ABCB11 p.Asp482Gly
Reviews: |
p.Asp482Gly
D
|
Predicted by SNAP2: | A: D (80%), C: D (80%), E: D (85%), F: D (91%), G: D (59%), H: D (91%), I: D (91%), K: D (91%), L: D (91%), M: D (91%), N: D (75%), P: D (91%), Q: D (85%), R: D (91%), S: D (80%), T: D (85%), V: D (91%), W: D (91%), Y: D (91%), |
Predicted by PROVEAN: | A: D, C: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] BSEP: function and role in progressive familial in... Semin Liver Dis. 2001 Nov;21(4):545-50. Thompson R, Strautnieks S
BSEP: function and role in progressive familial intrahepatic cholestasis.
Semin Liver Dis. 2001 Nov;21(4):545-50., [PMID:11745042]
Abstract [show]
Secretion of bile acids is the major driving force for bile flow in mammals. The recently described adenosine triphosphate (ATP)-dependent bile acid transporter, bile salt export pump (BSEP), formerly called sister of p-glycoprotein, is responsible for active transport of bile acids across the hepatocyte canalicular membrane into bile. It is now recognized that mutations in the gene encoding this protein (ABCB11) are responsible for a subgroup of infants and children with progressive familial cholestasis (PFIC-2), a cholestatic disorder causing extreme pruritus, growth failure, and progression to cirrhosis in the first decade of life. Understanding the structure and function of BSEP has improved our understanding of the mechanisms underlying bile secretion. Determining genotype/phenotype relationships in patients with mutations in this gene are currently ongoing.
Comments [show]
None has been submitted yet.
No. Sentence Comment
91 Two mutations, E297G and D482G, are "common" and have been found in 25 and 16 European families, respectively.
X
ABCB11 p.Asp482Gly 11745042:91:25
status: NEW[hide] Bile salt transporters: molecular characterization... Physiol Rev. 2003 Apr;83(2):633-71. Trauner M, Boyer JL
Bile salt transporters: molecular characterization, function, and regulation.
Physiol Rev. 2003 Apr;83(2):633-71., [PMID:12663868]
Abstract [show]
Molecular medicine has led to rapid advances in the characterization of hepatobiliary transport systems that determine the uptake and excretion of bile salts and other biliary constituents in the liver and extrahepatic tissues. The bile salt pool undergoes an enterohepatic circulation that is regulated by distinct bile salt transport proteins, including the canalicular bile salt export pump BSEP (ABCB11), the ileal Na(+)-dependent bile salt transporter ISBT (SLC10A2), and the hepatic sinusoidal Na(+)- taurocholate cotransporting polypeptide NTCP (SLC10A1). Other bile salt transporters include the organic anion transporting polypeptides OATPs (SLC21A) and the multidrug resistance-associated proteins 2 and 3 MRP2,3 (ABCC2,3). Bile salt transporters are also present in cholangiocytes, the renal proximal tubule, and the placenta. Expression of these transport proteins is regulated by both transcriptional and posttranscriptional events, with the former involving nuclear hormone receptors where bile salts function as specific ligands. During bile secretory failure (cholestasis), bile salt transport proteins undergo adaptive responses that serve to protect the liver from bile salt retention and which facilitate extrahepatic routes of bile salt excretion. This review is a comprehensive summary of current knowledge of the molecular characterization, function, and regulation of bile salt transporters in normal physiology and in cholestatic liver disease and liver regeneration.
Comments [show]
None has been submitted yet.
No. Sentence Comment
632 Most but not all of these mutations (C336S and D482G) also abolish bile salt transport activity when assessed in Sf9 cells (54, 314, 375, 376).
X
ABCB11 p.Asp482Gly 12663868:632:47
status: NEW[hide] Molecular basis of intrahepatic cholestasis. Ann Med. 2004;36(8):606-17. Carlton VE, Pawlikowska L, Bull LN
Molecular basis of intrahepatic cholestasis.
Ann Med. 2004;36(8):606-17., [PMID:15768832]
Abstract [show]
Intrahepatic cholestasis, or impairment of bile flow, is an important manifestation of inherited and acquired liver disease. In recent years, human genetic and molecular studies have identified several genes, the disruption of which results in cholestasis. ATP8B1 (FIC1), ABCB11 (BSEP), and ABCB4 (MDR3) are disrupted in forms of progressive familial intrahepatic cholestasis (PFIC) and related disorders. Mutations in BAAT, TJP2 (ZO-2), and EPHX1 have been identified in patients with hypercholanemia. A CLDN1 mutation was recently reported in patients with ichthyosis, leukocyte vacuoles, alopecia and sclerosing cholangitis (ILVASC), and North American Indian childhood cirrhosis (NAIC) is associated with a missense mutation in CIRH1A. Alagille syndrome patients carry mutations in JAG1, and mutations in VPS33B have been identified in patients with arthrogryposis, renal dysfunction and cholestasis syndrome (ARC). Identification of these genes, and characterization of the proteins they encode, is enhancing our understanding of the biology of the enterohepatic circulation in health and disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
144 Several ABCB11 mutations have been functionally characterized in vitro, revealing that at least one ABCB11 mutation, D482G (common in patients of Polish ethnicity) may represent only a partial loss of function (39).
X
ABCB11 p.Asp482Gly 15768832:144:117
status: NEW[hide] Two common PFIC2 mutations are associated with the... Hepatology. 2005 Apr;41(4):916-24. Hayashi H, Takada T, Suzuki H, Akita H, Sugiyama Y
Two common PFIC2 mutations are associated with the impaired membrane trafficking of BSEP/ABCB11.
Hepatology. 2005 Apr;41(4):916-24., [PMID:15791618]
Abstract [show]
Progressive familial intrahepatic cholestasis type 2 (PFIC2) is caused by a mutation in the bile salt export pump (BSEP/ABCB11) gene. However, the mechanisms for the deficiency in the function of two mutations (E297G and D482G), which are frequently found in European patients, have not yet been identified. In the present study, we examined the transport activity and cellular localization of these two mutants in human embryonic kidney 293 and Madin-Darby canine kidney II cells, respectively. Introduction of E297G and D482G mutations into the human BSEP gene by site-directed mutagenesis resulted in a significant reduction in the BSEP expression level, which was associated with impaired membrane trafficking. Most of the D482G BSEP and some of the E297G BSEP underwent only core glycosylation and appeared to be predominantly located in the endoplasmic reticulum. The inhibition of proteasome function by MG132 resulted in the cellular accumulation of the core glycosylation form of the two mutants. In contrast, transport studies for taurocholate and glycocholate with membrane vesicles isolated from complementary DNA-transfected cells indicated that both mutations did not significantly affect the transport function of BSEP per se. In conclusion, E297G and D482G mutations result in impaired membrane trafficking, whereas the transport functions of these mutants remain largely unchanged.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 However, the mechanisms for the deficiency in the function of two mutations (E297G and D482G), which are frequently found in European patients, have not yet been identified.
X
ABCB11 p.Asp482Gly 15791618:1:87
status: NEW3 Introduction of E297G and D482G mutations into the human BSEP gene by site-directed mutagenesis resulted in a significant reduction in the BSEP expression level, which was associated with impaired membrane trafficking.
X
ABCB11 p.Asp482Gly 15791618:3:26
status: NEW4 Most of the D482G BSEP and some of the E297G BSEP underwent only core glycosylation and appeared to be predominantly located in the endoplasmic reticulum.
X
ABCB11 p.Asp482Gly 15791618:4:12
status: NEW7 In conclusion, E297G and D482G mutations result in impaired membrane trafficking, whereas the transport functions of these mutants remain largely unchanged.
X
ABCB11 p.Asp482Gly 15791618:7:25
status: NEW9 T he efficient biliary excretion of monovalent bile acids is mediated by the bile salt export pump (BSEP/ABCB11), an ATP-binding cassette transmembrane transporter located on the bile canalicular membrane.1 The function of BSEP/ABCB11 has been clarified by examining the adenosine triphosphate (ATP)- dependent transport of monovalent bile acids (such as taurocholic acid) in isolated bile canalicular membrane vesicles and/or membrane vesicles isolated from cells transfected with the complementary DNA (cDNA) for BSEP.2,3 Many studies have also been performed in patients and it has been shown that the hereditary defect in the expression of BSEP results in the acquisition of progressive familial intrahepatic cholestasis type 2 (PFIC2).4,5 Genomic analysis of PFIC2 patients has revealed that many kinds of missense, premature termination, frame shift, and splicing junction mutations are associated with the BSEP gene.4 Among these, E297G and D482G, two missense mutations in the second intracellular loop and in the first ATP-binding domain, respectively, are frequently observed in PFIC2 patients.
X
ABCB11 p.Asp482Gly 15791618:9:948
status: NEW23 In addition, the mechanism remains to be clarified for other important mutations, including D482G, which is very common in European PFIC2 patients.
X
ABCB11 p.Asp482Gly 15791618:23:92
status: NEW28 We focused particularly on E297G and D482G mutations, which are frequently found in European PFIC2 patients.6 Materials and Methods Materials.
X
ABCB11 p.Asp482Gly 15791618:28:37
status: NEW44 For the determination of BSEP messenger RNA (mRNA) levels, MDCK II cells were seeded 24 hours before infection at a density of 1.3 ϫ 106 cells per 10-cm dish and were infected with recombinant adenoviruses containing wild-type, E297G, and D482G BSEP cDNA at a multiplicity of infection (MOI) of 50.
X
ABCB11 p.Asp482Gly 15791618:44:245
status: NEW67 To determine the localization of BSEP, MDCK II cells were seeded on glass coverslips 24 hours before infection at a density of 3 ϫ 105 cells/well in 12-well plates and were infected with recombinant adenoviruses at 25 MOI (wild-type and E297G BSEP) or 250 MOI (D482G BSEP).
X
ABCB11 p.Asp482Gly 15791618:67:267
status: NEW74 To examine the cellular localization and transport function of the two mutants (E297G and D482G), we constructed recombinant adenoviruses containing wild-type and mutated BSEP cDNA.
X
ABCB11 p.Asp482Gly 15791618:74:90
status: NEW87 Although the wild-type BSEP was detected as approximately 170 kDa, D482G BSEP was detected as approximately 150 kDa.
X
ABCB11 p.Asp482Gly 15791618:87:67
status: NEW90 These results suggest that D482G BSEP and some of the E297G BSEP molecules are present as immature endoplasmic reticulum (ER)-resident forms.
X
ABCB11 p.Asp482Gly 15791618:90:27
status: NEW93 Although wild-type BSEP is predominantly localized in the apical membrane at 25 MOI (Fig. 3A), there was very little expression of D482G BSEP in most cells at 25 MOI because of the low expression level, as suggested by Western blot analysis (see Fig. 2A).
X
ABCB11 p.Asp482Gly 15791618:93:131
status: NEW94 An increase in the MOI to 250 resulted in significant expression of D482G BSEP, suggesting that D482G BSEP are expressed intracellularly (see Fig. 3A).
X
ABCB11 p.Asp482Gly 15791618:94:68
status: NEWX
ABCB11 p.Asp482Gly 15791618:94:96
status: NEW99 Cell surface BSEP was detected in wild-type and E297G-expressing MDCK II cells as the mature form, whereas no D482G BSEP molecules were detectable on the cell surface (Fig. 3B).
X
ABCB11 p.Asp482Gly 15791618:99:110
status: NEW100 This result is also consistent with the results of the Western blot analysis of the whole cell lysate in which the mature form of D482G BSEP was not detectable (see Fig. 3B).
X
ABCB11 p.Asp482Gly 15791618:100:130
status: NEW102 It has been reported that proteasomes play an important role in the degradation of incompletely folded and misfolded protein retained in the ER.17,18 Because the expression levels of E297G and D482G BSEP were lower than that of the wild-type BSEP-and because it is possible that these mutants are localized in the ER-proteasomes may be responsible for their degradation.
X
ABCB11 p.Asp482Gly 15791618:102:193
status: NEW103 To examine this hypothesis, cells were treated with 5 mol/L MG132, a specific proteasome inhibitor, for 8 hours, and its effects on E297G and D482G BSEP were examined via Western blot anasysis.
X
ABCB11 p.Asp482Gly 15791618:103:150
status: NEW104 Western blot analysis showed that MG132 treatment caused the accumulation of immature forms (150 kDa), particularly in E297G and D482G BSEP-expressing MDCK II cells (Fig. 4).
X
ABCB11 p.Asp482Gly 15791618:104:129
status: NEW106 It was found that MG132 treatment resulted in an increase in the number of wild-type, E297G, and D482G BSEP-expressing cells, and the degree of increase was particularly high for the latter two; in the absence of MG132, the number of E297G BSEP-expressing cells after adenovirus infection was only approximately 25% of those expressing wild-type BSEP, and only a minimal number of cells expressed D482G BSEP.
X
ABCB11 p.Asp482Gly 15791618:106:97
status: NEWX
ABCB11 p.Asp482Gly 15791618:106:397
status: NEW107 In contrast, in the presence of MG132, the number of cells expressing E297G and D482G BSEP was almost the same as that in wild-type BSEP-expressing cells after infection of adenoviruses at the same MOI (data not shown).
X
ABCB11 p.Asp482Gly 15791618:107:80
status: NEW108 In the presence of MG132, E297G and D482G BSEP were predominantly expressed in the intracellular compartment, which is the same as that observed under control conditions (see Fig. 3A).
X
ABCB11 p.Asp482Gly 15791618:108:36
status: NEW115 (A) Results of Western blot analysis with crude membrane fraction prepared from MDCK II cells. MDCK II cells were infected with recombinant adrenoviruses at 250 MOI 48 hours before the experiments. Crude membrane fractions prepared from GFP (control), wild-type, E297G, and D482G BSEP-expressing MDCK II cells (80, 40, 80, and 80 g protein, respectively) were analyzed.
X
ABCB11 p.Asp482Gly 15791618:115:274
status: NEW120 Before the transport experiments, the expression level of BSEP was compared among the isolated membrane vesicles expressing wild-type, E297G, and D482G BSEP.
X
ABCB11 p.Asp482Gly 15791618:120:146
status: NEW121 D482G BSEP, as well as wild-type and E297G BSEP, were detected as approximately 170-kDa bands in isolated membrane vesicles (Fig. 5A).
X
ABCB11 p.Asp482Gly 15791618:121:0
status: NEW122 The band density of the 170-kDa form of E297G and D482G in the isolated membrane vesicles was approximately 25% and 10% of wild-type BSEP, respectively (Fig. 5B).
X
ABCB11 p.Asp482Gly 15791618:122:50
status: NEW124 The ATP-dependent uptake of taurocholate and glycocholate by wild-type, E297G and D482G BSEP-expressing isolated membrane vesicles was much higher than that by GFP-expressing vesicles (Fig. 6A).
X
ABCB11 p.Asp482Gly 15791618:124:82
status: NEW125 By normalizing the BSEP expression levels in the isolated membrane vesicles based on the results of Western blot analysis (see Fig. 5B), it was demonstrated that the transport of taurocholate and glycocholate mediated per unit mass of E297G and D482G BSEP molecules was not significantly different from that by wild-type BSEP (Figs. 5B and 6B).
X
ABCB11 p.Asp482Gly 15791618:125:245
status: NEW127 Wild-type, E297G, and D482G BSEP-mediated initial ATP-dependent uptake rates were saturable with apparent Km values of 4.61 Ϯ 0.91, 5.41 Ϯ 0.27, and 14.3 Ϯ 2.0 mol/L, respectively (Fig. 6C).
X
ABCB11 p.Asp482Gly 15791618:127:22
status: NEW128 The maximum taurocholate transport velocity (Vmax) for wild-type, E297G, and D482G BSEP were 2310 Ϯ 220, 485 Ϯ 15, and 761 Ϯ 60 pmol/min/mg isolated membrane vesicle protein, respectively.
X
ABCB11 p.Asp482Gly 15791618:128:77
status: NEW132 MDCK II cells were infected with the recombinant adenoviruses at 25 MOI (wild-type and E297G BSEP) or 250 MOI (D482G BSEP) 48 hours before the experiments.
X
ABCB11 p.Asp482Gly 15791618:132:111
status: NEW140 mass of E297G and D482G BSEP molecules was calculated to be 94% and 329%, respectively, of wild-type BSEP.
X
ABCB11 p.Asp482Gly 15791618:140:18
status: NEW141 Discussion In the present study, we analyzed the consequence of two frequently found PFIC2 mutations (E297G and D482G) in vitro to investigate the pathogenesis of PFIC2.
X
ABCB11 p.Asp482Gly 15791618:141:112
status: NEW143 Although quantitative PCR showed no difference in mRNA levels between the wild-type and two mutated BSEP (see Fig. 1), Western blot analysis indicated reduced expression of D482G and E297G BSEP (see Fig. 2A).
X
ABCB11 p.Asp482Gly 15791618:143:173
status: NEW144 In addition, the molecular weight of most of the D482G BSEP and some of the E297G molecules was approximately 150 kDa (see Fig. 2A).
X
ABCB11 p.Asp482Gly 15791618:144:49
status: NEW147 This suggestion is also consistent with the immunofluorescence observations which indicated that D482G and E297G BSEP molecules are located intracellularly (see Fig. 3A).
X
ABCB11 p.Asp482Gly 15791618:147:97
status: NEW148 The results of the surface biotinylation study also suggested that the D482G BSEP and core glycosylated form of E297G BSEP are located intracellularly (see Fig. 3B).
X
ABCB11 p.Asp482Gly 15791618:148:71
status: NEW149 In addition, the results of the MG132 treatment experiment suggested that E297G and D482G BSEP molecules are degraded by the proteasome pathway (see Fig. 4).
X
ABCB11 p.Asp482Gly 15791618:149:84
status: NEW156 Western blot analysis of the isolated membrane vesicles indicated the presence of approximately 170-kDa molecules for wild-type, E297G, and D482G BSEP.
X
ABCB11 p.Asp482Gly 15791618:156:140
status: NEW157 Moreover, it was found that the amount of 150-kDa molecules for E297G and D482G BSEP in the isolated membrane vesicles was lower than that in the crude membrane fraction.
X
ABCB11 p.Asp482Gly 15791618:157:74
status: NEW163 Effects of proteasome inhibitors on the localization of BSEP in MDCK II cells. MDCK II cells were infected with recombinant adenoviruses at 250 MOI 48 hours before the experiments. Crude membrane fractions prepared from GFP (control), wild-type, E297G, and D482G BSEP-expressing MDCK II cells (80, 40, 80, and 80 g protein, respectively), treated with or without 5 mol/L MG132 for 8 hours before the preparation of crude membrane, were subjected to Western blot analysis.
X
ABCB11 p.Asp482Gly 15791618:163:257
status: NEW165 Functional analysis using these membrane vesicles indicated that the transport of taurocholate and glycocholate in E297G and D482G BSEP-expressing isolated membrane vesicles was significantly higher than that in control isolated membrane vesicles (see Fig. 6A).
X
ABCB11 p.Asp482Gly 15791618:165:125
status: NEW166 Based on the hypothesis that the transport activity per unit mass of BSEP molecules can be calculated by considering the BSEP expression level in the isolated membrane vesicles, it was found that the transport of taurocholate and glycocholate mediated per unit mass of E297G and D482G BSEP molecules was not reduced compared with wild-type BSEP (see Figs. 5B and 6B).
X
ABCB11 p.Asp482Gly 15791618:166:279
status: NEW167 The Km values for taurocholate of wild-type, E297G, and D482G BSEP molecules were consistent with previous observations obtained using membrane vesicles isolated from human wild-type BSEP cDNA-infected Sf9 and Sf High Five cells.2,3 Based on these results, it appears that the transport function of two mutated BSEP molecules (E297G and D482G) per se remains normal (see Fig. 6).
X
ABCB11 p.Asp482Gly 15791618:167:56
status: NEWX
ABCB11 p.Asp482Gly 15791618:167:337
status: NEW168 These results suggest that, if E297G and D482G are matured and consequently expressed on the membrane surface, these mutated transporters are able to transport BSEP substrates.
X
ABCB11 p.Asp482Gly 15791618:168:41
status: NEW169 Our results using mutated human BSEP were different fromthosereportedinapreviousstudy,inwhichthecauseof PFIC2wasexaminedusingmutatedratBsep,7 buttheywere consistentwiththosereportedrecently,inwhichtheeffectof D482G mutation was examined using mouse Bsep.8 In the study using rat Bsep gene, the pathogenic mechanism for the D482G mutation was not identified because D482G rat Bsep is localized in the apical membrane as well as the cytoplasm of MDCK cells, and this mutation did not significantly affect taurocholate transport examined using Fig. 5.
X
ABCB11 p.Asp482Gly 15791618:169:209
status: NEWX
ABCB11 p.Asp482Gly 15791618:169:323
status: NEWX
ABCB11 p.Asp482Gly 15791618:169:365
status: NEW174 5 g (upper lane), 15 g (middle lane) and 30 g (lower lane) protein of isolated membrane vesicles prepared from GFP (control), wild-type, E297G and D482G BSEP-expressing HEK 293 cells were subjected to Western blot analysis.
X
ABCB11 p.Asp482Gly 15791618:174:171
status: NEW176 The results for wild-type (F), E297G (E), and D482G (■) BSEP are shown.
X
ABCB11 p.Asp482Gly 15791618:176:46
status: NEW177 (C) Results of Western blot analysis using crude membrane fraction and isolated membrane vesicles prepared from GFP (control), wild-type, E297G, and D482G BSEP-expressing HEK 293 cells (50, 20, 75, and 75 g protein, respectively).
X
ABCB11 p.Asp482Gly 15791618:177:149
status: NEW179 membranevesiclesisolatedfromSf9cells.7 Incontrast,inthe study with mouse Bsep gene, it was found that D482G mutation resulted in impaired canalicular trafficking in HepG2 cells, although this mutation did not affect the transport of taurocholate examined using membrane vesicles isolated from Sf21 cells.8 Concerning E297G mutation, it has been shownthatE297GratBsepiswidelydistributedthroughout the cytoplasm, and the studies using isolated membrane vesicles indicated that this mutation resulted in the loss of taurocholate transport activity.7 The differences among these results involving the previous mutated rat Bsep, mouse Bsep, and the present mutated human BSEP may be explained by considering the species difference in the Bsep/BSEP sequence, although the homology of the amino acid sequence around E297G and D482G is quite high as far as human BSEPandratandmouseBsepareconcerned.Forexample,it is still possible that the introduction of the D482G mutation to human BSEP, but not rat Bsep, results in a conformational change in human BSEP so that D482G BSEP is bound to some molecular chaperons.
X
ABCB11 p.Asp482Gly 15791618:179:102
status: NEWX
ABCB11 p.Asp482Gly 15791618:179:819
status: NEWX
ABCB11 p.Asp482Gly 15791618:179:951
status: NEWX
ABCB11 p.Asp482Gly 15791618:179:1056
status: NEW180 The features of D482G BSEP resemble those of the CFTR ⌬F508 mutant in that the deletion of phenylalanine at 508 results in the accumulation of the mutated protein in the ER followed by proteasome degradation.
X
ABCB11 p.Asp482Gly 15791618:180:16
status: NEW182 One of the methods being explored as a potential treatment of CFTR ⌬F508 patients is to administer drugs (such as sodium 4-phenylbutyrate) which are capable of trafficking the mutated protein to the apical membrane by inhibiting the binding to the molecular chaperons in the ER.21-23 After clarifying the mechanism for the intracellular retention of E297G and D482G BSEP, it is possible to identify agents able to target these mutated BSEP molecules to the apical surface.
X
ABCB11 p.Asp482Gly 15791618:182:367
status: NEW184 In conclusion, the results of the present in vitro study suggest that E297G and D482G, which are frequently observed PFIC2 mutations, cause deficient BSEP maturation, although the transport functions of these mutants per se remain almost normal.
X
ABCB11 p.Asp482Gly 15791618:184:80
status: NEW[hide] Expression and localization of hepatobiliary trans... Hepatology. 2005 May;41(5):1160-72. Keitel V, Burdelski M, Warskulat U, Kuhlkamp T, Keppler D, Haussinger D, Kubitz R
Expression and localization of hepatobiliary transport proteins in progressive familial intrahepatic cholestasis.
Hepatology. 2005 May;41(5):1160-72., [PMID:15841457]
Abstract [show]
Mutations of the bile salt export pump (BSEP) or the multidrug resistance P-glycoprotein 3 (MDR3) are linked to impaired bile salt homeostasis and lead to progressive familial intrahepatic cholestasis (PFIC)-2 and -3, respectively. The regulation of bile salt transporters in PFIC is not known. Expression of hepatobiliary transporters in livers of ten patients with a PFIC phenotype was studied by quantitative reverse transcription polymerase chain reaction, Western blotting, and immunofluorescence microscopy. PFIC was diagnosed by clinical and laboratory findings. All patients could be assigned to PFIC-2 or PFIC-3 by the use of BSEP- and MDR3-specific antibodies and by MDR3 gene-sequencing. Whereas in all PFIC-2 patients, BSEP immunoreactivity was absent from the canalicular membrane, in three PFIC-3 livers, canalicular MDR3 immunoreactivity was detectable. Serum bile salts were elevated to 276 +/- 233 and to 221 +/- 109 micromol/L in PFIC-2 and PFIC-3, respectively. Organic anion transporting polypeptide OATP1B1, OATP1B3, and MRP2 mRNA and protein levels were reduced, whereas sodium taurocholate cotransporting polypeptide (NTCP) was only reduced at the protein level, suggesting a posttranscriptional NTCP regulation. Whereas MRP3 mRNA and protein were not significantly altered, MRP4 messenger RNA and protein were significantly increased in PFIC. In conclusion, PFIC-2 may be reliably diagnosed by immunofluorescence, whereas the diagnosis of PFIC-3 requires gene-sequencing. Several mechanisms may contribute to elevated plasma bile salts in PFIC: reduced bile salt uptake via NTCP, OATP1B1, and OATP1B3, decreased BSEP-dependent secretion into bile, and increased transport back into plasma by MRP4. Upregulation of MRP4, but not of MRP3, might represent an important escape mechanism for bile salt extrusion in PFIC.
Comments [show]
None has been submitted yet.
No. Sentence Comment
166 Defective BSEP targeting as an important mechanism underlying PFIC-2 was reported recently: 5 of 7 mutations prevented rat Bsep from trafficking to the apical membrane.37 Similarly, increased intracellular degradation and reduced canalicular targeting of mouse Bsep carrying the common D482G mutation was demonstrated recently.38 MDR3 immunofluorescence is of limited value in the diagnosis of PFIC-3, as shown by the association of disease-causing MDR3 mutations and normal canalicular MDR3 localization.
X
ABCB11 p.Asp482Gly 15841457:166:286
status: NEW[hide] Benign recurrent intrahepatic cholestasis associat... J Clin Gastroenterol. 2006 Feb;40(2):171-5. Kubitz R, Keitel V, Scheuring S, Kohrer K, Haussinger D
Benign recurrent intrahepatic cholestasis associated with mutations of the bile salt export pump.
J Clin Gastroenterol. 2006 Feb;40(2):171-5., [PMID:16394881]
Abstract [show]
A young patient with recurrent attacks of intrahepatic cholestasis is described. On the basis of clinical presentation, laboratory findings and genetic analysis, the diagnosis of benign recurrent intrahepatic cholestasis type 2 (BRIC-2) was established. By the use of BSEP-specific antibodies, almost complete absence of BSEP from the canalicular membrane of liver cells was detected in the patient. Two different BSEP mutations were found. One mutation (E186G) had been described in one BRIC-2 case; the second mutation (V444A) is more frequent and has been linked to intrahepatic cholestasis of pregnancy. It is concluded that this form of compound heterozygosity of the BSEP gene reduces the amount of BSEP protein due to protein instability or mis-targeting, which is the underlying reason for reduced bile salt excretion and cholemia.
Comments [show]
None has been submitted yet.
No. Sentence Comment
80 This might include protein misfolding and increased ER-associated degradation of BSEP as shown for some frequent BSEP mutations underlying PFIC-2.28,29 Other possibilities of reduced protein amounts of BSEP are an increased retention of BSEP within the secretory pathway11 or an increased vesicular retrieval of BSEP from the canalicular membrane as described in animal models of cholestasis.30,31 Targeting defects might be even more important than alteration in transporter activity as shown for the most frequent PFIC-2 mutations E297G and D482G.32 Cholestatic episodes of the patient were triggered by infections.16,33,34 These infections might induce cell stress,35,36 which might be the reason for protein instability and improper trafficking.
X
ABCB11 p.Asp482Gly 16394881:80:543
status: NEW[hide] Cholestasis and cholestatic syndromes. Curr Opin Gastroenterol. 2006 May;22(3):209-14. Rutherford AE, Pratt DS
Cholestasis and cholestatic syndromes.
Curr Opin Gastroenterol. 2006 May;22(3):209-14., [PMID:16550034]
Abstract [show]
PURPOSE OF REVIEW: This review highlights recent advances in understanding the regulation of bile acid transport in cholestasis and in the pathogenesis, outcomes, epidemiology, and treatment of a variety of cholestatic liver diseases and their associated complications. RECENT FINDINGS: Highlights include additional understanding of the role of the nuclear receptors farsenoid X receptor, pregnane X receptor, and constitutive androstane receptor in bile acid homeostasis, new understanding of the pathogenesis of primary biliary cirrhosis, familial intrahepatic cholestasis, biliary atresia, and primary sclerosing cholangitis, and clinical trials of therapies for intrahepatic cholestasis of pregnancy, primary biliary cirrhosis, and primary sclerosing cholangitis. SUMMARY: Our understanding of the molecular mechanisms, epidemiology and pathogenesis of cholestasis continues to advance. These advances will hopefully lead to more effective therapies for specific cholestatic conditions.
Comments [show]
None has been submitted yet.
