ABCMdb

ABCB11 p.Val444Ala

ClinVar:	c.1331T>C , p.Val444Ala N , Benign
Reviews:	p.Ala444Val D p.Val444Ala D p.Val444Gly N p.Val444Asp N
Predicted by SNAP2:	A: N (66%), C: D (66%), D: N (53%), E: N (97%), F: N (82%), G: N (93%), H: N (93%), I: N (97%), K: N (97%), L: N (97%), M: N (97%), N: N (97%), P: N (87%), Q: N (72%), R: N (97%), S: N (97%), T: N (72%), W: N (61%), Y: N (87%),
Predicted by PROVEAN:	A: N, C: N, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, R: N, S: N, T: N, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Interindividual variability of canalicular ATP-bin... Hepatology. 2006 Jul;44(1):62-74. Meier Y, Pauli-Magnus C, Zanger UM, Klein K, Schaeffeler E, Nussler AK, Nussler N, Eichelbaum M, Meier PJ, Stieger B
Interindividual variability of canalicular ATP-binding-cassette (ABC)-transporter expression in human liver.
Hepatology. 2006 Jul;44(1):62-74., [PMID:16799996]

Abstract [show]
Interindividual variability in hepatic canalicular transporter expression might predispose to the development of hepatic disorders such as acquired forms of intrahepatic cholestasis. We therefore investigated expression patterns of bile salt export pump (BSEP, ABCB11), multidrug resistance protein 3 (MDR3, ABCB4), multidrug resistance associated protein 2 (MRP2, ABCC2) and multidrug resistance protein 1 (MDR1, ABCB1) in healthy liver tissue of a white population. Protein expression levels were correlated with specific single nucleotide polymorphisms (SNPs) in the corresponding transporter genes. Hepatic protein expression levels from 110 individuals undergoing liver resection were assessed by Western blot analysis of liver plasma membranes enriched in canalicular marker enzymes. Each individual was genotyped for the following synonymous (s) and nonsynonymous (ns) SNPs: ABCB11: (ns:1457T>C and 2155A>G), ABCB4: (ns:3826A>G) and ABCC2 (ns:1286G>A,3600T>A and 4581G>A) and ABCB1 (ns:2677G>T/A and s:3435C>T). Transporter expression followed unimodal distribution. However, of all tested individuals 30% exhibited a high expression and 32% a low or very low expression phenotype for at least one of the four investigated transport proteins. Transporter expression levels did not correlate with age, sex, underlying liver disease, or presurgery medication. However, low BSEP expression was associated with the 1457C-allele in ABCB11 (P = .167) and high MRP2 expression was significantly correlated with the 3600A and 4581A ABCC2 variants (P = .006). In conclusion, the results demonstrate a considerable interindividual variability of canalicular transporter expression in normal liver. Furthermore, data suggest a polymorphic transporter expression pattern, which might constitute a risk factor for the development of acquired forms of cholestatic liver diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
154 Box-plot analysis of (A) normalized BSEP-expression against genetic variants of 1457TϾC(V444A) and 2155A Ͼ G(M677V); (B) MDR3-expression against 3826A Ͼ G (R652G); (C) MRP2-expression against 1286G Ͼ A(V417I), 3600T Ͼ A(V1188E), and 4581G Ͼ A(C1515Y) and MDR1 against 3435C Ͼ T and 2677G Ͼ T/A(A893S/T). Login to comment
63 Primers and Probes of RealTime PCR for Allelic Discrimination of Single Nucleotide Polymorphisms (SNPs) in Whites Gene Exon cDNA PositionA SNPB GenBank Reference Amino Acid Exchange Sense-Antisense Primer Probesc ABCB11 13 1457 T Ͼ C rs2287617* V444A 5Ј-CTTTCTTCTCCAGATTCTAAATGACCTCA-3Ј/ VIC 5Ј-CCTGGTTTAATGACCATGT-3Ј 5Ј-GTCCTACCAGAGCTGTCATTTCC-3Ј FAM 5Ј-CTGGTTTAATGGCCATGT-3Ј ABCB11 17 2155 A Ͼ G Ref. 14,15** M677V 5Ј-TCATGCTGTGTTGAGTAGATGCA-3Ј/ VIC 5Ј- CTGAAGATGACATGCTT-3Ј 5Ј-GGTAGCTCCCTCTGCTAAAGGT-3Ј FAM 5Ј- ACTGAAGATGACGTGCTT-3Ј ABCB4 16 3826 A Ͼ G rs8187799* R652G 5Ј-TCCAGTCAGAAGAATTTGAACTAAATGATGAA-3Ј/ VIC 5Ј-CTGCCACTAGAATGG-3Ј 5Ј-GCCTAAATAGATTTCCAGCCATTTGG-3Ј FAM 5Ј-TGCCACTGGAATGG-3Ј ABCC2 10 1286 G Ͼ A rs2273697* V417I 5Ј-CCAACTTGGCCAGGAAGGA-3Ј/ VIC 5Ј-CTGTTTCTCCAACGGTGTA-3Ј 5Ј-GGCATCCACAGACATCAGGTT-3Ј FAM 5Ј-ACTGTTTCTCCAATGGTGTA-3Ј ABCC2 25 3600 T Ͼ A rs8187694* V1188E 5Ј-GCACCAGCAGCGATTTCTG-3Ј/ VIC 5Ј-ACACAATGAGGTGAGGAT-3Ј 5Ј-AGGTGATCCAGGAAAAGACACATTT-3Ј FAM 5Ј-ACAATGAGGAGAGGAT-3Ј ABCC2 32 4581 G Ͼ A rs8187710* C1515Y 5Ј-GTAATGGTCCTAGACAACGGGAAG-3Ј/ VIC 5Ј- AGAGTGCGGCAGCC -3Ј 5Ј-CCAGGGATTTGTAGCAGTTCTTCAG-3Ј FAM 5Ј-ATTATAGAGTACGGCAGCC-3Ј ABCB1 26 3435 CϾT rs1045642* synonym. Login to comment
131 Specifically, for ABCB11 1457TϾC(V444A), corresponding BSEP mean expression levels were 1.15 Ϯ 0.52 for the 1457TT genotype, 0.90 Ϯ 0.46 for 1457CC, and 1.00 Ϯ 0.54 for 1457TC (Fig. 5A). Login to comment
141 Distribution of Genotypes and Allelic Frequencies of Investigated SNPs in Individuals With Low, Normal and High Transporter Expression Phenotypes SNP Study population Low expressorsA Normal expressorsB High expressionC 1) BSEP n ϭ 110 (100%) n ϭ 14 (100%) n ϭ 79 (100%) n ϭ 17 (100%) Alleles (2n) 220 (100%) 28 (100%) 158 (100%) 34 (100%) a) ABCB11 1457T>C (V444A): Genotypes: TT 19 (17%) 1 (7%) 14 (18%) 4 (24%) CC 29 (26%) 6 (43%) 19 (24%) 4 (24% TC 62 (56%) 7 (50%) 46 (58%) 9 (53%) Allelic frequency: C-allele 120 (55%) 19 (68%) 84 (53%) 17 (50%) b) ABCB11 2155A>G (M677V): Genotypes: AA 102 (93%) 14 (100%) 72 (91%) 16 (94%) AG 8 (7%) 7 (9%) 1 (6%) Allelic frequency: G-allele 8 (4%) 7 (7%) 1 (3%) 2) MDR3 n ϭ 110 (100%) n ϭ 13 (100%) n ϭ 86 (100%) n ϭ 11 (100%) Alleles (2n) 220 (100%) 26 (100%) 172 (100%) 22 (100%) ABCB4 3826A>G (R652G): Genotypes: AA 87 (89%) 8 (62%) 71 (83%) 8 (73%) AG 23 (21%) 5 (38%) 15 (17%) 3 (27%) Allelic frequency: G-allele 23 (10%) 5 (19%) 15 (9%) 3 (14%) 3) MRP2 n ϭ 110 (100%) n ϭ 11 (100%) n ϭ 90 (100%) n ϭ 9 (100%) Alleles (2n) 220 (100%) 22 (100%) 180 (100%) 18 (100%) a) ABCC2 1286G>A (V417I): Genotypes: GG 64 (58%) 7 (64%) 51 (57%) 6 (67%) AA 1 (1%) 1 (1%) GA 45 (41%) 4 (36%) 38 (42%) 3 (33%) Allelic frequency: A-allele 47 (26%) 4 (18%) 40 (22%) 3 (17%) b) ABCC2 3600T>A (V1188E): Genotypes: TT 95 (86%) 10 (91%) 80 (89%) 5 (56%) AA 1 (1%) 1 (11%) TA 14 (13%) 1 (9%) 10 (11%) 3 (33%) Allelic frequency: A-allele 16 (6%) 1 (5%) 10 (5%) 5 (28%) c) ABCC2 4581G>A (C1515Y): Genotypes: GG 95 (86%) 10 (91%) 80 (89%) 5 (56%) AA 1 (1%) 1 (11%) GA 14 (13%) 1 (9%) 10 (11%) 3 (33%) Allelic frequency: A-allele 16 (6%) 1 (5%) 10 (5%) 5 (28%) 4) MDR1 n ϭ 110 (100%) n ϭ 17 (100%) n ϭ 77 (100%) n ϭ 16 (100%) Alleles (2n) 220 (100%) 34 (100%) 154 (100%) 32 (100%) a) ABCB1 3435C>T: Genotypes: CC 23 (21%) 3 (18%) 16 (21%) 4 (25%) TT 28 (25%) 4 (24%) 20 (26%) 4 (25%) CT 59 (54%) 10 (58%) 41 (53%) 8 (50%) Allelic frequency: T-allele 115 (52%) 18 (53%) 81 (53%) 16 (50%) b) ABCB1 2677G>T/A (A893S/T): Genotypes: GG 31 (28%) 6 (35%) 20 (26%) 5 (31%) TT 21 (19%) 5 (29%) 15 (20%) 1 (6%) AA 1 (1%) 1 (6%) GT 48 (44%) 4 (24%) 35 (45%) 9 (56%) GA 4 (4%) 3 (4%) 1 (6%) TA 5 (5%) 1 (6%) 4 (5%) Allelic frequency: T/A-allele 95/11 (43%/5%) 15/3 (44%/9%) 69/7 (45%/5%) 11/1 (34%/3%) AIndividuals with phenotype low expressors (Ͻmean-1SD) and very low (Ͻmean-2SD) transporter expression levels. Login to comment
168 Specifically, a nonsynonymous BSEP polymorphism in exon13 of ABCB11(V444A) was more frequent in low and very low BSEP expressors than in individuals with normal or high BSEP expression. Login to comment

[hide] Three hundred twenty-six genetic variations in gen... J Hum Genet. 2002;47(1):38-50. Saito S, Iida A, Sekine A, Miura Y, Ogawa C, Kawauchi S, Higuchi S, Nakamura Y
Three hundred twenty-six genetic variations in genes encoding nine members of ATP-binding cassette, subfamily B (ABCB/MDR/TAP), in the Japanese population.
J Hum Genet. 2002;47(1):38-50., [PMID:11829140]

Abstract [show]
We screened DNAs from 48 Japanese individuals for single-nucleotide polymorphisms (SNPs) in nine genes encoding components of ATP-binding cassette subfamily B (ABCB/MDR/TAP) by directly sequencing the entire applicable genomic regions except for repetitive elements. This approach identified 297 SNPs and 29 insertion/deletion polymorphisms among the nine genes. Of the 297 SNPs, 50 were identified in the ABCB1 gene, 14 in TAP], 35 in TAP2, 48 in ABCB4, 13 in ABCB7, 21 in ABCB8, 21 in ABCB9, 13 in ABCB10, and 82 in ABCB11. Thirteen were located in 5' flanking regions, 237 in introns, 37 in exons, and 10 in 3' flanking regions. These variants may contribute to investigations of possible correlations between genotypes and disease-susceptibility phenotypes or responsiveness to drug therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Among the 37 SNPs detected in exons, 23 were present in coding regions; 10 of those would cause amino acid substitutions: Ala893Ser/Thr in the ABCB1 gene, (rs2032582); Ile393Val in TAP1 (rs1057141); Val379Ile (rs1800454), Cys651Arg, Thr665Ala (rs241447), and stop687Gln (rs241448) in TAP2; Val135Ile in ABCB8; Val121Met in ABCB9; Ala150Ser in ABCB10; and Val444Ala in ABCB11. Login to comment
51 Of these, 5 were novel (Cys651Arg in TAP2, Val135Ile in ABCB8, Val121Met in ABCB9, Ala150Ser in ABCB10, and Val444Ala in ABCB11). Login to comment
58 The synonymous 1145Ile polymorphism has been Table 1I. Summary of genetic variations detected in the ABCB11 gene No. Location Position Genetic variation NCBI SNP ID 1 5Ј Flanking -(2596-2595) TT/ins 2 5Ј Flanking -1746 G/A 3 5Ј Flanking -(325-314) (T)9-12 4 5Ј Flanking -135 T/C 5 Intron 1 511 A/del 6 Intron 1 581 C/T 7 Intron 1 1938-1951 (A)10-13 8 Intron 1 4517 G/A 9 Intron 1 5651 T/C 10 Intron 1 12200-12201 CT/del 11 Intron 1 13023 G/A 12 Intron 2 739 C/T 13 Intron 2 921-922 CAGATCTTCTTCAGCTAATTTAGAAATGT/ins 14 Intron 3 644 G/A 15 Intron 3 2231 A/G 16 Intron 3 2406 T/C 17 Exon 4 10 T/C(Asp36Asp) 18 Intron 4 434 A/G 19 Intron 4 518 G/T 20 Exon 5 120 T/C(Phe90Phe) 21 Intron 5 320 T/C 22 Intron 5 16076 T/G 23 Intron 6 303 G/C 24 Intron 7 1141 A/G 25 Intron 8 2463 A/C 26 Intron 8 2677 A/C 27 Intron 8 2699 T/A 28 Exon 9 24 T/C(Tyr269Tyr) 29 Intron 9 108 A/G 30 Intron 10 2475 C/A 31 Intron 10 2478 T/A 32 Intron 10 2711 C/T 33 Intron 10 3539 C/G 34 Intron 10 3623 T/C 35 Intron 10 3661 A/T 36 Intron 10 5100 A/G 37 Intron 10 5292 G/A 38 Intron 10 5912 A/del 39 Intron 12 116 G/A 40 Intron 12 326 G/C 41 Intron 12 335 A/G 42 Intron 12 2572 C/T 43 Exon 13 23 T/C(Val444Ala) 44 Intron 13 70 C/T 45 Intron 13 1578-1579 C/ins 46 Intron 14 32 C/T 47 Intron 14 80 C/T 48 Intron 14 439 A/G 49 Intron 14 1262-1263 T/ins 50 Intron 14 1283 A/C 51 Intron 14 1339 G/A 52 Intron 14 1359 T/C 53 Intron 14 1480 G/A 54 Intron 15 370 G/A 55 Intron 16 550-559 (T)9-12 56 Intron 17 188 T/G 57 Intron 17 194 T/G 58 Intron 17 197-198 T/ins 59 Intron 17 289-296 (A)7G(A)4/(A)12/(A)8 60 Intron 17 1070 C/T 61 Intron 17 1651 T/C 62 Intron 17 2226 T/A 63 Intron 17 2979 T/del 64 Intron 17 3288 T/G 65 Intron 17 3289 C/T 66 Intron 18 97 A/G 67 Intron 18 98 T/C 68 Intron 18 892 C/T 69 Intron 18 2681 A/G 70 Intron 18 3780 C/G 71 Intron 18 5741 C/T Table 1I. Continued No. Location Position Genetic variation NCBI SNP ID 72 Intron 18 5882-5883 C/ins 73 Intron 18 6061 C/A rs853772 74 Intron 19 127 C/T rs853773 75 Intron 19 10022 A/del 76 Intron 19 11880 G/A rs853785 77 Intron 19 12846 T/G rs860510 78 Intron 21 322 C/del 79 Intron 21 -1744 A/G rs479682 80 Intron 21 -1488 A/G rs567074 81 Intron 21 -1340 T/C rs565412 82 Intron 22 257 T/C 83 Intron 22 320 T/C rs472614 84 Intron 22 552 G/C 85 Intron 22 569 G/A 86 Exon 24 28 A/G(Ala1028Ala) rs497692 87 Intron 24 413 G/A rs531772 88 Intron 24 848 T/C rs527150 89 Intron 24 1201 G/A rs551754 90 Intron 27 206 A/G rs519035 91 Intron 27 282 A/G rs519887 92 Intron 27 349 C/T rs575671 93 Intron 27 801 A/G rs579275 94 Exon 28 437 G/A(3ЈUTR) rs473351 95 Exon 28 569 G/A(3ЈUTR) rs495714 96 Exon 28 621 A/G(3ЈUTR) rs496550 97 3Ј Flanking 243 G/A 98 3Ј Flanking 292 C/T rs478333 ABCB11, ATP-binding cassette, subfamily B, member 11 Table 3. Login to comment
66 However, we detected four novel nonsynonymous polymorphisms (Val135Ile in ABCB8, Val121Met in ABCB9, Ala150Ser in ABCB10, and Val444Ala in ABCB11). Login to comment

