska L, Cebecauerova D, Rayner A, Dutton L, Meier Y, Antoniou A, Stieger B, Arnell H, Ozcay F, Al-Hussaini HF, Bassas AF, Verkade HJ, Fischler B, Nemeth A, Kotalova R, Shneider BL, Cielecka-Kuszyk J, McClean P, Whitington PF, Sokal E, Jirsa M, Wali SH, Jankowska I, Pawlowska J, Mieli-Vergani G, Knisely AS, Bull LN, Thompson RJ
Severe bile salt export pump deficiency: 82 different ABCB11 mutations in 109 families.
Gastroenterology. 2008 Apr;134(4):1203-14. doi: 10.1053/j.gastro.2008.01.038. Epub 2008 Jan 18., [PMID:18395098]
Abstract [show]
BACKGROUND & AIMS: Patients with severe bile salt export pump (BSEP) deficiency present as infants with progressive cholestatic liver disease. We characterized mutations of ABCB11 (encoding BSEP) in such patients and correlated genotypes with residual protein detection and risk of malignancy. METHODS: Patients with intrahepatic cholestasis suggestive of BSEP deficiency were investigated by single-strand conformation polymorphism analysis and sequencing of ABCB11. Genotypes sorted by likely phenotypic severity were correlated with data on BSEP immunohistochemistry and clinical outcome. RESULTS: Eighty-two different mutations (52 novel) were identified in 109 families (9 nonsense mutations, 10 small insertions and deletions, 15 splice-site changes, 3 whole-gene deletions, 45 missense changes). In 7 families, only a single heterozygous mutation was identified despite complete sequence analysis. Thirty-two percent of mutations occurred in >1 family, with E297G and/or D482G present in 58% of European families (52/89). On immunohistochemical analysis (88 patients), 93% had abnormal or absent BSEP staining. Expression varied most for E297G and D482G, with some BSEP detected in 45% of patients (19/42) with these mutations. Hepatocellular carcinoma or cholangiocarcinoma developed in 15% of patients (19/128). Two protein-truncating mutations conferred particular risk; 38% (8/21) of such patients developed malignancy versus 10% (11/107) with potentially less severe genotypes (relative risk, 3.7 [confidence limits, 1.7-8.1; P = .003]). CONCLUSIONS: With this study, >100 ABCB11 mutations are now identified. Immunohistochemically detectable BSEP is typically absent, or much reduced, in severe disease. BSEP deficiency confers risk of hepatobiliary malignancy. Close surveillance of BSEP-deficient patients retaining their native liver, particularly those carrying 2 null mutations, is essential.
Comments [show]
None has been submitted yet.
No. Sentence Comment
150 Missense Mutations in ABCB11 Nucleotide change Predicted effect Exon CpG site Location Change in: Size Charge Hyd/Pol Shape c.149Tb0e;C p.Leu50Ser 4 No NH2 term Y Y Y c.470Ab0e;G p.Tyr157Cys 6 No TM2 Y Y Y c.725Cb0e;T p.Thr242Ile 8 No TM4 Y Y c.890Ab0e;G p.Glu297Gly 9 No IC2 Y Y Y c.908Gb0e;A p.Arg303Lys 9 No IC2 c.937Cb0e;A p.Arg313Ser 10 Yes IC2 Y Y Y Y c.980Gb0e;A p.Gly327Glu 10 No TM5 Y Y Y c.1168Gb0e;C p.Ala390Pro 11 No TM/NBF Y c.1229Gb0e;A p.Gly410Asp 12 No TM/NBF Y Y c.1238Tb0e;G p.Leu413Trp 12 No TM/NBF c.1388Cb0e;T p.Thr463Ile 13 No Adj Walker A Y Y