No. Sentence Comment
38 Of these, two missense mutations (E297G and D482G) are present in 30% of European PFIC2 families.
X
ABCB11 p.Asp482Gly 16550034:38:44
status: NEW[hide] Hepatocellular carcinoma in ten children under fiv... Hepatology. 2006 Aug;44(2):478-86. Knisely AS, Strautnieks SS, Meier Y, Stieger B, Byrne JA, Portmann BC, Bull LN, Pawlikowska L, Bilezikci B, Ozcay F, Laszlo A, Tiszlavicz L, Moore L, Raftos J, Arnell H, Fischler B, Nemeth A, Papadogiannakis N, Cielecka-Kuszyk J, Jankowska I, Pawlowska J, Melin-Aldana H, Emerick KM, Whitington PF, Mieli-Vergani G, Thompson RJ
Hepatocellular carcinoma in ten children under five years of age with bile salt export pump deficiency.
Hepatology. 2006 Aug;44(2):478-86., [PMID:16871584]
Abstract [show]
Hepatocellular carcinoma (HCC) is rare in young children. We attempted to see if immunohistochemical and mutational-analysis studies could demonstrate that deficiency of the canalicular bile acid transporter bile salt export pump (BSEP) and mutation in ABCB11, encoding BSEP, underlay progressive familial intrahepatic cholestasis (PFIC)--or "neonatal hepatitis" suggesting PFIC--that was associated with HCC in young children. We studied 11 cases of pediatric HCC in the setting of PFIC or "neonatal hepatitis" suggesting PFIC. Archival liver were retrieved and immunostained for BSEP. Mutational analysis of ABCB11 was performed in leukocyte DNA from available patients and parents. Among the 11 nonrelated children studied aged 13-52 months at diagnosis of HCC, 9 (and a full sibling, with neonatal hepatitis suggesting PFIC, of a tenth from whom liver was not available) had immunohistochemical evidence of BSEP deficiency; the eleventh child did not. Mutations in ABCB11 were demonstrated in all patients with BSEP deficiency in whom leukocyte DNA could be studied (n = 7). These mutations were confirmed in the parents (n = 14). With respect to the other 3 children with BSEP deficiency, mutations in ABCB11 were demonstrated in all 5 parents in whom leukocyte DNA could be studied. Thirteen different mutations were found. In conclusion, PFIC associated with BSEP deficiency represents a previously unrecognized risk for HCC in young children. Immunohistochemical evidence of BSEP deficiency correlates well with demonstrable mutation in ABCB11.
Comments [show]
None has been submitted yet.
No. Sentence Comment
66 Patients, Clinical Courses, and ABCB11 / BSEP Mutations Patient/Gender; Origins Sibling(s) With PFIC Age, PFIC Manifest Intervention(s) Age, HCC Diagnosed Outcome to Date Nucleotide Changes Predicted Consequences A/Male; Northern European Caucasian 0 Cholestasis from 3 wk Hepatocyte infusion, 16 mo 21 mo (incidental in explant; AFP 199, nl Ͻ 7), at LT Healthy (2 y, 8 mo after LT) 1939delA/IVS16-8TϾG (compound heterozygote) 647K then VFTSLX/ splice site disruption B/Female; Northern European Caucasian 0 Cholestasis from 2 wk, hospitalized for evaluation aged 12 wk None 28 mo, at open biopsy; AFP not determined Palliative care only; death aged 33 mo IVS18ϩ1GϾA/74CϾA (compound heterozygote) Splice site disruption/ S25X C/Male; Northern European Caucasian 0 Cholestasis from birth None 23 mo (AFP 30k, nl Ͻ 5; liver mass); histologic diagnosis at necropsy, 24 mo Palliative care only; death aged 24 mo 1445AϾG/3691CϾT (compound heterozygote) D482G/R1231W D/Male; Northern European Caucasian 1 Cholestasis from 3 wk Partial external biliary diversion (PEBD), 11 mo; decreased pruritus temporarily, clinical-laboratory test results and growth no better 22 mo (AFP 158k, nl Ͻ 15); liver mass; lung and bone lesions; chemotherapy given; histologic diagnosis at LT, 25 mo Death, 6 d after LT (sepsis; no HCC at necropsy) 890AϾG/890AϾG (homozygote) E297G/E297G E/Male; Northern European Caucasian 1 Growth failure from 6 mo; diagnosed 9.5 mo PEBD, 10 mo; no response 29 mo (incidental in explant; AFP 6.4k, nl Ͻ 9), at LT Healthy (5 y, 10 mo after LT) IVS7ϩ1GϾA/890AϾG (compound heterozygote) Splice site disruption/ E297G F/Male; Northern European Caucasian 1 Cholestasis from 6 wk None 16 mo (clinically unsuspected), at necropsy; AFP not determined Death with metastatic HCC in lungs IVS9ϩ1GϾT/not known Splice site disruption/ not known G/Female; Arabic 3 Cholestasis from 6 wk None 15 mo (AFP 11k, nl Ͻ 7; liver mass); histologic diagnosis at LT, 16 mo Healthy (1 y, 7 mo after LT) 1416TϾA/1416TϾA (homozygote) Y472X/Y472X H/Male; Northern European Caucasian 0 Evaluation at 6 mo for jaundice and growth failure PEBD, 32 mo; excellent response (pruritus resolved, bile salts in serum normal range, growth resumed) 52 mo (marked increase in abdominal size; tumor metastasized at diagnosis; AFP 2x106, nl Ͻ 9), at open biopsy Palliative care only; death 3 wk after diagnosis 890 AϾG/ IVS13del-13ˆ-8 (compound heterozygote) E297G/splice site disruption I/Male; Central Asian Caucasian 0 Cholestasis from birth None 13 mo (incidental in explant; AFP 831, nl Ͻ 23), at LT Healthy (1 y, 11 mo after LT) IVS19ϩ2TϾC (homozygote) Splice site disruption J/Male; Central Asian Caucasian 0 Cholestasis from 1 wk None 14 mo (AFP 4k, nl Ͻ 23; liver mass), at biopsy; confirmed at LT, 15 mo Healthy (1 y, 2 mo after LT) 2316TϾG (homozygote) Y772X K/Male; Northern European Caucasian 3 Cholestasis from 3 mo None 26 mo (marked increase in abdominal size; tumor metastasized at diagnosis; AFP not measured), at open biopsy Death with metastatic HCC in lungs, aged 27 mo None sought None predicted Fig. 1.
X
ABCB11 p.Asp482Gly 16871584:66:996
status: NEW138 The common Polish mutation 1445AϾG (D482G)8 was present in one parent of a patient from whom leukocytes were not available (patient C).
X
ABCB11 p.Asp482Gly 16871584:138:42
status: NEW177 Among the missense changes is 1 in exon 27 (patient C); those in patients D, E, and H (890AϾG [E297G], exon 9) and the other mutation in patient C (1445AϾG [D482G], exon 14) have been described previously.8 The 890AϾG (E297G) and 1445AϾG (D482G) mutations reportedly affect BSEP transport activity,21,33 with altered trafficking of BSEP to the canalicular membrane.33-35 The mutation in patient C, 3691CϾT (R1231W), is predicted to alter an amino acid residue between the ATP-binding cassette signature motif and the Walker B motif of BSEP.
X
ABCB11 p.Asp482Gly 16871584:177:169
status: NEWX
ABCB11 p.Asp482Gly 16871584:177:263
status: NEW185 Also of interest is the presence among our patients of the 890AϾG (E297G) mutation (patient D, homozygous; patients E and H, heterozygous) and the 1445AϾG (D482G) mutation (patient C, heterozy- gous).
X
ABCB11 p.Asp482Gly 16871584:185:168
status: NEW218 Note Added in Proof: The liver of yet another child with PFIC and hepatocellular carcinoma46 (3 years, 5 months of age at transplant hepatectomy) does not express BSEP; the common Polish mutation 1445AϾG(D482G)8 is present in one copy of ABCB11.
X
ABCB11 p.Asp482Gly 16871584:218:210
status: NEW[hide] The bile salt export pump. Pflugers Arch. 2007 Feb;453(5):611-20. Epub 2006 Oct 19. Stieger B, Meier Y, Meier PJ
The bile salt export pump.
Pflugers Arch. 2007 Feb;453(5):611-20. Epub 2006 Oct 19., [PMID:17051391]
Abstract [show]
Canalicular secretion of bile salts mediated by the bile salt export pump Bsep constitutes the major driving force for the generation of bile flow. Bsep is a member of the B-family of the super family of ATP-binding cassette transporters and is classified as ABCB11. Bsep has a narrow substrate specificity, which is largely restricted to bile salts. Bsep is extensively regulated at the transcriptional and posttranscriptional level, which directly modulates canalicular bile formation. Pathophysiological alterations of Bsep by either inherited mutations or acquired processes such as inhibition by drugs or disease-related down regulation may lead to a wide spectrum of mild to severe forms of liver disease. Furthermore, many genetic variants of Bsep are known, some of which potentially render individuals susceptible to acquired forms of liver disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
160 Their bile flow rate is slightly but not significantly lower in comparison to controls, but the total bile salt output into bile is massively reduced and their liver bile salt concen- S114R G238V V284L* C336S D482G R487H S593R E636G G982R G1004D R1153CD R1268Q E186G E297G R432T I498T I498T T923P A926P R1050C R1128H S194P G260D N519S A1228V V444A K461E M677V R698H PFIC2 BRIC2 acquired cholestasis SNP Fig. 2 Putative secondary structure of Bsep (NT-005403) generated with the TOPO program (http://www.sacs.ucsf.edu/TOPO-run/wtopo.pl).
X
ABCB11 p.Asp482Gly 17051391:160:209
status: NEW[hide] Two N-linked glycans are required to maintain the ... Am J Physiol Gastrointest Liver Physiol. 2007 Mar;292(3):G818-28. Epub 2006 Nov 2. Mochizuki K, Kagawa T, Numari A, Harris MJ, Itoh J, Watanabe N, Mine T, Arias IM
Two N-linked glycans are required to maintain the transport activity of the bile salt export pump (ABCB11) in MDCK II cells.
Am J Physiol Gastrointest Liver Physiol. 2007 Mar;292(3):G818-28. Epub 2006 Nov 2., [PMID:17082223]
Abstract [show]
The aim of this study was to determine the role of N-linked glycosylation in protein stability, intracellular trafficking, and bile acid transport activity of the bile salt export pump [Bsep (ATP-binding cassette B11)]. Rat Bsep was fused with yellow fluorescent protein, and the following mutants, in which Asn residues of putative glycosylation sites (Asn(109), Asn(116), Asn(122), and Asn(125)) were sequentially replaced with Gln, were constructed by site-directed mutagenesis: single N109Q, double N109Q + N116Q, triple N109Q + N116Q + N122Q, and quadruple N109Q + N116Q + N122Q + N125Q. Immunoblot and glycosidase cleavage analysis demonstrated that each site was glycosylated. Removal of glycans decreased taurocholate transport activity as determined in polarized MDCK II cells. This decrease resulted from rapid decay of the mutant Bsep protein; biochemical half-lives were 3.76, 3.65, 3.24, 1.35, and 0.52 h in wild-type, single-mutant, double-mutant, triple-mutant, and quadruple-mutant cells, respectively. Wild-type and single- and double-mutant proteins were distributed exclusively along the apical membranes, whereas triple- and quadruple-mutant proteins remained intracellular. MG-132 but not bafilomycin A(1) extended the half-life, suggesting a role for the proteasome in Bsep degradation. To determine whether a specific glycosylation site or the number of glycans was critical for protein stability, we studied the protein expression of combinations of N-glycan-deficient mutants and observed that Bsep with one glycan was considerably unstable compared with Bsep harboring two or more glycans. In conclusion, at least two N-linked glycans are required for Bsep protein stability, intracellular trafficking, and function in the apical membrane.
Comments [show]
None has been submitted yet.
No. Sentence Comment
350 However, a recent study (21) demonstrated that Bsep protein with a PFIC-2 mutation in the first nucleotide-binding domain (D482G) is unstable because of lack of glycosylation, suggesting that sugar attachment may be inhibited by a mutation in a region unrelated to N-linked glycosylation.
X
ABCB11 p.Asp482Gly 17082223:350:123
status: NEW[hide] Prediction of drug-induced intrahepatic cholestasi... Expert Opin Drug Saf. 2007 Jan;6(1):71-86. Sakurai A, Kurata A, Onishi Y, Hirano H, Ishikawa T
Prediction of drug-induced intrahepatic cholestasis: in vitro screening and QSAR analysis of drugs inhibiting the human bile salt export pump.
Expert Opin Drug Saf. 2007 Jan;6(1):71-86., [PMID:17181454]
Abstract [show]
Drug-induced intrahepatic cholestasis is one of the major causes of hepatotoxicity, which often occur during the drug discovery and development process. Human ATP-binding cassette transporter ABCB11 (sister of P-glycoprotein/bile salt export pump) mediates the elimination of cytotoxic bile salts from liver cells to bile, and, therefore, plays a critical role in the generation of bile flow. The authors have recently developed in vitro high-speed screening and quantitative structure-activity relationship analysis methods to investigate the interaction of ABCB11 with a variety of compounds. Based on the extent of inhibition of the bile salt export pump, the authors analysed the quantitative structure-activity relationship to identify chemical groups closely associated with the inhibition of ABCB11. This approach provides a new tool to predict compounds with a potential risk of drug-induced intrahepatic cholestasis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
120 H2N COOH S56L G238V G260D C336S L339V V444A K461E D482G T923P K930X G982R R1090X R1153C Outside Inside R1268Q A1228VE1186K R1128H R1057X R1050C A926P A865V R698H E636G M677V S593R E592Q N591S R575XA570T Q558H I498T R432T R415Q R299K E297G V284A I206V S194P E186G cholestasis Expert Opin. Drug Saf. (2007) 6(1) Table 1.
X
ABCB11 p.Asp482Gly 17181454:120:50
status: NEW122 [39,41,44,46,48,102] - 12 1381 A→G Lys461Glu PFIC2 [35] - 13 1445 A→G Asp482Gly PFIC2 [35] - 13 1493 T→C Ile498Thr PFIC2?BRIC2?
X
ABCB11 p.Asp482Gly 17181454:122:84
status: NEW[hide] 4-phenylbutyrate enhances the cell surface express... Hepatology. 2007 Jun;45(6):1506-16. Hayashi H, Sugiyama Y
4-phenylbutyrate enhances the cell surface expression and the transport capacity of wild-type and mutated bile salt export pumps.
Hepatology. 2007 Jun;45(6):1506-16., [PMID:17538928]
Abstract [show]
Progressive familial intrahepatic cholestasis type 2 (PFIC2) is caused by a mutation in the bile salt export pump (BSEP/ABCB11) gene. We previously reported that E297G and D482G BSEP, which are frequently found mutations in European patients, result in impaired membrane trafficking, whereas both mutants retain their transport function. The dysfunctional localization is probably attributable to the retention of BSEP in endoplasmic reticulum (ER) followed by proteasomal degradation. Because sodium 4-phenylbutyrate (4PBA) has been shown to restore the reduced cell surface expression of mutated plasma membrane proteins, in the current study, we investigated the effect of 4PBA treatment on E297G and D482G BSEP. Transcellular transport and cell surface biotinylation studies using Madin-Darby canine kidney (MDCK) II cells demonstrated that 4PBA treatment increased functional cell surface expression of wild-type (WT), E297G, and D482G BSEP. The prolonged half-life of cell surface-resident BSEP with 4PBA treatment was responsible for this result. Moreover, treatment of Sprague-Dawley rats with 4PBA resulted in an increase in BSEP expression at the canalicular membrane, which was accompanied by an increase in the biliary excretion of [(3)H]taurocholic acid (TC). CONCLUSION: 4PBA treatment with a clinically achievable concentration enhances the cell surface expression and the transport capacity of WT, E297G, and D482G BSEP in MDCK II cells, and also induces functional BSEP expression at the canalicular membrane and bile acid transport via canalicular membrane in vivo. 4PBA is a potential pharmacological agent for treating not only PFIC2 patients with E297G and D482G mutations but also other cholestatic patients, in whom the BSEP expression at the canalicular membrane is reduced.
Comments [show]
None has been submitted yet.
No. Sentence Comment
1 We previously reported that E297G and D482G BSEP, which are frequently found mutations in European patients, result in impaired membrane trafficking, whereas both mutants retain their transport function.
X
ABCB11 p.Asp482Gly 17538928:1:38
status: NEW3 Because sodium 4-phenylbutyrate (4PBA) has been shown to restore the reduced cell surface expression of mutated plasma membrane proteins, in the current study, we investigated the effect of 4PBA treatment on E297G and D482G BSEP.
X
ABCB11 p.Asp482Gly 17538928:3:218
status: NEW4 Transcellular transport and cell surface biotinylation studies using Madin-Darby canine kidney (MDCK) II cells demonstrated that 4PBA treatment increased functional cell surface expression of wild-type (WT), E297G, and D482G BSEP.
X
ABCB11 p.Asp482Gly 17538928:4:219
status: NEW7 Conclusion: 4PBA treatment with a clinically achievable concentration enhances the cell surface expression and the transport capacity of WT, E297G, and D482G BSEP in MDCK II cells, and also induces functional BSEP expression at the canalicular membrane and bile acid transport via canalicular membrane in vivo.
X
ABCB11 p.Asp482Gly 17538928:7:152
status: NEW8 4PBA is a potential pharmacological agent for treating not only PFIC2 patients with E297G and D482G mutations but also other cholestatic patients, in whom the BSEP expression at the canalicular membrane is reduced.
X
ABCB11 p.Asp482Gly 17538928:8:94
status: NEW21 1506 ing junction mutations in the BSEP gene.1 Among them, E297G and D482G, two missense mutations in the second intracellular loop and in the first ATP-binding domain, respectively, are frequently observed in PFIC2 patients.
X
ABCB11 p.Asp482Gly 17538928:21:70
status: NEW23 However, both mutated BSEPs per se exhibit normal transport functions.10 Accordingly, restoration of the reduced cell surface expression of these mutated BSEPs is an important task for achieving the therapeutic goal for PFIC2 patients with E297G and D482G mutations.
X
ABCB11 p.Asp482Gly 17538928:23:250
status: NEW24 Sodium 4-phenylbutyrate (4PBA) has been shown to be capable of restoring the reduced cell surface expression of cystic fibrosis transmembrane conductance regulator (CFTR/ABCC7) with the deletion of phenylalanine at 508 (CFTR ⌬F508).11 CFTR ⌬F508 is the most common mutation in cystic fibrosis patients12 and has similar features to E297G and D482G BSEP in that this mutated molecule accumulates in the endoplasmic reticulum (ER), followed by degradation in the proteasomes, but maintains its normal function as a chloride channel.13-15 4PBA is a nontoxic butyrate analog that was originally approved for clinical use as an ammonia scavenger in subjects with urea cycle disorders.16 Clinical trials of this agent in cystic fibrosis patients with ⌬F508 demonstrated that CFTR function in the nasal epithelia is induced by 4PBA therapy.17 Considering that a surgical procedure such as liver transplantation is the only therapy to cure PFIC2, this compound may offer a new medical therapy for PFIC2.
X
ABCB11 p.Asp482Gly 17538928:24:356
status: NEW26 We evaluated the effectiveness and mechanism of action of 4PBA by biological and transport functional experiments with Madin-Darby canine kidney (MDCK) II cells expressing wild-type (WT), E297G, and D482G BSEP.
X
ABCB11 p.Asp482Gly 17538928:26:199
status: NEW36 The BD Adeno-X Adenoviral Expression System (BD Biosciences, Palo Alto, CA) was used to establish the human WT, E297G, and D482G BSEP recombinant adenoviruses as previously described.10 The virus titer was checked with an Adeno-X Rapid Titer Kit (Clontech).
X
ABCB11 p.Asp482Gly 17538928:36:123
status: NEW39 MDCK II cells were seeded in six-well plates at a density of 2.5 ϫ 105 cells per well. After a 24-hour culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, D482G BSEP, and GFP at 200 multiplicity of infection (MOI).
X
ABCB11 p.Asp482Gly 17538928:39:206
status: NEW47 After 2 days` culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, D482G BSEP, and GFP at 50 MOI. Cells were cultured for 24 hours after infection and subsequently treated with 1 mM 4PBA. Then, 24 hours after treatment, the transcellular transport assays were performed as described.19 The apparent efflux clearance across the apical membrane (PSapical) was calculated by dividing the steady-state rate for the transcellular transport of [3H]TC determined over 2 hours by the cellular concentration of [3H]TC determined at the end of the experiments (2 hours).
X
ABCB11 p.Asp482Gly 17538928:47:111
status: NEW49 MDCK II cells were seeded in 6-well plates at a density of 2.5 ϫ 105 cells per well. After a 24-hour culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, D482G BSEP, and GFP at 200 MOI. Cells were cultured for 24 hours after infection and subsequently treated with 1 mM 4PBA. Then, 24 hours after treatment, cell surface biotinylation was performed as described.10 When the degradation rate of the cell surface-resident protein was examined, biotinylated MDCK II cells were incubated for various periods at 37°C, with or without 1 mM 4PBA, before solubilization.
X
ABCB11 p.Asp482Gly 17538928:49:204
status: NEW52 MDCK II cells were seeded in six-well plates at a density of 2.5 ϫ 105 cells per well. After a 24-hour culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, D482G BSEP, and GFP at 50 MOI. Cells were cultured for 24 hours after infection and subsequently treated with 1 mM 4PBA. Then, 24 hours after treatment, RNA was isolated using ISOGEN (Wako Pure Chemical Industries, Osaka, Japan) according to the manufacturer`s instructions.
X
ABCB11 p.Asp482Gly 17538928:52:206
status: NEW57 MDCK II cells were seeded in 6-well plates at a density of 2.5 ϫ 105 cells per well. After a 24-hour culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, and D482G BSEP at 200 MOI. Cells were cultured for 36 hours after infection and subsequently treated, with or without 5 g/ml Act D (Sigma, St. Louis, MO), to inhibit mRNA synthesis and, with or without 20 g/ml CHX (Sigma, St. Louis, MO), to inhibit protein synthesis.
X
ABCB11 p.Asp482Gly 17538928:57:208
status: NEW59 Subsequently, 6 hours (E297G, D482G BSEP) or 8 hours (WT) after 4PBA treatment, the crude membrane fraction was prepared as described previously.19 The specimens were separated by 6% SDS-PAGE and subjected to western blot analysis.
X
ABCB11 p.Asp482Gly 17538928:59:30
status: NEW61 MDCK II cells were seeded in 6-well plates at a density of 2.5 ϫ 105 cells per well. After a 24-hour culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, and D482G BSEP at 200 MOI. Cells were cultured for 12 hours after infection, and subsequently treated, with or without 5 g/ml brefeldin A (BFA) (Sigma, St. Louis, MO), to inhibit the translocation of BSEP from ER to the Golgi complex.
X
ABCB11 p.Asp482Gly 17538928:61:208
status: NEW82 MDCK II cells expressing WT, E297G, and D482G were treated with 4PBA for various periods and at various concentrations (Fig. 1A,B).
X
ABCB11 p.Asp482Gly 17538928:82:40
status: NEW84 4PBA treatment altered the expression level of the mature form of not only E297G and D482G BSEP but also WT BSEP in a concentration-dependent and time-dependent manner, the optimal condition being 1 mM for 24 hours.
X
ABCB11 p.Asp482Gly 17538928:84:85
status: NEW85 The expression level of the mature form of WT, E297G, and D482G BSEP was increased 2.5-fold to 3-fold in response to 1 mM 4PBA treatment for 24 hours, which is a clinically achievable concentration.21-23 We then examined the increase in cell surface expression of BSEP by 4PBA treatment using transcellular transport assay and cell surface biotinylation methods.
X
ABCB11 p.Asp482Gly 17538928:85:58
status: NEW87 Vectorial transport of [3H]TC in the apical direction was observed in MDCK II monolayers expressing WT, E297G, and D482G BSEP, and hardly detected in MDCK II monolayers expressing GFP.
X
ABCB11 p.Asp482Gly 17538928:87:115
status: NEW88 Similar to hepatocyte, coexpression of Naϩ-taurocholate cotransporting polypeptide (NTCP), basolateral uptake transporter, and BSEP, apical efflux transporter, is needed to detect the vectorial transport of [3H]TC in the apical direction in LLC-PK1 and MDCK monolayers.19,24 The finding that the expression of BSEP alone is sufficient to induce the vectorial transport of [3H]TC in the apical direction suggests that MDCK II cells endogenously express uptake transporter for bile acids in the basolateral membrane as suggested.25 The basal-to-apical flux of [3H]TC across MDCK II monolayers expressing WT, E297G, and D482G BSEP was increased 1.5-fold, 2.5-fold, and 3-fold, respectively, by 4PBA treatment under optimal conditions (1 mM, 24 hours), whereas the increase in the basal-to-apical flux of [3H]TC was not detected in MDCK II cells expressing GFP.
X
ABCB11 p.Asp482Gly 17538928:88:623
status: NEW93 MDCK II cells expressing WT, E297G, and D482G BSEP were treated for the indicated periods with 1 mM 4PBA before the preparation of crude membrane fractions. Prepared specimens (40 g ) were separated by 6% SDS-PAGE and subjected to western blot analysis.
X
ABCB11 p.Asp482Gly 17538928:93:40
status: NEW95 MDCK II cells expressing WT, E297G, and D482G BSEP were treated with the indicated 4PBA concentration for 24 hours before the preparation of crude membrane fractions. Prepared specimens (40 g) were separated by 6% SDS-PAGE and subjected to western blot analysis.
X
ABCB11 p.Asp482Gly 17538928:95:40
status: NEW97 PSapical was increased in MDCK II cells expressing WT, E297G, and D482G BSEP, but not affected in MDCK II cells expressing GFP by 4PBA treatment.
X
ABCB11 p.Asp482Gly 17538928:97:66
status: NEW98 BSEP-dependent PSapical (PSapical, BSEP) in MDCK II cells expressing WT, E297G, and D482G BSEP, which was calculated by subtracting the PSapical value in MDCK II cells expressing GFP from that in MDCK II cells expressing WT, E297G, and D482G BSEP, was enhanced 1.7-, 3.0-, and 2.8-fold, respectively, by 4PBA treatment under optimal conditions (1 mM, 24 hours).
X
ABCB11 p.Asp482Gly 17538928:98:84
status: NEWX
ABCB11 p.Asp482Gly 17538928:98:236
status: NEW100 Cell surface expression of WT, E297G, and D482G BSEP was increased 1.8-fold, 3.1-fold, and 2.6-fold, respectively, by 4PBA treatment under optimal conditions (1 mM, 24 hours), whereas cell surface expression of exogenously expressing P-gp and endogenously expressing DPPIV was not affected (Fig. 2D).
X
ABCB11 p.Asp482Gly 17538928:100:42
status: NEW101 The increase in cell surface expression of BSEP by 4PBA treatment was to an equivalent degree to that in PSapical, BSEP, suggesting that 4PBA treatment with a clinically achievable concentration can enhance the transport capacity of BSEP in MDCK II cells expressing WT, E297G, and D482G BSEP by increasing the cell surface expression of WT, E297G, and D482G BSEP.
X
ABCB11 p.Asp482Gly 17538928:101:281
status: NEWX
ABCB11 p.Asp482Gly 17538928:101:352
status: NEW104 A possible mechanism is that 4PBA treatment promotes transcription or translation of WT, E297G, and D482G BSEP and consequently increases the cell surface expression of WT, E297G, and D482G BSEP by mass action.
X
ABCB11 p.Asp482Gly 17538928:104:100
status: NEWX
ABCB11 p.Asp482Gly 17538928:104:184
status: NEW107 WT, E297G, and D482G BSEP mRNA expression levels were slightly increased by 4PBA treat- Fig. 2.
X
ABCB11 p.Asp482Gly 17538928:107:15
status: NEW109 MDCK II cells expressing WT, E297G, D482G BSEP, and GFP were treated for 24 hours, with or without 1 mM 4PBA, before the experiments.
X
ABCB11 p.Asp482Gly 17538928:109:36
status: NEW112 Transcellular transport of 1 M [3H]TC across MDCK II monolayers expressing WT, E297G, D482G BSEP, and GFP was examined as a function of time.
X
ABCB11 p.Asp482Gly 17538928:112:94
status: NEW118 The clearance of the transport of [3H]TC across the apical membrane of MDCK II monolayers expressing WT, E297G, D482G BSEP, and GFP (PSapical) was determined as described in Materials and Methods.
X
ABCB11 p.Asp482Gly 17538928:118:112
status: NEW123 ment, but the difference was not statistically significant [P ϭ 0.10 (WT), 0.20 (E297G, D482G)] (Fig. 3A).
X
ABCB11 p.Asp482Gly 17538928:123:94
status: NEW126 The inhibition of transcription with Act D and translation with CHX did not affect the 4PBA-mediated increase in the mature form of BSEP in MDCK II cells expressing WT, E297G, and D482G BSEP.
X
ABCB11 p.Asp482Gly 17538928:126:180
status: NEW127 These results indicate that a post-translational mechanism mainly contributes to the 4PBA-mediated increase in the cell surface expression of WT, E297G, and D482G BSEP.
X
ABCB11 p.Asp482Gly 17538928:127:157
status: NEW135 MDCK II cells expressing WT, E297G, and D482G BSEP were treated for 24 hours, with or without 1 mM 4PBA, before the experiments.
X
ABCB11 p.Asp482Gly 17538928:135:40
status: NEW140 MDCK II cells expressing WT, E297G, and D482G BSEP were treated for 6 hours (E297G, D482G BSEP) or 8 hours (WT BSEP), with or without 1 mM 4PBA, in the presence or absence of 5 g/ml Act D (B), and 20 g/ml CHX (C) before the preparation of crude membrane fractions. Prepared specimens (40 g) were separated by 6% SDS-PAGE and subjected to western blot analysis.
X
ABCB11 p.Asp482Gly 17538928:140:40
status: NEWX
ABCB11 p.Asp482Gly 17538928:140:84
status: NEW144 MDCK II cells expressing WT, E297G, and D482G BSEP were treated for 12 hours, with or without 1 mM 4PBA, in the presence or absence of 5 g/ml BFA.