[hide] Bile salt export pump gene mutations in two Japane... J Pediatr Gastroenterol Nutr. 2003 May;36(5):647-50. Goto K, Sugiyama K, Sugiura T, Ando T, Mizutani F, Terabe K, Ban K, Togari H
Bile salt export pump gene mutations in two Japanese patients with progressive familial intrahepatic cholestasis.
J Pediatr Gastroenterol Nutr. 2003 May;36(5):647-50., [PMID:12717091]

Abstract [show]
BACKGROUND: In recent years, progressive familial intrahepatic cholestasis has been classified into at least three types by genetic analysis: PFIC1, PFIC2, and MDR3. Liver transplantation is effective for treating patients with this intractable syndrome. Confirming the correct diagnosis is of paramount importance because prognosis after transplantation differs with the genetic type of the disease. METHODS: Synthesis of cDNA was accomplished using RNA extracted from liver tissue of two Japanese patients with progressive familial intrahepatic cholestasis. Polymerase chain reaction was performed using 13 primer sets designed for amplification of the bile salt export pump cDNA. Direct sequencing was undertaken, and identified sequences were compared with the sequence for bile salt export pump gene registered with GenBank. In addition, gene sequences for nonprogressive familial intrahepatic cholestasis patients were analyzed. RESULTS: Genetic analysis of patient 1 revealed that substitutions in bile salt export pump protein sequences, namely R575X and E636G, might be the cause of the disease. In patient 2, V330X and R487H might fulfill the same role. Results of gene analysis in parents and cholestatic controls supported these conclusions. CONCLUSIONS: Absence or presence of bile salt export protein gene mutations was confirmed as representing a useful prognostic marker for clinical course after liver transplantation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 Table 3 summarizes the findings for patient 2. Comparison of cDNA sequences between the patient and the reference revealed five base sequence differences, resulting in four amino acid substitutions. Of the four substitutions, one was a nonsense mutation, and three were missense substitutions. Of the missense substitutions, V339L was found in all control subjects, and V444A was identified in some control subjects. Login to comment
82 Differences between BSEP mRNA sequence of Case 1 and registered sequence, and results of genetic analyses performed on family members Nucleotide number of reference sequence Nucleotide substitutions from reference sequence Type of nucleotide Amino acid substitutions from reference sequence Familial investigation of nucleotide substitutions Frequency of alleles of non-PFIC cases 1015 G → C G Val → Leu 0/10 homo C (V339L) 10/10 1331 T → C T Val → Ala 2/10 hetero C (V444A) 8/10 1723 C → T C Arg → Stop Patient: CT Father: CT 10/10 hetero T (R575X) Mother: CC Brother: CC 0/10 1907 A → G A Glu → Gly Patient: AG Father: AA 110/110 hetero G (E636G) Mother: AG Brother: AA 0/100 2594 C → T C Ala → Val 106/110 hetero T (A865V) 4/110 3084 A → G A (-) 5/10 homo G 5/10 A, adenine; T, thymine; G, guanine; C, cytosine; Val, V, valine; Leu, L, Leucine; Ala, A, alanine; Arg, R, arginine; Glu, E, glutamate; Gly, G, glycine; homo, homozygote; hetero, heterozygote. Login to comment

[hide] BSEP and MDR3 haplotype structure in healthy Cauca... Hepatology. 2004 Mar;39(3):779-91. Pauli-Magnus C, Kerb R, Fattinger K, Lang T, Anwald B, Kullak-Ublick GA, Beuers U, Meier PJ
BSEP and MDR3 haplotype structure in healthy Caucasians, primary biliary cirrhosis and primary sclerosing cholangitis.
Hepatology. 2004 Mar;39(3):779-91., [PMID:14999697]

Abstract [show]
Primary biliary cirrhosis (PBC) and primary sclerosing cholangitis (PSC) are characterized by a cholestatic pattern of liver damage, also observed in hereditary or acquired dysfunction of the canalicular membrane transporters bile salt export pump (BSEP, ABCB11) and multidrug resistance protein type 3 (MDR3, ABCB4). Controversy exists whether a genetically determined dysfunction of BSEP and MDR3 plays a pathogenic role in PBC and PSC. Therefore, 149 healthy Caucasian control individuals (control group) were compared to 76 PBC and 46 PSC patients with respect to genetic variations in BSEP and MDR3. Sequencing spanned approximately 10,000 bp including promoter and coding regions as well as 50-350 bp of flanking intronic regions. In all, 46 and 45 variants were identified in BSEP and MDR3, respectively. No differences between the groups were detected either in the total number of variants (BSEP: control group: 37, PBC: 37, PSC: 31; and MDR3: control group: 35; PBC: 32, PSC: 30), or in the allele frequency of the common variable sites. Furthermore, there were no significant differences in haplotype distribution and linkage disequilibrium. In conclusion, this study provides an analysis of BSEP and MDR3 variant segregation and haplotype structure in a Caucasian population. Although an impact of rare variants on BSEP and MDR3 function cannot be ruled out, our data do not support a strong role of BSEP and MDR3 genetic variations in the pathogenesis of PBC and PSC.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Five coding region changes were single nucleotide polymorphisms present in all of the studied populations at an allele frequency of Ͼ1% (synonymous: exon 5: T270C, exon 10: A957G, exon 24: G3084A; nonsynonymous: exon 13: T1331C 3 V444A and exon 17: A2029G 3 M677V). Login to comment
73 Alignment of all mammalian BSEP sequences indicated that 5 of the 6 nonsynonymous coding variants were in codons for an evolutionarily conserved amino acid (S194P, V284A, V444A, R698H, and A1228V) (Table 2). Login to comment

[hide] Sequence analysis of bile salt export pump (ABCB11... Pharmacogenetics. 2004 Feb;14(2):91-102. Pauli-Magnus C, Lang T, Meier Y, Zodan-Marin T, Jung D, Breymann C, Zimmermann R, Kenngott S, Beuers U, Reichel C, Kerb R, Penger A, Meier PJ, Kullak-Ublick GA
Sequence analysis of bile salt export pump (ABCB11) and multidrug resistance p-glycoprotein 3 (ABCB4, MDR3) in patients with intrahepatic cholestasis of pregnancy.
Pharmacogenetics. 2004 Feb;14(2):91-102., [PMID:15077010]

Abstract [show]
Intrahepatic cholestasis of pregnancy (ICP) is a liver disorder associated with increased risk of intrauterine fetal death and prematurity. There is increasing evidence that genetically determined dysfunction in the canalicular ABC transporters bile salt export pump (BSEP, ABCB11) and multidrug resistance protein 3 (MDR3, ABCB4) might be risk factors for ICP development. This study aimed to (i). describe the extent of genetic variability in BSEP and MDR3 in ICP and (ii). identify new disease-causing mutations. Twenty-one women with ICP and 40 women with uneventful pregnancies were recruited between April 2001 and April 2003. Sequencing of BSEP and MDR3 spanned 8-10 kb per gene and comprised the promoter region and 100-350 bp of the flanking intronic region around each exon. DNA sequencing of polymerase chain reaction fragments was performed on an ABI3700 capillary sequencer. MDR3 promoter activity of promoter constructs carrying different ICP-specific mutations was studied using reporter assays. A total of 37 and 51 variant sites were detected in BSEP and MDR3, respectively. Three non-synonymous sites in codons for evolutionarily conserved amino acids were specific for the ICP collective (BSEP, N591S; MDR3, S320F and G762E). Furthermore, four ICP-specific splicing mutations were detected in MDR3 [intron 21, G(+1)A; intron 25, G(+5)C and C(-3)G; and intron 26, T(+2)A]. Activity of the mutated MDR3 promoter was similar to that observed for the wild-type promoter. Our data further support an involvement of MDR3 genetic variation in the pathogenesis of ICP, whereas analysis of BSEP sequence variation indicates that this gene is probably less important for the development of pregnancy-associated cholestasis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 P R415 Q V444A Cytoplasm N519S M677V K F K R M K Q I M C D F H G I S V G E L H T H I D D S F K I H D A I A D Q H E R Y F R R I H R Q R Y A L E Y D T A V R H S S I A F G E K R E L K E Y R E V F Q R H G I R K E V V A K G V V A D F K K T G H AA R K T L L E G L K F G F R A H R D F H A I D Q D R H S P G A L S Q V Q G A A G S S L G T R F G T L H R R S L A E H T T G I G K E R T E L A E I E K T A I Q K A H Q I R D A L E H V G T Q F A A S I K S G V F A L V F A C S I H G Y K I H A A R A I V Q T S S I S P G A K R S L D IV L A D T A L R T S K K S A I H V A L E P F K Q F H D R D T H D L L I K P L G V I E K G V K A H L E E Q Q D L L Q F S S K G C G G V S Q E P E P I E K T R E K Q R I S V L H G L R T I H GQ D A S T A E L I A V H A Q I V K Y Y A G L S P S G T T I H V S I P P F E L L Q I Q L R S H I K A A I V R S G S Q L S T P S R P D Y R F A QY V K E S E T T S I Q H A D T D K E G A T K Q D P D Y D K K V H V F H L Q A Q K E T H V G D V D C K F H G S D YF A D L A V Q K I I A H R L V G R E R C T S V H L E P I V H D H G Q H F G I K I T H G H E H T G R G Q A L H E A K I D E E S R A S I E G T A V Q I E H D LH Q K S R Q R S T E E D R K Y S R H A V S V K R E L L L T L Q S Q A D D E T S G S Y Q D A T I I G F L G V L RD E V L Y S L H A V D H K S V P P LR FY TT A TFRV I P H R I Q V L S K K E T H D L L L S E A H V A E S G LA I R A I A L V H G G Q K Q S Q Q P L D H Q E V L T D F G G E H A Y H A D V Q A A K I E H A I T T E D R G Y R I E A E E P V L D R Q I G I V D L G V T V H D H S R I D H L I R Y D P C F T L Q L I Q A S T E G P K H G P G V L A S A L D L H H H S P E V K I R P E K I D G T H H F E I V F GGHTHQKGYH LAIFSFGEIL K Y G D E S H C D I I P A P E V E E Q V P I D K D G A T T E F I S T A A A R P V R I L K F S A P E H S D S V I L R H H E E G F K K D G F Y H H D K K S S K D D G K K E D Q G V R L F R F S S S Q F F T D S I R L E S V G V F I D Y D D L E Q L E V Q I P H H T T V H V C A H L S S H T Q H H C G L L H I R T G G K T H I H E S E H F A T H T S R G H K T S G Y H P G T L V Q L V TL D E G E Y T G L I Q R S Q I H G F S QI P D K E E G G Y R Y F S Y V F R Y L HI S H E G L F S H K L I F L YG P G V Q G I A H A F L C G S L V L H FHI A G I Y V A V A I T G L I Q I Y F H V C A A A I T L V L I S V I P L I S I G A G T I G A S V S L F L S I I V G V L H L A H A S G C L E P F A T A C L L V V A H F C V S G F T Q L L Q G F A F A Y T S T H A L F H A F L C Y A L L I F C F V H G F F T G L F S F L Y A P T V T G A V H A S V G G T H V F G H I I A Q C F Y G F I S L L I S A V V L S V T A L A R A F G Y T P S S Y A C F A A H F I A H S A S I L V F F C F L P L S A A T G V H S T V A H I I A F S H L V YI V H G I Q R I C G F L L G F F R H H R V D Extracellular Fig. 1 Secondary structure of the bile salt export pump with non-synonymous coding region genetic variants. Login to comment
94 V444A and exon 17, A2029G.M677V). Login to comment
96 Alignment of all mammalian BSEP sequences indicated that three of the four non-synonymous coding variants were in codons for evolutionarily conserved amino acids (R415Q, V444A and N591S) (Table 1). Login to comment

[hide] Benign recurrent intrahepatic cholestasis associat... J Clin Gastroenterol. 2006 Feb;40(2):171-5. Kubitz R, Keitel V, Scheuring S, Kohrer K, Haussinger D
Benign recurrent intrahepatic cholestasis associated with mutations of the bile salt export pump.
J Clin Gastroenterol. 2006 Feb;40(2):171-5., [PMID:16394881]

Abstract [show]
A young patient with recurrent attacks of intrahepatic cholestasis is described. On the basis of clinical presentation, laboratory findings and genetic analysis, the diagnosis of benign recurrent intrahepatic cholestasis type 2 (BRIC-2) was established. By the use of BSEP-specific antibodies, almost complete absence of BSEP from the canalicular membrane of liver cells was detected in the patient. Two different BSEP mutations were found. One mutation (E186G) had been described in one BRIC-2 case; the second mutation (V444A) is more frequent and has been linked to intrahepatic cholestasis of pregnancy. It is concluded that this form of compound heterozygosity of the BSEP gene reduces the amount of BSEP protein due to protein instability or mis-targeting, which is the underlying reason for reduced bile salt excretion and cholemia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 One mutation (E186G) had been described in one BRIC-2 case; the second mutation (V444A) is more frequent and has been linked to intrahepatic cholestasis of pregnancy. Login to comment
74 The same mutation was detected in our patient together with the polymorphism V444A. Login to comment
75 This latter polymorphism has an allele frequency of 51% in a normal female population, who did not develop intrahepatic cholestasis of pregnancy (ICP) compared with 83% in females with ICP.8 The association of V444A to ICP suggests that this polymorphism/ mutation might become disease relevant in certain conditions such as pregnancy. Login to comment
81 The immunofluorescence findings suggest that either BSEP mutation of our patient (E186G and V444A) predisposes for these mechanisms during cholestatic episodes. Login to comment

[hide] Genetic variability, haplotype structures, and eth... Drug Metab Dispos. 2006 Sep;34(9):1582-99. Epub 2006 Jun 8. Lang T, Haberl M, Jung D, Drescher A, Schlagenhaufer R, Keil A, Mornhinweg E, Stieger B, Kullak-Ublick GA, Kerb R
Genetic variability, haplotype structures, and ethnic diversity of hepatic transporters MDR3 (ABCB4) and bile salt export pump (ABCB11).
Drug Metab Dispos. 2006 Sep;34(9):1582-99. Epub 2006 Jun 8., [PMID:16763017]