Y c.1396Cb0e;A p.Gln466Lys 13 No Adj Walker A Y c.1409Gb0e;A p.Arg470Gln 13 Yes Adj Walker A Y c.1415Ab0e;G p.Tyr472Cys 13 No Adj Walker A Y Y Y c.1442Tb0e;A p.Val481Glu 14 No NBF1 Y Y Y c.1445Ab0e;G p.Asp482Gly 14 No NBF1 Y Y c.1460Gb0e;C p.Arg487Pro 14 Yes NBF1 Y Y Y Y c.1468Ab0e;G p.Asn490Asp 14 No NBF1 Y c.1535Tb0e;C p.Ile512Thr 14 No NBF1 Y Y Y c.1544Ab0e;C p.Asn515Thr 14 No NBF1 Y Y c.1550Gb0e;A p.Arg517His 14 Yes NBF1 Y Y c.1621Ab0e;C p.Ile541Leu 14 No NBF1 c.1622Tb0e;C p.Ile541Thr 14 No NBF1 Y Y Y c.1643Tb0e;A p.Phe548Tyr 15 No Adj ABC c.1685Gb0e;A p.Gly562Asp 15 No ABC Y Y c.1708Gb0e;A p.Ala570Thr 15 Yes ABC/Walker B Y c.1763Cb0e;T p.Ala588Val 15 No Adj Walker B Y c.2272Gb0e;C p.Gly758Arg 19 No NBF/TM Y Y Y c.2296Gb0e;A p.Gly766Arg 19 Yes TM7 Y Y Y c.2494Cb0e;T p.Arg832Cys 21 Yes IC3 Y Y Y Y c.2576Cb0e;G p.Thr859Arg 21 No IC3 Y Y Y Y c.2842Cb0e;T p.Arg948Cys 23 Yes IC4 Y Y Y Y c.2935Ab0e;G p.Asn979Asp 23 No TM11 Y c.2944Gb0e;A p.Gly982Arg 23 Yes TM11 Y Y Y c.3086Cb0e;A p.Thr1029Lys 24 No TM12 Y Y Y Y c.3329Cb0e;A p.Ala1110Glu 25 Yes Adj Walker A Y Y Y c.3382Cb0e;T p.Arg1128Cys 25 Yes Adj Walker A Y Y Y Y c.3457Cb0e;T p.Arg1153Cys 26 Yes NBF2 Y Y Y Y c.3458Gb0e;A p.Arg1153His 26 Yes NBF2 Y Y c.3460Tb0e;C p.Ser1154Pro 26 No NBF2 Y c.3628Ab0e;C p.Thr1210Pro 27 No Adj ABC Y c.3691Cb0e;T p.Arg1231Trp 27 Yes ABC/Walker B Y Y c.3692Gb0e;A p.Arg1231Gln 27 Yes ABC/Walker B Y c.3724Cb0e;A p.Leu1242Ile 27 No Walker B c.3892Gb0e;A p.Gly1298Arg 28 No NBF2 Y Y Y NOTE.
X
ABCB11 p.Ser1154Pro 18395098:150:1920
status: NEW[hide] The bile salt export pump (BSEP) in health and dis... Clin Res Hepatol Gastroenterol. 2012 Dec;36(6):536-53. doi: 10.1016/j.clinre.2012.06.006. Epub 2012 Jul 12. Kubitz R, Droge C, Stindt J, Weissenberger K, Haussinger D
The bile salt export pump (BSEP) in health and disease.
Clin Res Hepatol Gastroenterol. 2012 Dec;36(6):536-53. doi: 10.1016/j.clinre.2012.06.006. Epub 2012 Jul 12., [PMID:22795478]
Abstract [show]
The bile salt export pump (BSEP) is the major transporter for the secretion of bile acids from hepatocytes into bile in humans. Mutations of BSEP are associated with cholestatic liver diseases of varying severity including progressive familial intrahepatic cholestasis type 2 (PFIC-2), benign recurrent intrahepatic cholestasis type 2 (BRIC-2) and genetic polymorphisms are linked to intrahepatic cholestasis of pregnancy (ICP) and drug-induced liver injury (DILI). Detailed analysis of these diseases has considerably increased our knowledge about physiology and pathophysiology of bile secretion in humans. This review focuses on expression, localization, and function, short- and long-term regulation of BSEP as well as diseases association and treatment options for BSEP-associated diseases.
Comments [show]
None has been submitted yet.
No. Sentence Comment
173 By the use of an in vitro minigene approach, interference with splicing was shown for c.1445A > G (p.D482G), c.1757C > T (p.T586I), c.3432C > A (p.S1144R), c.3458G > A (p.R1153H), c.3460T > C (p.S1154P), c.3691C > T (p.R1231 W) and c.3692G > A (p.R1231Q) [132].