X
ABCB11 p.Asp482Gly 17538928:144:40
status: NEW151 The expression level of the immature ER-resident form of WT, E297G, and D482G BSEP was almost identical in non- and 4PBA-treated MDCK II cells just after BFA washout (Fig. 4A; 0 hours), and that of the mature form was similar in non- and 4PBA-treated MDCK II cells until 3 hours after BFA washout, at which time the mature form of BSEP linearly increased.
X
ABCB11 p.Asp482Gly 17538928:151:72
status: NEW153 This result suggests that 4PBA treatment does not promote WT, E297G, and D482G BSEP maturation, but stabilizes the mature form of these proteins.
X
ABCB11 p.Asp482Gly 17538928:153:73
status: NEW156 To examine whether 4PBA treatment can inhibit the cell surface-resident BSEP from entering the degradation pathway, we measured the degradation rate of the cell surface-resident BSEP using biotin-labeling methods in MDCK II cells expressing WT, E297G, and D482G BSEP.
X
ABCB11 p.Asp482Gly 17538928:156:256
status: NEW158 The degradation rate of cell surface-resident D482G BSEP could not be determined under the same conditions as WT and E297G because of its low expression level.
X
ABCB11 p.Asp482Gly 17538928:158:46
status: NEW169 (C) Cell surface expression of D482G BSEP at a low temperature.
X
ABCB11 p.Asp482Gly 17538928:169:31
status: NEW170 MDCK II cells expressing D482G BSEP were cultured for 24 hours at 27°C before the cell surface biotinylation.
X
ABCB11 p.Asp482Gly 17538928:170:25
status: NEW172 (D) The degradation rate of cell surface-resident D482G BSEP.
X
ABCB11 p.Asp482Gly 17538928:172:50
status: NEW173 MDCK II cells expressing D482G BSEP were cultured at 27°C for 24 hours, with or without 1 mM 4PBA, before the experiments.
X
ABCB11 p.Asp482Gly 17538928:173:25
status: NEW175 (E) Quantification of band density indicating D482G BSEP in (D).
X
ABCB11 p.Asp482Gly 17538928:175:46
status: NEW176 The intensity of the band indicating D482G BSEP was quantified by Image Gauge software and expressed as a percentage of the BSEP present at 0 hours, respectively. Closed and open circles represent remaining cell surface D482G BSEP in MDCK II cells treated, with and without 4PBA, respectively.
X
ABCB11 p.Asp482Gly 17538928:176:37
status: NEWX
ABCB11 p.Asp482Gly 17538928:176:220
status: NEW178 D482G (Fig. 5C).
X
ABCB11 p.Asp482Gly 17538928:178:0
status: NEW179 The cell surface expression of D482G increased 4.0-fold by 24-hour culture at a lower temperature (27°C).
X
ABCB11 p.Asp482Gly 17538928:179:31
status: NEW180 We further examined the degradation rate of cell surface-resident D482G at 37°C after 24 hours` culture at a lower temperature (Fig. 5D,E).
X
ABCB11 p.Asp482Gly 17538928:180:66
status: NEW181 The half-life of the cell surface-resident D482G BSEP was prolonged 3.3-fold by 4PBA treatment such as WT and E297G BSEP.
X
ABCB11 p.Asp482Gly 17538928:181:43
status: NEW182 The prolonged half-life of the cell surface-resident WT, E297G, and D482G BSEP is consistent with the result of the BFA washout study, which suggests that 4PBA treatment stabilizes the mature form of BSEP (Fig. 4A,B).
X
ABCB11 p.Asp482Gly 17538928:182:68
status: NEW184 4PBA treatment can increase the functional cell surface expression of WT, E297G, and D482G BSEP in MDCK II cells (Fig. 2).
X
ABCB11 p.Asp482Gly 17538928:184:85
status: NEW205 Discussion We previously reported that E297G and D482G BSEP, which are frequently found mutants in European patients, result in impaired membrane trafficking, whereas the transport function of both mutated BSEPs remains almost normal.10 Restoration of the reduced cell surface expression of these mutated BSEPs is a therapeutic goal for PFIC2 patients with E297G and D482G mutations, because both mutated BSEPs per se exhibit normal transport functions.
X
ABCB11 p.Asp482Gly 17538928:205:49
status: NEWX
ABCB11 p.Asp482Gly 17538928:205:367
status: NEW206 In the current study, we analyzed the potential therapeutic effect of 4PBA against PFIC2 by examining the effect of 4PBA treatment on the cell surface expression of E297G and D482G BSEP.
X
ABCB11 p.Asp482Gly 17538928:206:175
status: NEW208 Initially, we examined the effect of 4PBA treatment on WT, E297G, and D482G BSEP using MDCK II cells.
X
ABCB11 p.Asp482Gly 17538928:208:70
status: NEW210 Together with the finding that the increase in PSapical, BSEP by 4PBA treatment correlates with the cell surface expression of WT, E297G, and D482G BSEP (Fig. 2C), 4PBA treatment with a clinically achievable concentration can enhance the cell surface expression and the transport capacity of WT, E297G, and D482G BSEP in MDCK II cells.
X
ABCB11 p.Asp482Gly 17538928:210:142
status: NEWX
ABCB11 p.Asp482Gly 17538928:210:307
status: NEW214 Furthermore, the expression levels of the immature ER-resident form of WT, E297G, and D482G BSEP were almost identical in non- and 4PBA-treated MDCK II cells just after BFA washout (Fig. 4A; 0 hours).
X
ABCB11 p.Asp482Gly 17538928:214:86
status: NEW215 These results indicate that a post-translational mechanism mainly contributes to the 4PBA-mediated increase in the cell surface expression of WT, E297G, and D482G BSEP.
X
ABCB11 p.Asp482Gly 17538928:215:157
status: NEW216 Although we investigated whether 4PBA treatment promotes the maturation of WT, E297G, and D482G BSEP as the possible post-translational mechanism, such an effect of 4PBA treatment was not observed in the BFA washout study (Fig. 4A,B).
X
ABCB11 p.Asp482Gly 17538928:216:90
status: NEW217 However, the results of this study showed that 4PBA treatment could stabilize the mature form of WT, E297G, and D482G BSEP (Fig. 4A,B).
X
ABCB11 p.Asp482Gly 17538928:217:112
status: NEW230 E297G, and D482G BSEP (Fig. 5A-E).
X
ABCB11 p.Asp482Gly 17538928:230:11
status: NEW231 Because cell surface-resident BSEP constitutively cycles between the canalicular membrane and the intracellular compartment, and is finally removed from this cycle to the degradation pathway,30,31 4PBA treatment may interrupt the internalization process or promote the recycling process and, consequently, increase the cell surface expression of WT, E297G, and D482G BSEP.
X
ABCB11 p.Asp482Gly 17538928:231:361
status: NEW233 Although the molecular mechanism of this effect remains unknown, taking into the consideration that the prolonged half-life with 4PBA treatment was only detected in cell surface-resident WT, E297G, and D482G BSEP, but not for other membrane proteins such as P-gp and DPPIV (Fig. 5B,E), 4PBA treatment possibly induces a specific interaction of WT, E297G, and D482G BSEP with adaptor proteins.
X
ABCB11 p.Asp482Gly 17538928:233:202
status: NEWX
ABCB11 p.Asp482Gly 17538928:233:359
status: NEW238 If the prolonged half-life of cell surface-resident Bsep with 4PBA treatment is responsible for this result in vivo as well as in vitro, the protective effect of 4PBA treatment against hepatocellular damage by increasing biliary excretion of bile acids and lowering intrahepatic bile acids may be remarkably observed in PFIC2 patients with E297G and D482G mutations.
X
ABCB11 p.Asp482Gly 17538928:238:350
status: NEW249 In conclusion, we demonstrated that 4PBA treatment with a clinically achievable concentration induces the cell surface expression and the transport capacity of WT, E297G, and D482G BSEP in MDCK II cells and also enhances functional Bsep expression at the canalicuar membrane and bile acid transport via canalicular membrane in vivo.
X
ABCB11 p.Asp482Gly 17538928:249:175
status: NEW251 These results suggest that 4PBA is a potential pharmacological agent not only for PFIC2 patients with E297G and D482G mutations but also for other cholestatic patients, in whom the BSEP expression at the canalicular membrane is reduced.
X
ABCB11 p.Asp482Gly 17538928:251:112
status: NEW[hide] Levels of plasma membrane expression in progressiv... Am J Physiol Cell Physiol. 2007 Nov;293(5):C1709-16. Epub 2007 Sep 13. Lam P, Pearson CL, Soroka CJ, Xu S, Mennone A, Boyer JL
Levels of plasma membrane expression in progressive and benign mutations of the bile salt export pump (Bsep/Abcb11) correlate with severity of cholestatic diseases.
Am J Physiol Cell Physiol. 2007 Nov;293(5):C1709-16. Epub 2007 Sep 13., [PMID:17855769]
Abstract [show]
Human BSEP (ABCB11) mutations are the molecular basis for at least three clinical forms of liver disease, progressive familial intrahepatic cholestasis type 2 (PFIC2), benign recurrent intrahepatic cholestasis type 2 (BRIC2), and intrahepatic cholestasis of pregnancy (ICP). To better understand the pathobiology of these disease phenotypes, we hypothesized that different mutations may cause significant differences in protein defects. Therefore we compared the effect of two PFIC2 mutations (D482G, E297G) with two BRIC2 mutations (A570T and R1050C) and one ICP mutation (N591S) with regard to the subcellular localization, maturation, and function of the rat Bsep protein. Bile salt transport was retained in all but the E297G mutant. Mutant proteins were expressed at reduced levels on the plasma membrane of transfected HEK293 cells compared with wild-type (WT) Bsep in the following order: WT > N591S > R1050C approximately A570T approximately E297G >> D482G. Total cell protein and surface protein expression were reduced to the same extent, suggesting that trafficking of these mutants to the plasma membrane is not impaired. All Bsep mutants accumulate in perinuclear aggresome-like structures in the presence of the proteasome inhibitor MG-132, suggesting that mutations are associated with protein instability and ubiquitin-dependent degradation. Reduced temperature, sodium butyrate, and sodium 4-phenylbutyrate enhanced the expression of the mature and cell surface D482G protein in HEK293 cells. These results suggest that the clinical phenotypes of PFIC2, BRIC2, and ICP may directly correlate with the amount of mature protein that is expressed at the cell surface and that strategies to stabilize cell surface mutant protein may be therapeutic.
Comments [show]
None has been submitted yet.
No. Sentence Comment
9 Therefore we compared the effect of two PFIC2 mutations (D482G, E297G) with two BRIC2 mutations (A570T and R1050C) and one ICP mutation (N591S) with regard to the subcellular localization, maturation, and function of the rat Bsep protein.
X
ABCB11 p.Asp482Gly 17855769:9:57
status: NEW11 Mutant proteins were expressed at reduced levels on the plasma membrane of transfected HEK293 cells compared with wild-type (WT) Bsep in the following order: WT Ͼ N591S Ͼ R1050C ϳ A570T ϳ E297G ϾϾ D482G.
X
ABCB11 p.Asp482Gly 17855769:11:233
status: NEW14 Reduced temperature, sodium butyrate, and sodium 4-phenylbutyrate enhanced the expression of the mature and cell surface D482G protein in HEK293 cells. These results suggest that the clinical phenotypes of PFIC2, BRIC2, and ICP may directly correlate with the amount of mature protein that is expressed at the cell surface and that strategies to stabilize cell surface mutant protein may be therapeutic.
X
ABCB11 p.Asp482Gly 17855769:14:121
status: NEW32 These studies suggest that two PFIC2 mutations, D482G and E297G, lead to reduced total protein expression presumably due to folding, processing, and/or trafficking defects (8, 19, 22, 30).
X
ABCB11 p.Asp482Gly 17855769:32:48
status: NEW39 0363-6143/07 $8.00 Copyright (c) 2007 the American Physiological Societyhttp://www.ajpcell.org C1709 trast to these conclusions, we find that all five green fluorescent protein (GFP)-tagged mutant proteins, including D482G and E297G, traffic to the cell surface as detected by confocal microscopy and by biotinylation of plasma membrane Bsep when expressed in MDCK and HEK293 cells, respectively.
X
ABCB11 p.Asp482Gly 17855769:39:218
status: NEW45 All point mutations (D482G, E297G, A570T, R1050C, N591S) were introduced with the QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA).
X
ABCB11 p.Asp482Gly 17855769:45:21
status: NEW64 PFIC2 (D482G, E297G), BRIC2 (A570T, R1050C), and ICP (N591S) mutations that are investigated in this study are indicated in italics.
X
ABCB11 p.Asp482Gly 17855769:64:7
status: NEW84 Stably transfected D482G HEK293 cells were treated with and without 2 M MG-132 for 16 h.
X
ABCB11 p.Asp482Gly 17855769:84:19
status: NEW94 Sf9 cells infected with recombinant virus (mock, WT, D482G, E297G, A570T, R1050C, and N591S) were harvested, and cell membranes were prepared as described previously (23).
X
ABCB11 p.Asp482Gly 17855769:94:53
status: NEW107 The subcellular distributions of D482G, E297G, A570T, R1050C, and N591S were examined first because intracellular accumulation of misfolded proteins has been shown for many diseases.
X
ABCB11 p.Asp482Gly 17855769:107:33
status: NEW118 The level of cell surface expression of Bsep protein was quantitated by densitometry and determined to be in the following order: WT (100%) Ͼ N591S (75.6 Ϯ 15.6%) Ͼ E297G (38.5 Ϯ 12.6%) ϳ R1050C (35.6 Ϯ 14.5%) ϳ A570T (29.5 Ϯ 8.8%) ϾϾ D482G (5.7 Ϯ 2.3%).
X
ABCB11 p.Asp482Gly 17855769:118:295
status: NEW120 The total expression (cell surface and intracellular proteins) also showed changes similar to those in cell surface expression: WT (100%) Ͼ N591S (73.5 Ϯ 4.3%) Ͼ E297G (33.7 Ϯ 20.4%) ϳ R1050C (26.7 Ϯ 16.0%) ϳ A570T (11.9 Ϯ 5.2%) ϾϾ D482G (2.5 Ϯ 2.0%) (Fig. 4B).
X
ABCB11 p.Asp482Gly 17855769:120:292
status: NEW132 We colocalized the D482G mutant with endogenous ubiquitin and with transfected rat ubiquitin tagged with hemagglutinin (Fig. 5C).
X
ABCB11 p.Asp482Gly 17855769:132:19
status: NEW135 To further confirm that Bsep is ubiquitinated, we immunoprecipitated D482G molecules from stably transfected cells and blotted the immunoprecipitates with an anti-ubiquitin antibody (Fig. 5D).
X
ABCB11 p.Asp482Gly 17855769:135:69
status: NEW137 MG-132 treatment increased both the D482G protein and its ubiquitinated form.
X
ABCB11 p.Asp482Gly 17855769:137:36
status: NEW138 These results indicate that the proteasome is involved in the turnover of D482G protein.
X
ABCB11 p.Asp482Gly 17855769:138:74
status: NEW140 To investigate whether chemical chaperones could stabilize the D482G mutant, we found that reduced temperature, sodium butyrate, and sodium 4-phenylbutyrate could enhance the expression of the mature D482G protein (band C) and surface expression in stably transfected HEK293 cells (Fig. 6).
X
ABCB11 p.Asp482Gly 17855769:140:63
status: NEWX
ABCB11 p.Asp482Gly 17855769:140:200
status: NEW141 Recently, Hayashi and Sugiyama (7) also showed that sodium 4-phenylbutyrate enhances the expression of cell surface human D482G protein in MDCK cells. These results confirm that 4-phenylbutyrate has similar effect in stabilizing D482G mutant with human or rat gene.
X
ABCB11 p.Asp482Gly 17855769:141:122
status: NEWX
ABCB11 p.Asp482Gly 17855769:141:229
status: NEW150 The membrane vesicles expressing D482G, A570T, R1050C, or N591S showed similar levels of taurocholate uptake compared with WT Bsep.
X
ABCB11 p.Asp482Gly 17855769:150:33
status: NEW155 Cells were transiently transfected with pEGFPN1 (control), rat Bsep-GFP [wild type (WT)], D482G-GFP, E297G-GFP, A570T-GFP, R1050C-GFP, and N591S-GFP constructs.
X
ABCB11 p.Asp482Gly 17855769:155:90
status: NEW164 A PFIC2 mutation (D482G) is highly unstable (ϳ5% of WT), while the BRIC2 variants A570T and R1050C are expressed at the plasma membrane at intermediate levels (ϳ25% of WT).
X
ABCB11 p.Asp482Gly 17855769:164:18
status: NEW169 Cells were transfected with rat Bsep-GFP (WT), D482G-GFP, E297G-GFP, A570T-GFP, R1050C-GFP, and N591S-GFP constructs and were examined for GFP by confocal laser microscopy.
X
ABCB11 p.Asp482Gly 17855769:169:47
status: NEW171 D482G, E297G, A570T, and R1050C mutants partially colocalized with recycling endosome marker Rab11.
X
ABCB11 p.Asp482Gly 17855769:171:0
status: NEW176 D4, D482G; E2, E297G; A5, A570T; R10, R1050C; N5, N591S.
X
ABCB11 p.Asp482Gly 17855769:176:4
status: NEW183 P Ͻ 0.05, D482G, E297G, A570T, R1050C, and N591S compared with WT control.
X
ABCB11 p.Asp482Gly 17855769:183:16
status: NEW186 This study shows that the D482G mutant is ubiquitinated and that proteasome inhibition increases the level of the mutant protein, thereby providing a means to regulate Bsep stability.
X
ABCB11 p.Asp482Gly 17855769:186:26
status: NEW192 Our results confirm previous results from this lab (30) and others (8, 19, 22) that have described a low expression of the PFIC2 mutant D482G in human, rat, and mouse Bsep following transfection into different mammalian cell lines.
X
ABCB11 p.Asp482Gly 17855769:192:136
status: NEW196 Twenty-five micrograms of protein was used for each reaction, except that 100 g of D482G protein was used for digestion to detect expression (**).
X
ABCB11 p.Asp482Gly 17855769:196:91
status: NEW200 C: Bsep-D482G-GFP (a) colocalizes with transfected hemagglutinin (HA)-tagged ubiquitin (b) with HA antibody.
X
ABCB11 p.Asp482Gly 17855769:200:8
status: NEW202 Bar ϭ 5 m. D: Western blots of total lysates or immunoprecipitates (IP) of D482G stably transfected HEK293 cells treated with and without MG-132 using anti-ubiquitin (ub) antibody or Bsep antibody (Bsep).
X
ABCB11 p.Asp482Gly 17855769:202:89
status: NEW204 Temperature and chemical chaperones rescue mature D482G mutant protein.
X
ABCB11 p.Asp482Gly 17855769:204:50
status: NEW205 A: stably transfected WT (top) and D482G (bottom) in HEK293 cells were incubated at 37°C or shifted to 27°C overnight.
X
ABCB11 p.Asp482Gly 17855769:205:35
status: NEW206 There was a marked increase in plasma membrane expression of the D482G-GFP mutant compared with slight increase in plasma membrane expression of WT-GFP.
X
ABCB11 p.Asp482Gly 17855769:206:65
status: NEW207 Western immunoblotting shows the increase in expression of mature and immature protein of D482G (bottom) compared with little change in expression of WT (top) after temperature rescue.
X
ABCB11 p.Asp482Gly 17855769:207:90
status: NEW208 B: chemical chaperones sodium butyrate (NaB) and sodium 4-phenylbutyrate (NaPB) and DMSO control (Ctl) were used to treat WT (top) and D482G (bottom) stably transfected HEK293 cells for 24 h. NaB and NaPB enhanced the expression of D482G at the plasma membrane and increased the expression levels of mature and immature protein (bottom).
X
ABCB11 p.Asp482Gly 17855769:208:135
status: NEWX
ABCB11 p.Asp482Gly 17855769:208:232
status: NEW220 Reduced temperature and 4-phenylbutyrate have been demonstrated in this study and by others (7) to increase mature and cell surface protein expression for the D482G mutant.
X
ABCB11 p.Asp482Gly 17855769:220:159
status: NEW229 A: immunoblot of the isolated Sf9 cell membrane proteins with anti-Bsep polyclonal antibody: GFP control expressed in HEK293 cells, WT expressed in HEK293 cells, rat liver homogenate (L), pFastBac1-Gus control (C), wild type (WT), D482G (D4), E297G (E2), A570T (A5), R1050C (R10), N591S (N5).
X
ABCB11 p.Asp482Gly 17855769:229:231
status: NEW231 B: TCA (200 M) stimulates and orthovanadate inhibits ATPase activity in membrane vesicles containing comparable levels of WT or D482G, E297G, A570T, R1050C, and N591S mutant Bsep.
X
ABCB11 p.Asp482Gly 17855769:231:136
status: NEW[hide] Phenotypic differences in PFIC2 and BRIC2 correlat... Am J Physiol Gastrointest Liver Physiol. 2008 Jan;294(1):G58-67. Epub 2007 Oct 18. Kagawa T, Watanabe N, Mochizuki K, Numari A, Ikeno Y, Itoh J, Tanaka H, Arias IM, Mine T
Phenotypic differences in PFIC2 and BRIC2 correlate with protein stability of mutant Bsep and impaired taurocholate secretion in MDCK II cells.
Am J Physiol Gastrointest Liver Physiol. 2008 Jan;294(1):G58-67. Epub 2007 Oct 18., [PMID:17947449]
Abstract [show]
Progressive familial cholestasis (PFIC) 2 and benign recurrent intrahepatic cholestasis (BRIC) 2 are caused by mutations in the bile salt export pump (BSEP, ABCB11) gene; however, their prognosis differs. PFIC2 progresses to cirrhosis and requires liver transplantation, whereas BRIC2 is clinically benign. To identify the molecular mechanism(s) responsible for the phenotypic differences, eight PFIC2 and two BRIC2 mutations were introduced in rat Bsep, which was transfected in MDCK II cells. Taurocholate transport activity, protein expression, and subcellular distribution of these mutant proteins were studied in a polarized MDCK II monolayer. The taurocholate transport activity was approximately half of the wild-type (WT) in BRIC2 mutants (A570T and R1050C), was substantially less in two PFIC2 mutants (D482G and E297G), and was almost abolished in six other PFIC2 mutants (K461E, G982R, R1153C, R1268Q, 3767-3768insC, and R1057X). Bsep protein expression levels correlated closely with transport activity, except for R1057X. The half-life of the D482G mutant was shorter than that of the WT (1.35 h vs. 3.49 h in the mature form). BRIC2 mutants and three PFIC mutants (D482G, E297G, and R1057X) were predominantly distributed in the apical membrane. The other PFIC2 mutants remained intracellular. The R1057X mutant protein was stably expressed and trafficked to the apical membrane, suggesting that the COOH-terminal tail is required for transport activity but not for correct targeting. In conclusion, taurocholate transport function was impaired in proportion to rapid degradation of Bsep protein in the mutants, which were aligned in the following order: A570T and R1050C > D482G > E297G > K461E, G982R, R1153C, R1268Q, 3767-3768insC, and R1057X. These results may explain the phenotypic difference between BRIC2 and PFIC2.
Comments [show]
None has been submitted yet.
No. Sentence Comment
13 The taurocholate transport activity was approximately half of the wild-type (WT) in BRIC2 mutants (A570T and R1050C), was substantially less in two PFIC2 mutants (D482G and E297G), and was almost abolished in six other PFIC2 mutants (K461E, G982R, R1153C, R1268Q, 3767-3768insC, and R1057X).
X
ABCB11 p.Asp482Gly 17947449:13:163
status: NEW15 The half-life of the D482G mutant was shorter than that of the WT (1.35 h vs. 3.49 h in the mature form).
X
ABCB11 p.Asp482Gly 17947449:15:21
status: NEW16 BRIC2 mutants and three PFIC mutants (D482G, E297G, and R1057X) were predominantly distributed in the apical membrane.
X
ABCB11 p.Asp482Gly 17947449:16:38
status: NEW19 In conclusion, taurocholate transport function was impaired in proportion to rapid degradation of Bsep protein in the mutants, which were aligned in the following order: A570T and R1050C Ͼ D482G Ͼ E297G Ͼ K461E, G982R, R1153C, R1268Q, 3767-3768insC, and R1057X.
X
ABCB11 p.Asp482Gly 17947449:19:195
status: NEW29 Of these, D482G and E297G mutations are most frequent (35).
X
ABCB11 p.Asp482Gly 17947449:29:10
status: NEW30 Studies of TC transport activity and intracellular trafficking by D482G and E297G mutants have reported inconstant results.
X
ABCB11 p.Asp482Gly 17947449:30:66
status: NEW32 D482G mutant Bsep was localized in the apical membrane of HepG2 (28) and Madin-Darby canine kidney (MDCK) cells (41), and in the cytoplasm of MDCK II cells (8).
X
ABCB11 p.Asp482Gly 17947449:32:0
status: NEW87 Briefly, MDCK II cells grown on 24-mm Transwell membrane inserts were transfected with WT or D482G mutant Bsep.
X
ABCB11 p.Asp482Gly 17947449:87:93
status: NEW115 RESULTS TC transport activity, protein expression, and mRNA expression of the D482G mutant.
X
ABCB11 p.Asp482Gly 17947449:115:78
status: NEW116 The D482G mutant is the most frequently observed mutation in PFIC2.
X
ABCB11 p.Asp482Gly 17947449:116:4
status: NEW118 In a polarized MDCK II monolayer, the D482G mutation revealed 32.3 Ϯ 5.8% (mean Ϯ SD) TC transport activity of that observed in WT (Fig. 2A).
X
ABCB11 p.Asp482Gly 17947449:118:38
status: NEW121 The D482G mutant produced the same two bands, suggesting normal maturation of Bsep protein.
X
ABCB11 p.Asp482Gly 17947449:121:4
status: NEW124 These results reveal that the observed decrease in TC transport activity of the D482G mutation is attributable to decrease in Bsep protein expression.
X
ABCB11 p.Asp482Gly 17947449:124:80
status: NEW126 The mRNA expression of D482G was slightly higher than that of WT; however, the difference was not statistically significant (Fig. 2C), which suggests that the D482G mutant Bsep protein may be degraded faster than is the WT.
X
ABCB11 p.Asp482Gly 17947449:126:23
status: NEWX
ABCB11 p.Asp482Gly 17947449:126:159
status: NEW127 Next, we tested the subcellular distribution of the D482G mutant (Fig. 3).
X
ABCB11 p.Asp482Gly 17947449:127:52
status: NEW128 MDCK II cells were transfected with WT or D482G Bsep, and the fluorescent signals were observed by confocal laser scanning microscopy.
X
ABCB11 p.Asp482Gly 17947449:128:42
status: NEW129 The D482G mutant was predominantly distributed along apical membranes similar to that of WT (Fig. 3A).
X
ABCB11 p.Asp482Gly 17947449:129:4
status: NEW131 As expected, WT and D482G Bsep were not detected in the basolateral membrane (Fig. 3B).
X
ABCB11 p.Asp482Gly 17947449:131:20
status: NEW133 D482G mutant protein was present in the apical membrane at 30.6 Ϯ 14.4% of the level of WT.
X
ABCB11 p.Asp482Gly 17947449:133:0
status: NEW139 The positions of 8 PFIC2 mutations (E297G, K461E, D482G, G982R, R1057C, R1153C, 3767-3768insC, and R1268Q) and 2 BRIC2 mutations (A570T and R1050C) are indicated by ଝ and ଙ, respectively.
X
ABCB11 p.Asp482Gly 17947449:139:50
status: NEW142 G60 RAPID DEGRADATION OF PFIC2, BRIC2 MUTANT AJP-Gastrointest Liver Physiol • VOL 294 • JANUARY 2008 • www.ajpgi.org Biochemical half-life of the D482G mutant.
X
ABCB11 p.Asp482Gly 17947449:142:168
status: NEW143 To explore the mechanism(s) for attenuation of protein expression of the D482G mutant, the biochemical half-life was determined in MDCK II cells by analyzing Bsep protein expression after inhibiting further protein synthesis with cycloheximide treatment (Fig. 4).
X
ABCB11 p.Asp482Gly 17947449:143:73
status: NEW145 Band C of the WT was still present in 12 h, whereas, in D482G, bands disappeared in 4 h.
X
ABCB11 p.Asp482Gly 17947449:145:56
status: NEW146 The calculated half-life of band C in the D482G was 1.35 h, which was significantly shorter than that in WT (3.49 h, P Ͻ 0.05, Fig. 4B).
X
ABCB11 p.Asp482Gly 17947449:146:42
status: NEW147 Likewise the half-life of band B in the D482G was shorter than that in WT (0.41 h vs. 1.16 h, P Ͻ 0.05, Fig. 4B).
X
ABCB11 p.Asp482Gly 17947449:147:40
status: NEW148 These results suggest that the D482G protein is degraded faster than is the WT.
X
ABCB11 p.Asp482Gly 17947449:148:31
status: NEW152 Bands C of WT at 12 h and D482G at 4 h were denser in the presence of MG132.
X
ABCB11 p.Asp482Gly 17947449:152:26
status: NEW153 The half-life of each band was significantly extended by MG132 in WT and D482G; from 3.49 to 14.1 h in WT band C, from 1.35 to 13.2 h in D482G band C, from 1.16 to 2.95 h in WT band B, and from 0.41 to 1.73 h in D482G band B (Fig. 5C).
X
ABCB11 p.Asp482Gly 17947449:153:73
status: NEWX
ABCB11 p.Asp482Gly 17947449:153:137
status: NEWX
ABCB11 p.Asp482Gly 17947449:153:212
status: NEW155 These results suggest that the WT and D482G mutant Bsep proteins are degraded in proteasomes rather than in lysosomes.
X
ABCB11 p.Asp482Gly 17947449:155:38
status: NEW171 Taurocholate (TC) transport activity and expression of Bsep protein and mRNA of the D482G mutant expressed in MDCK II cells.