Abstract [show]
Biliary excretion of bile salts and other bile constituents from hepatocytes is mediated by the apical (canalicular) transporters P-glycoprotein 3 (MDR3, ABCB4) and the bile salt export pump (ABCB11). Mutations in ABCB4 and ABCB11 contribute to cholestatic diseases [e.g., progressive familial intrahepatic cholestasis 2 (PFIC2), PFIC3, and intrahepatic cholestasis of pregnancy], and our objective was to establish genetic variability and haplotype structures of ABCB4 and ABCB11 in healthy populations of different ethnic backgrounds. All coding exons, 5 of 6 noncoding exons, 50 to 300 base pairs of the flanking intronic regions, and 2.5 to 2.8 kilobase pairs of the promoter regions of ABCB4 and ABCB11 were sequenced in 159 and 196 DNA samples of Caucasian, African-American, Japanese, and Korean origin. In total, 76 and 86 polymorphisms were identified in ABCB4 and ABCB11, respectively; among them, 14 and 28 exonic polymorphisms, and 8 and 10 protein-altering variants, of which 4 were predicted to have functional consequences. Both genes showed substantial ethnic differences with respect to allele number, frequency of common and population-specific sites, and patterns of linkage disequilibrium. Population genetic analysis suggested some selective pressure against changes in the protein, supporting the important endogenous role of these transporters. Haplotype variability was greater in ABCB11 than in ABCB4. An ABCB11 promoter haplotype was associated with significant decrease of activity compared with wild type. Our results contribute to a better understanding of the molecular basis and of ethnic differences in drug response, and provide a valuable tool for future research on the heredity of cholestatic liver injury.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 The numbers 1 to 53 in the variant ID column indicate all variants included in haplotype analysis and linkage disequilibrium estimation. Variant ID 5Ј Sequence Genetic Variation 3Ј Sequence Region Amino Acid Change CA AA JA Total n % n % n % n % 54 GTAGTCACA g.-15595CϾT TTTCAGAGC Promoter 186 0.5 92 0.0 88 0.0 366 0.3 1 ACACTCTCT g.-15281_-15278 delCTCT CACACAGCA Promoter 186 10.2 92 4.3 86 26.7 364 12.6 2 CCCCCTCCC g.-15150TϾC GCCCCCAGA Promoter 148 48.0 76 39.5 92 25.0 316 58.9 3 TGACTGTAG g.-15018GϾA GACCACAAC Promoter 158 10.1 78 0.0 92 29.3 328 13.1 4 ATTAAGCAC g.-14944GϾA ATCAACTCA Promoter 198 10.1 72 0.0 96 28.1 366 12.8 5 CTATTGGGA g.-14589AϾT TCTTTTCCC Promoter 198 0.0 90 2.2 88 0.0 376 0.5 55 TGAAGCAAA g.-14524AϾT TTTTTTTCC Promoter 198 0.0 90 1.1 88 0.0 376 0.3 6 TACATTTGC g.-14473GϾA TCAACTCAG Promoter 198 2.5 90 18.9 88 0.0 376 8.8 7 TTGCATAGA g.-14437GϾA GAAACATCT Promoter 198 29.8 94 22.3 96 14.6 388 24.2 8 ATTATATGT g.-14353TϾC ATAATTTTG Promoter 190 61.6 80 92.5 88 75.0 358 71.8 56 ATAAACCAT g.-14316CϾA TTATACATA Promoter 192 0.5 80 0.0 88 0.0 360 0.3 9 ACCATCTTA g.-14312TϾC ACATAAATT Promoter 192 0.0 80 0.0 88 3.4 360 0.8 57 ATAAATTCC g.-14300AϾT ATAGAGAAA Promoter 192 0.0 80 1.3 88 0.0 360 0.3 10 TTTAATTTC g.-14207TϾC GCAAATTAA Promoter 190 2.1 80 17.5 88 10.2 358 7.5 11 TTGTTACAC g.-14104CϾT TTAGGAGGA Promoter 196 2.6 92 0.0 96 0.0 384 1.3 12 CATGATAGC g.-14035AϾG CCCAACTCC Promoter 194 1.5 92 1.1 96 0.0 382 1.0 58 AAGGCTGGA g.-13910GϾA TGAGAGGCA Promoter 202 0.0 94 1.1 96 0.0 392 0.3 13 AGAGGAAGA g.-13814GϾA GCAGCACAA Promoter 194 0.0 94 6.4 88 0.0 376 1.6 14 GCACAAATA g.-13801TϾC ATTGGAGCT Promoter 194 1.5 94 0.0 88 0.0 376 0.8 15 CTCAGACTT g.-13662TϾC TGAGCAAGG Promoter 192 0.0 94 7.4 86 0.0 372 1.9 83 TTAAAGGTA g.-13523͓T͔9 GTCTTGTTA Promoter 200 10.0 90 11.1 96 28.1 386 14.8 84 TTAAAGGTA g.-13523͓T͔10 GTCTTGTTA Promoter 200 9.0 90 18.9 96 6.3 386 10.6 85 TTAAAGGTA g.-13523͓T͔11 GTCTTGTTA Promoter 200 65.0 90 53.3 96 45.8 386 57.5 86 TTAAAGGTA g.-13523͓T͔12 GTCTTGTTA Promoter 200 16.0 90 16.7 96 19.8 386 17.1 59 CTGGGCCAG g.-13595GϾA AGCATCTGG Promoter 198 0.0 94 1.1 96 0.0 388 0.3 16 CAAGCACAC g.-13333TϾC CTGTGTTTG Promoter 196 0.0 76 0.0 96 3.9 368 0.9 17 ATGTTTCTC g.-13297GϾA TATGTCACT Promoter 196 0.0 76 3.9 96 0.0 368 0.8 60 TCCACAGTG g.-13142GϾA AGTCCATTA Exon 1 194 0.0 76 0.0 92 1.1 362 0.3 18 TTGATTAAA g.-77GϾA AAGAAAGAA Intron 1 202 2.5 88 11.4 90 12.2 380 6.8 19 ATTTTTTTT g.1319delT CTGACAGAT Intron 2 198 0.0 88 3.4 92 0.0 378 0.8 20 TTTAAATCC g.3754TϾC TATGTTTTT Intron 3 198 7.1 62 32.3 88 12.5 348 12.9 21 GTTACAAGA g.3781TϾC GAGAAGAAA Exon 4 D36D 198 0.0 62 0.0 88 26.1 348 6.6 22 GAATCTAGT g.4542AϾT ACTAAATTA Intron 4 184 0.0 90 0.0 92 2.2 366 0.5 61 CAAGTTTCG g.4621GϾA TTTTCTTCA Exon 5 R52R 184 0.0 90 1.1 92 0.0 366 0.3 23 AGATGTTTT g.4735TϾC ATTGACTAC Exon 5 F90F 184 2.7 90 13.3 92 12.0 366 7.7 24 GGGTAGGTT g.4862GϾA TTTTTGTTT Intron 5 182 4.9 90 2.2 94 0.0 366 3.0 25 GCTGAACAT g.21416CϾT GAGAGCGAA Exon 6 I134I 192 0.0 86 18.6 88 0.0 366 4.4 26 AGCTCCTCC g.21507GϾA TATAATTTA Intron 6 196 0.0 92 18.5 92 0.0 380 4.5 27 ACAATGAGA g.21554TϾG GCAATGTGT Intron 6 196 0.0 92 0.0 92 4.3 380 1.1 62 TGTATTGAA g.22567AϾT GTACTTTCT Intron 6 198 0.5 94 0.0 94 0.0 386 0.3 63 TTTGAATGA g.24203TϾC CAAATTCAG Intron 7 192 0.5 90 0.0 94 0.0 376 0.3 64 TCTAGTGAT g.24248AϾG TTAATAAAA Exon 8 I206V 194 0.0 90 1.1 96 0.0 380 0.3 28 TACGGACTA g.27224TϾC GAGCTGAAG Exon 9 Y269Y 200 0.0 80 0.0 96 27.1 376 6.9 65 CTGATGAAG g.27268TϾC CATTTCATC Exon 9 V284A 200 0.5 80 0.0 96 0.0 376 0.3 66 GTGAGAAAA g.27313GϾA AGAGGTTGA Exon 9 R299K 200 0.0 80 0.0 96 1.0 376 0.3 29 ACTGCATCA g.31773CϾT GGCCTGTTT Intron 9 178 5.1 70 1.4 48 0.0 296 3.4 30 TGTTTCTGC g.31811CϾT GAAATTGAC Intron 9 196 4.6 72 4.2 86 0.0 354 3.4 31 TTGACTCAA g.31825GϾA CATTTTGTC Intron 9 196 4.6 72 26.4 86 0.0 354 7.9 32 GACTCAAGC g.31827AϾG TTTTGTCTT Intron 9 196 70.4 72 84.7 86 90.7 354 78.2 33 TAGAAAAGG g.31890AϾG ATAGTGATG Exon 10 G319G 196 4.6 72 26.4 86 0.0 354 7.9 34 GACTTATTG g.32034AϾT CCGAGACAT Intron 10 196 0.0 66 4.5 82 0.0 344 0.9 67 CCTCAGTGT g.38161CϾT ATAGTAGGA Exon 11 V366V 196 0.0 88 1.1 94 0.0 378 0.3 35 CATTTTTGA g.38248GϾA ACAATAGAC Exon 11 E395E 196 0.0 88 8.0 96 0.0 380 1.8 36 GCAGAGATA g.41348CϾT GCCAAAGAT Intron 11 198 0.0 72 2.8 80 0.0 350 0.6 37 CCACAAATT g.41622GϾT CTCATTTTC Intron 12 196 1.0 72 0.0 74 0.0 342 0.6 38 CAGTGACAA g.44255delT CTGAACTTT Intron 12 190 0.0 94 2.1 92 0.0 376 0.5 39 TCAACATGG g.44308TϾC CATTAAACC Exon 13 V444A 190 59.5 90 65.6 92 80.4 372 66.1 40 TTGATCAAA g.44481CϾT AGAAAGGTG Intron 13 188 59.0 90 65.6 92 80.4 370 65.9 68 CAAGGAGGC g.46246CϾT AATGCCTAC Exon 14 A535A 184 0.0 86 0.0 96 1.0 366 0.3 41 GGGAGAAAC g.46311TϾC AAGAGGTCG Intron 14 182 60.4 86 66.3 94 79.8 362 66.9 42 GTTGCTCAT g.48611CϾG GCTTGTCTA Exon 16 R616G 194 0.0 90 2.2 96 0.0 380 0.5 69 CGCTTGTCT g.48620AϾG CGGTCAGAG Exon 16 T619A 194 0.0 90 1.1 96 0.0 380 0.3 70 CAGAGCTGC g.48634AϾG GATACCATC Exon 16 A623A 194 0.0 90 1.1 96 0.0 380 0.3 43 GAAGATGAC g.49653AϾG TGCTTGCGA Exon 17 M677V 190 4.2 86 14.0 88 0.0 364 5.5 71 CCGGCAAC g.53835GϾA CTCCAAGTC Exon 18 R698H 196 0.5 82 0.0 94 0.0 372 0.3 72 GAACCTCCA g.53876TϾC TAGCTGTTG Exon 18 L712L 196 0.5 82 0.0 94 0.0 372 0.3 44 TTAATATAA g.59981CϾA CCTCTCTCT Intron 18 192 43.2 84 21.4 90 27.8 366 34.4 45 AATAGATTT g.73116_73119delATTT TTCTATTTA Intron 19 192 0.0 66 6.1 96 0.0 354 1.1 46 ATTTATAAT g.73132_73133insCAA AAAGTTACT Intron 19 194 0.0 66 6.1 96 0.0 356 1.1 47 ACTTTCTTG g.73148TϾC TTACTATCT Intron 19 196 69.4 66 93.9 96 0.0 358 82.1 qanal/courses/predoc97/blosum62.cmp), and Grantham values (Grantham, 1974). Login to comment
116 Two Caucasian-specific variants in exon 13 (c.1331TϾC; 59.4%) and exon 17 (c.2029AϾG; 4.2%) coded for amino acid substitutions p.V444A and p.M677V; one variant, detected in exon 16 (c.1846CϾG, 2.2%) in the African-American population sample, resulted in protein sequence alteration p.R616G; and the Japanese-specific exon 21 variant c.2594CϾT (2.4%) resulted in amino acid substitution p.A865V (Table 4). Login to comment
166 The most common ABCB11 protein-altering polymorphism was p.V444A, which was frequently observed in all groups [ABCB11 p.M677V was present in both the Caucasian (4.2%,) and the African-American (14%) population sample and p.A865V was only found in Japanese samples]. Login to comment
177 Amino Acid Change Scoring Systems for Nonsynonymous Variants Grantham SIFT PolyPhen Blosum62 EC/EU MDR3 D87E 45 1.00 0.48 2 EC P95S 74 0.48 0.87 -1 EC T175A 58 0.01 0.72 -1 EC I367V 29 0.23 0.96 3 EC E450G 98 0.01 0.13 -2 EC R590Q 43 0.01 2.51 1 EC R652G 125 0.36 1.47 -2 EU E1099G 98 0.04 1.58 -2 EC BSEP I206V 29 1.00 0.23 3 EU V284A 64 0.13 0.43 -2 EC R299K 26 1.00 0.38 2 EU V444A 64 0.63 0.78 -2 EC R616G 125 0.01 3.16 -2 EC T619A 58 0.00 1.78 -1 EC M677V 21 0.29 0.82 1 EU R698H 29 0.30 0.57 0 EC A865V 64 0.02 1.12 0 EC R958Q 43 0.04 0.24 1 EU neutral mutation model (Tajima, 1989). Login to comment
236 With respect to the reference sequence, ABCB11_3, ABCB11_4, ABCB11_5, ABCB11_6, ABCB11_11 ABCB11_37, and ABCB11_38 contain one nonsynonymous cSNP (c.1331TϾC) in exon 13 (p.V444A) and three to four linked intronic SNPs in introns 9, 13, and 14, and 20 as a common denominator. Login to comment

[hide] The bile salt export pump. Pflugers Arch. 2007 Feb;453(5):611-20. Epub 2006 Oct 19. Stieger B, Meier Y, Meier PJ
The bile salt export pump.
Pflugers Arch. 2007 Feb;453(5):611-20. Epub 2006 Oct 19., [PMID:17051391]

Abstract [show]
Canalicular secretion of bile salts mediated by the bile salt export pump Bsep constitutes the major driving force for the generation of bile flow. Bsep is a member of the B-family of the super family of ATP-binding cassette transporters and is classified as ABCB11. Bsep has a narrow substrate specificity, which is largely restricted to bile salts. Bsep is extensively regulated at the transcriptional and posttranscriptional level, which directly modulates canalicular bile formation. Pathophysiological alterations of Bsep by either inherited mutations or acquired processes such as inhibition by drugs or disease-related down regulation may lead to a wide spectrum of mild to severe forms of liver disease. Furthermore, many genetic variants of Bsep are known, some of which potentially render individuals susceptible to acquired forms of liver disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
160 Their bile flow rate is slightly but not significantly lower in comparison to controls, but the total bile salt output into bile is massively reduced and their liver bile salt concen- S114R G238V V284L* C336S D482G R487H S593R E636G G982R G1004D R1153CD R1268Q E186G E297G R432T I498T I498T T923P A926P R1050C R1128H S194P G260D N519S A1228V V444A K461E M677V R698H PFIC2 BRIC2 acquired cholestasis SNP Fig. 2 Putative secondary structure of Bsep (NT-005403) generated with the TOPO program (http://www.sacs.ucsf.edu/TOPO-run/wtopo.pl). Login to comment