X
ABCB11 p.Ser1154Pro 22795478:173:195
status: NEW185 PFIC BRIC/NFC ICP Other liver diseases Genetic variants without disease association Missense mutations M1V C336S D549V L1055P E135K E137K T87R V43I S701P G19R W342G G556R C1083Y E137K L198P M123T S56L L712L L50S A382G G562D A1110E E186G E297G S194P Q121K A865D M62K R387H A570T S1114R L198P R415Q L198P R128H A865G C68Y A390P L581F G1116E E297G V444A G260D I206V S874P C107R G410D A588V G1116F G374S D482G E297K V284A I939M I112T L413W S593R G1116R A390P N591S V444A G295C R958Q W114R I420T I627T S1120N R432T T655I T510T G295R F959C Y157C D440E E636G R1128C V444A T655I G295S F959V A167T G455E R698C S1144R I498T D676Y R299K T965S A167V K461E S699P R1153C A570T P710P R303K F971L I182K T463I E709K R1153H T586I L827I L339V F971Y M183T Q466K G758R S1154P G648V G855R H423R L1006F M183V R470Q G766R N1173D T655I E1186K V444A N1009H G188W Y472C Y818F T1210P T923P V444D K1145N M217R V481E R832C N1211D A926P V444G I1183T R223C D482G R832H V1212F R948C A459V S226L R487H T859R R1231Q G1004D I468I G238V R487P A865V R1231W R1050C R487L T242I N490D Q869P L1242I G1116R Q546K A257G I498T G877R D1243G R1128H Q558H V284L G499E S901R R1268Q L1197G E592Q E297G I512T R948C A1283V R1231Q V597M R303G N515T N979D G1292V R616G R303K R517H G982R G1298R T619A Q312H F540L G1004D M677L R313S I541L T1029K M677V G327E I541T G1032R R696Q W330R F548Y A1044P R698H Nonsense mutations (premature stop-codons) S25X Y472X Y772X R1090X E96X W493X Q791X V1147X W330X R520X R928X Q1215X Y354X I528X Y1041X R1235X R415X R575X R1057X E1302X R470X Q702X Q1058X Table 1 (Continued) PFIC BRIC/NFC ICP Other liver diseases Genetic variants without disease association Splice site mutations 76 + 3G > T 908 + 1delG 2178 + 1G > T 3057-2A > G Q159Q 77-1G > C 908 + 1G > T 2179-2A > G 3213 + 1delG Q361Q 99-1G > T 908 + 1G > A 2343 + 1G > T 3213 + 4A > G 150 + 3A > C 1435-13 -8del 2343 + 2T > C 3213 + 5G > A 390-1G > A 2012-8T > G 2611-2A > T 611 + 1G > A 2178 + 1G > A R1001R Deletions/insertions/frame shifts Q101Dfs8X L380Wfs18X G648Vfs5X Q1058Hfs38X F959Hfs1X T127Hfs6X A382 A388del K700Sfs12X I1061Vfs34X F959Gfs48X N199Ifs14X P456Pfs24X T919del L1165del L232Cfs9X H484Rfs5X K930Efs92X A1192Efs50X R303Sfs17X I528Sfs21X K930Efs79X T1256Tfs40X V368Rfs27X I610Qfs45X K969 K972del Synonymous variants without disease association R33R F90F L232L I416I G557G I876I A1028A K1145K D36D I134I Y269Y G418G V597V G937G K1070K R52R S136S Q312Q F427F A804A Y981Y T1086T D58D V195V G319G E395E A535A G817G G1004G A1110A The overview shows ࣈ 290 known variants of BSEP on the protein level, except splice site mutations, which are shown on cDNA level.
X
ABCB11 p.Ser1154Pro 22795478:185:748
status: NEW[hide] Genetic variations of bile salt transporters. Drug Discov Today Technol. 2014 Jun;12:e55-67. doi: 10.1016/j.ddtec.2014.03.006. Kubitz R, Droge C, Kluge S, Stindt J, Haussinger D
Genetic variations of bile salt transporters.
Drug Discov Today Technol. 2014 Jun;12:e55-67. doi: 10.1016/j.ddtec.2014.03.006., [PMID:25027376]
Abstract [show]
Bile salt transporters directly or indirectly influence biological processes through physicochemical or signalling properties of bile salts. The coordinated action of uptake and efflux transporters in polarized epithelial cells of the liver, biliary tree, small intestine and kidney determine bile salt concentrations in different compartments of the body. Genetic variations of bile salt transporters lead to clinical relevant phenotypes of varying severity ranging from a predisposition for drug-induced liver injury to rapidly progressing end-stage liver disease. This review focuses on the impact of genetic variations of bile salt transporters including BSEP, NTCP, ASBT and OSTalpha/beta and discusses approaches for transporter analysis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
137 BSEP/Bsep NTCP ASBT Exon skipping E186G G1116R G319G R1128C T463I R1128H A926P E1186K A1028Aa R1231W A1110E Aberrant splicing E297K R1153H R832C S1154P S1144R No splice product T586I R1231Q Reduced plasma membrane expression E135K A570T I223T E297Gb N591Sb V444A R1050C Intracellular retention Y818F G982R Reduced or absent bile salt transport A570T R432T A64T K314E V98Ic M264V I206V Q558H I223T C144Y P290S E297Gb N591Sb S267F L243P G374S E1186K I279T T262M a A1028A induces significant exon skipping in vitro but probably not in vivo (unpublished data; Dro &#a8;ge, Ha &#a8;ussinger, Kubitz).
X
ABCB11 p.Ser1154Pro 25027376:137:145
status: NEW