X
ABCB11 p.Asp482Gly 17947449:171:84
status: NEW172 A: MDCK II cells grown on Transwell membrane inserts were cotransfected with Ntcp and beta-gal or Ntcp and either wild-type (WT) or the D482G mutant Bsep.
X
ABCB11 p.Asp482Gly 17947449:172:136
status: NEW174 Each value represents mean Ϯ SD of 6 independent experiments performed in duplicate. B: MDCK II cells were transiently transfected with WT or D482G mutant Bsep and lysed. Five micrograms of cell lysates were separated by SDS-PAGE and subjected to immunoblot analysis using antibody to GFP.
X
ABCB11 p.Asp482Gly 17947449:174:148
status: NEW177 C: MDCK II cells were transiently transfected with an empty vector or WT or D482G mutant Bsep, and total RNA was extracted 24 h after transfection. cDNA was obtained by reverse transcription with SuperScript III and random hexamers, and quantitative real-time PCR was performed using TaqMan technology on ABI 7700 sequence detection system.
X
ABCB11 p.Asp482Gly 17947449:177:76
status: NEW186 Two PFIC2 mutants (D482G and E297G) were expressed at 10-30% of WT, trafficked correctly, and exhibited 10-30% activity.
X
ABCB11 p.Asp482Gly 17947449:186:19
status: NEW197 From the observation that a representative mutant, D482G, had a shorter biochemical half-life than the WT, rapid degradation of Bsep protein may be responsible for impaired function.
X
ABCB11 p.Asp482Gly 17947449:197:51
status: NEW204 The biochemical half-life of both forms of the D482G mutant was significantly shorter than that of the WT (mature form: 1.35 h, and core-glycosylated form: 0.41 h, Fig. 4B).
X
ABCB11 p.Asp482Gly 17947449:204:47
status: NEW205 These results suggest that after translation D482G Bsep protein is unstable and rapidly degraded.
X
ABCB11 p.Asp482Gly 17947449:205:45
status: NEW206 In contrast to a previous study (28), D482G was completely glycosylated (Fig. 2B).
X
ABCB11 p.Asp482Gly 17947449:206:38
status: NEW209 Subcellular localization of the WT and D482G mutant Bsep.
X
ABCB11 p.Asp482Gly 17947449:209:39
status: NEW210 A: MDCK II cells grown on Transwell membrane inserts were transfected with the WT or D482G mutant Bsep.
X
ABCB11 p.Asp482Gly 17947449:210:85
status: NEW214 The scale bars are 10 m. B: MDCK II cells grown on 24-mm Transwell membrane inserts were transfected with the WT or the D482G mutant Bsep.
X
ABCB11 p.Asp482Gly 17947449:214:128
status: NEW228 Biochemical half-life of the WT and D482G mutant Bsep in MDCK II cells.
X
ABCB11 p.Asp482Gly 17947449:228:36
status: NEW229 A: MDCK II cells were transiently transfected with the WT or D482G mutant Bsep.
X
ABCB11 p.Asp482Gly 17947449:229:61
status: NEW230 After 24 h cells were further cultured in the presence of cycloheximide (20 g/ml) and lysed at 0, 3, 6, and 12 h (WT) or at 0, 1, 2 and 4 h (D482G).
X
ABCB11 p.Asp482Gly 17947449:230:149
status: NEW237 A and B: MDCK II cells were transiently transfected with the WT or D482G mutant Bsep.
X
ABCB11 p.Asp482Gly 17947449:237:67
status: NEW238 After 24 h, cells were cultured with cycloheximide (20 g/ml) in the absence or presence of either MG132 (10 M) (A) or bafilomycin A1 (1 M) (B) and lysed at 0, 3, 6, and 12 h (WT) or at 0, 1, 2, and 4 h (D482G).
X
ABCB11 p.Asp482Gly 17947449:238:227
status: NEW244 In the eight PFIC2 mutants studied, D482G and E297G were predominantly distributed in the apical membrane and exhibited TC transport activity (D482G: 32.3% and E297G: 10.2% of WT).
X
ABCB11 p.Asp482Gly 17947449:244:36
status: NEWX
ABCB11 p.Asp482Gly 17947449:244:143
status: NEW247 Our observation that the D482G and E297G mutants exhibited less impaired transport activity than other mutants is in agreement with the clinical phenotype.
X
ABCB11 p.Asp482Gly 17947449:247:25
status: NEW248 The response to biliary diversion is better in PFIC2 patients carrying D482G and E297G mutations than in those with other mutations (27).
X
ABCB11 p.Asp482Gly 17947449:248:71
status: NEW290 From the view of maintenance of TC transport activity, the mutants could be aligned in the following order: A570T and R1050C Ͼ D482G Ͼ E297G Ͼ K461E, G982R, R1153C, R1268Q, 3767-3768insC, and R1057X.
X
ABCB11 p.Asp482Gly 17947449:290:133
status: NEW295 When we were preparing the manuscript, a paper appeared in which 4-phenylbutyrate (4PBA) was demonstrated to extend the half-life of cell surface-resident WT, E297G, and D482G BSEP by 1.8-, 2.5-, and 3.3-fold, respectively, in MDCK II cells (7).
X
ABCB11 p.Asp482Gly 17947449:295:170
status: NEW[hide] Update on progressive familial intrahepatic choles... J Pediatr Gastroenterol Nutr. 2008 Mar;46(3):241-52. Alissa FT, Jaffe R, Shneider BL
Update on progressive familial intrahepatic cholestasis.
J Pediatr Gastroenterol Nutr. 2008 Mar;46(3):241-52., [PMID:18376240]
Abstract [show]
Three distinct forms of familial intrahepatic cholestasis are the result of mutations in the ATP8B1, ABCB11, and ABCB4 genes. The pathophysiologies of the latter 2 of these diseases are well characterized and are the result of abnormalities in canalicular excretion of bile acids and phospholipids, respectively. The molecular pathophysiology of the systemic disease associated with mutations in ATP8B1 remains unclear. In all of these diseases, wide variations in clinical phenotypes have been observed. The variability can be ascribed at least in part to predicted genotype:phenotype correlations. Disease- and genotype-specific prognoses and therapeutic approaches may exist, although much more information needs to be ascertained before clinicians can confidently make decisions based on genetic information.
Comments [show]
None has been submitted yet.
No. Sentence Comment
188 Other common mutations include R575X, R1057X, G982R, C336S, R1153C, D482G, K461E, R1153C, R1268Q, R1090X, G238V, S114R, S593R, del 695, and del 3213 (66,67).
X
ABCB11 p.Asp482Gly 18376240:188:68
status: NEW192 The E297G and D482G mutations may yield proteins that are functional but do not traffic appropriately to the canalicular membrane.
X
ABCB11 p.Asp482Gly 18376240:192:14
status: NEW[hide] Diagnosis of BSEP/ABCB11 mutations in Asian patien... J Pediatr. 2008 Dec;153(6):825-32. Epub 2008 Aug 9. Chen HL, Liu YJ, Su YN, Wang NY, Wu SH, Ni YH, Hsu HY, Wu TC, Chang MH
Diagnosis of BSEP/ABCB11 mutations in Asian patients with cholestasis using denaturing high performance liquid chromatography.
J Pediatr. 2008 Dec;153(6):825-32. Epub 2008 Aug 9., [PMID:18692205]
Abstract [show]
OBJECTIVE: To determine if specific mutations were present in Asian patients with progressive familial intrahepatic cholestasis (PFIC) type 2 caused by defects in bile salt export pump (BSEP), encoded by ABCB11. STUDY DESIGN: A combination of denaturing high-performance liquid chromatography (DHPLC) and direct sequencing was used to screen ABCB11 mutations in 18 Taiwanese patients with low gamma-glutamyltransferase PFIC or benign recurrent intrahepatic cholestasis (BRIC). Polymorphisms were also analyzed in patients with PFIC (n = 21), neonatal cholestasis (n = 23), and control subjects (n = 88). RESULTS: Seven mutations in 4 of 16 patients with PFIC from different families were detected by DHPLC, including M183V, V284L, R303K, R487H, W493X, G1004D, and 1145delC. G1004D was found in a patient with BRIC. L827I was found in another patient with neonatal cholestasis. Absent or defective BSEP staining was found in the liver of patients with mutations. Polymorphisms V444A and A865V, with an allele frequencies 75.6% and 0.6%, respectively, were found in our population. No differences were found between patients with cholestasis and control subjects. CONCLUSIONS: One-fourth of Taiwanese patients with PFIC/BRIC had compound heterozygous or single heterozygous ABCB11 mutations without hot spots. All of the mutations were different from those detected in Western countries.
Comments [show]
None has been submitted yet.
No. Sentence Comment
28 In a recent study analyzing patients of mostly European origin, 82 mutations that occurred throughout the protein were detected in 109 families.13 Some mutations were found in a number of affected families of European descent, such as E297G and D482G.4,13-14 No such hot spots have been found in patients with ABCB11 mutations in other ethnic backgrounds, especially in Asian populations. In this study, we developed a method to perform ABCB11 genomic analysis more efficiently by first amplifying all of the ABCB11 exons, and then subjecting the exons to denaturing high performance liquid chromatography (DHPLC) analysis, followed by confirmation using direct sequencing.
X
ABCB11 p.Asp482Gly 18692205:28:245
status: NEW119 E297G and D482G were present in 58% of European families with PFIC, and the 2 mutations were proposed to originate from Northern Europe and Central/Eastern Europe, respectively.13 From our present data, there is no evidence that these mutations have spread to east Asia.
X
ABCB11 p.Asp482Gly 18692205:119:10
status: NEW[hide] Degradation of the bile salt export pump at endopl... Hepatology. 2008 Nov;48(5):1558-69. Wang L, Dong H, Soroka CJ, Wei N, Boyer JL, Hochstrasser M
Degradation of the bile salt export pump at endoplasmic reticulum in progressive familial intrahepatic cholestasis type II.
Hepatology. 2008 Nov;48(5):1558-69., [PMID:18798335]
Abstract [show]
The bile salt export pump (Bsep) represents the major bile salt transport system at the canalicular membrane of hepatocytes. When examined in model cell lines, genetic mutations in the BSEP gene impair its targeting and transport function, contributing to the pathogenesis of progressive familial intrahepatic cholestasis type II (PFIC II). PFIC II mutations are known to lead to a deficiency of BSEP in human hepatocytes, suggesting that PFIC II mutants are unstable and degraded in the cell. To investigate this further, we have characterized the impact of several PFIC II mutations on the processing and stability of rat Bsep. G238V, D482G, G982R, R1153C, and R1286Q all retain Bsep to the endoplasmic reticulum (ER) to different extents. Except for R1153C, the PFIC II mutants are degraded with varying half-lives. G238V and D482G are partially misfolded and can be stabilized by low temperature and glycerol. The proteasome provides the major degradation pathway for the PFIC II mutants, whereas the lysosome also contributes to the degradation of D482G. The PFIC II mutants appear to be more heavily ubiquitinated compared with the wild-type (wt) Bsep, and their ubiquitination is increased by the proteasome inhibitors. Overexpression of several E3 ubiquitin ligases, which are involved in ER-associated degradation (ERAD), lead to the decrease of both mutant and wt Bsep. Gene knockdown studies showed that the ERAD E3s Rma1 and TEB4 contribute to the degradation of G238V, whereas HRD1 contributes to the degradation of a mutant lacking the lumenal glycosylation domain (DeltaGly). Furthermore, we present evidence that G982R weakly associates with various components of the ER quality control system. These data together demonstrate that the PFIC II mutants except R1153C and DeltaGly are degraded by the ERAD pathway.
Comments [show]
None has been submitted yet.
No. Sentence Comment
4 G238V, D482G, G982R, R1153C, and R1286Q all retain Bsep to the endoplasmic reticulum (ER) to different extents.
X
ABCB11 p.Asp482Gly 18798335:4:7
status: NEW6 G238V and D482G are partially misfolded and can be stabilized by low temperature and glycerol.
X
ABCB11 p.Asp482Gly 18798335:6:10
status: NEW7 The proteasome provides the major degradation pathway for the PFIC II mutants, whereas the lysosome also contributes to the degradation of D482G.
X
ABCB11 p.Asp482Gly 18798335:7:139
status: NEW31 Inhibition of proteasomes also stabilized Bsep G238V, E297G, and D482G when examined in Madin-Darby canine kidney (MDCK) cells and human embryonic kidney (HEK) cells.8,10,13 These findings suggest that the proteasome plays a major role in the degradation of these BSEP mutants in PFIC II patients.
X
ABCB11 p.Asp482Gly 18798335:31:65
status: NEW48 The following missense mutants were studied in this work: G238V, D482G, G982R, R1153C, and R1286Q.
X
ABCB11 p.Asp482Gly 18798335:48:65
status: NEW82 The positions of G238V, D482G, G982R, R1153C, and R1286Q are indicated by star signs in a predicted topology model of rat Bsep.
X
ABCB11 p.Asp482Gly 18798335:82:24
status: NEW90 In contrast, the PFIC II mutants were mostly detected as core-glycosylated proteins, except G238V and D482G, for which a fraction of 190-kDa mature glycosylated form was also observed.
X
ABCB11 p.Asp482Gly 18798335:90:102
status: NEW96 For G238V and D482G, which are partially core-glycosylated, there is a partial colocalization between GFP-Bsep and calnexin.
X
ABCB11 p.Asp482Gly 18798335:96:14
status: NEW99 Besides different glycosylation pattern, PFIC II mutants were also noticeably expressed at lower levels compared with the wt protein, with D482G, G982R, and ⌬Gly showing the lowest expression (Fig. 2A).
X
ABCB11 p.Asp482Gly 18798335:99:139
status: NEW108 For D482G, approximately 30% of the core-glycosylated Fig. 2.
X
ABCB11 p.Asp482Gly 18798335:108:4
status: NEW118 protein was degraded, whereas a significant fraction was converted to the mature glycosylated form, indicating that this mutant is probably only weakly misfolded and a portion of correctly folded D482G can traffic through the secretory pathway.
X
ABCB11 p.Asp482Gly 18798335:118:196
status: NEW124 For G238V and D482G, respectively, only approximately 20% and 40% of the 140-kDa protein is converted to the 160-kDa protein, whereas approximately 50% of the 140-kDa protein is degraded over the 120-minute chase (Fig. 3D).
X
ABCB11 p.Asp482Gly 18798335:124:14
status: NEW125 These data suggest that the core-glycosylated G238V and D482G have a half-life of approximately 2 hours, which is consistent with the results from the cycloheximide chase studies, which used chase times up to 4 hours (Fig. 3A).
X
ABCB11 p.Asp482Gly 18798335:125:56
status: NEW126 The higher conversion percentage for D482G is also consistent with the data in Fig. 3A.
X
ABCB11 p.Asp482Gly 18798335:126:37
status: NEW127 The Effect of Low Temperature and Chemical on G238V and D482G.
X
ABCB11 p.Asp482Gly 18798335:127:56
status: NEW128 The data in Fig. 3 suggest that a portion of D482G and G238V can be converted to the mature glycosylated form over time during biosynthesis.
X
ABCB11 p.Asp482Gly 18798335:128:45
status: NEW129 We next asked whether conditions such as low temperature or chemical chaperones can stabilize D482G and G238V, because these conditions favor protein folding and have been shown to stabilize the misfolded mutant protein CFTR ⌬F508 during its biogenesis.19 Both incubation at low temperature (30°C) and addition of glycerol increases the peripheral, cell surface expression of GFP-tagged D482G and G238V in HEK cells (Fig. 4A).
X
ABCB11 p.Asp482Gly 18798335:129:94
status: NEWX
ABCB11 p.Asp482Gly 18798335:129:399
status: NEW130 This is confirmed by a higher percentage of mature glycosylated form in D482G and G238V in HEK cells under these conditions (Fig. 4B).
X
ABCB11 p.Asp482Gly 18798335:130:72
status: NEW131 These data together confirm the notion that a fraction of correctly folded D482G and G238V can traffic through secretory pathway, and this fraction is increased under the conditions that favor protein folding.
X
ABCB11 p.Asp482Gly 18798335:131:75
status: NEW133 Because the proteasome and lysosome provide two of the major degradation mechanisms in the cell, we next examined the contribution of these two pathways to the stability of G238V, D482G, and G982R.
X
ABCB11 p.Asp482Gly 18798335:133:180
status: NEW147 Low temperature and glycerol stabilize G238V and D482G.
X
ABCB11 p.Asp482Gly 18798335:147:49
status: NEW148 (A) The HEK 293 cells were transfected with wt GFP-Bsep, G238V, and D482G.
X
ABCB11 p.Asp482Gly 18798335:148:68
status: NEW156 In contrast, treatment with MG132 significantly stabilized the 170-kDa core-glycosylated form of G982R, D482G, and G238V.
X
ABCB11 p.Asp482Gly 18798335:156:104
status: NEW158 In contrast, the combination of ammonium chloride, leupeptin, and pepstatin only moderately increases the mature glycosylated form of D482G, while not affecting the expression of G238V or G982R.
X
ABCB11 p.Asp482Gly 18798335:158:134
status: NEW161 (A) The HEK 293 cells were transfected with the wt GFP-Bsep, G238V, D482G, and G982R.
X
ABCB11 p.Asp482Gly 18798335:161:68
status: NEW173 It is possible that D482G became prone to lysosome degradation when it traffics to a later stage of secretory pathway.
X
ABCB11 p.Asp482Gly 18798335:173:20
status: NEW174 It is also worth noting that the 190-kDa mature glycosylated form of D482G also increases by the treatment of MG132 compared with the control condition.
X
ABCB11 p.Asp482Gly 18798335:174:69
status: NEW175 This may reflect a situation that when the proteasome function is inhibited, the stabilized immature glycosylated D482G can traffic beyond the ER and is thus converted to the 190-kDa mature glycosylated form.
X
ABCB11 p.Asp482Gly 18798335:175:114
status: NEW183 However, the increase in ubiquitination is moderate for wt Bsep, compared with the mutant proteins G238V, D482G, G982R, and ⌬Gly.
X
ABCB11 p.Asp482Gly 18798335:183:106
status: NEW246 Taken together, the data from this study show that G238V, D482G, G982R, R1153C, R1286Q, and ⌬Gly mutations cause retention of Bsep in the ER to different extents.
X
ABCB11 p.Asp482Gly 18798335:246:58
status: NEW248 Although weakly expressed, a significant portion of D482G is expressed as mature glycosylated protein, which is consistent with previous reports showing that this mutant can be expressed at the cell surface and also retains bile salt transport function.8-10 These data together show that D482G is likely to be only a weakly misfolded mutant.
X
ABCB11 p.Asp482Gly 18798335:248:52
status: NEWX
ABCB11 p.Asp482Gly 18798335:248:288
status: NEW251 For mutants D482G and G238V, only a portion of immature glycosylated protein can be converted to mature glycosylated protein over the chase period, whereas a large pool of immature glycosylated protein is degraded.
X
ABCB11 p.Asp482Gly 18798335:251:12
status: NEW252 This suggests that D482G and G238V are partly misfolded.
X
ABCB11 p.Asp482Gly 18798335:252:19
status: NEW253 This notion is supported by the data showing that conditions favoring protein folding, such as low temperature or the addition of glycerol, stabilize D482G and G238V and increase the fraction of the mature glycosylated form and cell surface expression (Fig. 4).
X
ABCB11 p.Asp482Gly 18798335:253:150
status: NEW254 Proteasomes, rather than lysosomes, provide the major degradation pathway for the PFIC II mutants, whereas lysosome also moderately contributes to the degradation of D482G.
X
ABCB11 p.Asp482Gly 18798335:254:166
status: NEW255 This may reflect a situation that D482G can traffic through the secretory pathway, and at different stages of the secretory pathway it can be sorted to proteasome or lysosome for degradation.
X
ABCB11 p.Asp482Gly 18798335:255:34
status: NEW256 Kagawa et al.13 have recently also analyzed the degradation of D482G.
X
ABCB11 p.Asp482Gly 18798335:256:63
status: NEW257 Comparable results were seen for the stabilization of D482G by proteasome inhibitor MG132 in MDCK cells.
X
ABCB11 p.Asp482Gly 18798335:257:54
status: NEW263 In addition, G238V, D482G, G982R, and ⌬Gly become relatively more ubiquitinated, compared with wt Bsep, when the function of the proteasome is inhibited, consistent with the notion that these mutant Bseps are misfolded and thus unstable.
X
ABCB11 p.Asp482Gly 18798335:263:20
status: NEW300 This may be particularly pertinent to the rescue of those mutants that are partly misfolded but still functional, such as the D482G Bsep mutant.
X
ABCB11 p.Asp482Gly 18798335:300:126
status: NEW[hide] Short-chain ubiquitination is associated with the ... Mol Pharmacol. 2009 Jan;75(1):143-50. Epub 2008 Oct 1. Hayashi H, Sugiyama Y
Short-chain ubiquitination is associated with the degradation rate of a cell-surface-resident bile salt export pump (BSEP/ABCB11).
Mol Pharmacol. 2009 Jan;75(1):143-50. Epub 2008 Oct 1., [PMID:18829893]
Abstract [show]
The reduced expression of the bile salt export pump (BSEP/ABCB11) at the canalicular membrane is associated with cholestasis-induced hepatotoxicity due to the accumulation of bile acids in hepatocytes. We demonstrated previously that 4-phenylbutyrate (4PBA) treatment, a U.S. Food and Drug Administration-approved drug for the treatment of urea cycle disorders, induces the cell-surface expression of BSEP by prolonging the degradation rate of cell-surface-resident BSEP. On the other hand, BSEP mutations, E297G and D482G, found in progressive familial intrahepatic cholestasis type 2 (PFIC2), reduced it by shortening the degradation rate of cell-surface-resident BSEP. Therefore, to help the development of the medical treatment of cholestasis, we investigated the underlying mechanism by which 4PBA and PFIC2-type mutations affect the BSEP degradation from cell surface, focusing on short-chain ubiquitination. In Madin-Darby canine kidney II (MDCK II) cells expressing BSEP and rat canalicular membrane vesicles, the molecular mass of the mature form of BSEP/Bsep shifted from 170 to 190 kDa after ubiquitin modification (molecular mass, 8 kDa). Ubiquitination susceptibility of BSEP/Bsep was reduced in vitro and in vivo by 4PBA treatment and, conversely, was enhanced by BSEP mutations E297G and D482G. Moreover, biotin-labeling studies using MDCK II cells demonstrated that the degradation of cell-surface-resident chimeric protein fusing ubiquitin to BSEP was faster than that of BSEP itself. In conclusion, BSEP/Bsep is modified with two to three ubiquitins, and its ubiquitination is modulated by 4PBA treatment and PFIC2-type mutations. Modulation of short-chain ubiquitination can regulate the change in the degradation rate of cell-surface-resident BSEP by 4PBA treatment and PFIC2-type mutations.
Comments [show]
None has been submitted yet.
No. Sentence Comment
2 On the other hand, BSEP mutations, E297G and D482G, found in progressive familial intrahepatic cholestasis type 2 (PFIC2), reduced it by shortening the degradation rate of cell-surface-resident BSEP.
X
ABCB11 p.Asp482Gly 18829893:2:45
status: NEW5 Ubiquitination susceptibility of BSEP/Bsep was reduced in vitro and in vivo by 4PBA treatment and, conversely, was enhanced by BSEP mutations E297G and D482G.
X
ABCB11 p.Asp482Gly 18829893:5:152
status: NEW20 1 Copyright (c) 2009 The American Society for Pharmacology and Experimental Therapeutics 49288/3415636 Mol Pharmacol 75:143-150, 2009 Printed in U.S.A. degradation from the endoplasmic reticulum (ER) are responsible for the reduced cell-surface expression of BSEP in PFIC2 patients with E297G and D482G mutations (Hayashi and Sugiyama, 2007), both of which are the most frequently found in patients with PFIC2 (Strautnieks et al., 2008).
X
ABCB11 p.Asp482Gly 18829893:20:299
status: NEW42 The BD Adeno-X Adenoviral Expression System (BD Biosciences) was used to create BSEP, E297G BSEP, D482G BSEP, HA-BSEP, HA-BSEP-Ub⌬GG , and HA-BSEP-Ub⌬GG/I44A recombinant adenoviruses as described previously (Hayashi et al., 2005a).
X
ABCB11 p.Asp482Gly 18829893:42:98
status: NEW60 After a 24-h culture, confluent cells were infected with recombinant adenovirus containing cDNAs for BSEP, E297G BSEP, D482G BSEP, HA-BSEP, and GFP at a multiplicity of infection of 200.
X
ABCB11 p.Asp482Gly 18829893:60:119
status: NEW112 We reported previously that E297G and D482G, frequent mutations in PFIC2 patients, shorten the half-life of cell-surface-resident BSEP by approximately 1.5-and 4-fold, respectively, and, conversely, 4PBA treatment prolongs cell-surface-resident BSEP 2-fold (Hayashi and Sugiyama, 2007).
X
ABCB11 p.Asp482Gly 18829893:112:38
status: NEW113 To explore a possible correlation between the half-life of cell-surface-resident BSEP and the short-chain ubiquitination susceptibility of BSEP, mutated BSEP was immunoprecipitated from MDCK II cells expressing E297G BSEP and D482G BSEP, and the immunoprecipitates were subjected to Western blot analysis for Ub and BSEP (Fig. 2A).
X
ABCB11 p.Asp482Gly 18829893:113:226
status: NEW115 Quantitative densitometry analysis revealed that the ratio of the short-chain ubiquitinated BSEP, PFIC2-type mutated BSEPs (Figs. 2A and 3, A and B, arrow) to the mature form of BSEP, PFIC2-type mutated BSEPs (Figs. 2A and 3, A and B, filled arrowhead) was significantly greater, 6- and 30-fold by E297G and D482G mutations, respectively, than that in wild-type BSEP (Fig. 2B), and was reduced in a time-dependent manner after 4PBA treatment in vitro (Fig. 3, D and E).
X
ABCB11 p.Asp482Gly 18829893:115:308
status: NEW120 A, short-chain ubiquitination susceptibility of PFIC2-type mutated BSEPs, E297G BSEP and D482G BSEP.
X
ABCB11 p.Asp482Gly 18829893:120:89
status: NEW126 Open, gray, and closed columns represent the ratio of band density indicating the short-chain ubiquitinated BSEP to that indicating the mature form of BSEP in MDCK II cells expressing BSEP, E297G BSEP, and D482G BSEP, respectively. Each bar represents the mean Ϯ S.E., n ϭ 3 to 4. Asterisks represent statistically significant differences between BSEP and mutated BSEP, ,ء P Ͻ 0.05, and ,ءء P Ͻ 0.01.
X
ABCB11 p.Asp482Gly 18829893:126:206
status: NEW148 We have found previously that shortening the half-life of cell-surface-resident BSEP is partly responsible for the reduced cell surface expression of BSEP in patients with PFIC2 with E297G and D482G mutations (Hayashi and Sugiyama, 2007).
X
ABCB11 p.Asp482Gly 18829893:148:193
status: NEW[hide] Prenatal diagnosis of progressive familial intrahe... J Gastroenterol Hepatol. 2008 Sep;23(9):1390-3. Chen ST, Chen HL, Su YN, Liu YJ, Ni YH, Hsu HY, Chu CS, Wang NY, Chang MH
Prenatal diagnosis of progressive familial intrahepatic cholestasis type 2.
J Gastroenterol Hepatol. 2008 Sep;23(9):1390-3., [PMID:18853996]
Abstract [show]
BACKGROUND AND AIM: Progressive familial intrahepatic cholestasis type 2 (PFIC2) results from genetic defects of the hepatobiliary bile salt export pump (BSEP, ABCB11) at chromosome 2q24. Patients with progressive cholestasis and liver cirrhosis usually need liver transplantation in the first decade. Mutations in ABCB11 are also associated with benign recurrent intrahepatic cholestasis type 2 and intrahepatic cholestasis of pregnancy in adult patients. We aimed to make the prenatal diagnosis of PFIC2. METHODS: Genetic diagnosis was performed by genomic DNA analysis. Prenatal genetic diagnosis was made by fetal amniotic DNA and chorionic DNA analysis. RESULTS: We report on two families of PFIC2 with inherited compound heterozygous mutations of ABCB11 (M183V and R303K in Family 1, V284L and 1145delC in Family 2) from the parents. An infant with heterozygous M183V mutation was later born healthy in Family 1. A fetus with compound heterozygous missense mutation V284L and 1145delC was terminated in Family 2. CONCLUSION: Prenatal diagnosis of PFIC2 was helpful to prevent further affected children in families with this fatal disease.
Comments [show]
None has been submitted yet.
No. Sentence Comment
103 Some common mutations have been found in European patients, such as E297G and D482G.15 There is no hotspot found in Asian patients reported from Taiwan and Japan.9,16 In this study, the four mutations found in the two families had not been found in European or Japanese patients.
X
ABCB11 p.Asp482Gly 18853996:103:78
status: NEW[hide] Contribution of variant alleles of ABCB11 to susce... Gut. 2009 Apr;58(4):537-44. Epub 2008 Nov 5. Dixon PH, van Mil SW, Chambers J, Strautnieks S, Thompson RJ, Lammert F, Kubitz R, Keitel V, Glantz A, Mattsson LA, Marschall HU, Molokhia M, Moore GE, Linton KJ, Williamson C
Contribution of variant alleles of ABCB11 to susceptibility to intrahepatic cholestasis of pregnancy.