[hide] Prediction of drug-induced intrahepatic cholestasi... Expert Opin Drug Saf. 2007 Jan;6(1):71-86. Sakurai A, Kurata A, Onishi Y, Hirano H, Ishikawa T
Prediction of drug-induced intrahepatic cholestasis: in vitro screening and QSAR analysis of drugs inhibiting the human bile salt export pump.
Expert Opin Drug Saf. 2007 Jan;6(1):71-86., [PMID:17181454]

Abstract [show]
Drug-induced intrahepatic cholestasis is one of the major causes of hepatotoxicity, which often occur during the drug discovery and development process. Human ATP-binding cassette transporter ABCB11 (sister of P-glycoprotein/bile salt export pump) mediates the elimination of cytotoxic bile salts from liver cells to bile, and, therefore, plays a critical role in the generation of bile flow. The authors have recently developed in vitro high-speed screening and quantitative structure-activity relationship analysis methods to investigate the interaction of ABCB11 with a variety of compounds. Based on the extent of inhibition of the bile salt export pump, the authors analysed the quantitative structure-activity relationship to identify chemical groups closely associated with the inhibition of ABCB11. This approach provides a new tool to predict compounds with a potential risk of drug-induced intrahepatic cholestasis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 H2N COOH S56L G238V G260D C336S L339V V444A K461E D482G T923P K930X G982R R1090X R1153C Outside Inside R1268Q A1228VE1186K R1128H R1057X R1050C A926P A865V R698H E636G M677V S593R E592Q N591S R575XA570T Q558H I498T R432T R415Q R299K E297G V284A I206V S194P E186G cholestasis Expert Opin. Drug Saf. (2007) 6(1) Table 1. Login to comment
121 Nonsynonymous polymorphisms and mutations in the ABCB11 gene NCBI No. Exon Nucleotide Amino acid alteration Phenotype Ref. Position Alteration rs11568361 5 167 C→T Ser56Leu - [102] - 5 341 G→C Ser114Arg PFIC2 [47]* - 6 557 A→G Glu186Gly BRIC2 [45,48] - 6 580 T→C Ser194Pro - [44] rs11568358 7 616 A→G Ile206Val - [102] - 7 695 T→del Frame shift at position 232 PFIC2 [47] - 7 713 G→T Gly238Val PFIC2 [47] - 8 779 G→A Gly260Asp - [44] - 8 851 T→C Val284Ala - [44] rs11568372 8 890 A→G Glu297Gly PFIC2/BRIC2 [35,43,45,47,102] rs2287617 8 896 G→A Arg299Lys - [102] - 8 908 G→del Frame shift at position 303 PFIC2 [35] - 9 1007 G→C Cys336Ser PFIC2 [47] - 9 1015 C→G Leu339Val - [46] - 11 1244 G→A Arg415Gln - [39] - 11 1294 G→C Arg432Thr BRIC2 [43] rs2287622 12 1331 T→C Val444Ala ICP/PFIC2? Login to comment

[hide] Mutations and polymorphisms in the bile salt expor... Pharmacogenet Genomics. 2007 Jan;17(1):47-60. Lang C, Meier Y, Stieger B, Beuers U, Lang T, Kerb R, Kullak-Ublick GA, Meier PJ, Pauli-Magnus C
Mutations and polymorphisms in the bile salt export pump and the multidrug resistance protein 3 associated with drug-induced liver injury.
Pharmacogenet Genomics. 2007 Jan;17(1):47-60., [PMID:17264802]

Abstract [show]
OBJECTIVES: Increasing evidence suggests that a genetically determined functional impairment of the hepatocellular efflux transporters bile salt export pump (BSEP, ABCB11) and multidrug resistance protein 3 (MDR3, ABCB4) play a pathophysiological role in the development of drug-induced liver injury. The aim of this study was therefore to describe the extent of genetic variability in ABCB11 and ABCB4 in patients with drug-induced liver injury and to in vitro functionally characterize newly detected ABCB11 mutations and polymorphisms. METHODS: ABCB11 and ABCB4 were sequenced in 23 patients with drug-induced cholestasis and 13 patients with drug-induced hepatocellular injury. Ninety-five healthy Caucasians served as the control group. Reference and mutant BSEP were expressed in Sf9 cells and ATP-dependent transport of [H]-taurocholate was measured in a rapid filtration assay. RESULTS: Four highly conserved nonsynonymous mutations were specific for drug-induced liver injury [ABCB11: D676Y (drug-induced cholestasis) and G855R (drug-induced cholestasis); ABCB4: I764L (drug-induced cholestasis) and L1082Q (drug-induced hepatocellular injury)]. Furthermore, a polymorphism in exon 13 of ABCB11 (V444A), which is associated with decreased hepatic BSEP expression was significantly more frequent in drug-induced cholestasis patients than in drug-induced hepatocellular injury patients and healthy controls (76 versus 50 and 59% in drug-induced cholestasis patients, drug-induced hepatocellular injury patients and healthy controls, respectively; P<0.05). The in-vitro transport activity of the V444A and the D676Y BSEP constructs was similar, whereas the G855R mutation was nonfunctional. CONCLUSION: In summary, our data support a role of ABCB11 and ABCB4 mutations and polymorphisms in drug-induced cholestasis. Genotyping of selected patients with acquired cholestasis might help to identify individuals with a genetic predisposition.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Furthermore, a polymorphism in exon 13 of ABCB11 (V444A), which is associated with decreased hepatic BSEP expression was significantly more frequent in drug-induced cholestasis patients than in drug-induced hepatocellular injury patients and healthy controls (76 versus 50 and 59% in drug-induced cholestasis patients, drug-induced hepatocellular injury patients and healthy controls, respectively; P < 0.05). Login to comment
7 The in-vitro transport activity of the V444A and the D676Y BSEP constructs was similar, whereas the G855R mutation was nonfunctional. Login to comment
39 Furthermore, genotype distribution at position 1331T > C (V444A) was determined in 110 additional Caucasian individuals recently described by Meier and coworkers [24] (total: 95 + 110; n = 205). Login to comment
97 Chemical classification of all causative drugs revealed that the most prominent structures were the b-lactam ring of antibacterials in Fig. 2 Extracellular V284A V444A G855R R698H D676Y M677V Cytoplasm Secondary structure of bile salt export pump (BSEP) with nonsynonymous coding region variants. Login to comment
100 Table 4 Genotype distribution of ABCB11 SNP 1331T > C (V444A) in DC and DH patients and healthy controls DCall a DCØmut a DHa Healthy controls Variant siteb n (%) 95% CIc n (%) 95% CI n (%) 95% CI n (%) 95% CI Total 23 (100%) 20 (100) 13 (100) 205 (100) 1331T > C (V444A) TT (VV) 2 (8.7%) 1.0-28.1 2 (10.0) 1.2-31.7 4 (30.8) 9.0-61.5 38 (18.5) 13.4-24.6 TC (VA) 7 (30.4%) 13.2-53.0 4 (20.0) 5.7-43.7 5 (38.5) 13.7-68.5 101 (49.3) 42.2-56.4 CC (AA) 14 (60.9%) 38.5-80.3 14 (70.0) 45.7-88.2 4 (30.8) 9.0-61.5 66 (32.2) 25.8-39.1 a All drug-induced cholestasis patients (DCall), DC without disease associated nonsynonymous ABCB11 and ABCB4 mutations (DCØmut). Login to comment
118 Of the coding region changes, eight have been previously described in healthy Caucasians [23], including two frequent nonsynonymous polymorphisms (exon 13: 1331T > C-V444A and exon 17: 2029A > G- M677V). Login to comment
125 Fig. 3 DCØmutDCall (n=46) (n=40) (n=26) (n=410) DH Healthy controls P = 0.015; OR: 4 (1.3; 11.9) P = 0.01; OR: 2.4 (1.2; 4.9) NS P = 0.04; OR: 3.2 (1.1; 8.9) Allelicfrequencypercentage(95%CI) P = 0.004; OR: 3 (1.4; 6.8) T-allele C-allele 100 90 80 70 60 50 40 30 20 10 0 Allelic frequency of the T-allele (white panel) and C-allele (black panel) of the ABCB11 1331T > C (V444A) polymorphism: 23 DC patients (DCall, n = 46 alleles), 20 DC patients with no additional nonsynonymous ABCB4 or ABCB11 mutations (DCØmut, n = 40), 13 with DH (n = 24), and 205 Caucasians (n = 410). Login to comment
131 In addition, the V444A polymorphism was observed significantly more frequently in patients with DC than in patients with DH and healthy controls, with the CC genotype being encountered in 61% of DC patients compared with 31 and 32% in DH and healthy controls, respectively (Table 4). Login to comment
168 Very interestingly, a common ABCB11 polymorphism in exon 13 (1331T > C-V444A) was observed significantly more frequently in patients with DC than in healthy Caucasian controls and patients with DH. Login to comment

[hide] Levels of plasma membrane expression in progressiv... Am J Physiol Cell Physiol. 2007 Nov;293(5):C1709-16. Epub 2007 Sep 13. Lam P, Pearson CL, Soroka CJ, Xu S, Mennone A, Boyer JL
Levels of plasma membrane expression in progressive and benign mutations of the bile salt export pump (Bsep/Abcb11) correlate with severity of cholestatic diseases.
Am J Physiol Cell Physiol. 2007 Nov;293(5):C1709-16. Epub 2007 Sep 13., [PMID:17855769]

Abstract [show]
Human BSEP (ABCB11) mutations are the molecular basis for at least three clinical forms of liver disease, progressive familial intrahepatic cholestasis type 2 (PFIC2), benign recurrent intrahepatic cholestasis type 2 (BRIC2), and intrahepatic cholestasis of pregnancy (ICP). To better understand the pathobiology of these disease phenotypes, we hypothesized that different mutations may cause significant differences in protein defects. Therefore we compared the effect of two PFIC2 mutations (D482G, E297G) with two BRIC2 mutations (A570T and R1050C) and one ICP mutation (N591S) with regard to the subcellular localization, maturation, and function of the rat Bsep protein. Bile salt transport was retained in all but the E297G mutant. Mutant proteins were expressed at reduced levels on the plasma membrane of transfected HEK293 cells compared with wild-type (WT) Bsep in the following order: WT > N591S > R1050C approximately A570T approximately E297G >> D482G. Total cell protein and surface protein expression were reduced to the same extent, suggesting that trafficking of these mutants to the plasma membrane is not impaired. All Bsep mutants accumulate in perinuclear aggresome-like structures in the presence of the proteasome inhibitor MG-132, suggesting that mutations are associated with protein instability and ubiquitin-dependent degradation. Reduced temperature, sodium butyrate, and sodium 4-phenylbutyrate enhanced the expression of the mature and cell surface D482G protein in HEK293 cells. These results suggest that the clinical phenotypes of PFIC2, BRIC2, and ICP may directly correlate with the amount of mature protein that is expressed at the cell surface and that strategies to stabilize cell surface mutant protein may be therapeutic.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 V444A (F) has been identified as a polymorphic site (14). Login to comment
191 A third patient with severe ICP was found to have combined homozygous alterations of a BSEP polymorphism (V444A) and a MDR3 missense mutation, possibly explaining the early onset and severity of the ICP (10). Login to comment

[hide] Increased susceptibility for intrahepatic cholesta... World J Gastroenterol. 2008 Jan 7;14(1):38-45. Meier Y, Zodan T, Lang C, Zimmermann R, Kullak-Ublick GA, Meier PJ, Stieger B, Pauli-Magnus C
Increased susceptibility for intrahepatic cholestasis of pregnancy and contraceptive-induced cholestasis in carriers of the 1331T>C polymorphism in the bile salt export pump.
World J Gastroenterol. 2008 Jan 7;14(1):38-45., 2008-01-07 [PMID:18176959]

Abstract [show]
AIM: To study the association of three common ABCB11 and ABCC2 polymorphisms (ABCB11: 1331T>C --> V444A; ABCC2: 3563T>A --> V1188E and 4544G>A --> C1515Y) with intrahepatic cholestasis of pregnancy (ICP) and contraceptive-induced cholestasis (CIC). METHODS: ABCB11 and ABCC2 genotyping data were available from four CIC patients and from 42 and 33 ICP patients, respectively. Allele-frequencies of the studied polymorphisms were compared with those in healthy pregnant controls and Caucasian individuals. Furthermore, serum bile acid levels were correlated with the presence or absence of the 1331 C allele. RESULTS: The ABCB11 1331T>C polymorphism was significantly more frequent in cholestatic patients than in pregnant controls: C allele 76.2% (CI, 58.0-94.4) vs 51.3% (CI 35.8-66.7), respectively (P = 0.0007); and CC allele 57.1% (CI 36.0-78.3) vs 20% (CI 7.6-32.4), respectively (P = 0.0065). All four CIC patients were homozygous carriers of the C allele. In contrast, none of the studied ABCC2 polymorphism was overrepresented in ICP or CIC patients. Higher serum bile acid levels were found in carriers of the 1331CC genotype compared to carriers of the TT genotype. CONCLUSION: Our data support a role for the ABCB11 1331T>C polymorphism as a susceptibility factor for the development of estrogen-induced cholestasis, whereas no such association was found for ABCC2. Serum bile acid and gamma-glutamyl transferase levels might help to distinguish ABCB4- and ABCB11-related forms of ICP and CIC.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 paulic@uhbs.ch Telephone: + 41-61-3287715 Fax: + 41-61-2653708 Received: July 12, 2007 Revised: September 12, 2007 Abstract AIM: To study the association of three common ABCB11 and ABCC2 polymorphisms (ABCB11: 1331T>C V444A; ABCC2: 3563T>A V1188E and 4544G>A C1515Y) with intrahepatic cholestasis of pregnancy (ICP) and contraceptive-induced cholestasis (CIC). Login to comment
87 In contrast, the ABCB11 1331T>C → V444A polymorphism was significantly more frequent in ICP and CIC patients compared to the two control groups. Login to comment
88 Specifically, the CC genotype was encountered in 57.1% of all ICP patients (ICPnew, 47.6% and ICPold, 67.7%) and 100% of CIC patients compared to 20 and 32.2% in pregnant Table 2 New group of patients with ICP (ICPnew) Patient ID Age (yr) Liver parameters Comments Genotypes of SNPs ALT (ULN) AP (ULN) g-GT (ULN) tBili (ULN) tBA (ULN) No of preg/ No ICP Others ABCB11 1331T>C (V444A) ABCC2 3600T>A (V1188E) ABCC2 4581G>A (C1515Y) 1 36 0.9 2.3 3.3 0.8 10.7 2/1 CC TA GA 2 31 1.6 2.5. Login to comment
90 Table 3 Characteristics of patients with oral CIC Patient ID Oral contraceptive Age (yr) Exposure time Liver parameters Comments Genotypes of SNPs ALT AP gGT tBili tBA Clinical features Histology ABCB11 1331T>C (V444A) ABCC2 3600T>A (V1188E) ABCC2 4581G>A (C1515Y) (ULN) (ULN) (ULN) (ULN) (ULN) 11 30 ʼg ethinylestradiol/ 75 ʼg gestodene 32 nd 4.9 1.7 1 10.9 22.3 Jaundice Intrahepatic cholestasis CC TT GG 2 30 ʼg ethinylestradiol/ 150 ʼg levonorgestrel 15 21 d 1 3 1 4.2 nd Jaundice, nausea, pruritus Extensive intrahepatic cholestasis CC TT GG 3 35 ʼg ethinylestradiol/ 50 ʼg levonorgestrel 40 2 yr 3.9 2.8 3.6 0.5 1.6 Pruritus Bland CC TT GG 4 35 ʼg ethinylestradio/ 2 mg cyproteron 34 nd 1 1.3 nd 2.8 1.6 Jaundice Extensive canalicular cholestasis, mild portal inflamation CC TA GA 1 Patient exhibited previous episodes of ICP. Login to comment
105 DISCUSSION We investigated the risk association between different ABCB11 and ABCC2 polymorphisms in ICP and CIC, and correlated different genotypes with serum bile acid levels Table 4 Genotype distribution of non-synonymous ABCB11 variant site 1331T>C in patients and controls Genotype SNP ICPold ICPnew ICPtotal Pregnant controls Caucasian controls n (%) 95 % CI n (%) 95 % CI n (%) 95 % CI n (%) 95 % CI n (%) 95 % CI ABCB11 1331T>C (V444A) 21 (100) 21 (100) 42 (100) 40 (100) 205 (100) TT (VV) - - 2 (9.5) 0.0-22.1 2 (4.8) 0.0-13.9 7 (17.5) 5.7-29.3 38(18.5) 13.2-23.9 CC (AA) 14 (67.7) 46.5 -86.8 10 (47.6) 26.3-69.0 24 (57.1) 36.0-78.3 8 (20) 7.6-32.4 66 (32.2) 25.8-38.6 TC (VA) 7 (33.3) 13.2-53.5 9 (42.9) 21.7-64.0 16 (38.1) 17.3-58.9 25 (62.5) 47.5-77.5 101 (49.3) 42.4-56.1 Frequency C allele 35 (83.3) 67.4-99.3 29 (69.0) 49.3-88.8 64 (76.2) 58.0-94.4 41 (51.3) 35.8-66.7 233 (56.8) 50.1-63.6 Frequency T allele 7 (16.7) 0.7-32.6 13 (31.0) 11.2-50.7 20 (23.8) 5.6-42.0 39 (48.8) 33.3-64.2 177 (43.2) 36.4-50.0 ABCC2 3563T>A (V1188E) 16 (100) 17 (100) 33 (100) 42 (100) 110 (100) TT (VV) 15 (93.8) 71.3-98.6 13 (76.5) 52.3-90.4 28 (84.8) 68.9-93.3 37 (88.1) 74.3-96.1 95 (86.4) 68.9-93.3 AA (EE) - - - - - - - - 1 (0.9) 0.0-5.0 TA (VE) 1 (3.1) 0.0-15.8 4 (23.5) 9.6-47.7 5 (15.2) 6.7-31.1 5 (11.9) 3.9-25.7 14 (12.7) 7.1-20.5 ABCC2 4544G>A (C1515Y) 16 (100) 17 (100) 33 (100) 42 (100) 110 (100) GG (CC) 15 (93.8) 71.3-98.6 13 (76.5) 52.3-90.4 28 (84.8) 68.9-93.3 36 (85.7) 71.4-94.6 95 (86.4) 68.9-93.3 AA (YY) - - - - - - - - 1 (0.9) 0.0-5.0 GA (CY) 1 (3.1) 0.0-15.8 4 (23.5) 9.6-47.7 5 (15.2) 6.7-31.1 6 (14.3) 5.4-28.6 14 (12.7) 7.1-20.5 Results are given with 95 percent confidence interval (95% CI). Login to comment
107 CC vs TT C vs T Fisher Odds ratio 95% CI Fisher Odds ratio 95% CI ICPold vs Pregnant controls 0.0041 nd1 - 0.0004 4.8 2.2-15.0 ICPold vs Caucasian controls 0.0029 nd1 - 0.0005 3.8 1.9-11.1 ICPnew vs Pregnant controls 0.1082 4.4 0.7-27.2 0.0441 2.1 1.0-4.7 ICnew vs Caucasian controls 0.1461 2.9 0.6-13.8 0.0850 1.7 0.9-3.4 ICPtotal vs Pregnant controls 0.0065 10.5 1.9-63.7 0.0007 3.0 1.7-6.4 ICPtotal vs Caucasian controls 0.0025 6.9 1.6-32.1 0.0006 2.4 1.5-4.5 Table 5 1331T>C (V444A): Fisher's exact test and ORs for the presence of homozygous CC variant and the C allele in the different groups as a marker of cholestasis. Login to comment

[hide] Update on progressive familial intrahepatic choles... J Pediatr Gastroenterol Nutr. 2008 Mar;46(3):241-52. Alissa FT, Jaffe R, Shneider BL
Update on progressive familial intrahepatic cholestasis.
J Pediatr Gastroenterol Nutr. 2008 Mar;46(3):241-52., [PMID:18376240]

Abstract [show]
Three distinct forms of familial intrahepatic cholestasis are the result of mutations in the ATP8B1, ABCB11, and ABCB4 genes. The pathophysiologies of the latter 2 of these diseases are well characterized and are the result of abnormalities in canalicular excretion of bile acids and phospholipids, respectively. The molecular pathophysiology of the systemic disease associated with mutations in ATP8B1 remains unclear. In all of these diseases, wide variations in clinical phenotypes have been observed. The variability can be ascribed at least in part to predicted genotype:phenotype correlations. Disease- and genotype-specific prognoses and therapeutic approaches may exist, although much more information needs to be ascertained before clinicians can confidently make decisions based on genetic information.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
194 Even more subtle mutations of ABCB11 were described in patients with an intermittent form of disease (BRIC2; see below), these mutations include E186G, A570T, T923P, A926P, R1050C, R1128H, V444A, and E297G. Login to comment
195 The E297G mutation was previously described in patients with BSEP disease, and V444A was also found in intrahepatic cholestasis of pregnancy (69,70). Login to comment

[hide] Diagnosis of BSEP/ABCB11 mutations in Asian patien... J Pediatr. 2008 Dec;153(6):825-32. Epub 2008 Aug 9. Chen HL, Liu YJ, Su YN, Wang NY, Wu SH, Ni YH, Hsu HY, Wu TC, Chang MH
Diagnosis of BSEP/ABCB11 mutations in Asian patients with cholestasis using denaturing high performance liquid chromatography.
J Pediatr. 2008 Dec;153(6):825-32. Epub 2008 Aug 9., [PMID:18692205]

Abstract [show]
OBJECTIVE: To determine if specific mutations were present in Asian patients with progressive familial intrahepatic cholestasis (PFIC) type 2 caused by defects in bile salt export pump (BSEP), encoded by ABCB11. STUDY DESIGN: A combination of denaturing high-performance liquid chromatography (DHPLC) and direct sequencing was used to screen ABCB11 mutations in 18 Taiwanese patients with low gamma-glutamyltransferase PFIC or benign recurrent intrahepatic cholestasis (BRIC). Polymorphisms were also analyzed in patients with PFIC (n = 21), neonatal cholestasis (n = 23), and control subjects (n = 88). RESULTS: Seven mutations in 4 of 16 patients with PFIC from different families were detected by DHPLC, including M183V, V284L, R303K, R487H, W493X, G1004D, and 1145delC. G1004D was found in a patient with BRIC. L827I was found in another patient with neonatal cholestasis. Absent or defective BSEP staining was found in the liver of patients with mutations. Polymorphisms V444A and A865V, with an allele frequencies 75.6% and 0.6%, respectively, were found in our population. No differences were found between patients with cholestasis and control subjects. CONCLUSIONS: One-fourth of Taiwanese patients with PFIC/BRIC had compound heterozygous or single heterozygous ABCB11 mutations without hot spots. All of the mutations were different from those detected in Western countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Polymorphisms V444A and A865V, with an allele frequencies 75.6% and 0.6%, respectively, were found in our population. Login to comment
75 Analysis of V444A and A865V in Patients with Neonatal Cholestasis and PFIC To investigate whether the 2 nonsynonymous polymorphisms found in our population have functional consequences and affect disease presentation, we analyzed the allele frequencies of polymorphisms in 21 patients with PFIC/BRIC, 23 patients with neonatal cholestasis other than PFIC, and 88 control subjects with chronic nonsymptomatic HBV. Login to comment
76 These samples were tested using DHPLC analysis of exons 13 and 21, followed by direct sequencing to identify the V444A and A865V polymorphisms. Login to comment
91 Polymorphism Analysis Two previously reported nonsynonymous polymorphisms at c.1331TϾC (p.V444A,) and c. Login to comment
93 The denaturing pattern for heterozygous TC in V444A (pattern A) was different from the TT and CC (pattern B, Figure 2). Login to comment
95 Distributions of V444A and A865V polymorphisms, as well as allele frequencies, are shown in Table III. We found that V444A was a more prevalent polymorphism in control patients, and had an allele frequency of 75.6%. Login to comment
96 However, V444A was not associated with PFIC or neonatal cholestasis in our patients using univariate analysis. Login to comment
98 All of the patients with A865V also carried the homozygous V444A polymorphism. Login to comment
104 Comparing our results with previously reported large scale genetic analysis of ABCB11 variations in healthy Caucasians, African Americans, and Japanese subjects,19 the missense mutations found in our study were not reported in all the 3 populations. In the same study, V444A and A865V were the only nonsynonymous polymorphisms found in Japanese population, which was consistent with our findings. Login to comment
108 The SIFT results indicated that all of the missense mutations (except polymorphisms V444A and A865V) may affect protein function. Login to comment
123 Interestingly, although our patients had mutations distinct from patients in Western countries, there Table III. Distribution of V444A and A865V polymorphisms and allele frequencies in Taiwanese patients and control subjects PFIC/BRIC Neonatal cholestasis (non-PFIC) Control P1 P2 P3 V444A n ϭ 21 n ϭ 23 n ϭ 88 0.798 0.508 0.806 TT 2 (9.5%) 2 (8.7%) 5 (5.7%) TC 8 (38.1%) 11 (47.8%) 33 (37.5%) CC 11 (52.4%) 10 (43.5%) 50 (56.8%) Allele frequency T % 12 (28.6%) 15 (32.6%) 43 (24.4%) 0.693 0.264 0.818 C % 30 (71.4%) 31 (67.4%) 133 (75.6%) A865V n ϭ 21 n ϭ 23 n ϭ 88 0.094 0.108 1.000 CC 19 (90.5%) 21 (91.3%) 87 (98.9%) CT 2 (9.5%) 2 (8.7%) 1 (1.1%) TT 0 (0.0%) 0 (0.0%) 0 (0.0%) Allele frequency C % 40 (95.2%) 44 (95.7%) 175 (99.4%) 0.096 0.110 1.000 T % 2 (4.8%) 2 (4.3%) 1 (0.6%) P1: Comparisons between PFIC/BRIC vs control. Login to comment
128 Prediction of functional consequences of nonsynonymous mutations and polymorphisms in ABCB11 found in Asian patients Amino acid change SIFT PolyPhen (PSIC score) EC/EU M183V 0.02 1.45 EC V284L 0.02 1.87 EC R303K 0.00 0.38 EC V444A 0.76 0.60 EC R487H 0.01 0.65 EC L827I 0.01 1.23 EC A865V 0.10 0.76 EC G1004D 0.00 1.97 EC SIFT, Sorting intolerant from tolerant (SIFT scores Ͻ0.05 indicate evolutionarily conserved amino acids, and mutation of these residues are predicted to be deleterious); PolyPhen, polymorphism phenotyping (a PSIC score Ͻ0.5 denotes benign variants, between 1.5 and 2 is possibly damaging, and Ͼ2 is probably damaging); EC, evolutionarily conserved; EU, evolutionarily unconserved. Login to comment
140 V444A is a highly prevalent polymorphism. Login to comment
146 (80.4%) than in Caucasians (59.5%).19 V444A has previously been implicated in BRIC-2 and severe intrahepatic cholestasis during pregnancy, when present in combination with other ABCB11 or ABCB4 mutations.7,10 This polymorphism has also been implicated in drug-induced cholestasis. Login to comment
147 An in vitro study demonstrated that the V444A polymorphism leads to a lower BSEP transporter activity.9 However, ABCB11 sequence variations were found to be less important in the development of pregnancy-associated cholesatsis.22 In our study, homozygous V444A mutations were highly prevalent in PFIC parents and in control patients lacking a cholestatic phenotype. Login to comment
148 Because the number of patients tested in this study is small, it is not conclusive whether V444A or A865V plays roles in PFIC or neonatal cholestasis. Login to comment
149 It is possible that the functional consequence of V444A is affected by many other factors, such as concurrent mutations in ABCB11 or other genes, drugs or toxins, and different ethnic backgrounds. Login to comment
150 A protective effect of V444A in certain populations is also possible. Login to comment
165 V444A and A865V are nonsynonymous polymorphisms found in ABCB11 exons in our population, and their association with pediatric cholestatic diseases is not clear. Login to comment

[hide] Contribution of variant alleles of ABCB11 to susce... Gut. 2009 Apr;58(4):537-44. Epub 2008 Nov 5. Dixon PH, van Mil SW, Chambers J, Strautnieks S, Thompson RJ, Lammert F, Kubitz R, Keitel V, Glantz A, Mattsson LA, Marschall HU, Molokhia M, Moore GE, Linton KJ, Williamson C
Contribution of variant alleles of ABCB11 to susceptibility to intrahepatic cholestasis of pregnancy.
Gut. 2009 Apr;58(4):537-44. Epub 2008 Nov 5., [PMID:18987030]