Gut. 2009 Apr;58(4):537-44. Epub 2008 Nov 5., [PMID:18987030]
Abstract [show]
BACKGROUND: Intrahepatic cholestasis of pregnancy (ICP) has a complex aetiology with a significant genetic component. ABCB11 encodes the bile salt export pump (BSEP); mutations cause a spectrum of cholestatic disease, and are implicated in the aetiology of ICP. METHODS: ABCB11 variation in ICP was investigated by screening for five mutant alleles (E297G, D482G, N591S, D676Y and G855R) and the V444A polymorphism (c.1331T>C, rs2287622) in two ICP cohorts (n = 333 UK, n = 158 continental Europe), and controls (n = 261) for V444A. PCR primers were used to amplify and sequence patient and control DNA. The molecular basis for the observed phenotypes was investigated in silico by analysing the equivalent residues in the structure of the homologous bacterial transporter Sav1866. RESULTS: E297G was observed four times and D482G once. N591S was present in two patients; D676Y and G855R were not observed. The V444A polymorphism was associated with ICP (allelic analysis for C vs T: OR 1.7 (95% CI 1.4 to 2.1, p<0.001)). In addition, CC homozygotes were more likely to have ICP than TT homozygotes: OR 2.8 (95% CI 1.7 to 4.4 p<0.0001). Structural analyses suggest that E297G and D482G destabilize the protein fold of BSEP. The molecular basis of V444A and N591S was not apparent from the Sav1866 structure. CONCLUSIONS: Heterozygosity for the common ABCB11 mutations accounts for 1% of European ICP cases; these two mutants probably reduce the folding efficiency of BSEP. N591S is a recurrent mutation; however, the mechanism may be independent of protein stability or function. The V444A polymorphism is a significant risk factor for ICP in this population.
Comments [show]
None has been submitted yet.
No. Sentence Comment
2 Methods: ABCB11 variation in ICP was investigated by screening for five mutant alleles (E297G, D482G, N591S, D676Y and G855R) and the V444A polymorphism (c.1331T.C, rs2287622) in two ICP cohorts (n = 333 UK, n = 158 continental Europe), and controls (n = 261) for V444A.
X
ABCB11 p.Asp482Gly 18987030:2:95
status: NEW5 Results: E297G was observed four times and D482G once.
X
ABCB11 p.Asp482Gly 18987030:5:43
status: NEW9 Structural analyses suggest that E297G and D482G destabilise the protein fold of BSEP.
X
ABCB11 p.Asp482Gly 18987030:9:43
status: NEW18 ABCC2 (encoding MRP2) variation has also been implicated in ICP in a South American cohort,23 but this has not been replicated to date in European populations.24 BSEP is a high affinity liver-specific transporter, which is responsible for the export of conjugated bile acids into the bile canaliculus.25-27 It is a member of the ABC transporter family of proteins, of which there are 48 members in the human genome and whose functions include the transport of a range of substances including lipids, drugs, cholesterol and bile salts.28 Two mutant alleles of ABCB11, namely E297G and D482G, have been found frequently in European families and one or both are present in 58%.29 The function of BSEP and the role of ABCB11 mutations in PFIC and BRIC indicate that variation in this gene could be involved in the aetiology of ICP.
X
ABCB11 p.Asp482Gly 18987030:18:584
status: NEW21 BSEP is homologous with the bacterial multidrug resistance protein (Sav1866) for which two structures have recently been determined at high resolution by x ray crystallography.35 36 We therefore used this structure to consider the possible effects of E297G, D482G, N591S and V444A on BSEP, all of which were identified in patients with ICP, to provide insights into potential mutational mechanisms.
X
ABCB11 p.Asp482Gly 18987030:21:258
status: NEW48 RESULTS Sequencing DNA sequence was generated for the UK ICP cohort (333 patients) for exons 9 and 14 which contain the common European mutations E297G and D482G, together with exons 15, 17 and 21 containing the previously described ICP-linked mutation (N591S) and the two DIC-linked mutations (D676Y and G855R), respectively.
X
ABCB11 p.Asp482Gly 18987030:48:156
status: NEW52 Analysis of exon 14 did not identify any carriers of D482G, and no carriers of the DIC mutations were identified.
X
ABCB11 p.Asp482Gly 18987030:52:53
status: NEW54 In this cohort, a single occurrence each of E297G and D482G was identified together with two occurrences of N591S.
X
ABCB11 p.Asp482Gly 18987030:54:54
status: NEW75 Replacing this conserved aspartic acid with a glycine (as in BSEP D482G) would probably destabilise this region of the protein and may prevent correct folding of the entire b-roll.
X
ABCB11 p.Asp482Gly 18987030:75:66
status: NEW77 S363 occupies the position of V444 in Sav1866. S363 hydrogen-bonds with D341 in an adjacent antiparallel b-strand within the Sav1866 NBD (fig 2C), but as it is only one of many bonds between the Table 1 Clinical features of ICP patients with heterozygous ABCB11 mutations Patient No Cohort Biochemistry (highest level measured) Other maternal clinical findings Fetal and labour complications Family history of ICPBile acids* ALT* GGT* E297G 1 UK 32 133 27 - - Yes 2{ UK 41 166 16 - M, H No 3{ UK 118 229 NP G, C Pr No 4 CE 41 82 NP - - No D482G 5 CE 74 98 15 J, P, BR - No N591S 6 CE 270 195 29 - - - 7 CE 32 60 11 - - - *Normal ranges: bile acids, ,14 mmol/l; alanine aminotransferase (ALT), (31 IU/l; c-glutamyl transferase (GGT), ,30 IU/l; bilirubin (BR), ,17 mmol/l.
X
ABCB11 p.Asp482Gly 18987030:77:539
status: NEW88 Indeed, in the sequence of MJ0796 from Methanococcus jannaschii this position is occupied by a serine, suggesting that the serine side chain is likely to be tolerated as a replacement for N591 in BSEP.38 DISCUSSION We report here the identification of seven heterozygous carriers of BSEP (ABCB11) mutations (four E297G, one D482G and two N591S) in a large cohort of patients with ICP.
X
ABCB11 p.Asp482Gly 18987030:88:324
status: NEW91 To understand the effects of PFIC and BRIC mutations, several groups have studied the effects of the E297G and D482G mutations on BSEP expression, transport, localisation, function and stability, in vitro.
X
ABCB11 p.Asp482Gly 18987030:91:111
status: NEW92 The D482G mutation has been studied in mouse,39 rat40-42 and human43 BSEP and, when expressed in mammalian cell lines at physiological temperature, all of the studies report reduced plasma membrane expression of the recombinant protein (quantified at 5%42 and 26%41 of the level of the wild-type protein).
X
ABCB11 p.Asp482Gly 18987030:92:4
status: NEW94 These data can be explained if the D482G mutant has a protein folding defect that slows progression through the trafficking pathway, resulting in much of the protein being degraded via the proteasome.
X
ABCB11 p.Asp482Gly 18987030:94:35
status: NEW95 Our structural analysis is entirely consistent with this interpretation and provides a molecular explanation for the observed phenotype, as the D482G change should destabilise the b-roll of NBD1.
X
ABCB11 p.Asp482Gly 18987030:95:144
status: NEW103 Table 3 Allelic analysis for the V444A polymorphism associated with cholestasis Allele OR (95%CI) p Value C vs T 1.70 (1.4 to 2.1) ,0.001 Table 4 Genotypic analysis for the V444A polymorphism associated with cholestasis OR (95% CI) p Value CC vs CT 1.9 (1.3 to 2.6) ,0.001 CC vs TT 2.8 (1.7 to 4.4) ,0.001 CC and CT vs TT 1.9 (1.3 to 2.9) 0.001 Biliary tract Gut 2009;58:537-544. doi:10.1136/gut.2008.159541 Figure 2 The structure of Sav1866 suggests a molecular mechanism for the bile salt export pump (BSEP) mutations E297G and D482G (A) Schematic representation of the drug exporter Sav1866 with two bound ADPs shown as spheres (pdb 2HYD).
X
ABCB11 p.Asp482Gly 18987030:103:532
status: NEW115 The N-terminal Biliary tract Gut 2009;58:537-544. doi:10.1136/gut.2008.159541 of the E297G mutant is likely to be less stable, resulting in reduced expression at the plasma membrane, but, because of the position of this residue at the interface between the domains, mutant protein at the cell surface may also be deficient in communication between the bile acid-binding sites and the ATP catalytic sites, offering a molecular explanation for the uncoupling observed in one of the studies.42 However, the underlying codon change in the D482G mutant may also impair RNA splicing,45 raising the possibility that the phenotypic effect of the 482G codon may be mediated earlier in the gene expression pathway.
X
ABCB11 p.Asp482Gly 18987030:115:537
status: NEW122 Our results suggest that the common E297G and D482G mutations of this gene do not play a major role in ICP predisposition in our population.
X
ABCB11 p.Asp482Gly 18987030:122:46
status: NEW124 However, the single carrier of D482G was a primigravid woman who had an extended phenotype with markedly elevated liver enzymes and hyperbilirubinaemia in the postnatal period.
X
ABCB11 p.Asp482Gly 18987030:124:31
status: NEW127 The 444A allele may contribute to susceptibility in a considerably higher number of cases of ICP than the E297G and D482G mutations.
X
ABCB11 p.Asp482Gly 18987030:127:116
status: NEW[hide] Missense mutations and single nucleotide polymorph... Hepatology. 2009 Feb;49(2):553-67. Byrne JA, Strautnieks SS, Ihrke G, Pagani F, Knisely AS, Linton KJ, Mieli-Vergani G, Thompson RJ
Missense mutations and single nucleotide polymorphisms in ABCB11 impair bile salt export pump processing and function or disrupt pre-messenger RNA splicing.
Hepatology. 2009 Feb;49(2):553-67., [PMID:19101985]
Abstract [show]
The gene encoding the human bile salt export pump (BSEP), ABCB11, is mutated in several forms of intrahepatic cholestasis. Here we classified the majority (63) of known ABCB11 missense mutations and 21 single-nucleotide polymorphisms (SNPs) to determine whether they caused abnormal ABCB11 pre-messenger RNA splicing, abnormal processing of BSEP protein, or alterations in BSEP protein function. Using an in vitro minigene system to analyze splicing events, we found reduced wild-type splicing for 20 mutations/SNPs, with normal mRNA levels reduced to 5% or less in eight cases. The common ABCB11 missense mutation encoding D482G enhanced aberrant splicing, whereas the common SNP A1028A promoted exon skipping. Addition of exogenous splicing factors modulated several splicing defects. Of the mutants expressed in vitro in CHO-K1 cells, most appeared to be retained in the endoplasmic reticulum and degraded. A minority had BSEP levels similar to wild-type. The SNP variant A444 had reduced levels of protein compared with V444. Treatment with glycerol and incubation at reduced temperature overcame processing defects for several mutants, including E297G. Taurocholate transport by two assessed mutants, N490D and A570T, was reduced compared with wild-type. Conclusion: This work is a comprehensive analysis of 80% of ABCB11 missense mutations and single-nucleotide polymorphisms at pre-mRNA splicing and protein processing/functional levels. We show that aberrant pre-mRNA splicing occurs in a considerable number of cases, leading to reduced levels of normal mRNA. Thus, primary defects at either the protein or the mRNA level (or both) contribute significantly to BSEP deficiency. These results will help to develop mutation-specific therapies for children and adults suffering from intrahepatic cholestasis due to BSEP deficiency.
Comments [show]
None has been submitted yet.
No. Sentence Comment
3 The common ABCB11 missense mutation encoding D482G enhanced aberrant splicing, whereas the common SNP A1028A promoted exon skipping.
X
ABCB11 p.Asp482Gly 19101985:3:45
status: NEW67 ABCB11 Missense Mutations and SNPs Functionally Analyzed in This Study Exon Nucleotide Change Predicted Protein Effect Location in Protein Associated Phenotype Prevalence or Frequency* Any Defect(s) Identified Reference 4 c.149TϾC L50S NH2 term PFIC 1 family (het) Immature protein 31 5 c.270TϾC F90F EC1 SNP 2.7%-7.7% 43, 45 6 c.403GϾA E135K EC1 BRIC 1 family (het) Reduced levels of mature protein † 6 c.409GϾA E137K EC1 BRIC / ICP 1 family (het) Immature protein ‡ 7 c.500CϾT A167V TM2 PFIC 1 family (hom) Mild exon skipping beta 7 c.557AϾG E186G IC1 BRIC 2 families (both het) Moderate exon skipping; greatly reduced levels of mature protein 8, 37 7 c.580TϾC S194P IC1 SNP-PSC 1.1% 43 7 c.593TϾC L198P IC1 BRIC / ICP / DC 1 family (het) Greatly reduced levels of mature protein # 8 c.713GϾT G238V EC2 PFIC 1 family (hom) 29 8 c.725CϾT T242I TM4 PFIC 1 family (het) 31 8 c.779GϾA G260D TM4 SNP-PBC 0.8% 43 9 c.850GϾC V284L IC2 PFIC 1 family (het) No protein 28 9 c.851TϾC V284A IC2 SNP 0.5% Increased levels of mature protein 43, 45† 9 c.889GϾA E297K IC2 Prolonged NNH 1 family (het) Moderate differential splicing; immature protein ‡ 9 c. 890AϾG E297G IC2 PFIC, BRIC PFIC, 45 families (14 hom, 31 het) BRIC, 4 families (2 hom, 2 het) Greatly reduced levels of mature protein 7, 8, 12, 29-32, 35 10 c.936GϾT Q312H IC2 PFIC 1 family (het) ‡ 10 c.937CϾA R313S IC2 PFIC 1 family (het) 31 10 c.957AϾG G319G TM5 SNP 1.5 - 7.5% Mild exon skipping 42, 43, 45 10 c.980GϾA G327E TM5 PFIC 1 family (het) 31 10 c.1007GϾC C336S TM5 PFIC 1 family (het) 29 11 c.1168GϾC A390P NBF PFIC, BRIC 2 families (both het) Immature protein 31; # 12 c.1129GϾA G410D NBF PFIC 1 family (het) 31 12 c.1238TϾG L413W NBF PFIC 1 family (het) Greatly reduced levels of mature protein 31 12 c.1244GϾA R415Q NBF SNP-ICP 1.3% 42 12 c.1295GϾC R432T NBF BRIC 1 family (het) Reduced levels of mature protein 12 13 c.1331CϾT A444V NBF SNP, ICP, CC, DC, BRIC 43-60% Increased levels of mature protein 8, 28, 37, 39-45 13 c.1381AϾG K461E WA PFIC 1 family (hom) Immature protein 7 13 c.1388CϾT T463I WA PFIC 1 family (het) Mild exon skipping 31 13 c.1396CϾA Q466K Adj WA PFIC 1 family (het) 31 13 c.1409GϾA R470Q Adj WA PFIC 2 families (1 het, 1 consanguineous) Immature protein 31 14 c.1442TϾA V481E NBF1 PFIC 1 family (het) 31 14 c.1445AϾG D482G NBF1 PFIC 22 families (16 het, 6 hom) Severe differential splicing; immature protein 7, 30-32 14 c.1468AϾG N490D NBF1 PFIC 1 family (het) Greatly reduced levels of mature protein; reduction in bile salt transport 31 14 c.1493TϾC I498T NBF1 PFIC / BRIC 1 family (het) 38 14 c.1530CϾA T510T NBF1 SNP-PBC 0.7% 43 14 c.1535TϾC I512T NBF1 PFIC 1 family (het) 31 14 c.1544AϾC N515T NBF1 PFIC 1 family (het) 31, 32 14 c.1440GϾA R517H NBF1 PFIC 1 family (het) No protein 31, 32 14 c.1605CϾT A535A NBF1 SNP 0.3% Slightly reduced levels mature protein 39, 45 14 c.1621AϾC I541L NBF1 PFIC 3 families (1 het, 2 consanguineous) No protein 31-33 15 c.1643TϾA F548Y Adj ABCm PFIC 1 family (het) 31, 32 15 c.1685GϾA G562D ABCm PFIC 1 family (het) 31 15 c.1708GϾA A570T Adj ABCm/WB PFIC, BRIC PFIC, 1 family Greatly reduced levels of mature protein; reduction in bile salt transport 8, 31 Table 1.
X
ABCB11 p.Asp482Gly 19101985:67:2530
status: NEW93 Differential splice products were seen for six predicted ABCB11 missense mutations, leading to very low levels of wild-type splicing (indicated in parentheses): E297K (c.889GϾA; 50%; Fig. 2B), D482G (c.1445AϾG; 5%; Fig. 2C), R832C (c.2494CϾT; 50%; Fig. 2E), and S1144R (c.3432CϾA; 3%), R1153H (c.3458GϾA; 3%), and S1154P (c.3460TϾC; 3%; Fig. 2F).
X
ABCB11 p.Asp482Gly 19101985:93:199
status: NEW107 Scanning of exon 14 with the ESS prediction programme FAS-ESS52,53 indicates that the mutant D482G (c.1445AϾG) nucleotide sequence causes the introduction of two additional ESS hexamers, whereas the adjacent V481E (c.1442TϾA) does not.
X
ABCB11 p.Asp482Gly 19101985:107:93
status: NEW111 Positive-acting and negative-act- Exon 14 D482G Aberrant product Exon 14Minigene Cryptic acceptor splice Exon 14 CTACCACCATTGCAGAAAATATTCGCTATG ATACCATCATCCCAGAAAATATTCGCTATG ATCTCTTTTCACCCAATTTCTACAGGGCAATGCTGGGGCAAGAT Exon 21Exon 20 R832C Aberrant product AAGGCTACGTAAATTTGGTTTCAGGGCAATGCTGGGGCAAGAT AAGGCTATGTAAATTTGGTTTCAGGGCAATGCTGGGGCAAGAT Exon 21 R832C Exon 21 Cryptic acceptor splice Exon 9 E297K Aberrant product CTGCTTTTGGTGGTGAGAAAAGAGAGGTTGAAAGgttggtta Normal donor splice siteCryptic donor splice site CTGCTTTTGGTGGTAAGAAAAGAGAGGTTGAAAGgttggttaE297K Exon 9 CTGCTTTTGGTGCTGTTCCTCCTCCCACTGACCTGCGATT MinigeneExon 9 Intron 9 Intron 9 S1144R, R1153H, S1154P Aberrant product Exon 26 ATACCATCATCCCAGGAACCAGTGTTGTTTGCCT Exon 26Minigene AATTGTTTCCCAGGAACCAGTGTTGTTTGCCTCAG Cryptic acceptor splice D Fig. 3.
X
ABCB11 p.Asp482Gly 19101985:111:42
status: NEW112 (A-D) Illustration of variant splice forms associated with ABCB11 mutations (A) E297K, (B) D482G, (C) R832C, and (D) S1144R, R1153H, and S1154P.
X
ABCB11 p.Asp482Gly 19101985:112:91
status: NEW123 No added splicing factor substantially altered the cryptic splicing pattern associated with the D482G (c.1445AϾG) nucleotide substitution (Fig. 4A).
X
ABCB11 p.Asp482Gly 19101985:123:96
status: NEW155 D482G (c.1445AϾG) showed an improvement on treatment, but mature protein levels were lower than those for wild-type BSEP (Fig. 6D).
X
ABCB11 p.Asp482Gly 19101985:155:0
status: NEW170 Of the ABCB11 nucleotide changes assayed for pre-mRNA splicing defects, the introduction into exon 14 of the one predicted to generate D482G (c.1445AϾG) resulted in the predominant use of a cryptic splice site within this exon (Figs.
X
ABCB11 p.Asp482Gly 19101985:170:135
status: NEW172 D482G is one of the most common PFIC missense mutations in European patients, and in vitro studies have differed in their conclusions on Fig. 7.
X
ABCB11 p.Asp482Gly 19101985:172:0
status: NEW183 Therefore, if such splicing predominates in vivo, D482G-containing BSEP, per se, may only exist at very low levels in hepatocytes.
X
ABCB11 p.Asp482Gly 19101985:183:50
status: NEW185 Of BSEP deficiency patients who developed malignancy, 16% have the D482G mutation,30,31,35 putatively making it a more severe disease-causing mutation than previously recognized.
X
ABCB11 p.Asp482Gly 19101985:185:67
status: NEW187 Additionally, D482G-containing mRNA in vivo appears to be unstable, because in a previous small study from our group, liver from a patient heterozygous for D482G yielded no PCR-amplifiable ABCB11 exon 13 to exon 15 (indicating that the second mutation also resulted in deficiency of ABCB11 mRNA).61 The fact that the D482G-associated cryptic splicing could not be modulated by the addition of exogenous SC35 splicing factor (Fig. 4A) may make it more difficult to develop novel treatments to overcome this particular defect.
X
ABCB11 p.Asp482Gly 19101985:187:14
status: NEWX
ABCB11 p.Asp482Gly 19101985:187:156
status: NEWX
ABCB11 p.Asp482Gly 19101985:187:317
status: NEW220 A recent study introduced E297G and D482G into human BSEP and assessed their trafficking in MDCK cells.66 The addition of sodium 4-phenylbutyrate prolonged the half-life of both mutant BSEP forms and resulted in increased functional expression of the proteins.
X
ABCB11 p.Asp482Gly 19101985:220:36
status: NEW221 This concurs with the data presented here, which show reduced levels of mature BSEP when E297G and D482G were expressed in vitro (Fig. 5D).
X
ABCB11 p.Asp482Gly 19101985:221:99
status: NEW222 Furthermore, the addition of 10% glycerol and incubation at 28°C resulted in a substantial and a marginal increase in mature E297G and D482G protein, respectively (Fig. 6A, D).
X
ABCB11 p.Asp482Gly 19101985:222:140
status: NEW223 For D482G, we found significant splicing defects (see previous discussion).
X
ABCB11 p.Asp482Gly 19101985:223:4
status: NEW224 Neither this treatment nor sodium 4-phenylbutyrate could have any clinical effect if normal D482G mRNA processing were almost completely disrupted by aberrant splicing in patients, as suggested by our results in vitro.
X
ABCB11 p.Asp482Gly 19101985:224:92
status: NEW240 Similarly, nucleotide changes not predicted to cause any abnormalities, such as D482G (c.1445AϾG), did disrupt splicing.
X
ABCB11 p.Asp482Gly 19101985:240:80
status: NEW[hide] Progressive familial intrahepatic cholestasis. Orphanet J Rare Dis. 2009 Jan 8;4:1. Davit-Spraul A, Gonzales E, Baussan C, Jacquemin E
Progressive familial intrahepatic cholestasis.
Orphanet J Rare Dis. 2009 Jan 8;4:1., [PMID:19133130]
Abstract [show]
Progressive familial intrahepatic cholestasis (PFIC) refers to heterogeneous group of autosomal recessive disorders of childhood that disrupt bile formation and present with cholestasis of hepatocellular origin. The exact prevalence remains unknown, but the estimated incidence varies between 1/50,000 and 1/100,000 births. Three types of PFIC have been identified and related to mutations in hepatocellular transport system genes involved in bile formation. PFIC1 and PFIC2 usually appear in the first months of life, whereas onset of PFIC3 may also occur later in infancy, in childhood or even during young adulthood. Main clinical manifestations include cholestasis, pruritus and jaundice. PFIC patients usually develop fibrosis and end-stage liver disease before adulthood. Serum gamma-glutamyltransferase (GGT) activity is normal in PFIC1 and PFIC2 patients, but is elevated in PFIC3 patients. Both PFIC1 and PFIC2 are caused by impaired bile salt secretion due respectively to defects in ATP8B1 encoding the FIC1 protein, and in ABCB11 encoding the bile salt export pump protein (BSEP). Defects in ABCB4, encoding the multi-drug resistant 3 protein (MDR3), impair biliary phospholipid secretion resulting in PFIC3. Diagnosis is based on clinical manifestations, liver ultrasonography, cholangiography and liver histology, as well as on specific tests for excluding other causes of childhood cholestasis. MDR3 and BSEP liver immunostaining, and analysis of biliary lipid composition should help to select PFIC candidates in whom genotyping could be proposed to confirm the diagnosis. Antenatal diagnosis can be proposed for affected families in which a mutation has been identified. Ursodeoxycholic acid (UDCA) therapy should be initiated in all patients to prevent liver damage. In some PFIC1 or PFIC2 patients, biliary diversion can also relieve pruritus and slow disease progression. However, most PFIC patients are ultimately candidates for liver transplantation. Monitoring of hepatocellular carcinoma, especially in PFIC2 patients, should be offered from the first year of life. Hepatocyte transplantation, gene therapy or specific targeted pharmacotherapy may represent alternative treatments in the future.
Comments [show]
None has been submitted yet.
No. Sentence Comment
88 Missense mutations are also common defects [25] that either affect protein processing and trafficking (i.e. p.E297G, p.D482G) [26,27] or disrupt functional domains and protein structure.
X
ABCB11 p.Asp482Gly 19133130:88:119
status: NEW180 Preliminary data suggest that PFIC2 patients with p.D482G or p.E297G mutations may respond well to biliary diversion [60].
X
ABCB11 p.Asp482Gly 19133130:180:52
status: NEW[hide] The transporter "variome": the missing link betwee... Hepatology. 2009 Feb;49(2):352-4. Mullenbach R, Lammert F
The transporter "variome": the missing link between gene variants and bile salt transporter function.
Hepatology. 2009 Feb;49(2):352-4., [PMID:19177487]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
24 The results of the present study are consistent with data from recent high-throughput sequencing of transcripts, demonstrating that exon skipping is the most prevalent form of alternative splicing.12 This type of analysis also explains why some transporter variants that may appear to have rather low impact on the protein level, such as p.D482G,13 one of the most common PFIC missense mutations in Europe, give rise to a comparatively severe phenotype: The authors describe how this variant leads to altered pre-mRNA splicing, resulting in an mRNA which, when translated, introduces 14 novel amino acids, followed by a stop codon.
X
ABCB11 p.Asp482Gly 19177487:24:340
status: NEW25 This represents a much more serious alteration than the replacement of one amino acid, and the severity of the splice-induced abnormality explains the almost complete lack of detectable BSEP protein in immunohistochemical analysis of livers from patients with the p.D482G mutation.13,14 Of note, a patient with obstetric cholestasis carrying this variant also displayed a severe phenotype resolving only in part after delivery.3 Additional weight is added to the results from the splice site analyses by the fact that the development of hepatocellular carcinoma and cholangiocarcinoma is highly associated with splice site changes, deletions, insertions, and nonsense mutations predicted to result in total absence of BSEP protein.
X
ABCB11 p.Asp482Gly 19177487:25:266
status: NEW36 (4) Generation of a novel splice donor or acceptor site by an exonic variant may create exon skipping or missplicing, thereby creating a premature stop codon (as seen in ABCB11 p.D482G) or generating instable mRNA species.
X
ABCB11 p.Asp482Gly 19177487:36:179
status: NEW[hide] Recent insights into the function and regulation o... Curr Opin Lipidol. 2009 Jun;20(3):176-81. Stieger B
Recent insights into the function and regulation of the bile salt export pump (ABCB11).
Curr Opin Lipidol. 2009 Jun;20(3):176-81., [PMID:19684528]
Abstract [show]
PURPOSE OF REVIEW: Generation of bile is an important function of the liver. Its impairment can be caused by inherited mutations or by acquired factors and leads to cholestasis. Bile salts are an important constituent of bile and are secreted by the bile salt export pump (BSEP) from hepatocytes. RECENT FINDINGS: Significant progress was made in the understanding of mechanisms and consequences of malfunctioning BSEP. This information was gained from extensive characterization of patients with inherited BSEP deficiency and the subsequent characterization of the identified mutations in heterologous expression systems. Furthermore and importantly, clinical evidence shows that patients with severe BSEP deficiency are at risk to develop hepatocellular carcinoma. Bile salts are now recognized to be important in the modulation of whole body energy homeostasis. Because BSEP is the rate-limiting step in hepatocellular bile salt transport, it controls the spill over of bile salts into the systemic circulation. Therefore, an indirect role of BSEP in energy homeostasis becomes more and more likely. SUMMARY: In summary, knowledge on the physiologic and pathophysiologic role of BSEP is rapidly progressing. It can be anticipated that the next major step in better understanding BSEP should come from information on structure-function relationship. However, given the difficulty in structure determination of mammalian transporters, this will require major efforts.
Comments [show]
None has been submitted yet.
No. Sentence Comment
36 This study [13 ] also revealed that the common E297G and D482G mutant forms of BSEP varied most in their expression level between patients.
X
ABCB11 p.Asp482Gly 19684528:36:58
status: NEW37 This is of interest, as E297G and D482G have been shown to display residual [14] and normal [15] transport activity, respectively.
X
ABCB11 p.Asp482Gly 19684528:37:34
status: NEW41 Of note, the mutant D482G, which is common in Europe, displayed enhancement of aberrant splicing.
X
ABCB11 p.Asp482Gly 19684528:41:20
status: NEW42 This provides a possible explanation for the wide variation of BSEP expression found in patients with D482G mutations leading to clinical phenotypes with variable severity.
X
ABCB11 p.Asp482Gly 19684528:42:102
status: NEW76 Interestingly, the D482G mutation was found to exhibit decreased transport activity in this study, but after being cloned into mouse Bsep it displayed normal function [48].
X
ABCB11 p.Asp482Gly 19684528:76:19
status: NEW81 Interestingly, it was demonstrated that levels of the E297G and the D482G mutants of BSEP could be increased at the plasma membrane, if cells were treated with 4-phenylbutyrate [53 ].
X
ABCB11 p.Asp482Gly 19684528:81:68
status: NEW[hide] Novel ABCB11 mutations in a Thai infant with progr... World J Gastroenterol. 2009 Sep 14;15(34):4339-42. Treepongkaruna S, Gaensan A, Pienvichit P, Luksan O, Knisely AS, Sornmayura P, Jirsa M
Novel ABCB11 mutations in a Thai infant with progressive familial intrahepatic cholestasis.
World J Gastroenterol. 2009 Sep 14;15(34):4339-42., 2009-09-14 [PMID:19750581]
Abstract [show]
Progressive familial intrahepatic cholestasis (PFIC) type 2 is caused by mutations in ABCB11, which encodes bile salt export pump (BSEP). We report a Thai female infant who presented with progressive cholestatic jaundice since 1 mo of age, with normal serum gamma-glutamyltransferase. Immunohistochemical staining of the liver did not demonstrate BSEP along the canaliculi, while multidrug resistance protein 3 was expressed adequately. Novel mutations in ABCB11, a four-nucleotide deletion in exon 3, c.90_93delGAAA, and a single-nucleotide insertion in exon 5, c.249_250insT, were identified, with confirmation in her parents. These mutations were predicted to lead to synthesis of truncated forms of BSEP. Immunostaining and mutation analysis thus established the diagnosis of PFIC type 2.
Comments [show]
None has been submitted yet.
No. Sentence Comment
87 E297G and D482G are the two most common mutations in persons of European descent, and account for approximately 58% of BSEP mutations in European studies[7] .
X
ABCB11 p.Asp482Gly 19750581:87:10
status: NEW[hide] ABCB11 gene mutations in Chinese children with pro... Liver Int. 2010 Jul;30(6):809-15. Epub 2009 Oct 21. Liu LY, Wang ZL, Wang XH, Zhu QR, Wang JS
ABCB11 gene mutations in Chinese children with progressive intrahepatic cholestasis and low gamma glutamyltransferase.
Liver Int. 2010 Jul;30(6):809-15. Epub 2009 Oct 21., [PMID:19845854]
Abstract [show]
BACKGROUND: Progressive familial intrahepatic cholestasis type 2 (PFIC2) is a severe autosomal recessive liver disorder of childhood that can cause cholestasis and progress to end-stage liver disease. ABCB11 gene mutations causing PFIC2 have been reported in some population groups, but not in mainland Chinese. AIMS: To elucidate the existence of and characterize ABCB11 gene mutations in mainland Chinese with progressive intrahepatic cholestasis and low gamma glutamyltransferase (GGT). METHODS: Twenty-four children presenting with progressive intrahepatic cholestasis and low GGT were admitted to a tertiary paediatric hospital in eastern China from January 2004 to July 2007. All encoding exons and flanking areas of the ABCB11 gene were sequenced. Hepatic histopathology results were obtained by review of the medical record. RESULTS: Twelve novel mutations of ABCB11 gene were found in seven patients: three nonsense mutations, six missense mutations, two splicing mutations and one intronic mutation. Giant cell transformation of hepatocytes was demonstrated in all the four patients with ABCB11 mutations and four of 12 patients without mutations in coding sequences of ABCB11 gene who received liver needle biopsy. CONCLUSIONS: ABCB11 gene mutations play an important role in Chinese patients with progressive intrahepatic cholestasis and low GGT. The characteristics of ABCB11 gene mutations in Chinese are different from other population groups. Histological examination may be helpful in diagnosis of PFIC2.
Comments [show]
None has been submitted yet.
No. Sentence Comment
89 Common mutations, such as E297G and D482G detected in western population (23), were not found in Chinese, either from Taiwan (9, 10) or from mainland China.
X
ABCB11 p.Asp482Gly 19845854:89:36
status: NEW[hide] PFIC2 and ethnicity-specific bile salt export pump... Liver Int. 2010 Jul;30(6):777-9. Epub 2010 Mar 8. Ananthanarayanan M, Li Y
PFIC2 and ethnicity-specific bile salt export pump (BSEP, ABCB11) mutations: where do we go from here?
Liver Int. 2010 Jul;30(6):777-9. Epub 2010 Mar 8., [PMID:20214736]
Abstract [show]
Comments [show]
None has been submitted yet.
No. Sentence Comment
29 It is interesting that common ABCB11 mutations found in Western populations such as E297G and D482G were not found in either the current or the Chen study.
X
ABCB11 p.Asp482Gly 20214736:29:94
status: NEW[hide] The bile salt export pump: clinical and experiment... Semin Liver Dis. 2010 May;30(2):125-33. Epub 2010 Apr 26. Lam P, Soroka CJ, Boyer JL
The bile salt export pump: clinical and experimental aspects of genetic and acquired cholestatic liver disease.
Semin Liver Dis. 2010 May;30(2):125-33. Epub 2010 Apr 26., [PMID:20422495]
Abstract [show]
The primary transporter responsible for bile salt secretion is the bile salt export pump (BSEP, ABCB11), a member of the ATP-binding cassette (ABC) superfamily, which is located at the bile canalicular apical domain of hepatocytes. In humans, BSEP deficiency results in several different genetic forms of cholestasis, which include progressive familial intrahepatic cholestasis type 2 (PFIC2), benign recurrent intrahepatic cholestasis type 2 (BRIC2), as well as other acquired forms of cholestasis such as drug-induced cholestasis (DIC) and intrahepatic cholestasis of pregnancy (ICP). Because bile salts play a pivotal role in a wide range of physiologic and pathophysiologic processes, regulation of BSEP expression has been a subject of intense research. The authors briefly describe the molecular characteristics of BSEP and then summarize what is known about its role in the pathogenesis of genetic and acquired cholestatic disorders, emphasizing experimental observations from animal models and cell culture in vitro systems.
Comments [show]
None has been submitted yet.
No. Sentence Comment
39 Independent and collaborative studies have identified more than 100 different BSEP variants worldwide and the more frequent mutations are grouped as missense, nonsense, deletions and insertions, and splice-site mutations.11,42-47 A common result of these various gene mutations is the reduction or total loss of expression of the BSEP protein on the canalicular membrane.47 In addition, aberrant pre-mRNA splicing and reduced levels of BSEP mRNA can result from BSEP mutations and single nucleotide polymorphisms (SNPs) in the BSEP gene.48,49 Heterogeneity in clinical phenotypes from a single gene mutation (p.D482G) suggests that additional modifiers may influence the severity of the disease phenotype.47 To date, 86 polymorphisms in BSEP have been described in a population of Caucasians, Koreans, and African Americans.50 These polymorphisms are located in exons and introns, as well as in 50 -flanking regions, but no effect on the mRNA or protein has been determined.
X
ABCB11 p.Asp482Gly 20422495:39:611
status: NEW49 Similar to the results of immunofluorescence studies in liver tissue from PFIC2 patients,47 when PFIC2 human mutations were expressed in model mammalian cell lines (MDCK, HEK293, HepG2), the proteins failed to reach or be maintained at the cell surface.54-57 When BSEP mutations that cause PFIC2 (D482G, E297G), BRIC2 (A590T, R1050C), and ICP (N591S) were compared, the clinical severity of these mutations tended to correlate inversely with the amount of protein expressed on the cell surface.
X
ABCB11 p.Asp482Gly 20422495:49:297
status: NEW51 For example, the PFIC2 mutant D482G`s protein half-life is short compared with the wild-type and is shortened further after ubiquitylation with E3 ubiquitin ligases.58 However, a small amount of this mutant protein can reach the plasma membrane where it is functional.58 Additional studies have shown that the resident time on the cell surface is greatly reduced with D482G and E297G mutant proteins as a result of accelerated internalization, reduced recycling, and/or targeting of endocytosed proteins for degradation.57,59 These studies suggest that the use of small molecules that modulate these pathways might be worthwhile therapeutic approaches in some of these cholestatic disorders.
X
ABCB11 p.Asp482Gly 20422495:51:368
status: NEW52 For example, 4-phenylbutyrate (4-PBA) can enhance cell surface expression of D482G and E297G proteins.60 Furthermore, administration of 4-PBA to normal rats enhances BSEP expression and bile salt secretion.60 Further studies are clearly needed in this area.
X
ABCB11 p.Asp482Gly 20422495:52:77
status: NEW77 Ubiquitylation is involved in the degradation of receptors, channels, and transporters from the endoplasmic reticulum and cell surface of yeast and higher eukaryotes.86-88 Wang et al, showed for the first time that specific E3 ubiquitin ligases are involved in Bsep degradation.58 Bsep mutants (p.G238V, p.D482G, p.G982R, p.R1153C, and p.R1268Q) were highly ubiquitinated following overexpression of different E3 ubiquitin ligases and were rapidly degraded by proteasomes resulting in shorter half-lives compared with the wild-type protein.58 This study suggests that stabilizing aberrant BSEP proteins by inactivating key E3 ubiquitin ligases might be a novel therapeutic approach, providing that global effects on proteasomal degradation can be avoided.
X
ABCB11 p.Asp482Gly 20422495:77:306
status: NEW[hide] Genetic determinants of drug-induced cholestasis a... Semin Liver Dis. 2010 May;30(2):147-59. Epub 2010 Apr 26. Pauli-Magnus C, Meier PJ, Stieger B
Genetic determinants of drug-induced cholestasis and intrahepatic cholestasis of pregnancy.
Semin Liver Dis. 2010 May;30(2):147-59. Epub 2010 Apr 26., [PMID:20422497]
Abstract [show]
Intrahepatic cholestasis of pregnancy and drug-induced cholestasis are two clinically important forms of acquired cholestatic liver disease. The understanding of the underlying mechanisms of acquired cholestasis has recently made considerable progress by the identification of canalicular ATP-binding cassette (ABC) transporters as likely targets for these forms of cholestasis. Cholestasis of pregnancy is linked to estrogen and progesterone metabolites. These metabolites have been shown to impair the bile salt export pump (BSEP) function by an indirect mechanism. In addition, genetic variants (as well as mutants) of the genes coding for the phosphatidylcholine translocator MDR3 and BSEP and for the farnesoid X receptor, which is critical in the transcriptional activation of MDR3 ( ABCB4) and BSEP ( ABCB11) have been associated with intrahepatic cholestasis of pregnancy. The pathogenesis of drug-induced liver injury encompasses a wide spectrum of mechanisms, some of which are still poorly understood. BSEP is now known to be subject to drug inhibition in susceptible patients. Information on genetic factors rendering individuals susceptible to inhibition of BSEP by drugs or their metabolites is still scarce. Besides rare mutations that have been linked to drug-induced cholestasis, the common p.V444A polymorphism of BSEP has been identified as a potential risk factor. In this review, the authors summarize key concepts of physiology of bile formation, diagnostic principles to indentify these forms of acquired cholestasis, as well as pathogenetic mechanisms leading to intrahepatic cholestasis of pregnancy or drug-induced cholestasis. In addition, they review the current knowledge on genetic susceptibility factors for these two forms of cholestasis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
79 In the same study, heterozygosity for the BSEP mutations p.E297G, p.D482G, and p.N591S formerly associated with benign and progressive forms of familial intrahepatic cholestasis type 2 were found in four, one, and two ICP patients, respectively, allowing the extrapolation that 1% of European ICP cases are caused by these mutations.105 Although the molecular and mechanistic basis for p.V444A and p.N591S were not apparent, in silico structural and functional analysis suggests that p.E297G and p.D482G destabilizes the protein fold of BSEP, leading to decreased taurocholate transport in case of p.E297G.105,106 In addition, decreased hepatic BSEP expression,107,108 and very recently, significantly reduced hepatic mRNA levels109 was reported in healthy human liver tissue carrying the alanine allele in position 444 of BSEP, which could predispose to the development of ICP by way of decreased canalicular availability of BSEP.
X
ABCB11 p.Asp482Gly 20422497:79:68
status: NEWX
ABCB11 p.Asp482Gly 20422497:79:498
status: NEW[hide] Cholestatic liver disease in children. Curr Gastroenterol Rep. 2010 Feb;12(1):30-9. Santos JL, Choquette M, Bezerra JA
Cholestatic liver disease in children.
Curr Gastroenterol Rep. 2010 Feb;12(1):30-9., [PMID:20425482]
Abstract [show]
Inherited syndromes of intrahepatic cholestasis and biliary atresia are the most common causes of chronic liver disease and the prime indication for liver transplantation in children. Our understanding of the pathogenesis of these diseases has increased substantially by the discovery of genetic mutations in children with intrahepatic cholestasis and the findings that inflammatory circuits are operative at the time of diagnosis of biliary atresia. Building on this solid foundation, recent studies provide new insight into genotype-phenotype relationships and how mutations produce altered bile composition and cholestasis. New evidence exists that although liver transplantation is curative for patients with end-stage liver disease owing to cholestasis, some patients may develop recurrence of cholestasis because of the emergence of autoantibodies that disrupt canalicular function in the new graft. Progress is also evident in biliary atresia, with recent studies identifying candidate modifier genes and directly implicating lymphocytes and inflammatory signals in the pathogenesis of bile duct injury and obstruction.
Comments [show]
None has been submitted yet.
No. Sentence Comment
67 Interestingly, 93% of the mutations produced abnormal or absent BSEP expression on liver biopsies; immunostaining identified a variable pattern of BSEP expression in patients carrying the most common E297G or D482G mutations, thus limiting the use of immunohistochemistry to reliably pinpoint BSEP deficiency.
X
ABCB11 p.Asp482Gly 20425482:67:209
status: NEW[hide] The role of the sodium-taurocholate cotransporting... Handb Exp Pharmacol. 2011;(201):205-59. Stieger B
The role of the sodium-taurocholate cotransporting polypeptide (NTCP) and of the bile salt export pump (BSEP) in physiology and pathophysiology of bile formation.
Handb Exp Pharmacol. 2011;(201):205-59., [PMID:21103971]
Abstract [show]
Bile formation is an important function of the liver. Bile salts are a major constituent of bile and are secreted by hepatocytes into bile and delivered into the small intestine, where they assist in fat digestion. In the small intestine, bile salts are almost quantitatively reclaimed and transported back via the portal circulation to the liver. In the liver, hepatocytes take up bile salts and secrete them again into bile for ongoing enterohepatic circulation. Uptake of bile salts into hepatocytes occurs largely in a sodium-dependent manner by the sodium taurocholate cotransporting polypeptide NTCP. The transport properties of NTCP have been extensively characterized. It is an electrogenic member of the solute carrier family of transporters (SLC10A1) and transports predominantly bile salts and sulfated compounds, but is also able to mediate transport of additional substrates, such as thyroid hormones, drugs and toxins. It is highly regulated under physiologic and pathophysiologic conditions. Regulation of NTCP copes with changes of bile salt load to hepatocytes and prevents entry of cytotoxic bile salts during liver disease. Canalicular export of bile salts is mediated by the ATP-binding cassette transporter bile salt export pump BSEP (ABCB11). BSEP constitutes the rate limiting step of hepatocellular bile salt transport and drives enterohepatic circulation of bile salts. It is extensively regulated to keep intracellular bile salt levels low under normal and pathophysiologic situations. Mutations in the BSEP gene lead to severe progressive familial intrahepatic cholestasis. The substrates of BSEP are practically restricted to bile salts and their metabolites. It is, however, subject to inhibition by endogenous metabolites or by drugs. A sustained inhibition will lead to acquired cholestasis, which can end in liver injury.
Comments [show]
None has been submitted yet.
No. Sentence Comment
411 Another interesting finding of this study (Strautnieks et al. 2008) is the observation that the two common E297G and D482G mutants of BSEP varied most in their expression level among the respective carriers.
X
ABCB11 p.Asp482Gly 21103971:411:117
status: NEW412 This is notable, as E297G and D482G variants have been demonstrated to display residual (Noe et al. 2005) or normal (Hayashi et al. 2005a) transport activity, respectively.
X
ABCB11 p.Asp482Gly 21103971:412:30
status: NEW418 Importantly and interestingly, the common European mutant D482G shows an enhanced aberrant splicing.
X
ABCB11 p.Asp482Gly 21103971:418:58
status: NEW419 This finding could provide a possible explanation for the wide variation of BSEP expression observed in patients with D482G mutations consequently leading to clinical phenotypes with variable severity.
X
ABCB11 p.Asp482Gly 21103971:419:118
status: NEW472 Interestingly, the D482G mutation reduced transport activity for human BSEP but had no apparent effect on transport when introduced into mouse Bsep (Plass et al. 2004).
X
ABCB11 p.Asp482Gly 21103971:472:19
status: NEW486 (2008a) D482GReducedsurface expression na G982RNosurfaceexpressionnana R1153CNosurfaceexpressionnana R1286QNosurfaceexpressionnana E297GBSEPMDCKFasterturnoverof ubiquitinatedBSEP fromapical membrane Increased ubiquitination Hayashiand Sugiyama (2009) D482G AdditionalinformationonexpressionofBSEPmutantsisfoundinByrneetal.
X
ABCB11 p.Asp482Gly 21103971:486:251
status: NEW488 (2008) nanotassessed Of note, it was recently demonstrated that levels of the E297G and the D482G mutants of BSEP could be increased at the apical membrane of MDCK cells, if the cells were treated with 4-phenylbutyrate (Hayashi and Sugiyama 2007) or with short-and medium-chain fatty acids (Kato et al. 2010).
X
ABCB11 p.Asp482Gly 21103971:488:94
status: NEW[hide] Living-related liver transplantation for siblings ... Am J Transplant. 2011 Feb;11(2):394-8. doi: 10.1111/j.1600-6143.2010.03397.x. Epub 2011 Jan 10. Shimizu H, Migita O, Kosaki R, Kasahara M, Fukuda A, Sakamoto S, Shigeta T, Uemoto S, Nakazawa A, Kakiuchi T, Arai K
Living-related liver transplantation for siblings with progressive familial intrahepatic cholestasis 2, with novel genetic findings.
Am J Transplant. 2011 Feb;11(2):394-8. doi: 10.1111/j.1600-6143.2010.03397.x. Epub 2011 Jan 10., [PMID:21219577]
Abstract [show]
Progressive familial intrahepatic cholestasis is a syndrome of severe cholestasis progressing to biliary cirrhosis and liver failure that develops in childhood. This report describes two siblings with PFIC-2 who underwent living-related liver transplantation from their genetically proven heterozygous parents. Both patients had normal gamma-glutamyl transpeptidase levels, but showed severe pruritus with sleep disturbance, cholestasis, jaundice and growth failure. Genetic testing of each patient revealed two missense mutations of the bile salt export pump, S901R and C1083Y, which have not previously been associated with PFIC-2. Usual medical treatment failed to improve their clinical symptoms, and the two siblings underwent living-related liver transplantation from their heterozygous parents. The transplants improved their clinical symptoms significantly, and the patients have since shown age-appropriate growth. Electron microscopic findings of the explanted liver of the younger sister revealed dense and amorphous bile, which is characteristic of PFIC-2. In the cases presented here, living-related liver transplantation from a heterozygous donor was associated with better quality of life and improvement of growth, and thus appears to be a feasible option for PFIC-2 patients. Mutation analysis is a useful tool to help decide the course of treatment of PFIC.
Comments [show]
None has been submitted yet.
No. Sentence Comment
104 The common mutations include E297G, R575X, R1057X, G982R, C336S, R1153C, D482G, K461E, R1153C, R1268Q, R1090X, G238V, S114R, S593R, del 695 and del 3213 (22).
X
ABCB11 p.Asp482Gly 21219577:104:73
status: NEW[hide] Progressive familial intrahepatic cholestasis (PFI... Semin Liver Dis. 2011 Feb;31(1):3-10. Epub 2011 Feb 22. Morotti RA, Suchy FJ, Magid MS
Progressive familial intrahepatic cholestasis (PFIC) type 1, 2, and 3: a review of the liver pathology findings.
Semin Liver Dis. 2011 Feb;31(1):3-10. Epub 2011 Feb 22., [PMID:21344347]
Abstract [show]
Progressive familial intrahepatic cholestatic diseases encompass a group of autosomal recessive hereditary diseases, which usually present in infancy or childhood, with cholestasis of hepatocellular origin. The currently preferred nomenclature for the three PFIC disorders that have been characterized to date is FIC1 deficiency, BSEP deficiency, and MDR3 deficiency, relating to mutations in the specific genes involved in bile acid formation and transport. Since the first description of these diseases, extensive clinical, biochemical, and molecular studies have increased our understanding of the features specific to each one of them. This review focuses mainly on the liver histology, summarizing their characteristic pathologic features, the correlation to specific genotypes, and complications arising with disease progression.
Comments [show]
None has been submitted yet.
No. Sentence Comment
42 elevated Normal Bile acid High High High Lipoprotein X Present Present Absent Albumin Low Usually normal Normal Biochemical tests, bile: Bile acid Low Low Normal Phospholipid Normal Normal Low *Patients with the D482G-BSEP mutation tend to survive to an older age without cirrhosis.
X
ABCB11 p.Asp482Gly 21344347:42:212
status: NEW92 In a recent study, BSEP deficiency patients with the common European D482G mutation were reported to show giant cell hepatitis less frequently than patients with other mutations.11 Cholestasis is hepatocellular, frequently within ballooned hepatocytes, and canalicular.
X
ABCB11 p.Asp482Gly 21344347:92:69
status: NEW105 A recent study indicated that BSEP-deficiency patients with the D482G mutation survived to an older age, with slower progression of their disease.11 Therefore, presence of fibrosis/cirrhosis in earlier liver biopsies may be indicative of a more aggressive genotype (other than the D482G mutation).
X
ABCB11 p.Asp482Gly 21344347:105:64
status: NEWX
ABCB11 p.Asp482Gly 21344347:105:281
status: NEW108 As reported by Strautnieks et al, canalicular BSEP is not detectable by IHC in cases with protein-truncating mutations.12 With other mutations, such as single copy of the E297G and D482G, the BSEP expression varies from absent to abnormal to present/ normal.
X
ABCB11 p.Asp482Gly 21344347:108:181
status: NEW[hide] A gene encoding a liver-specific ABC transporter i... Nat Genet. 1998 Nov;20(3):233-8. Strautnieks SS, Bull LN, Knisely AS, Kocoshis SA, Dahl N, Arnell H, Sokal E, Dahan K, Childs S, Ling V, Tanner MS, Kagalwalla AF, Nemeth A, Pawlowska J, Baker A, Mieli-Vergani G, Freimer NB, Gardiner RM, Thompson RJ
A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis.
Nat Genet. 1998 Nov;20(3):233-8., [PMID:9806540]
Abstract [show]
The progressive familial intrahepatic cholestases (PFIC) are a group of inherited disorders with severe cholestatic liver disease from early infancy. A subgroup characterized by normal serum cholesterol and gamma-glutamyltranspeptidase (gammaGT) levels is genetically heterogeneous with loci on chromosomes 2q (PFIC2) and 18q. The phenotype of the PFIC2-linked group is consistent with defective bile acid transport at the hepatocyte canalicular membrane. The PFIC2 gene has now been identified by mutations in a positional candidate, BSEP, which encodes a liver-specific ATP-binding cassette (ABC) transporter, sister of p-glycoprotein (SPGP). The product of the orthologous rat gene has been shown to be an effective bile acid transporter in vitro. These data provide evidence that SPGP is the human bile salt export pump (BSEP).
Comments [show]
None has been submitted yet.
No. Sentence Comment
111 One Polish family and one Austrian family carry 1445 A→G (D482G), which causes substitution of a glycine for an aspartate.
X
ABCB11 p.Asp482Gly 9806540:111:65
status: NEW142 The ABC transporter family of proteins is the largest so far iden- Table 1• BSEP mutations found in PFIC patients Nucleotide mutation Amino acid number/ Protein consequence Families mutation 1723 C→T R575X Termination codon in first B2 heterozygous nucleotide binding fold Q homozygous 3169 C→T R1057X Termination codon in second B5 heterozygous nucleotide binding fold 908 del G 303 17 novel amino acids then truncation Family 57 heterozygous 3767-3768 ins C 1256 39 novel amino acids then truncation Family 99 homozygous 890 A→G E297G Glutamate to glycine in the intracellular loop S1, S3, S4B, S5, S6, S7, 38 homozygous between transmembrane spans 4 and 5 S4A, B5, B6, B7, 53, L heterozygous 1381 A→G K461E Lysine to glutamate in first Walker A motif Family 55 homozygous 1445 A→G D482G Aspartate to glycine in first P and 52 homozygous nucleotide binding fold 2944 G→A G982R Glycine to arginine in transmembrane span 11 Family 18 homozygous 3457 C→T R1153C Arginine to cysteine in second C and D homozygous nucleotide binding fold 3803 G→A R1268Q Arginine to glutamine in second J homozygous nucleotide binding fold In each case the nucleotide position in the human coding sequence is given along with details of the predicted protein consequence.
X
ABCB11 p.Asp482Gly 9806540:142:826
status: NEW162 Although no ancestral link can be established, 1445 A→G (D482G) has been found in both a Polish family and an Austrian family.
X
ABCB11 p.Asp482Gly 9806540:162:64
status: NEW236 The endonucleases used were: HphI (E297G), BpmI (K461E), FokI (D482G), AlwNI (G982R), BsrBI (R1153C) and AvaII (R1268Q).
X
ABCB11 p.Asp482Gly 9806540:236:63
status: NEW[hide] Protein quality control at the plasma membrane. Curr Opin Cell Biol. 2011 Aug;23(4):483-91. Epub 2011 May 14. Okiyoneda T, Apaja PM, Lukacs GL
Protein quality control at the plasma membrane.
Curr Opin Cell Biol. 2011 Aug;23(4):483-91. Epub 2011 May 14., [PMID:21571517]
Abstract [show]
Cellular proteostasis (or protein homeostasis) depends on the timely folding and disposal of conformationally damaged polypeptides during their life span at all subcellular locations. This process is particularly important for membrane proteins confined to the cell surface with crucial regulatory role in cellular homoeostasis and intercellular communication. Accumulating evidences indicate that membrane proteins exported from the endoplasmic reticulum (ER) are subjected to peripheral quality control (QC) along the late secretory and endocytic pathways, as well as at the plasma membrane (PM). Recently identified components of the PM QC recognition and effector mechanisms responsible for ubiquitination and lysosomal degradation of conformationally damaged PM proteins uncovered striking similarities to and differences from that of the ER QC machinery. Possible implications of the peripheral protein QC activity in phenotypic modulation of conformational diseases are also outlined.
Comments [show]
None has been submitted yet.
No. Sentence Comment
31 Structural destabilization of the Pma1 and Gap1 transmembrane domains in strains defective of sphingoid base synthesis could be mechanistically similar to the farnesol-induced 484 Membranes and organelles Table 1 Peripheral protein QC substrates Membrane protein Mutation/condition Degron PM stability Related disease Reference Mammalian bile salt export pump (BSEP) E297G (Cy) D482G (Cy) 2-3 Ub # progressive familial intrahepatic cholestasis type 2 (PFIC2) [36] CFTR rDF508 (Cy) poly/multimono Ub # cystic fibrosis (CF) [44 ,27 ] D70 (Cy truncation) poly/multimono Ub # [27 ] N894D, N900D (Ex) poly/multimono Ub # [22] Na/H exchanger (NHE6) D255-256 (TM) poly/multimono Ub # Angelman syndrome [35] MLC1 multiple (TM or Cy) ND # megalencephalic leukoencephalopathy with subcortical cysts (MLC) [66] HERG low K+ Ub # type 2 long QT syndrome [37] LDL receptor high salt or low pH (Ex) ND # hypercholesterolemia [16] Dopamine D4.4 receptor M345T (TM) poly/multimono Ub # attention deficit hyperactivity disorder [28 ] Vasopressin V2 receptor W164S (TM) poly/multimono Ub # nephrogenic diabetes insipidus [28 ] alpha-2A adrenergic receptor D79N (TM) ND # cardiovascular diseases [14] N422D (TM) ND # [14] Di3loop (Cy) ND # [69] CD4tl-lm L57C (Cy) poly/multimono Ub # model protein [28 ] H+ /K+ -ATPase b subunit N99Q, N130Q, N161Q, N222Q (Ex) ND # gastric, autoimmune diseases [18] k opioid receptor N25/39Q (Ex) ND # pain control, neuronal phenotypes [19] D opioid receptor N18Q/N33Q (Ex) ND # pain control, neuronal phenotypes [20] GLUT1 N45Y, Q or D (ex) ND # GLUT1 deficiency syndrome [70] EGFR L858R (Cy), exon 19 deletion (Cy) poly/multimono Ub # cancer suspectibility [71] ErbB2 Hsp90 inhibition poly/multimono Ub # breast cancer [72] TGFBR2 Hsp90 inhibition poly/multimono Ub # tumor suspectibility [73] Yeast Pma1 Icb1-100 poly/multimono Ub # NA [29] Pma1-7 poly/multimono Ub # NA [7] Pma1-10 poly/multimono Ub # NA [52] Gap1 absence of sphingolipids poly/multimono Ub # NA [9] Abbreviations: Cy, cytosolic; Ex, extracellular; TM, transmembrane; Ub, ubiquitin; ND, not determined; #, decreasing stability; CFTR, cystic fibrosis transmembrane conductance regulator; HERG, human ether-a` -go-go related gene; LDL, low-density lipoprotein; GLUT, glucose transporter; EGFR, epidermal growth factor receptor; ErbbB2, v-erb-b2 erythroblastic leukemia viral oncogene homolog 2; TGFBR2, transforming growth factor (TGF)- beta type II; Pma1, H(+)-ATPase; Gap1, general amino acid permease.
X
ABCB11 p.Asp482Gly 21571517:31:378
status: NEW[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]
Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.
Comments [show]
None has been submitted yet.
No. Sentence Comment
6508 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/ Localization ABCB11 BSEP N.D. G238V N.D. Intracellular A890G E297G 2 Intracellular N.D. C336S ↔ Normal G1296C R432T 2 Reduced T1331C V444A ↔ Normal/Reduced A1445G D482G 2 Normal/Reduced G2026T D676Y 2 Reduced G2563A G855R 2 Reduced G2944A G982R 2 Intracellular C3457T R1153C 2 Intracellular G3803A R1268Q 2 Intracellular searchers were able to identify functional roles for Mrp2 using rats lacking this transporter (Eisai hyperbilirubinemic rats on a Sprague-Dawley background and transport-deficient (TR-) on a Wistar background) (Paulusma et al., 1996; Ito et al., 1997).
X
ABCB11 p.Asp482Gly 20103563:6508:251
status: NEW[hide] Prolonged cholestasis triggered by hepatitis A vir... Ann Hepatol. 2012 Sep;11(5):710-4. Krawczyk M, Grunhage F, Langhirt M, Bohle RM, Lammert F
Prolonged cholestasis triggered by hepatitis A virus infection and variants of the hepatocanalicular phospholipid and bile salt transporters.