Abstract [show]
BACKGROUND: Intrahepatic cholestasis of pregnancy (ICP) has a complex aetiology with a significant genetic component. ABCB11 encodes the bile salt export pump (BSEP); mutations cause a spectrum of cholestatic disease, and are implicated in the aetiology of ICP. METHODS: ABCB11 variation in ICP was investigated by screening for five mutant alleles (E297G, D482G, N591S, D676Y and G855R) and the V444A polymorphism (c.1331T>C, rs2287622) in two ICP cohorts (n = 333 UK, n = 158 continental Europe), and controls (n = 261) for V444A. PCR primers were used to amplify and sequence patient and control DNA. The molecular basis for the observed phenotypes was investigated in silico by analysing the equivalent residues in the structure of the homologous bacterial transporter Sav1866. RESULTS: E297G was observed four times and D482G once. N591S was present in two patients; D676Y and G855R were not observed. The V444A polymorphism was associated with ICP (allelic analysis for C vs T: OR 1.7 (95% CI 1.4 to 2.1, p<0.001)). In addition, CC homozygotes were more likely to have ICP than TT homozygotes: OR 2.8 (95% CI 1.7 to 4.4 p<0.0001). Structural analyses suggest that E297G and D482G destabilize the protein fold of BSEP. The molecular basis of V444A and N591S was not apparent from the Sav1866 structure. CONCLUSIONS: Heterozygosity for the common ABCB11 mutations accounts for 1% of European ICP cases; these two mutants probably reduce the folding efficiency of BSEP. N591S is a recurrent mutation; however, the mechanism may be independent of protein stability or function. The V444A polymorphism is a significant risk factor for ICP in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2 Methods: ABCB11 variation in ICP was investigated by screening for five mutant alleles (E297G, D482G, N591S, D676Y and G855R) and the V444A polymorphism (c.1331T.C, rs2287622) in two ICP cohorts (n = 333 UK, n = 158 continental Europe), and controls (n = 261) for V444A. Login to comment
7 The V444A polymorphism was associated with ICP (allelic analysis for C vs T: OR 1.7 (95% CI 1.4 to 2.1, p,0.001)). Login to comment
10 The molecular basis of V444A and N591S was not apparent from the Sav1866 structure. Login to comment
13 The V444A polymorphism is a significant risk factor for ICP in this population. Login to comment
19 This was initially proposed in the Finnish population following analysis of a two SNP (single nucleotide polymorphism) haplotype in 57 cases.30 However, a subsequent study in a larger cohort of 142 ICP cases failed to replicate the initial findings, leaving the role of BSEP open to question.31 A recent study of the entire coding region of the BSEP gene identified a single potential mutation (N591S) in a cohort of 21 women with ICP.32 In addition, a polymorphism (c.1331C.T, V444A, rs2287622) possibly affecting BSEP expression has been suggested to play a role in ICP32 33 and has recently been reported to be associated with drug-induced cholestasis (DIC).34 This association has been replicated recently in a slightly larger cohort.24 We sought to clarify the role of ABCB11 mutations in predisposition to ICP by screening a large cohort of patients for the two common mutant alleles, together with the N591S mutation found previously in a case of ICP32 and the two recently described mutations (D676Y and G855R) associated with DIC.34 We also genotyped the V444A polymorphism in the largest case/control study to date in ICP. Login to comment
20 A control group of 261 European women with normal pregnancies were also genotyped for the V444A polymorphism. Login to comment
21 BSEP is homologous with the bacterial multidrug resistance protein (Sav1866) for which two structures have recently been determined at high resolution by x ray crystallography.35 36 We therefore used this structure to consider the possible effects of E297G, D482G, N591S and V444A on BSEP, all of which were identified in patients with ICP, to provide insights into potential mutational mechanisms. Login to comment
36 Genotyping of the c.1331C.T polymorphism (rs2287622, which results in V444A) was also performed by DNA sequencing of ABCB11 exon 13. Login to comment
57 Biliary tract Gut 2009;58:537-544. doi:10.1136/gut.2008.159541 Genotyping and statistics Genotyping of the V444A polymorphism in exon 13 in both cohorts resulted in the allele frequencies shown in table 2 and fig 1. Login to comment
62 Taken together, these results indicate that individuals with the C allele of the V444A polymorphism have increased risk for the development of ICP in this population, with homozygotes for this allele (CC, alanine) being at highest risk, with test for trend p,0.001. Login to comment
76 A putative functional or structural significance for the V444A variant of BSEP is less evident because the residue is not highly conserved in the NBDs of ABC transporters, and because replacing the valine with a similarly small and non-polar alanine is unlikely to be very detrimental. Login to comment
83 Table 2 Frequency counts for genotypes and alleles of the V444A polymorphism Genotype TotalCC CT TT Cases 222 (45%) 212 (43%) 57 (12%) 491 Controls 75 (29%) 133 (51%) 53 (20%) 261 Total 297 345 110 752 C (%) T (%) Total Cases 656 (67) 326 (33) 982 Controls 283 (54) 239 (46) 522 Biliary tract Gut 2009;58:537-544. doi:10.1136/gut.2008.159541 two strands (and because the aliphatic side chain of V444 is unable to form a similar bond) it is unlikely to be critical for the function or folding of the domain. Login to comment
90 Our work has also confirmed the role of the V444A polymorphism as a susceptibility locus for ICP, as suggested by prior studies in smaller cohorts.24 32 A previous study analysed the ABCB11 gene in ICP cases but sequenced the entire gene in a small number of patients.32 Haplotype analysis of the ABCB11 locus in a European Swedish population failed to identify a difference in the distribution of common haplotypes across this region.19 We chose to focus on frequent mutant PFIC/BRIC alleles together with ICP and DIC- associated mutations in order to analyse a much larger population of ICP cases than has been performed previously. Login to comment
100 The fold Figure 1 Genotype and allele frequencies for the V444A variant in cases (n = 491) and controls (n = 261). Login to comment
102 (B) Genotype frequencies in cases and controls for the V444A variant; The y-axis indicates frequency of the genotype expressed as a percentage. ORs for CC vs TT and CC vs CT comparisons together with 95% CIs are shown. Login to comment
103 Table 3 Allelic analysis for the V444A polymorphism associated with cholestasis Allele OR (95%CI) p Value C vs T 1.70 (1.4 to 2.1) ,0.001 Table 4 Genotypic analysis for the V444A polymorphism associated with cholestasis OR (95% CI) p Value CC vs CT 1.9 (1.3 to 2.6) ,0.001 CC vs TT 2.8 (1.7 to 4.4) ,0.001 CC and CT vs TT 1.9 (1.3 to 2.9) 0.001 Biliary tract Gut 2009;58:537-544. doi:10.1136/gut.2008.159541 Figure 2 The structure of Sav1866 suggests a molecular mechanism for the bile salt export pump (BSEP) mutations E297G and D482G (A) Schematic representation of the drug exporter Sav1866 with two bound ADPs shown as spheres (pdb 2HYD). Login to comment
128 A study of 21 ICP cases suggested a role for the V444A polymorphism in the disease,32 which was also supported by a further, slightly extended study.24 In addition, a second cholestatic phenotype, DIC, has been associated with this polymorphism.34 This polymorphism has biological plausibility, as indicated by functional evidence: there is a trend for low BSEP activity in liver specimens from individuals who harbour this polymorphism.33 V444A has been described as a mutation in three recent case reports of ICP46 47 and BRIC.48 Functional assays of BSEP activity in Sf9 cells failed to demonstrate a difference in taurocholate transport activity between constructs carrying valine or alanine at position 444.34 However, carriers of the alanine allele exhibit lower hepatic BSEP protein expression.33 Analysis of the equivalent residue (S363) in Sav1866 provided no compelling argument for a possible effect on BSEP folding or function. Login to comment
129 Comprehensive studies are warranted to quantify definitively the effect of V444A on BSEP expression and function, and an effect at the level of mRNA stability should also be examined to explain the reported associations with susceptibility to cholestasis. Login to comment
157 However, our study also indicates that V444A confers susceptibility to ICP in the largest cohort to be studied to date, indicating that genetic variation of ABCB11 may play a more central role in the aetiology of ICP than previously suspected. Login to comment

[hide] Missense mutations and single nucleotide polymorph... Hepatology. 2009 Feb;49(2):553-67. Byrne JA, Strautnieks SS, Ihrke G, Pagani F, Knisely AS, Linton KJ, Mieli-Vergani G, Thompson RJ
Missense mutations and single nucleotide polymorphisms in ABCB11 impair bile salt export pump processing and function or disrupt pre-messenger RNA splicing.
Hepatology. 2009 Feb;49(2):553-67., [PMID:19101985]

Abstract [show]
The gene encoding the human bile salt export pump (BSEP), ABCB11, is mutated in several forms of intrahepatic cholestasis. Here we classified the majority (63) of known ABCB11 missense mutations and 21 single-nucleotide polymorphisms (SNPs) to determine whether they caused abnormal ABCB11 pre-messenger RNA splicing, abnormal processing of BSEP protein, or alterations in BSEP protein function. Using an in vitro minigene system to analyze splicing events, we found reduced wild-type splicing for 20 mutations/SNPs, with normal mRNA levels reduced to 5% or less in eight cases. The common ABCB11 missense mutation encoding D482G enhanced aberrant splicing, whereas the common SNP A1028A promoted exon skipping. Addition of exogenous splicing factors modulated several splicing defects. Of the mutants expressed in vitro in CHO-K1 cells, most appeared to be retained in the endoplasmic reticulum and degraded. A minority had BSEP levels similar to wild-type. The SNP variant A444 had reduced levels of protein compared with V444. Treatment with glycerol and incubation at reduced temperature overcame processing defects for several mutants, including E297G. Taurocholate transport by two assessed mutants, N490D and A570T, was reduced compared with wild-type. Conclusion: This work is a comprehensive analysis of 80% of ABCB11 missense mutations and single-nucleotide polymorphisms at pre-mRNA splicing and protein processing/functional levels. We show that aberrant pre-mRNA splicing occurs in a considerable number of cases, leading to reduced levels of normal mRNA. Thus, primary defects at either the protein or the mRNA level (or both) contribute significantly to BSEP deficiency. These results will help to develop mutation-specific therapies for children and adults suffering from intrahepatic cholestasis due to BSEP deficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
202 Interestingly, the patient in question was also heterozygous for the SNP V444A (c.1331TϾC). Login to comment

[hide] Adult progressive intrahepatic cholestasis associa... Hepatol Res. 2009 Jun;39(6):625-31. Epub 2009 Feb 24. Hsu YC, Chen HL, Wu MZ, Liu YJ, Lee PH, Sheu JC, Chen CH
Adult progressive intrahepatic cholestasis associated with genetic variations in ATP8B1 and ABCB11.
Hepatol Res. 2009 Jun;39(6):625-31. Epub 2009 Feb 24., [PMID:19260995]

Abstract [show]
Severe intrahepatic cholestasis with low serum gamma-glutamyltranspeptidase (gamma-GT) activity is exceptionally rare in adult patients, and its association with multi-genetic alterations of bile salt transporters has not been reported. We investigated a 25-year-old man presenting with a four-year history of jaundice. Laboratory and radiographic examinations revealed clinical pictures of progressive intrahepatic cholestasis with low gamma-GT. Serial liver histopathology demonstrated cirrhosis resulting from progressive persistent cholestatic injury. Genetic sequencing studies for the entire coding exons of ATP8B1 and ABCB11 uncovered a heterozygous missense mutation 1798 C->T (R600W) in ATP8B1, and a homozygous nucleotide substitution 1331 T->C (V444A) in ABCB11. In conclusion, this is a rare case of adult onset progressive intrahepatic cholestasis with low gamma-GT associated with heterozygous ATP8B1 mutation and homozygous ABCB11 polymorphism. Further studies are necessary to investigate the impact of heterozygous R600W mutation and whether other cholestatic disorders are multi-genetic.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Serial liver histopathology demonstrated cirrhosis resulting from progressive persistent cholestatic injury. Genetic sequencing studies for the entire coding exons of ATP8B1 and ABCB11 uncovered a heterozygous missense mutation 1798 C->T (R600W) in ATP8B1, and a homozygous nucleotide substitution 1331 T->C (V444A) in ABCB11. Login to comment
8 Genetic sequencing analysis revealed a heterozygous ATP8B1 mutation (R600W) and a homozygous ABCB11 polymorphism (V444A). Login to comment
64 A heterozygous missense mutation c.1798C>T (p.R600W) was found in ATP8B1 and a homozygous nucleotide substitution c.1331T>C (p.V444A) was found in ABCB11. Login to comment
65 The R600W had been found to be associated with BRIC8 and the V444A had been reported to be a polymorphism associated with intrahepatic cholestasis of pregnancy,15,16 BRIC12 and drug-induced cholestasis.17 DISCUSSION THE UNIQUE FEATURE of this case was the adult onset progressive intrahepatic cholestasis with low g-GT. Login to comment
86 In contrast, homozygous V444A of ABCB11 was originally considered as a frequent polymorphism in the western population, which might be associated with intrahepatic cholestasis of pregnancy.15 Keitel et al. investigated an unusual case of severe intrahepatic cholestasis of pregnancy and demonstrated that a homozygous V444A in combination with a homozygous MDR3 mutation (S320F) was associated with diminished canalicular BSEP.16 Kubitz et al. reported compound heterozygosity of V444A and E186G in a BRIC-2 patient with decreased canalicular BSEP.12 Lang et al. described a significant association of V444A with drug-related cholestasis and concluded that V444A was susceptible for cholestasis under certain challenges, based on their in vitro study of BSEP expression and its transporter activity.17 It is possible that the multi-genetic alterations in this patient contributed to an inherited susceptibility for secondary insults, which caused the phenotype with disease onset at a later age than usual genetic diseases. Login to comment

[hide] Combined functional variants of hepatobiliary tran... Liver Int. 2009 Sep;29(8):1286-8. Zimmer V, Mullenbach R, Simon E, Bartz C, Matern S, Lammert F
Combined functional variants of hepatobiliary transporters and FXR aggravate intrahepatic cholestasis of pregnancy.
Liver Int. 2009 Sep;29(8):1286-8., [PMID:19490418]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Genetic analysis Sequencing of all exons and exon-intron boundaries of the ABCB4 and ABCB11 genes was performed, revealing the rare ABCB4 mutation c.959C 4 T (p.S320F) and the common ABCB11 variant c.1331T 4C (p.V444A). Login to comment
39 Of interest, in the nulligravid sister (II:2), who was also affected by juvenile cholelithiasis and biochemical evidence of mild cholestatic liver disease, the ABCB11 p.V444A variant was detected in the heterozygous state only. Login to comment

[hide] Genetic variations of the ABC transporter gene ABC... Drug Metab Pharmacokinet. 2009;24(3):277-81. Kim SR, Saito Y, Itoda M, Maekawa K, Kawamoto M, Kamatani N, Ozawa S, Sawada J
Genetic variations of the ABC transporter gene ABCB11 encoding the human bile salt export pump (BSEP) in a Japanese population.
Drug Metab Pharmacokinet. 2009;24(3):277-81., [PMID:19571440]

Abstract [show]
The bile salt export pump (BSEP) encoded by ABCB11 is located in the canalicular membrane of hepatocytes and mediates the secretion of numerous conjugated bile salts into the bile canaliculus. In this study, 28 ABCB11 exons (including non-coding exon 1) and their flanking introns were comprehensively screened for genetic variations in 120 Japanese subjects. Fifty-nine genetic variations, including 19 novel ones, were found: 14 in the coding exons (6 nonsynonymous and 8 synonymous variations), 4 in the 3'-UTR, and 41 in the introns. Three novel nonsynonymous variations, 361C>A (Gln121Lys), 667C>T (Arg223Cys), and 1460G>T (Arg487Leu), were found as heterozygotes and at 0.004 allele frequencies. These data provide fundamental and useful information for genotyping ABCB11 in the Japanese and probably other Asian populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 280 Su-Ryang KIM, et al. 281281Genetic Variations of ABCB11 in Japanese quency in Japanese (0.196-0.267) is slightly lower than that in Caucasians (0.405) and African-Americans (0.344) (described as g.44308TÀC [Val444Ala] in a previous paper).7) Two other known variations, 896GÀA (Arg299Lys) and 2594CÀT (Ala865Val), were detected only in the Japanese population at allele frequencies of 0.010 for 896GÀA and 0.024 for 2594CÀT, respectively.7) Both variations are located in the cytoplasmic loops between TMD4 and TMD5 and between TMD8 and TMD9. Login to comment

[hide] De novo bile salt transporter antibodies as a poss... Hepatology. 2009 Aug;50(2):510-7. Keitel V, Burdelski M, Vojnisek Z, Schmitt L, Haussinger D, Kubitz R
De novo bile salt transporter antibodies as a possible cause of recurrent graft failure after liver transplantation: a novel mechanism of cholestasis.
Hepatology. 2009 Aug;50(2):510-7., [PMID:19642168]