Ann Hepatol. 2012 Sep;11(5):710-4., [PMID:22947535]
Abstract [show]
Hepatitis A virus (HAV) infection resolves in most patients uneventfully within weeks from the onset of the disease. In rare cases, however, it may relapse or cause prolonged cholestasis. Here we present a case of a 36-year-old female patient who developed severe pruritus and jaundice three weeks after initially uncomplicated hepatitis A. A relapse of the infection was excluded. Since therapy with colestyramin, antihistaminics, naloxon and ursodeoxycholic acid (UDCA) did not improve symptoms, we decided to perform plasma absorption and to start rifampicin therapy. Under these measures, pruritus and jaundice, as well as serum bilirubin levels improved gradually and after four plasmapheresis sessions we were able to discharge the patient. Genetic testing showed the presence of two procholestatic polymorphisms, the c.3084 [GG] variant within the gene encoding the hepatocanalicular bile salt transporter ABCB11 and the c.711 [AT] variant of the phosphatidylcholine floppase ABCB4. We speculate that this compound ABCB4-ABCB11 genotype led to a severe intrahepatic cholestasis in the setting of HAV infection. In conclusion, our case suggests that polymorphisms within the hepatocanalicular transporters may contribute to a more pronounced course of HAV infection. Although dedicated studies in large cohorts of patients are needed to confirm this observation, we speculate that patients carrying procholestatic hepatobiliary transporter variants may benefit from vaccination against hepatitis A.
Comments [show]
None has been submitted yet.
No. Sentence Comment
58 To detect genetic factors contributing to severe phenotype, we genotyped procholestatic mutations and polymorphisms in the ABCB4 (p.R590Q, c.711A>T), ABCB11 (p.E297G, p.A444V, p.D482G, c.3084A>G), ATP8B1 (p.N45T, p.E429A, p.I661T) and FXR (c.-1 G>T) genes. The genotyping was performed using PCR-based assays with 5`-nuclease and fluorescence detection (TaqMan).
X
ABCB11 p.Asp482Gly 22947535:58:178
status: NEW57 To detect genetic factors contributing to severe phenotype, we genotyped procholestatic mutations and polymorphisms in the ABCB4 (p.R590Q, c.711A>T), ABCB11 (p.E297G, p.A444V, p.D482G, c.3084A>G), ATP8B1 (p.N45T, p.E429A, p.I661T) and FXR (c.-1 G>T) genes. The genotyping was performed using PCR-based assays with 5`-nuclease and fluorescence detection (TaqMan).
X
ABCB11 p.Asp482Gly 22947535:57:178
status: NEW[hide] Progressive familial intrahepatic cholestasis and ... Clin Res Hepatol Gastroenterol. 2012 Jun;36(3):271-4. Epub 2012 May 18. Jankowska I, Socha P
Progressive familial intrahepatic cholestasis and inborn errors of bile acid synthesis.
Clin Res Hepatol Gastroenterol. 2012 Jun;36(3):271-4. Epub 2012 May 18., [PMID:22609295]
Abstract [show]
Progressive familial intrahepatic cholestasis (PFIC), types 1, 2 and 3, are due to defects in genes involved in bile secretion (FIC1, BSEP, MDR3). PFIC and inborn errors of bile acid synthesis (IEBAS) often present in infancy with cholestasis. The distinctive feature of PFIC 1 and 2 and IEBAS is a normal level of GGT, while IEBAS are suspected in patients with low plasma bile acids concentration. Molecular testing, urinary bile acid analysis (IEBAS), liver biopsy and immuno-staining are used for the diagnosis. Some patients with PFIC can be successfully treated with ursodeoxycholic acid or partial external biliary diversion. IEBAS is treated with cholic acid. Liver transplantation is required for cirrhosis with liver failure. Hepatocarcinoma has been reported in PFIC2.
Comments [show]
None has been submitted yet.
No. Sentence Comment
42 Among PFIC2 patients, the course of disease is slower in patients bearing the D482G mutation [2].
X
ABCB11 p.Asp482Gly 22609295:42:78
status: NEW[hide] Familial cholestasis: progressive familial intrahe... Best Pract Res Clin Gastroenterol. 2010 Oct;24(5):541-53. van der Woerd WL, van Mil SW, Stapelbroek JM, Klomp LW, van de Graaf SF, Houwen RH
Familial cholestasis: progressive familial intrahepatic cholestasis, benign recurrent intrahepatic cholestasis and intrahepatic cholestasis of pregnancy.
Best Pract Res Clin Gastroenterol. 2010 Oct;24(5):541-53., [PMID:20955958]
Abstract [show]
Progressive familial intrahepatic cholestasis (PFIC) type 1, 2 and 3 are due to mutations in ATP8B1, ABCB11 and ABCB4, respectively. Each of these genes encodes a hepatocanalicular transporter, which is essential for the proper formation of bile. Mutations in ABCB4 can result in progressive cholestatic disease, while mutations in ATP8B1 and ABCB11 can result both in episodic cholestasis, referred to as benign recurrent intrahepatic cholestasis (BRIC) type 1 and 2, as well as in progressive cholestatic disease. This suggests a clinical continuum and these diseases are therefore preferably referred to as ATP8B1 deficiency and ABCB11 deficiency. Similarly PFIC type 3 is designated as ABCB4 deficiency. Heterozygous mutations in each of these transporters can also be associated with intrahepatic cholestasis of pregnancy. This review summarizes the pathophysiology, clinical features and current as well as future therapeutic options for progressive familial- and benign recurrent intrahepatic cholestasis as well as intrahepatic cholestasis of pregnancy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
67 In more than half of the European families the missense mutations E297G and/or D482G are present.
X
ABCB11 p.Asp482Gly 20955958:67:79
status: NEW69 Generally missense mutations, e.g. E297G or D482G, lead to a less severe phenotype than mutations that are predicted to result in premature protein truncation or total failure of protein production [6,23,29].
X
ABCB11 p.Asp482Gly 20955958:69:44
status: NEW135 The type of mutation seems to be associated with the outcome of PEBD, with better prognosis in disease caused by milder mutations, especially for the ABCB11 mutations E297G and D482G [3,23].
X
ABCB11 p.Asp482Gly 20955958:135:177
status: NEW[hide] Liver disease associated with canalicular transpor... J Hepatol. 2010 Feb;52(2):258-71. Epub 2009 Nov 21. Stapelbroek JM, van Erpecum KJ, Klomp LW, Houwen RH
Liver disease associated with canalicular transport defects: current and future therapies.
J Hepatol. 2010 Feb;52(2):258-71. Epub 2009 Nov 21., [PMID:20034695]
Abstract [show]
Bile formation at the canalicular membrane is a delicate process. This is illustrated by inherited liver diseases due to mutations in ATP8B1, ABCB11, ABCB4, ABCC2 and ABCG5/8, all encoding hepatocanalicular transporters. Effective treatment of these canalicular transport defects is a clinical and scientific challenge that is still ongoing. Current evidence indicates that ursodeoxycholic acid (UDCA) can be effective in selected patients with PFIC3 (ABCB4 deficiency), while rifampicin reduces pruritus in patients with PFIC1 (ATP8B1 deficiency) and PFIC2 (ABCB11 deficiency), and might abort cholestatic episodes in BRIC (mild ATP8B1 or ABCB11 deficiency). Cholestyramine is essential in the treatment of sitosterolemia (ABCG5/8 deficiency). Most patients with PFIC1 and PFIC2 will benefit from partial biliary drainage. Nevertheless liver transplantation is needed in a substantial proportion of these patients, as it is in PFIC3 patients. New developments in the treatment of canalicular transport defects by using nuclear receptors as a target, enhancing the expression of the mutated transporter protein by employing chaperones, or by mutation specific therapy show substantial promise. This review will focus on the therapy that is currently available as well as on those developments that are likely to influence clinical practice in the near future.
Comments [show]
None has been submitted yet.
No. Sentence Comment
287 4-PBA has been tested in vitro for the E297G and D482G mutations frequently found inABCB11deficiency.Treatmentreducedtheproteinubiquitination and increased the cell surface expression of mature ABCB11 [200- 202].
X
ABCB11 p.Asp482Gly 20034695:287:49
status: NEW286 4-PBA has been tested in vitro for the E297G and D482G mutations frequently found inABCB11deficiency.Treatmentreducedtheproteinubiquitination and increased the cell surface expression of mature ABCB11 [200-202].
X
ABCB11 p.Asp482Gly 20034695:286:49
status: NEW285 4-PBA has been tested in vitro for the E297G and D482G mutations frequently found inABCB11deficiency.Treatmentreducedtheproteinubiquitination and increased the cell surface expression of mature ABCB11 [200- 202].
X
ABCB11 p.Asp482Gly 20034695:285:49
status: NEW[hide] Receptor for activated C-kinase 1 regulates the ce... Hepatol Res. 2009 Nov;39(11):1091-107. Epub 2009 Aug 6. Ikebuchi Y, Takada T, Ito K, Yoshikado T, Anzai N, Kanai Y, Suzuki H
Receptor for activated C-kinase 1 regulates the cellular localization and function of ABCB4.
Hepatol Res. 2009 Nov;39(11):1091-107. Epub 2009 Aug 6., [PMID:19674157]
Abstract [show]
Aim: Multidrug resistance protein 3 (MDR3/ABCB4), located on the bile canalicular membrane of hepatocytes, is responsible for the translocation of phosphatidylcholine across the plasma membrane, and its hereditary defect causes liver disorders, such as progressive familial intrahepatic cholestasis type 3. We aimed to identify the proteins responsible for the surface expression of human ABCB4. Methods: We performed yeast two-hybrid screening with the cytoplasmic linker region of ABCB4 against a human liver cDNA library. This screening allowed us to identify the receptor for activated C-kinase 1 (RACK1) as a novel binding partner of ABCB4. The association of RACK1 with the linker region of ABCB4 was further confirmed by GST-pulldown assay, although we could not find out the interaction of full length of ABCB4 and RACK1 in co-immunoprecipitation assay in HeLa cells. Results: Down-regulation of endogenous RACK1 expression by siRNA in HeLa cells resulted in the localization of ABCB4 in the cytosolic compartment as well as reduced protein expression of ABCB4, although mRNA expression and the protein stability of ABCB4 were not affected by the suppression of endogenous RACK1. Similar alterations in cellular localization of ABCB4 were also found by suppressing endogenous RACK1 expression in HepG2 cells. Consequently, ABCB4-mediated phosphatidylcholine translocation activity was significantly reduced when endogenous RACK1 expression was suppressed in HeLa cells. In contrast, the membrane surface localization and the protein expression of ABCB1 were not affected by the suppression of endogenous RACK1 expression. Conclusion: These results suggest that RACK1 may have a functional significance as a regulatory cofactor of ABCB4 and is indispensable for the plasma membrane localization and translocation function of ABCB4.
Comments [show]
None has been submitted yet.
No. Sentence Comment
13 For example, we have found that E297G and D482G mutations in ABCB11, which are frequently found in PFIC2 patients, are associated with the retention of these mutated transporters in the endoplasmic reticulum (ER), although their transport function itself remains normal;20 indeed, following treatment with sodium 4-phenylbutyrate, E297G and D482G mutants appeared on the plasma membrane and were able to excrete substrate bile salts in Madin-Darby canine kidney (MDCK) II cells.21 In addition, insertion of several kinds of mutations in the ABCG5 or ABCG8 gene, which is found in sitosterolemia patients, results in the ER localization of this heterodimer.22 Furthermore, it has been demonstrated that localization of ABCB4 on the bile canalicular membrane is less marked in patients with one of the PFIC3 mutations.15 Concerning the pathogenesis of PFIC3, Dixon et al. tried to examine the localization and function of PFIC3 mutant in HEK293T cells;23 due to the difficulties in establishing a functional assay system of ABCB4 in mammalian cells, they introduced the PFIC3 mutation to the equivalent site of MDR1/ABCB1 to examine the function and localization of the mutated protein.23,24 From this perspective, it is important to identify the mechanism for the cellular localization of membrane transporters.
X
ABCB11 p.Asp482Gly 19674157:13:42
status: NEWX
ABCB11 p.Asp482Gly 19674157:13:341
status: NEW[hide] Apical/basolateral surface expression of drug tran... Pharm Res. 2005 Oct;22(10):1559-77. Epub 2005 Sep 22. Ito K, Suzuki H, Horie T, Sugiyama Y
Apical/basolateral surface expression of drug transporters and its role in vectorial drug transport.
Pharm Res. 2005 Oct;22(10):1559-77. Epub 2005 Sep 22., [PMID:16180115]
Abstract [show]
It is well known that transporter proteins play a key role in governing drug absorption, distribution, and elimination in the body, and, accordingly, they are now considered as causes of drug-drug interactions and interindividual differences in pharmacokinetic profiles. Polarized tissues directly involved in drug disposition (intestine, kidney, and liver) and restricted distribution to naive sanctuaries (blood-tissue barriers) asymmetrically express a variety of drug transporters on the apical and basolateral sides, resulting in vectorial drug transport. For example, the organic anion transporting polypeptide (OATP) family on the sinusoidal (basolateral) membrane and multidrug resistance-associated protein 2 (MRP2/ABCC2) on the apical bile canalicular membrane of hepatocytes take up and excrete organic anionic compounds from blood to bile. Such vectorial transcellular transport is fundamentally attributable to the asymmetrical distribution of transporter molecules in polarized cells. Besides the apical/basolateral sorting direction, distribution of the transporter protein between the membrane surface (active site) and the intracellular fraction (inactive site) is of practical importance for the quantitative evaluation of drug transport processes. The most characterized drug transporter associated with this issue is MRP2 on the hepatocyte canalicular (apical) membrane, and it is linked to a genetic disease. Dubin-Johnson syndrome is sometimes caused by impaired canalicular surface expression of MRP2 by a single amino acid substitution. Moreover, single nucleotide polymorphisms in OATP-C/SLC21A6 (SLCO1B1) also affect membrane surface expression, and actually lead to the altered pharmacokinetic profile of pravastatin in healthy subjects. In this review article, the asymmetrical transporter distribution and altered surface expression in polarized tissues are discussed.
Comments [show]
None has been submitted yet.
No. Sentence Comment
240 Seven amino acid substitutions in BSEP, linked to PFICII (G238V, E297G, C336S, D482G, G982R, R1153C, R1268Q), have been reported and have been examined using rat Bsep expressed in MDCK (128).
X
ABCB11 p.Asp482Gly 16180115:240:79
status: NEW244 Recently, the intracellular sorting and transport function of the D482G mutant was further examined in detail using mouse Bsep expressed in HepG2 cells and Sf21 insect cells (129).
X
ABCB11 p.Asp482Gly 16180115:244:66
status: NEW245 A considerable amount of D482G mutant mBsep protein was still detected in the cytoplasm as well as the bile canalicular space.
X
ABCB11 p.Asp482Gly 16180115:245:25
status: NEW253 D482G mutant without loss of transport function.
X
ABCB11 p.Asp482Gly 16180115:253:0
status: NEW254 D482G expressed in the nonpolarized Sf21 insect cell membrane was functionally active.
X
ABCB11 p.Asp482Gly 16180115:254:0
status: NEW255 Moreover, culturing the D482G expressing HepG2 cells at a lower temperature (30-C) resulted in increased expression of the fully glycosylated form of mouse Bsep (12.6-fold) compared with that at 37-C.
X
ABCB11 p.Asp482Gly 16180115:255:24
status: NEW[hide] Functional analysis of nonsynonymous single nucleo... Pharmacogenet Genomics. 2008 Sep;18(9):823-33. Kobayashi K, Ito K, Takada T, Sugiyama Y, Suzuki H
Functional analysis of nonsynonymous single nucleotide polymorphism type ATP-binding cassette transmembrane transporter subfamily C member 3.
Pharmacogenet Genomics. 2008 Sep;18(9):823-33., [PMID:18698235]
Abstract [show]
OBJECTIVES: The multidrug resistance-associated protein 3/ATP-binding cassette transmembrane transporter subfamily C member 3 (MRP3/ABCC3) plays an important role in exporting endogenous and xenobiotic anionic substrates, including glucuronide conjugates of xenobiotics, from hepatocytes into the blood circulation. This excretory function of ABCC3 becomes very apparent particularly under cholestatic conditions, since ABCC3 is induced when the biliary excretion pathway is impaired. In this study, we analyzed the functional properties of 11 nonsynonymous single nucleotide polymorphisms (SNPs) in the ABCC3 gene found in the public SNP database. METHODS: HeLa and Sf9 insect cells were used to analyze the protein expression and transport function, respectively. RESULTS: After transient transfection of cDNA into HeLa cells, it was found that R1381S ABCC3 exhibits intracellular accumulation of immature protein, the localization of which was mostly merged with a marker for the endoplasmic reticulum. Two kinds of SNPs type ABCC3 (S346F and S607N) lost their transport activity for [H]estradiol-17beta-D-glucuronide in membrane vesicles from Sf9 cells infected with the recombinant baculoviruses, although the band length and the amount of protein expression remained normal. In contrast, the cellular localization, protein expression and function of other eight kinds of SNPs type ABCC3 (G11D, R99Q, V765L, P920S, R923Q, R1286G, R1348C, and Q1365R ABCC3) remained normal. CONCLUSION: The results of this study suggest that the possession of R1381S, S346F, and S607N types of ABCC3 sequences may be a possible risk factor for the acquisition of hepatotoxicity, due to their poor ability to transport toxic compounds across the sinusoidal membrane.
Comments [show]
None has been submitted yet.
No. Sentence Comment
169 830 and D482G, both of which are frequently found in progressive familial intrahepatic cholestasis type 2 patients [39,40].
X
ABCB11 p.Asp482Gly 18698235:169:9
status: NEW[hide] Description of two new ABCB11 mutations responsibl... Can J Gastroenterol. 2011 Jun;25(6):311-4. Beausejour Y, Alvarez F, Beaulieu M, Bilodeau M
Description of two new ABCB11 mutations responsible for type 2 benign recurrent intrahepatic cholestasis in a French-Canadian family.
Can J Gastroenterol. 2011 Jun;25(6):311-4., [PMID:21766090]
Abstract [show]
Benign recurrent intrahepatic cholestasis is a rare clinical entity that is caused by mutations in the canalicular transport genes. The present report describes two individuals from the same family whose symptoms were typical of the clinical characteristics of type 2 benign recurrent intrahepatic cholestasis. Sequencing of the ABCB11 gene revealed two previously unreported mutations that predict the absence of expression of the protein. The clinical presentation of the current cases are discussed, as are the differential diagnosis and genetic characteristics of the hereditary cholestatic disorders, overemphasizing the possibility of making a definite genetic diagnosis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
87 Among the two most common mutations in individuals of European descent are the E297G and D482G mutations, which collectively account for approximately 58% of all cases (9).
X
ABCB11 p.Asp482Gly 21766090:87:89
status: NEW86 Among the two most common mutations in individuals of European descent are the E297G and D482G mutations, which collectively account for approximately 58% of all cases (9).
X
ABCB11 p.Asp482Gly 21766090:86:89
status: NEW[hide] ABCB4 and ABCB11 mutations in intrahepatic cholest... Dig Liver Dis. 2013 Mar;45(3):226-32. doi: 10.1016/j.dld.2012.08.011. Epub 2012 Sep 27. Anzivino C, Odoardi MR, Meschiari E, Baldelli E, Facchinetti F, Neri I, Ruggiero G, Zampino R, Bertolotti M, Loria P, Carulli L
ABCB4 and ABCB11 mutations in intrahepatic cholestasis of pregnancy in an Italian population.
Dig Liver Dis. 2013 Mar;45(3):226-32. doi: 10.1016/j.dld.2012.08.011. Epub 2012 Sep 27., [PMID:23022423]
Abstract [show]
BACKGROUND: Genetic alterations in the ATP-binding cassette subfamily B member 4 (ABCB4) and ATP-binding cassette subfamily B member 11 (ABCB11) have been associated to the onset of intrahepatic cholestasis of pregnancy (ICP) in predisposed women. AIMS: To identify new and/or frequent ABCB4 and ABCB11 genes variants in a cohort of Italian patients with ICP and to evaluate the possible pathogenetic role for the novel mutations identified. METHODS: DNA of 33 unrelated Italian women with obstetric cholestasis were screened for mutations in the entire coding sequence of ABCB4 and ABCB11 genes. Polymerase chain reaction and automated sequencing was performed on the 27 coding exons of both genes. RESULTS: Genotyping revealed 11 mutations, 5 of whom were novel variants: 2 localized on ABCB4 (p.I587DfsX603, p.I738LfsX744) and 3 on ABCB11 (p.V284D, p.Q558H, p.P731S). The most severe phenotypes were associated with the variants p.I587DfsX603, p.I738LfsX744 and p.V284D. Moreover, the already described mutation p.N510S found in ABCB4 seems to be strictly involved in the onset of ICP in that particular patient. CONCLUSIONS: Our data support the hypothesis of a significant involvement of ABCB4 mutations in the onset of ICP, but also confirm an important role for ABCB11 mutations in increasing the susceptibility to cholestasis of pregnancy.
Comments [show]
None has been submitted yet.
No. Sentence Comment
92 Variants p.E135K, p.D482G and p.R698H were reported in previous studies [12,25-28].
X
ABCB11 p.Asp482Gly 23022423:92:20
status: NEW101 Nucleotide change and effect on protein Location PSIC scores by PolyPhen-2 analysis Reference 1 c.217 C > G (p. L73V) Exon 4 0.489 [12] 2 c.523 A > G (p.T175A) Exon 6 0.774 [12] 3 c.1529 A > G (p.N510S) Exon 13 2.075 [24] 4 c.1758 1759 ins G (p.I587DfsX603) Exon 15 X This study 5 c.2211(+1) G > T (p.I738LfsX744) 5 Intron 17 X This study ABCB11 mutations 6 c.403 G > A (p.E135K) Exon 6 0.502 [26] 7 c.852 T > A (p.V284D) Exon 9 2.175 This study 8 c.1445 A > G (p.D482G) Exon 14 1.364 [26-28] 9 c.1674 G > C (p.Q558H) Exon 15 1.383 This study 10 c.2093 G > A (p.R698H) Exon 18 0.821 [12,25] 11 c.2191 C > T (p. P731S) Exon 19 0.851 This study New mutations are shown in bold.
X
ABCB11 p.Asp482Gly 23022423:101:465
status: NEW110 The already described mutations p.E135K and p.D482G are associated with two similar phenotypes (Table 4), except for the higher levels of serum bile acids in the patient carrying the p.E135K variant.
X
ABCB11 p.Asp482Gly 23022423:110:46
status: NEW129 Table 4 Clinical details of patients with ABCB11 mutations. Parameters Patient 6 E135K Patient7 V284D Patient 8 D482G Patient 9 Q558H Patient 10 R698H Patient 11 P731S Onset of pruritus 3rd trimester 2nd trimester 3rd trimester 2nd trimester 2nd trimester 3rd trimester Parity 2 1 2 2 2 2 Previous ICP Yes Yes Yes No Yes Yes Peak of AST (U/L) 24 92 29 125 244 105 Peak of ALT (U/L) 26 215 37 315 514 198 Peak of Bilirubin (mg/dL) 0.53 0.49 Nd 0.36 0.3 0.46 Peak of GGT (U/L) 7 25 Nd 23 14 16 Total bile acids (òe;mol/L) 93.6 112.4 28 Nd 20.4 23.4 Delivery Induction of labour (36w+4 )a Caesarean section (38w)a Induction of labour (38w+4 )a Caesarean section (36w)a Caesarean section (38w)a Induction of labour (38w) Cholelithiasis No No No No No No UDCA therapy Yes Yes No Yes Yes Yes AST: aspartate aminotransferase; ALT: alanine aminotransferase; GGT: ॹ-glutamyl transpeptidase; Nd: not determined. a Caesarean section or induction of labour due to pregnancy complications related to ICP (foetal distress and/or intolerable pruritus and/or persistent elevation of AST and ALT).
X
ABCB11 p.Asp482Gly 23022423:129:112
status: NEW93 Variants p.E135K, p.D482G and p.R698H were reported in previous studies [12,25-28].
X
ABCB11 p.Asp482Gly 23022423:93:20
status: NEW102 Nucleotide change and effect on protein Location PSIC scores by PolyPhen-2 analysis Reference 1 c.217 C > G (p. L73V) Exon 4 0.489 [12] 2 c.523 A > G (p.T175A) Exon 6 0.774 [12] 3 c.1529 A > G (p.N510S) Exon 13 2.075 [24] 4 c.1758 1759 ins G (p.I587DfsX603) Exon 15 X This study 5 c.2211(+1) G > T (p.I738LfsX744) 5 Intron 17 X This study ABCB11 mutations 6 c.403 G > A (p.E135K) Exon 6 0.502 [26] 7 c.852 T > A (p.V284D) Exon 9 2.175 This study 8 c.1445 A > G (p.D482G) Exon 14 1.364 [26-28] 9 c.1674 G > C (p.Q558H) Exon 15 1.383 This study 10 c.2093 G > A (p.R698H) Exon 18 0.821 [12,25] 11 c.2191 C > T (p. P731S) Exon 19 0.851 This study New mutations are shown in bold.
X
ABCB11 p.Asp482Gly 23022423:102:465
status: NEW111 The already described mutations p.E135K and p.D482G are associated with two similar phenotypes (Table 4), except for the higher levels of serum bile acids in the patient carrying the p.E135K variant.
X
ABCB11 p.Asp482Gly 23022423:111:46
status: NEW130 Table 4 Clinical details of patients with ABCB11 mutations. Parameters Patient 6 E135K Patient7 V284D Patient 8 D482G Patient 9 Q558H Patient 10 R698H Patient 11 P731S Onset of pruritus 3rd trimester 2nd trimester 3rd trimester 2nd trimester 2nd trimester 3rd trimester Parity 2 1 2 2 2 2 Previous ICP Yes Yes Yes No Yes Yes Peak of AST (U/L) 24 92 29 125 244 105 Peak of ALT (U/L) 26 215 37 315 514 198 Peak of Bilirubin (mg/dL) 0.53 0.49 Nd 0.36 0.3 0.46 Peak of GGT (U/L) 7 25 Nd 23 14 16 Total bile acids (òe;mol/L) 93.6 112.4 28 Nd 20.4 23.4 Delivery Induction of labour (36w+4 )a Caesarean section (38w)a Induction of labour (38w+4 )a Caesarean section (36w)a Caesarean section (38w)a Induction of labour (38w) Cholelithiasis No No No No No No UDCA therapy Yes Yes No Yes Yes Yes AST: aspartate aminotransferase; ALT: alanine aminotransferase; GGT: ॹ-glutamyl transpeptidase; Nd: not determined. a Caesarean section or induction of labour due to pregnancy complications related to ICP (foetal distress and/or intolerable pruritus and/or persistent elevation of AST and ALT).
X
ABCB11 p.Asp482Gly 23022423:130:112
status: NEW[hide] Progressive familial intrahepatic cholestasis. Clin Res Hepatol Gastroenterol. 2012 Sep;36 Suppl 1:S26-35. doi: 10.1016/S2210-7401(12)70018-9. Jacquemin E
Progressive familial intrahepatic cholestasis.
Clin Res Hepatol Gastroenterol. 2012 Sep;36 Suppl 1:S26-35. doi: 10.1016/S2210-7401(12)70018-9., [PMID:23141890]
Abstract [show]
Progressive familial intrahepatic cholestasis (PFIC) refers to a heterogeneous group of autosomal-recessive disorders of childhood that disrupt bile formation and present with cholestasis of hepatocellular origin. The exact prevalence remains unknown, but the estimated incidence varies between 1/50,000 and 1/100,000 births. Three types of PFIC have been identified and associated with mutations in hepatocellular transport-system genes involved in bile formation. PFIC1 and PFIC2 usually appear in the first months of life, whereas onset of PFIC3 may arise later in infancy, in childhood or even during young adulthood. The main clinical manifestations include cholestasis, pruritus and jaundice. PFIC patients usually develop fibrosis and end-stage liver disease before adulthood. Serum gamma-glutamyltransferase (GGT) activity is normal in PFIC1 and PFIC2 patients, but is elevated in PFIC3 patients. Both PFIC1 and PFIC2 are caused by impaired bile salt secretion due to defects in ATP8B1 encoding the FIC1 protein and in ABCB11 encoding bile salt export pump (BSEP) protein, respectively. Defects in ABCB4, encoding multidrug resistance 3 protein (MDR3), impair biliary phospholipid secretion, resulting in PFIC3. Diagnosis is based on clinical manifestations, liver ultrasonography, cholangiography and liver histology, as well as on specific tests to exclude other causes of childhood cholestasis. MDR3 and BSEP liver immunostaining, and analysis of biliary lipid composition should help to select PFIC candidates for whom genotyping could be proposed to confirm the diagnosis. Antenatal diagnosis may be proposed for affected families in which a mutation has been identified. Ursodeoxycholic acid (UDCA) therapy should be initiated in all patients to prevent liver damage. In some PFIC1 and PFIC2 patients, biliary diversion may also relieve pruritus and slow disease progression. However, most PFIC patients are ultimately candidates for liver transplantation. Monitoring of liver tumors, especially in PFIC2 patients, should be offered from the first year of life. Hepatocyte transplantation, gene therapy and specific targeted pharmacotherapy may represent alternative treatments in the future.
Comments [show]
None has been submitted yet.
No. Sentence Comment
151 Preliminary data suggest that PFIC2 patients with p.D482G or p.E297G mutations may respond well to biliary diversion.
X
ABCB11 p.Asp482Gly 23141890:151:52
status: NEW[hide] A progressive familial intrahepatic cholestasis ty... J Hepatol. 2004 Jan;40(1):24-30. Plass JR, Mol O, Heegsma J, Geuken M, de Bruin J, Elling G, Muller M, Faber KN, Jansen PL
A progressive familial intrahepatic cholestasis type 2 mutation causes an unstable, temperature-sensitive bile salt export pump.