Abstract [show]
Progressive familial intrahepatic cholestasis type 2 (PFIC-2) is caused by mutations of the bile salt export pump (BSEP [ABCB11]), an ATP-binding cassette (ABC)-transporter exclusively expressed at the canalicular membrane of hepatocytes. An absence of BSEP from the canalicular membrane causes cholestasis and leads to liver cirrhosis, which may necessitate liver transplantation in early childhood. We report on the first case of a child with PFIC-2 suffering from repeated posttransplant recurrence of progressive intrahepatic cholestasis due to autoantibodies against BSEP. These antibodies occurred after transplantation and were detected in the patient's serum and at the canalicular membrane of two consecutive liver transplants. The antibodies were reactive toward the first extracellular loop of BSEP, were of high affinity, and inhibited transport activity of BSEP, thus causing severe cholestasis. The patient had three homozygous, missense changes in the BSEP gene. Their combination resulted in the complete absence of BSEP, which explains the lack of tolerance, a prerequisite of autoantibody formation toward BSEP. The findings illustrate a novel disease mechanism due to a new class of functionally relevant autoantibodies resulting in cholestasis and subsequent liver failure.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
29 Compared to the reference sequence NM_003742 of BSEP (ABCB11), three homozygous missense changes were found: 1331T3C (V444A),17 2453A3T (Y818F), and 2944G3A (G982R)4 (start codon numbered as "1"). Login to comment
79 The construct contained three silent mutations (2190G3A, 3210A3G, 3516C3C) and one mutation (1331T3C), leading to an amino acid replacement (V444A). Login to comment
150 Introduction of the mutations V444A or Y818F separately or together into BSEP-YFP had no apparent effect on the localization of BSEPV444A, BSEPY818F, or BSEPV444A/Y818F as compared to wild-type BSEP-YFP (Fig. 2A, 4A). Login to comment
151 However, introduction of G982R alone or in combination with either V444A or Y818F (Fig. 4B) resulted in the retention of BSEPG982R, BSEPV444A/G982R, and BSEPY818F/G982R in the endoplasmic reticulum (ER) in colocalization with the ER marker protein disulfide isomerase. Login to comment
175 It is of note, that in addition to the G982R and Y818F mutations, the common mutation/polymorphism V444A is necessary for the complete disappearance of BSEP. Login to comment
176 V444A has a high prevalence in the Caucasian population,17 has been linked to the development of drug-induced liver injury,30 and may aggravate cholestatic liver diseases such as intrahepatic cholestasis of pregnan- cy31 or benign recurrent intrahepatic cholestasis.32 Expression of BSEPV444A/Y818F/G982R in hepatic and nonhepatic cell lines was below detectability. Login to comment
185 Combination of all three mutations of the patient (V444A,Y818F,G982R) induced complete absence of mutated BSEPV444A/Y818F/G982R-YFP. Login to comment

[hide] Recent insights into the function and regulation o... Curr Opin Lipidol. 2009 Jun;20(3):176-81. Stieger B
Recent insights into the function and regulation of the bile salt export pump (ABCB11).
Curr Opin Lipidol. 2009 Jun;20(3):176-81., [PMID:19684528]

Abstract [show]
PURPOSE OF REVIEW: Generation of bile is an important function of the liver. Its impairment can be caused by inherited mutations or by acquired factors and leads to cholestasis. Bile salts are an important constituent of bile and are secreted by the bile salt export pump (BSEP) from hepatocytes. RECENT FINDINGS: Significant progress was made in the understanding of mechanisms and consequences of malfunctioning BSEP. This information was gained from extensive characterization of patients with inherited BSEP deficiency and the subsequent characterization of the identified mutations in heterologous expression systems. Furthermore and importantly, clinical evidence shows that patients with severe BSEP deficiency are at risk to develop hepatocellular carcinoma. Bile salts are now recognized to be important in the modulation of whole body energy homeostasis. Because BSEP is the rate-limiting step in hepatocellular bile salt transport, it controls the spill over of bile salts into the systemic circulation. Therefore, an indirect role of BSEP in energy homeostasis becomes more and more likely. SUMMARY: In summary, knowledge on the physiologic and pathophysiologic role of BSEP is rapidly progressing. It can be anticipated that the next major step in better understanding BSEP should come from information on structure-function relationship. However, given the difficulty in structure determination of mammalian transporters, this will require major efforts.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 To date, c.1331T>C (p.V444A) in exon 13 and c.2029A>G (p.M677V) in exon 17 of the BSEP gene are two nonsynonymous SNPs, which have consistently been observed with frequencies of higher than 0.5% [8,30-32] in different cohorts. Login to comment
54 Interestingly, individuals carrying the p.V444A variant tended towards lower BSEP expression levels and all of the 17% of the 110 individuals having low or very low BSEP expression levels were carrying at least one c.1331T>C allele. Login to comment
56 Individuals carrying the p.V444A variant could be at a higher risk for developing acquired BSEP deficiency syndromes. Login to comment

[hide] Combined features of low phospholipid-associated c... Liver Int. 2010 Feb;30(2):327-31. Epub 2009 Oct 19. Poupon R, Barbu V, Chamouard P, Wendum D, Rosmorduc O, Housset C
Combined features of low phospholipid-associated cholelithiasis and progressive familial intrahepatic cholestasis 3.
Liver Int. 2010 Feb;30(2):327-31. Epub 2009 Oct 19., [PMID:19840255]

Abstract [show]
Adenosine triphosphate-binding cassette, subfamily B, member 4 (ABCB4) gene alterations can cause two distinct clinical entities: progressive familial intrahepatic cholestasis type 3 (PFIC3) and low phospholipid-associated cholelithiasis (LPAC). Based on the findings in two siblings and a review of the literature, we aimed to identify determinants of disease phenotypic traits associated with ABCB4 gene alterations. Two siblings presented, before the age of 30 years, recurrent symptomatic cholelithiasis and extensive biliary fibrosis that progressed towards portal hypertension and liver failure necessitating liver transplantation. We analysed the sequence of the ABCB4 gene and immunolocalization of the protein in the liver. Sequence analysis of ABCB11, potentially involved in similar symptoms, was also performed. Two heterozygous non-synonymous variants of ABCB4 were found in both siblings. One of them (c.959C>T; p.Ser320Phe) was previously implicated in LPAC and the second one (c.2858C>A; p.Ala953Asp) in PFIC3. Both patients were also heterozygous for the ABCB11 variant Val444Ala, which predisposes to cholestatic disorders. ABCB4 was normally detected at the canalicular membrane of hepatocytes. The review of ABCB4 gene variants reported so far shows that the vast majority of variants causing PFIC3 and LPAC are distinct. Also as a general rule, homozygous variants cause PFIC3 while heterozygous variants lead to LPAC. Combined PFIC3 and LPAC phenotype is a rare clinical event, which may be determined by the coexistence of ABCB4 variants related to both phenotypes and also potentially to the ABCB11 variant. Thus, most of the patients presenting with LPAC are not at a particular risk of developing PFIC3 features in adulthood.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 Both patients were also heterozygous for the ABCB11 variant Val444Ala, which predisposes to cholestatic disorders. Login to comment
91 Sequence analysis of the ABCB11 gene showed the presence of a heterozygous variation affecting exon 13 (c.1331T 4C; p.Val444Ala). Login to comment
121 In keeping with above mentioned, we performed the sequence analysis of the ABCB11 gene and found that both siblings were heterozygous for the Val444Ala variant. Login to comment

[hide] Polymorphic variants in the human bile salt export... Pharmacogenet Genomics. 2010 Jan;20(1):45-57. Ho RH, Leake BF, Kilkenny DM, Meyer Zu Schwabedissen HE, Glaeser H, Kroetz DL, Kim RB
Polymorphic variants in the human bile salt export pump (BSEP; ABCB11): functional characterization and interindividual variability.
Pharmacogenet Genomics. 2010 Jan;20(1):45-57., [PMID:20010382]

Abstract [show]
OBJECTIVES: Our aims were to identify and functionally characterize coding region nonsynonymous single nucleotide polymorphisms in the hepatic efflux transporter, bile salt export pump (BSEP; ABCB11), and to assess interindividual variability in BSEP expression. METHODS: We identified 24 single nucleotide polymorphisms, including nine nonsynonymous variants, in ABCB11 from genomic DNA of approximately 250 ethnically diverse healthy individuals using denaturing high-performance liquid chromatography analysis and DNA sequencing. Wild type and variant BSEP were generated and functionally characterized for taurocholate transport activity in vitro in HeLa cells using a recombinant vaccinia-based method. BSEP expression was assessed by real-time mRNA analysis, western blot analysis, and immunofluorescence confocal microscopy. RESULTS: For the most part, polymorphisms were rare and ethnic-dependent. In vitro functional studies revealed several rare variants, including 616A>G, 1674G>C, 1772A>G, and 3556G>A, to be associated with significantly impaired taurocholate transport activity while the 890A>G variant trended towards impaired function but was not statistically significant. The 3556G>A variant was associated with reduced cell surface to total protein expression compared with wild-type BSEP. Expression of BSEP by mRNA and protein analysis was determined from a bank of human liver samples. Wide interindividual variability was noted in both mRNA (19-fold) and protein (31-fold) expression levels. The common variant 1331T>C was associated with significantly reduced hepatic BSEP mRNA levels. CONCLUSION: Accordingly, our study indicates there are functionally relevant polymorphisms in ABCB11 which may be of potential relevance in the predisposition to acquired liver disorders such as drug-induced cholestasis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
146 Two common BSEP polymorphisms, 1331T > C (Val444Ala) and 2029A > G (Met677Val), were not associated with significant changes in taurocholate transport activity. Login to comment
156 Calnexin, an intracellular resident Table 1 Single-nucleotide polymorphisms in ABCB11 Allele frequencies (%) SNP rs number Amino acid change African-American European-American Asian-American Mexican-American Pacific Islanders 108T > C rs3815675 Synonymous 1.5 1.5 25 5.0 21.4 167C > T rs11568361 Ser56Leu 0.5 0 0 0 0 174C > T rs11568362 Synonymous 0.5 0 0 0 0 270T > C rs414877 Synonymous 3.0 3.5 5.0 0 7.1 402C > T rs11568377 Synonymous 3.5 0 0 0 0 585G > C rs11568365 Synonymous 0.5 0 0 0 0 616A > G rs11568357 Ile206Val 2.5 0 0 0 0 696G > T rs11568358 Synonymous 0 0.5 0 0 0 807T > C rs2287616 Synonymous 2.0 0.5 23.3 5.0 21.4 890A > G rs11568372 Glu297Gly 0 0.5 0 0 0 957A > G rs7563233 Synonymous 31.5 0.5 0 15.0 0 1281C > T rs11568360 Synonymous 0.5 0 0 0 0 1331T > C rs2287622 Val444Ala 53.0 57.1 66.7 50.0 92.9 1671C > T rs11568368 Synonymous 0 0.5 0 0 0 1674G > C rs11568369 Gln558His 0 0.5 0 0 0 1772A > G rs11568367 Asn591Ser 0 0.5 0 0 0 1774G > C rs11568370 Glu592Gln 0 0.5 0 0 0 1791G > T rs11568371 Synonymous 0 0.5 0 0 0 2029A > G rs11568364 Met677Val 15.0 5.5 1.7 5.0 0 2412A > G rs11568373 Synonymous 8.0 0 0 5.0 0 3084A > G rs97692 Synonymous 28.6 54.6 63.3 37.5 21.4 3258A > G rs11568359 Synonymous 7.0 0 0 0 0 3435A > G rs11568366 Synonymous 1.0 0 0 0 0 3556G > A rs1521808 Glu1186Lys 2.5 0 0 0 0 Allele frequencies for single-nucleotide polymorphisms (SNPs) in ABCB11 were determined from a DNA panel of ethnically defined healthy individuals - African-Americans (n = 100), European-Americans (n = 100), Asian-Americans (n = 30), Mexican-Americans (n = 10) and Pacific Islanders (n = 7). Login to comment
230 Indeed, Lang et al. [24] found that a common BSEP variant, 1331T > C (Val444Ala), was more frequently observed in DC patients than in drug-induced hepatocellular injury patients or healthy controls. Login to comment
231 However, when expressed and functionally characterized in Sf9 membrane vesicles, there were no significant differences in protein expression or taurocholate transport activity in the Val444Ala variant versus wild-type BSEP, consistent with our data. Login to comment
232 The same group previously reported that the Val444Ala variant was associated with low-protein expression from a bank of 110 liver samples from individuals undergoing liver resection for various hepatic diseases [32], though it was not statistically significant. Login to comment

[hide] Role of the bile salt export pump, BSEP, in acquir... Drug Metab Rev. 2010 Aug;42(3):437-45. Stieger B
Role of the bile salt export pump, BSEP, in acquired forms of cholestasis.
Drug Metab Rev. 2010 Aug;42(3):437-45., [PMID:20028269]

Abstract [show]
Generation of bile is a key function of the liver. Its impairment leads to accumulation of cytotoxic bile salts in hepatocytes and, consequently, to liver disease. The bile salt export pump, BSEP, is critically involved in the secretion of bile salts into bile. Its function can be disturbed or abolished by inherited mutations. This will lead to progressive intrahepatic cholestais and severe liver disease. In addition to mutations, BSEP can be inhibited by acquired factors, such as xenobiotics or drugs, aberrant bile salt metabolites, or pregnancy. This inhibition will lead to acquired cholestasis. Some drugs are now known to be competitive inhibitors of Bsep. In addition, a polymorphism in the gene coding for BSEP has been identified as a potential susceptibility factor for acquired cholestasis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
141 Until now, the nonsynonomous c.1331T>C (p.V444A) in exon 13 and c.2029A>G (p.M677V) in exon 17 have consistently been reported to have frequencies of higher than 0.5% (Saito etal., 2002; Pauli-Magnus etal., 2004; Lang etal., 2006). Login to comment
142 Investigation of the expression of four canalicular ABC transporters, including BSEP, in 110 healthy liver samples revealed that the p.V444A variant tended to lower BSEP expression levels (Meier et al., 2006). Login to comment
144 Hence, individuals carrying the p.V444A variant could be more prone to acquired cholestais. Login to comment
146 These three studies, therefore, suggest that the c.1331T>C (p.V444A) variant of ABCB11 could be a susceptibility factor for acquired cholestasis. Login to comment

[hide] ATP8B1 and ABCB11 analysis in 62 children with nor... Hepatology. 2010 May;51(5):1645-55. Davit-Spraul A, Fabre M, Branchereau S, Baussan C, Gonzales E, Stieger B, Bernard O, Jacquemin E
ATP8B1 and ABCB11 analysis in 62 children with normal gamma-glutamyl transferase progressive familial intrahepatic cholestasis (PFIC): phenotypic differences between PFIC1 and PFIC2 and natural history.
Hepatology. 2010 May;51(5):1645-55., [PMID:20232290]