J Hepatol. 2004 Jan;40(1):24-30., [PMID:14672610]
Abstract [show]
BACKGROUND/AIMS: Progressive familial intrahepatic cholestasis type 2 (PFIC-2) patients have a defect in the hepatocanalicular bile salt secretion. The disease is caused by mutations in the bile salt export pump (BSEP). Ten different missense mutations have been described. In this study, we analysed the effect of the D482G PFIC-2 mutation on BSEP function. METHODS: Adenosine triphosphatase (ATPase) and taurocholate transport assays were performed with full-length mouse Bsep (mBsep) with and without the D482G mutation. The effect on expression and subcellular sorting was studied in HepG2 cells, stably expressing enhanced green fluorescent protein (EGFP)-tagged mBsep proteins. RESULTS: The D482G mutation did not significantly affect the taurocholate transport activity of mBsep, even though the bile salt-inducible ATPase activity of the mutant protein was slightly reduced. Protein expression and canalicular sorting were strongly affected by the D482G mutation. Mutant EGFP-mBsep protein was only partly glycosylated and detected in both the canalicular membrane and the cytoplasm. At 30 degrees C, the mutant mRNA and protein levels were strongly increased, and the protein was predominantly glycosylated and efficiently targeted to the canalicular membrane. CONCLUSIONS: These data suggest that PFIC-2 patients with the D482G mutation express a functional, but highly unstable, temperature-sensitive bile salt export pump.
Comments [show]
None has been submitted yet.
No. Sentence Comment
3 In this study, we analysed the effect of the D482G PFIC-2 mutation on BSEP function.
X
ABCB11 p.Asp482Gly 14672610:3:45
status: NEW4 Methods: Adenosine triphosphatase (ATPase) and taurocholate transport assays were performed with full-length mouse Bsep (mBsep) with and without the D482G mutation.
X
ABCB11 p.Asp482Gly 14672610:4:149
status: NEW6 Results: The D482G mutation did not significantly affect the taurocholate transport activity of mBsep, even though the bile salt-inducible ATPase activity of the mutant protein was slightly reduced.
X
ABCB11 p.Asp482Gly 14672610:6:13
status: NEW7 Protein expression and canalicular sorting were strongly affected by the D482G mutation.
X
ABCB11 p.Asp482Gly 14672610:7:73
status: NEW10 Conclusions: These data suggest that PFIC-2 patients with the D482G mutation express a functional, but highly unstable, temperature-sensitive bile salt export pump.
X
ABCB11 p.Asp482Gly 14672610:10:62
status: NEW24 Abbreviations: ABC, ATP-binding cassette; ATPase, adenosine triphosphatase; BCV, bile canalicular-like vacuole; BSEP, human bile salt export pump; mBsep, mouse bile salt export pump; D482G, aspartate- to-glycine mutation at position 482 in BSEP/Bsep; EGFP, enhanced green fluorescent protein; NBD, nucleotide binding domain; PCR, polymerase chain reaction; PFIC, progressive familial intrahepatic cholestasis; PNGase F, peptide N-glycosidase F; SDS-PAGE, sodium dodecyl sulphate polyacrylamide gel electrophoresis; TCA, taurocholate.
X
ABCB11 p.Asp482Gly 14672610:24:183
status: NEW40 We investigated the effects of the PFIC-2 related missense mutation D482G, an aspartate to glycine change at position 482 [10], occurring in the first nucleotide-binding domain of BSEP, on the adenosine triphosphatase (ATPase) activity, transport activity, sorting, and expression of the protein.
X
ABCB11 p.Asp482Gly 14672610:40:68
status: NEWX
ABCB11 p.Asp482Gly 14672610:40:78
status: NEW42 In fact, the D482G mutation causes a temperature-sensitive reduction of BSEP protein expression, probably caused by reduced protein stability.
X
ABCB11 p.Asp482Gly 14672610:42:13
status: NEW48 HepG2 cells were stably transfected with pEGFP-C1-mBsep[WT] or pEGFP-C1-mBsep[D482G] using the calcium phosphate precipitation method [12] and geneticin-resistant clones were selected.
X
ABCB11 p.Asp482Gly 14672610:48:78
status: NEW55 Site-directed mutagenesis was performed using the QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) to introduce the D482G mutation in pFASTBAC1-mBsep and pEGFP-C1-mBsep (primers used: mD482Gsense/antisense).
X
ABCB11 p.Asp482Gly 14672610:55:136
status: NEW87 The D482G mutation is present in the first nucleotide-binding domain of BSEP, which is highly conserved between species (Fig. 1).
X
ABCB11 p.Asp482Gly 14672610:87:4
status: NEW90 The mBsep[D482G] protein is still functional as a bile salt transporter Wild type and D482G mutant mBsep were expressed at comparable levels in Sf21 insect cells (Fig. 2A, insert).
X
ABCB11 p.Asp482Gly 14672610:90:10
status: NEWX
ABCB11 p.Asp482Gly 14672610:90:86
status: NEW94 Similar results were obtained with membrane fractions containing mBsep[D482G] (black bars).
X
ABCB11 p.Asp482Gly 14672610:94:71
status: NEW96 This shows that the ATPase activity of both WT and D482G mBsep are stimulated by the substrates of the transporter.
X
ABCB11 p.Asp482Gly 14672610:96:51
status: NEW97 The bile salt transport activity of the wild type and mutant mBsep is shown in Fig. 2B. Both mBsep[WT] - and mBsep[D482G] -vesicles show similar TCA uptake rates (32.7 ^ 1.5 versus 30.5 ^ 3.3 pmol TCA&#b7;min21 &#b7;mg21 protein).
X
ABCB11 p.Asp482Gly 14672610:97:115
status: NEW99 The EGFP-mBsep[D482G] is inefficiently targeted to the canalicular membrane in HepG2 cells To study the protein stability and subcellular sorting of wild type and mutant mBsep, we generated stable HepG2 cell lines that express these proteins, N-terminally tagged to the EGFP.
X
ABCB11 p.Asp482Gly 14672610:99:15
status: NEW111 The EGFP-mBsep[D482G] mutant protein was detected in the BCV`s but, in addition, a considerable amount of protein was retained in the cytoplasm (Figs. 3D-F).
X
ABCB11 p.Asp482Gly 14672610:111:15
status: NEW113 The D482G mutation results in unstable and immature mBsep protein Next, we analyzed the correlation between the mRNA and protein level of cells stably expressing EGFP-mBsep[WT] and EGFP-mBsep[D482G] .
X
ABCB11 p.Asp482Gly 14672610:113:4
status: NEWX
ABCB11 p.Asp482Gly 14672610:113:192
status: NEW115 However, the EGFP-mBsep[D482G] signal at this position is hardly detectable (Fig. 4, lane 1).
X
ABCB11 p.Asp482Gly 14672610:115:24
status: NEW119 PNGase F-treatment of EGFP-mBsep[D482G] resulted in the disappearance of the minor 190 kDa band.
X
ABCB11 p.Asp482Gly 14672610:119:33
status: NEW121 This shows that the 160 kDa EGFP-mBsep[D482G] protein band is full-length, but improperly glycosylated protein.
X
ABCB11 p.Asp482Gly 14672610:121:39
status: NEW122 Moreover, the specific amount of EGFP-mBsep[D482G] protein appeared lower than the EGFP-mBsep[WT] protein.
X
ABCB11 p.Asp482Gly 14672610:122:44
status: NEW123 Therefore, we determined the specific mRNA levels of EGFP-mBsep[WT] and EGFP-mBsep[D482G] in the corresponding cell lines.
X
ABCB11 p.Asp482Gly 14672610:123:83
status: NEW124 In contrast to the difference in protein level, the relative amount of EGFP-mBsep[D482G] was 4.5-fold higher compared to the EGFP-mBsep[WT] mRNA level (Fig. 5A).
X
ABCB11 p.Asp482Gly 14672610:124:82
status: NEW125 These data show that high mRNA levels for EGFP-mBsep[D482G] do not give rise to similarly high protein levels, relative to the results obtained for EGFP-mBsep[WT] .
X
ABCB11 p.Asp482Gly 14672610:125:53
status: NEW129 Therefore, we cultured both the EGFP-mBsep[WT] and EGFP-mBsep[D482G] HepG2 cells at 308C and determined the specific mRNA and protein levels.
X
ABCB11 p.Asp482Gly 14672610:129:62
status: NEW130 Surprisingly, we found that the relative mRNA levels for both EGFP-mBsep[WT] and EGFP-mBsep[D482G] increased approximately 12-fold in cells grown at 308C compared to cells grown at 378C (Fig. 5A).
X
ABCB11 p.Asp482Gly 14672610:130:92
status: NEW131 However, the 4.5-fold difference between EGFP-mBsep[D482G] and EGFP-mBsep[WT] remained despite the overall higher mRNA levels.
X
ABCB11 p.Asp482Gly 14672610:131:52
status: NEW132 In cells grown at 308C, the protein level of both EGFP-mBsep[WT] and EGFP-mBsep[D482G] increased significantly when compared to cells at 378C (Fig. 5B).
X
ABCB11 p.Asp482Gly 14672610:132:80
status: NEW133 However, the EGFP-mBsep[D482G] showed a much stronger increase in protein level than the EGFP-mBsep[WT] .
X
ABCB11 p.Asp482Gly 14672610:133:24
status: NEW134 Moreover, at 308C the EGFP-mBsep[D482G] appeared predominantly in fully glycosylated form.
X
ABCB11 p.Asp482Gly 14672610:134:33
status: NEW135 Under these conditions, the EGFP-mBsep[D482G] protein level was approximately 5-fold higher than EGFP-mBsep[WT] as determined by densitometry.
X
ABCB11 p.Asp482Gly 14672610:135:39
status: NEW137 Confocal laser scanning microscopy revealed that at 308C, the EGFP-mBsep[D482G] protein was efficiently targeted to the BCV`s (Figs. 3G-I).
X
ABCB11 p.Asp482Gly 14672610:137:73
status: NEW139 The D482G mutation does not block the ATPase and transport activity of mBsep.
X
ABCB11 p.Asp482Gly 14672610:139:4
status: NEW140 (A) Membrane vesicles containing comparable levels of wild type or D482G mutant mBsep (insert) are subjected to an ATPase assay in the absence or presence of 30 mM TCA and 200 mM orthovanadate as described in Section 2.
X
ABCB11 p.Asp482Gly 14672610:140:67
status: NEW148 Discussion In this study, we analysed the effect of the PFIC-2 mutation, D482G, on Bsep function and intracellular expression.
X
ABCB11 p.Asp482Gly 14672610:148:73
status: NEW151 The D482G-mutant Bsep protein appears to be temperature-sensitive.
X
ABCB11 p.Asp482Gly 14672610:151:4
status: NEW152 At 308C, high levels of normally glycosylated, and correctly sorted Bsep[D482G] were detected.
X
ABCB11 p.Asp482Gly 14672610:152:73
status: NEW156 Efficient sorting of the D482G mutant mBsep in HepG2 cells is temperature-sensitive.
X
ABCB11 p.Asp482Gly 14672610:156:25
status: NEW158 At 378C, both EGFP-tagged wild type (A, C) and D482G mutant (D, F) mBsep sort to the BCV.
X
ABCB11 p.Asp482Gly 14672610:158:47
status: NEW159 However, significant amounts of the D482G mutant mBsep are detected intracellular (D, F).
X
ABCB11 p.Asp482Gly 14672610:159:36
status: NEW162 When cells were grown at 308C, the D482G mutant mBsep was solely observed in the BCV`s.
X
ABCB11 p.Asp482Gly 14672610:162:35
status: NEW167 The D482G mutation leads to low levels and incompletely glycosylated mBsep protein.
X
ABCB11 p.Asp482Gly 14672610:167:4
status: NEW168 Western blot analysis using a GFP antibody of approximately160 mg of total protein extracts from EGFP-mBsep[D482G] HepG2 cells (lane 1), and EGFP-mBsep[WT] cells (lanes 2 and 3).
X
ABCB11 p.Asp482Gly 14672610:168:108
status: NEW170 Since the D482G mutation is present in the first NBD of BSEP, we first tested its effect on the ATPase activity.
X
ABCB11 p.Asp482Gly 14672610:170:10
status: NEW173 The ATPase activity of the mBsep[D482G] -protein was also induced by TCA, be it to a lower level than the WT protein.
X
ABCB11 p.Asp482Gly 14672610:173:33
status: NEW175 Taken together, these results show that the mBsep[D482G] is a functional bile salt transporter with biochemical characteristics comparable to the wild type protein.
X
ABCB11 p.Asp482Gly 14672610:175:50
status: NEW176 To study the effect of the D482G mutation on intracellular sorting and protein stability, we constructed stable HepG2 cell lines, expressing mBsep[WT] or mBsep[D482G] N-terminally tagged with EGFP.
X
ABCB11 p.Asp482Gly 14672610:176:27
status: NEWX
ABCB11 p.Asp482Gly 14672610:176:160
status: NEW177 Detectable amounts of EGFP-mBsep[D482G] protein were only observed in clones with significantly (5-fold) higher mRNA levels as compared to EGFP-mBsep[WT] .
X
ABCB11 p.Asp482Gly 14672610:177:33
status: NEW179 This was confirmed by confocal laser scanning microscopy analyses, in which significant amounts of the EGFP-mBsep[D482G] protein were detected in a fine reticulum-like pattern in the cytoplasm.
X
ABCB11 p.Asp482Gly 14672610:179:114
status: NEW181 Collectively, our findings suggest that the D482G mutation results in low BSEP protein levels and that the mutant protein is improperly glycosylated and targeted at physiological conditions.
X
ABCB11 p.Asp482Gly 14672610:181:44
status: NEW186 Therefore, we cultured our stable cell lines at reduced (308C) temperatures and found that the mRNA level for both EGFP-mBsep[WT] and EGFP-mBsep[D482G] increased approximately 12-fold compared to the level in cells grown at 378C.
X
ABCB11 p.Asp482Gly 14672610:186:145
status: NEW192 At 308C, both the mRNA and protein level of EGFP-mBsep[D482G] were approximately 5-fold higher than those for EGFP-mBsep[WT] mRNA level.
X
ABCB11 p.Asp482Gly 14672610:192:55
status: NEW196 They found that the D482G mutation reduced the taurocholate transport activity of rat Bsep by approximately 50% and GFP-tagged rBsep[D482G] was found at the apical membrane and in the cytoplasm of Madin-Darby canine kidney (MDCK) cells.
X
ABCB11 p.Asp482Gly 14672610:196:20
status: NEWX
ABCB11 p.Asp482Gly 14672610:196:133
status: NEW197 The correlation between GFP- rBsep[D482G] mRNA and protein levels was not determined in detail.
X
ABCB11 p.Asp482Gly 14672610:197:35
status: NEW198 Our results show little or no effect of the D482G mutation on the BSEP transport function, but a very strong effect on protein stability, maturation and/or turnover.
X
ABCB11 p.Asp482Gly 14672610:198:44
status: NEW202 The deleterious effect of the D482G mutation could Fig. 5.
X
ABCB11 p.Asp482Gly 14672610:202:30
status: NEW206 (B) Total protein lysates from HepG2 cells expressing the wild type or D482G mutant mBsep were isolated.
X
ABCB11 p.Asp482Gly 14672610:206:71
status: NEW213 In conclusion, our data show that PFIC-2 patients with the D482G mutation express a functional, but highly unstable bile salt export pump.
X
ABCB11 p.Asp482Gly 14672610:213:59
status: NEW[hide] Impaired expression and function of the bile salt ... J Hepatol. 2005 Sep;43(3):536-43. Noe J, Kullak-Ublick GA, Jochum W, Stieger B, Kerb R, Haberl M, Mullhaupt B, Meier PJ, Pauli-Magnus C
Impaired expression and function of the bile salt export pump due to three novel ABCB11 mutations in intrahepatic cholestasis.
J Hepatol. 2005 Sep;43(3):536-43., [PMID:16039748]
Abstract [show]
BACKGROUND/AIMS: Inherited dysfunction of the bile salt export pump BSEP (ABCB11) causes a progressive and a benign form of familial intrahepatic cholestasis, denominated as PFIC2 and BRIC2, respectively. We functionally characterized novel ABCB11 mutations encountered in two patients with a PFIC2 and a BRIC2 phenotype, respectively. METHODS: BSEP expression was determined in liver biopsies by immunohistochemistry. ABCB11 mutations were functionally characterized by taurocholate transport in SF9 cells transfected with human ABCB11. RESULTS: The PFIC2 patient was compound heterozygous for a splicing mutation in intron 4 ((+3)A > C) combined with an early stop codon at position 930 (R930X), while the BRIC2 patient was compound heterozygous for two nonsynonymous mutations in exon 9 (E297G) and exon 12 (R432T), respectively. Hepatic BSEP expression was absent in PFIC2 and preserved in BRIC2. In BRIC2, taurocholate transport was decreased to 13% and 20% of reference levels for R432T and E297G, respectively. CONCLUSIONS: The intron 4 (+3)A > C, R930X and R432T represent previously undescribed mutations of the ABCB11 gene that confer a PFIC2 and a BRIC2 phenotype, respectively. By combining functional in-vitro characterization with immunohistochemical detection of variant BSEP we provide direct evidence for the role of ABCB11 mutations in the pathogenesis of different forms of intrahepatic cholestasis.
Comments [show]
None has been submitted yet.
No. Sentence Comment
29 However, the D482G mutation, which was found to exhibit decreased function by Wang, showed preserved transport activity when cloned into mouse Abcb11, indicating the possible impact of species differences on protein function [13].
X
ABCB11 p.Asp482Gly 16039748:29:13
status: NEW[hide] Severe bile salt export pump deficiency: 82 differ... Gastroenterology. 2008 Apr;134(4):1203-14. doi: 10.1053/j.gastro.2008.01.038. Epub 2008 Jan 18. Strautnieks SS, Byrne JA, Pawlikowska L, Cebecauerova D, Rayner A, Dutton L, Meier Y, Antoniou A, Stieger B, Arnell H, Ozcay F, Al-Hussaini HF, Bassas AF, Verkade HJ, Fischler B, Nemeth A, Kotalova R, Shneider BL, Cielecka-Kuszyk J, McClean P, Whitington PF, Sokal E, Jirsa M, Wali SH, Jankowska I, Pawlowska J, Mieli-Vergani G, Knisely AS, Bull LN, Thompson RJ
Severe bile salt export pump deficiency: 82 different ABCB11 mutations in 109 families.
Gastroenterology. 2008 Apr;134(4):1203-14. doi: 10.1053/j.gastro.2008.01.038. Epub 2008 Jan 18., [PMID:18395098]
Abstract [show]
BACKGROUND & AIMS: Patients with severe bile salt export pump (BSEP) deficiency present as infants with progressive cholestatic liver disease. We characterized mutations of ABCB11 (encoding BSEP) in such patients and correlated genotypes with residual protein detection and risk of malignancy. METHODS: Patients with intrahepatic cholestasis suggestive of BSEP deficiency were investigated by single-strand conformation polymorphism analysis and sequencing of ABCB11. Genotypes sorted by likely phenotypic severity were correlated with data on BSEP immunohistochemistry and clinical outcome. RESULTS: Eighty-two different mutations (52 novel) were identified in 109 families (9 nonsense mutations, 10 small insertions and deletions, 15 splice-site changes, 3 whole-gene deletions, 45 missense changes). In 7 families, only a single heterozygous mutation was identified despite complete sequence analysis. Thirty-two percent of mutations occurred in >1 family, with E297G and/or D482G present in 58% of European families (52/89). On immunohistochemical analysis (88 patients), 93% had abnormal or absent BSEP staining. Expression varied most for E297G and D482G, with some BSEP detected in 45% of patients (19/42) with these mutations. Hepatocellular carcinoma or cholangiocarcinoma developed in 15% of patients (19/128). Two protein-truncating mutations conferred particular risk; 38% (8/21) of such patients developed malignancy versus 10% (11/107) with potentially less severe genotypes (relative risk, 3.7 [confidence limits, 1.7-8.1; P = .003]). CONCLUSIONS: With this study, >100 ABCB11 mutations are now identified. Immunohistochemically detectable BSEP is typically absent, or much reduced, in severe disease. BSEP deficiency confers risk of hepatobiliary malignancy. Close surveillance of BSEP-deficient patients retaining their native liver, particularly those carrying 2 null mutations, is essential.
Comments [show]
None has been submitted yet.
No. Sentence Comment
7 Thirty-two percent of mutations occurred in >1 family, with E297G and/or D482G present in 58% of European families (52/89).
X
ABCB11 p.Asp482Gly 18395098:7:73
status: NEW9 Expression varied most for E297G and D482G, with some BSEP detected in 45% of patients (19/42) with these mutations.
X
ABCB11 p.Asp482Gly 18395098:9:37
status: NEW77 The common mutations E297G, D482G, R575X, R1153C, and R1153H abolish HphI, FokI, FokI, BsrBI, and BsrBI sites, respectively, while G982R creates an AlwNI site.
X
ABCB11 p.Asp482Gly 18395098:77:28
status: NEW98 Most frequent were E297G and D482G, one or both of which were present in 58% of European families (52/89) and 15% of non-European families (3/20).
X
ABCB11 p.Asp482Gly 18395098:98:29
status: NEW100 D482G occurred in 20 European families (25 alleles) and on one allele in a Central Asian/Arab family.
X
ABCB11 p.Asp482Gly 18395098:100:0
status: NEW112 In 23 families homozygosity was associated with known consanguinity, while in 9 families, 2 copies of either E297G or D482G were found.
X
ABCB11 p.Asp482Gly 18395098:112:118
status: NEW113 To assess effects of specific ABCB11 genotypes on expression of immunohistochemically detectable BSEP protein, families were grouped according to whether they carried 2 likely protein-truncating mutations, at least one missense mutation (E297G or D482G excluded), at least one copy of E297G, at least one copy of D482G, or only one identified mutation (Supplementary Tables 1A-E).
X
ABCB11 p.Asp482Gly 18395098:113:247
status: NEWX
ABCB11 p.Asp482Gly 18395098:113:313
status: NEW116 Variability in BSEP expression was greatest when either of the 2 common European mutations, E297G or D482G, was present on one or both alleles (Supplementary Tables 1C-E).
X
ABCB11 p.Asp482Gly 18395098:116:101
status: NEW118 For 14 patients with at least one copy of D482G, BSEP staining was not detected in 8 (57%), was abnormal in 3 (21%), and was normal in 3 (21%).
X
ABCB11 p.Asp482Gly 18395098:118:42
status: NEW150 Missense Mutations in ABCB11 Nucleotide change Predicted effect Exon CpG site Location Change in: Size Charge Hyd/Pol Shape c.149Tb0e;C p.Leu50Ser 4 No NH2 term Y Y Y c.470Ab0e;G p.Tyr157Cys 6 No TM2 Y Y Y c.725Cb0e;T p.Thr242Ile 8 No TM4 Y Y c.890Ab0e;G p.Glu297Gly 9 No IC2 Y Y Y c.908Gb0e;A p.Arg303Lys 9 No IC2 c.937Cb0e;A p.Arg313Ser 10 Yes IC2 Y Y Y Y c.980Gb0e;A p.Gly327Glu 10 No TM5 Y Y Y c.1168Gb0e;C p.Ala390Pro 11 No TM/NBF Y c.1229Gb0e;A p.Gly410Asp 12 No TM/NBF Y Y c.1238Tb0e;G p.Leu413Trp 12 No TM/NBF c.1388Cb0e;T p.Thr463Ile 13 No Adj Walker A Y Y Y c.1396Cb0e;A p.Gln466Lys 13 No Adj Walker A Y c.1409Gb0e;A p.Arg470Gln 13 Yes Adj Walker A Y c.1415Ab0e;G p.Tyr472Cys 13 No Adj Walker A Y Y Y c.1442Tb0e;A p.Val481Glu 14 No NBF1 Y Y Y c.1445Ab0e;G p.Asp482Gly 14 No NBF1 Y Y c.1460Gb0e;C p.Arg487Pro 14 Yes NBF1 Y Y Y Y c.1468Ab0e;G p.Asn490Asp 14 No NBF1 Y c.1535Tb0e;C p.Ile512Thr 14 No NBF1 Y Y Y c.1544Ab0e;C p.Asn515Thr 14 No NBF1 Y Y c.1550Gb0e;A p.Arg517His 14 Yes NBF1 Y Y c.1621Ab0e;C p.Ile541Leu 14 No NBF1 c.1622Tb0e;C p.Ile541Thr 14 No NBF1 Y Y Y c.1643Tb0e;A p.Phe548Tyr 15 No Adj ABC c.1685Gb0e;A p.Gly562Asp 15 No ABC Y Y c.1708Gb0e;A p.Ala570Thr 15 Yes ABC/Walker B Y c.1763Cb0e;T p.Ala588Val 15 No Adj Walker B Y c.2272Gb0e;C p.Gly758Arg 19 No NBF/TM Y Y Y c.2296Gb0e;A p.Gly766Arg 19 Yes TM7 Y Y Y c.2494Cb0e;T p.Arg832Cys 21 Yes IC3 Y Y Y Y c.2576Cb0e;G p.Thr859Arg 21 No IC3 Y Y Y Y c.2842Cb0e;T p.Arg948Cys 23 Yes IC4 Y Y Y Y c.2935Ab0e;G p.Asn979Asp 23 No TM11 Y c.2944Gb0e;A p.Gly982Arg 23 Yes TM11 Y Y Y c.3086Cb0e;A p.Thr1029Lys 24 No TM12 Y Y Y Y c.3329Cb0e;A p.Ala1110Glu 25 Yes Adj Walker A Y Y Y c.3382Cb0e;T p.Arg1128Cys 25 Yes Adj Walker A Y Y Y Y c.3457Cb0e;T p.Arg1153Cys 26 Yes NBF2 Y Y Y Y c.3458Gb0e;A p.Arg1153His 26 Yes NBF2 Y Y c.3460Tb0e;C p.Ser1154Pro 26 No NBF2 Y c.3628Ab0e;C p.Thr1210Pro 27 No Adj ABC Y c.3691Cb0e;T p.Arg1231Trp 27 Yes ABC/Walker B Y Y c.3692Gb0e;A p.Arg1231Gln 27 Yes ABC/Walker B Y c.3724Cb0e;A p.Leu1242Ile 27 No Walker B c.3892Gb0e;A p.Gly1298Arg 28 No NBF2 Y Y Y NOTE.
X
ABCB11 p.Asp482Gly 18395098:150:816
status: NEW162 In 5 cases, the single mutations were splice-site changes or E297G/D482G.
X
ABCB11 p.Asp482Gly 18395098:162:67
status: NEW208 By far most common, however, were E297G and D482G, at least one of which was present in 58% (52/89) of European and in 15% (3/20) of non-European families.
X
ABCB11 p.Asp482Gly 18395098:208:44
status: NEW211 In contrast, D482G likely originated in Central or Eastern Europe, with cases identified in Polish, Austrian, Slovak, Czech, Hungarian, and Russian families.
X
ABCB11 p.Asp482Gly 18395098:211:13
status: NEW231 Residual staining was most striking in patients with E297G or D482G, with some seen in 45% of patients (19/42) carrying at least one of these alleles.
X
ABCB11 p.Asp482Gly 18395098:231:62
status: NEW234 Because most of these were found in combination with E297G or D482G, their individual effects could not be assessed.
X
ABCB11 p.Asp482Gly 18395098:234:62
status: NEW[hide] Short- and medium-chain fatty acids enhance the ce... Biochim Biophys Acta. 2010 Sep;1801(9):1005-12. doi: 10.1016/j.bbalip.2010.04.002. Epub 2010 Apr 14. Kato T, Hayashi H, Sugiyama Y
Short- and medium-chain fatty acids enhance the cell surface expression and transport capacity of the bile salt export pump (BSEP/ABCB11).
Biochim Biophys Acta. 2010 Sep;1801(9):1005-12. doi: 10.1016/j.bbalip.2010.04.002. Epub 2010 Apr 14., [PMID:20398791]
Abstract [show]
The reduced expression of the bile salt export pump (BSEP/ABCB11) at the canalicular membrane is associated with cholestasis-induced hepatotoxicity due to the accumulation of bile acids in hepatocytes. We previously reported that 4-phenylbutyrate (4PBA), an approved drug for urea cycle disorders, is a promising agent for intrahepatic cholestasis because it increases both the cell surface expression and the transport capacity of BSEP. In the present study, we searched for effective compounds other than 4PBA by focusing on short- and medium-chain fatty acids, which have similar characteristics to 4PBA such as their low-molecular-weight and a carboxyl group. In transcellular transport studies using Madin-Darby canine kidney (MDCK) II cells, all short- and medium-chain fatty acids tested except for formate, acetate, and hexanoic acid showed more potent effects on wild type (WT) BSEP-mediated [3H]taurocholate transport than did 4PBA. The increase in WT BSEP transport with butyrate and octanoic acid treatment correlated with an increase in its expression at the cell surface. Two PFIC2-type variants, E297G and D482G BSEP, were similarly affected with both compounds treatment. The prolonged half-life of cell surface-resident WT BSEP was responsible for this increased octanoic acid-stimulated transport, but not for that of butyrate. In conclusion, short- and medium-chain fatty acids have potent effects on the increase in WT and PFIC2-type BSEP-mediated transport in MDCK II cells. Although both short- and medium-chain fatty acids enhance the transport capacity of WT and PFIC2-type BSEP by inducing those expressions at the cell surface, the underlying mechanism seems to differ between fatty acids.
Comments [show]
None has been submitted yet.
No. Sentence Comment
5 Two PFIC2-type variants, E297G and D482G BSEP, were similarly affected with both compounds treatment.
X
ABCB11 p.Asp482Gly 20398791:5:35
status: NEW19 We and other groups have indicated previously that the reduced cell surface expression of BSEP is responsible for the dysfunction of BSEP in PFIC2 patients with E297G or D482G mutation, both of which are observed frequently in European PFIC2 patients [12,14-17].
X
ABCB11 p.Asp482Gly 20398791:19:170
status: NEW29 We previously reported that 4-phenylbutyrate (4PBA), an approved drug for treating urea cycle disorders, is a promising agent for the treatment of intrahepatic cholestasis because it increases both the