Abstract [show]
Progressive familial intrahepatic cholestasis (PFIC) types 1 and 2 are characterized by normal serum gamma-glutamyl transferase (GGT) activity and are due to mutations in ATP8B1 (encoding FIC1) and ABCB11 (encoding bile salt export pump [BSEP]), respectively. Our goal was to evaluate the features that may distinguish PFIC1 from PFIC2 and ease their diagnosis. We retrospectively reviewed charts of 62 children with normal-GGT PFIC in whom a search for ATP8B1 and/or ABCB11 mutation, liver BSEP immunostaining, and/or bile analysis were performed. Based on genetic testing, 13 patients were PFIC1 and 39 PFIC2. The PFIC origin remained unknown in 10 cases. PFIC2 patients had a higher tendency to develop neonatal cholestasis. High serum alanine aminotransferase and alphafetoprotein levels, severe lobular lesions with giant hepatocytes, early liver failure, cholelithiasis, hepatocellular carcinoma, very low biliary bile acid concentration, and negative BSEP canalicular staining suggest PFIC2, whereas an absence of these signs and/or presence of extrahepatic manifestations suggest PFIC1. The PFIC1 and PFIC2 phenotypes were not clearly correlated with mutation types, but we found tendencies for a better prognosis and response to ursodeoxycholic acid (UDCA) or biliary diversion (BD) in a few children with missense mutations. Combination of UDCA, BD, and liver transplantation allowed 87% of normal-GGT PFIC patients to be alive at a median age of 10.5 years (1-36), half of them without liver transplantation. CONCLUSION: PFIC1 and PFIC2 differ clinically, biochemically, and histologically at presentation and/or during the disease course. A small proportion of normal-GGT PFIC is likely not due to ATP8B1 or ABCB11 mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 The 24 remaining mutations were single missense substitutions. In addition to the 41 disease-causing mutations, we found three other variants (p.V444A, p.G319G, p.M677V) considered SNPs.7,27 The p.V444A mutation was present on 44% of PFIC alleles Table 1. Login to comment
80 †Patient harboring the heterozygous ABCB11 mutation p.V444A. Login to comment
109 33†,‡ p.R698H nf na BSEP 6 PFIC2 no. 34 p.M1V p.R387H na na PFIC2 no. Login to comment
110 35† p.E297G p.S699P na na PFIC2 no. Login to comment
112 *Patient harboring the heterozygous ABCB11 mutation p.V444A. Login to comment
113 †Patient harboring the homozygous ABCB11 mutation p.V444A. Login to comment
243 Five of these patients also harbored the p.V444A variant, which may lower the BSEP expression level.11 Mutations located outside the sequenced regions, such as in regulatory domains, or microdeletions of one or more exons cannot be excluded.7 Such defects could explain the phenotype of the PFIC? Login to comment
79 †Patient harboring the heterozygous ABCB11 mutation p.V444A. Login to comment
239 Five of these patients also harbored the p.V444A variant, which may lower the BSEP expression level.11 Mutations located outside the sequenced regions, such as in regulatory domains, or microdeletions of one or more exons cannot be excluded.7 Such defects could explain the phenotype of the PFIC? Login to comment

[hide] The bile salt export pump: clinical and experiment... Semin Liver Dis. 2010 May;30(2):125-33. Epub 2010 Apr 26. Lam P, Soroka CJ, Boyer JL
The bile salt export pump: clinical and experimental aspects of genetic and acquired cholestatic liver disease.
Semin Liver Dis. 2010 May;30(2):125-33. Epub 2010 Apr 26., [PMID:20422495]

Abstract [show]
The primary transporter responsible for bile salt secretion is the bile salt export pump (BSEP, ABCB11), a member of the ATP-binding cassette (ABC) superfamily, which is located at the bile canalicular apical domain of hepatocytes. In humans, BSEP deficiency results in several different genetic forms of cholestasis, which include progressive familial intrahepatic cholestasis type 2 (PFIC2), benign recurrent intrahepatic cholestasis type 2 (BRIC2), as well as other acquired forms of cholestasis such as drug-induced cholestasis (DIC) and intrahepatic cholestasis of pregnancy (ICP). Because bile salts play a pivotal role in a wide range of physiologic and pathophysiologic processes, regulation of BSEP expression has been a subject of intense research. The authors briefly describe the molecular characteristics of BSEP and then summarize what is known about its role in the pathogenesis of genetic and acquired cholestatic disorders, emphasizing experimental observations from animal models and cell culture in vitro systems.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 Two nonsynonymous SNPs, c.1331T>C (p.V444A) in exon 13 and c.2029A>G (p.M677V), have been consistently observed and patients with at least one c.1331T allele tended to have lower levels of BSEP expression.49,51 The V444A variant is also associated with ICP and drug-induced cholestasis,46,49,51-53 but functional activity is not affected.51 It should be noted that these polymorphisms in BSEP that have been associated with ICP and drug cholestasis will require further validation and functional analyses in a larger group of patients. Login to comment
47 Two single nucleotide polymorphisms (SNPs; V444A and M677V, cross) are also represented and have been characterized by functional studies (gray star). Login to comment

[hide] Genetic determinants of drug-induced cholestasis a... Semin Liver Dis. 2010 May;30(2):147-59. Epub 2010 Apr 26. Pauli-Magnus C, Meier PJ, Stieger B
Genetic determinants of drug-induced cholestasis and intrahepatic cholestasis of pregnancy.
Semin Liver Dis. 2010 May;30(2):147-59. Epub 2010 Apr 26., [PMID:20422497]

Abstract [show]
Intrahepatic cholestasis of pregnancy and drug-induced cholestasis are two clinically important forms of acquired cholestatic liver disease. The understanding of the underlying mechanisms of acquired cholestasis has recently made considerable progress by the identification of canalicular ATP-binding cassette (ABC) transporters as likely targets for these forms of cholestasis. Cholestasis of pregnancy is linked to estrogen and progesterone metabolites. These metabolites have been shown to impair the bile salt export pump (BSEP) function by an indirect mechanism. In addition, genetic variants (as well as mutants) of the genes coding for the phosphatidylcholine translocator MDR3 and BSEP and for the farnesoid X receptor, which is critical in the transcriptional activation of MDR3 ( ABCB4) and BSEP ( ABCB11) have been associated with intrahepatic cholestasis of pregnancy. The pathogenesis of drug-induced liver injury encompasses a wide spectrum of mechanisms, some of which are still poorly understood. BSEP is now known to be subject to drug inhibition in susceptible patients. Information on genetic factors rendering individuals susceptible to inhibition of BSEP by drugs or their metabolites is still scarce. Besides rare mutations that have been linked to drug-induced cholestasis, the common p.V444A polymorphism of BSEP has been identified as a potential risk factor. In this review, the authors summarize key concepts of physiology of bile formation, diagnostic principles to indentify these forms of acquired cholestasis, as well as pathogenetic mechanisms leading to intrahepatic cholestasis of pregnancy or drug-induced cholestasis. In addition, they review the current knowledge on genetic susceptibility factors for these two forms of cholestasis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 Besides rare mutations that have been linked to drug-induced cholestasis, the common p.V444A polymorphism of BSEP has been identified as a potential risk factor. Login to comment
77 Although high GGT values were present in the majority of ICP patients with an ABCB4 mutation, genetic ABCB11 dysfunction was postulated in low GGT cases.98,103 Two Swiss studies conducted in independent ICP collectives first suggested the BSEP p.V444A polymorphism as the ICP susceptibility factor, with the homozygous and heterozygous state for the alanine in position 444 being significantly more frequent in ICP women than in healthy pregnant controls.66,104 Very interestingly, the ABCB11 genotype in position 444 also correlated with serum bile acid levels, with carriers of the alanine showing higher serum bile acid levels than carriers of the valine allele. Login to comment
79 In the same study, heterozygosity for the BSEP mutations p.E297G, p.D482G, and p.N591S formerly associated with benign and progressive forms of familial intrahepatic cholestasis type 2 were found in four, one, and two ICP patients, respectively, allowing the extrapolation that 1% of European ICP cases are caused by these mutations.105 Although the molecular and mechanistic basis for p.V444A and p.N591S were not apparent, in silico structural and functional analysis suggests that p.E297G and p.D482G destabilizes the protein fold of BSEP, leading to decreased taurocholate transport in case of p.E297G.105,106 In addition, decreased hepatic BSEP expression,107,108 and very recently, significantly reduced hepatic mRNA levels109 was reported in healthy human liver tissue carrying the alanine allele in position 444 of BSEP, which could predispose to the development of ICP by way of decreased canalicular availability of BSEP. Login to comment
128 In the same study, the BSEP p.V444A polymorphism was observed significantly more frequent in patients with drug-induced cholestasis than in patients with drug-induced hepatocellular injury and healthy controls, with the AA phenotype being encountered in 61% of cholestatic patients compared with 31% and 32% in patients with hepatocellular injury and healthy controls, respectively. Login to comment

[hide] The role of bile acid retention and a common polym... J Viral Hepat. 2010 Aug 15. Iwata R, Stieger B, Mertens JC, Muller T, Baur K, Frei P, Braun J, Vergopoulos A, Martin IV, Schmitt J, Goetze O, Bibert S, Bochud PY, Mullhaupt B, Berg T, Geier A
The role of bile acid retention and a common polymorphism in the ABCB11 gene as host factors affecting antiviral treatment response in chronic hepatitis C.
J Viral Hepat. 2010 Aug 15., 2010-08-15 [PMID:20723035]

Abstract [show]
Summary. The outcome of hepatitis C virus (HCV) infection and the likelihood of a sustained virological response (SVR) to antiviral therapy depends on both viral and host characteristics. In vitro studies demonstrated that bile acids (BA) interfere with antiviral interferon effects. We investigate the influence of plasma BA concentrations and an ABCB11 polymorphism associated with lower transporter expression on viral load and SVR. Four hundred and fifty-one Caucasian HCV-patients treated with PEG-interferon and ribavirin were included in the study. ABCB11 1331T>C was genotyped, and plasma BA levels were determined. The 1331C allele was slightly overrepresented in HCV-patients compared to controls. In HCV-patients, a significant difference between patients achieving SVR vs non-SVR was observed for HCV-2/3 (5 vs 9 mum; P = 0.0001), while median BA levels in HCV-1 were marginally elevated. Elevated BA levels >8 mum were significantly associated with SVR (58.3%vs 36.3%; OR 2.48; P = 0.0001). This difference was significant for HCV-2/3 (90.7%vs 67.6%; P = 0.002) but marginal in HCV-1 (38.7%vs 27.8%; P = 0.058). SVR rates were equivalent between ABCB11 genotypes for HCV-1, but increased for HCV-2/3 (TT 100%vs CC 78%; OR 2.01; P = 0.043). IL28B genotype had no influence on these associations. No correlation between BA levels and HCV RNA was detected for any HCV genotype. The higher allelic frequency of ABCB11 1331C in HCV-patients compared to controls may indirectly link increased BA to HCV chronicity. Our data support a role for BA as host factor affecting therapy response in HCV-2/3 patients, whereas a weaker association was found for HCV-1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
49 Genotyping of the single-nucleotide polymorphism (SNP) ABCB11 1331T>G (V444A, rs2287622) was performed with the TaqMan SNP genotyping assay C_16182459_10 (Applied Biosystems, Foster City, CA, USA). Login to comment

[hide] A common polymorphism in the ABCB11 gene is associ... Clin Sci (Lond). 2011 Apr;120(7):287-96. Iwata R, Baur K, Stieger B, Mertens JC, Daly AK, Frei P, Braun J, Vergopoulos A, Stickel F, Sabrane K, Martin IV, Schmitt J, Goetze O, Day CP, Mullhaupt B, Geier A
A common polymorphism in the ABCB11 gene is associated with advanced fibrosis in hepatitis C but not in non-alcoholic fatty liver disease.
Clin Sci (Lond). 2011 Apr;120(7):287-96., [PMID:20883210]

Abstract [show]
Chronic HCV (hepatitis C virus)-associated cirrhosis represents a major indication for liver transplantation. Bile acids contribute to hepatic stellate cell activation as a key event in fibrogenesis. The aim of the present study was to investigate the role of bile acids and polymorphisms in bile acid level-regulating genes on fibrosis progression. A total of 206 subjects with chronic HCV infection were included for ABCB11 (ATP-binding cassette, subfamily B, member II) 1331T>C and NR1H4 (nuclear receptor) -1G>T genotyping, 178 of which were analysed for fibrosis stage. Exclusion criteria were HBV (hepatitis B virus) or HIV coinfection, alcohol >40 g/day and morbid obesity. A total of 358 patients with NAFLD (non-alcoholic fatty liver disease) were genotyped for comparison with a non-viral liver disease. Caucasian individuals (n = 110), undergoing liver resection for focal hepatic metastasis, served as controls. The ABCB11 1331C allele was significantly overrepresented in HCV patients compared with controls {allelic frequency 62.9%; OR (odds ratio), 1.41 [95% CI (confidence interval), 1.012-1.965]}. Median plasma bile acid levels were not significantly increased in the CC compared with TT genotype [7.2 (1-110) mumol/l compared with 3.5 (1-61) mumol/l; values are medians (range). A significant association between the presence of cirrhosis and ABCB11 genotype (CC compared with CT or TT, P=0.047) was observed in the chi2 test and independent of other risk factors of age, gender, body mass index and disease duration in multivariate analysis (P = 0.010). No such association could be observed in fatty liver patients with regard to advanced fibrosis (F >/= 2). The common ABCB11 1331CC genotype, which is present in 40% of HCV patients and renders the carrier susceptible to increased bile acid levels, is associated with cirrhosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 In these cohorts, genotyping of the SNP ABCB11 1331T>C (V444A, rs2287622) was performed with the TaqMan SNP genotyping assay C_16182459_10, genotyping of the SNP NR1H4 - 1G>T with a custom-made TaqMan SNP genotyping assay SNP-FXR3-FXR3 [18] (Applied Biosystems). Login to comment
132 The common ABCB11 1331T>C (V444A) polymorphism in the BSEP gene, which is encountered in about half of the Caucasian population, has been linked to increased serum bile acid levels in patients with cholestasis of pregnancy [13]. Login to comment

[hide] The role of the sodium-taurocholate cotransporting... Handb Exp Pharmacol. 2011;(201):205-59. Stieger B
The role of the sodium-taurocholate cotransporting polypeptide (NTCP) and of the bile salt export pump (BSEP) in physiology and pathophysiology of bile formation.
Handb Exp Pharmacol. 2011;(201):205-59., [PMID:21103971]

Abstract [show]
Bile formation is an important function of the liver. Bile salts are a major constituent of bile and are secreted by hepatocytes into bile and delivered into the small intestine, where they assist in fat digestion. In the small intestine, bile salts are almost quantitatively reclaimed and transported back via the portal circulation to the liver. In the liver, hepatocytes take up bile salts and secrete them again into bile for ongoing enterohepatic circulation. Uptake of bile salts into hepatocytes occurs largely in a sodium-dependent manner by the sodium taurocholate cotransporting polypeptide NTCP. The transport properties of NTCP have been extensively characterized. It is an electrogenic member of the solute carrier family of transporters (SLC10A1) and transports predominantly bile salts and sulfated compounds, but is also able to mediate transport of additional substrates, such as thyroid hormones, drugs and toxins. It is highly regulated under physiologic and pathophysiologic conditions. Regulation of NTCP copes with changes of bile salt load to hepatocytes and prevents entry of cytotoxic bile salts during liver disease. Canalicular export of bile salts is mediated by the ATP-binding cassette transporter bile salt export pump BSEP (ABCB11). BSEP constitutes the rate limiting step of hepatocellular bile salt transport and drives enterohepatic circulation of bile salts. It is extensively regulated to keep intracellular bile salt levels low under normal and pathophysiologic situations. Mutations in the BSEP gene lead to severe progressive familial intrahepatic cholestasis. The substrates of BSEP are practically restricted to bile salts and their metabolites. It is, however, subject to inhibition by endogenous metabolites or by drugs. A sustained inhibition will lead to acquired cholestasis, which can end in liver injury.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
439 To date, c.1331T>C (p.V444A) in exon 13 and c.2029A>G (p.M677V) in exon 17 of the BSEP gene are two nonsynonymous SNPs, which consistently have been found with frequencies higher than 0.5% (Lang et al. 2006; Pauli-Magnus et al. 2004a; Saito et al. 2002a; Stieger 2009; Stieger et al. 2007) in different, unrelated cohorts. Login to comment
451 Clearly, although the association of a common BSEP variant with increased risk for acquired BSEP deficiency syndromes seems now well established, independent studies with large cohorts are needed to firmly establish the p.V444A polymorphism as a risk factor. Login to comment

[hide] Living-related liver transplantation for siblings ... Am J Transplant. 2011 Feb;11(2):394-8. doi: 10.1111/j.1600-6143.2010.03397.x. Epub 2011 Jan 10. Shimizu H, Migita O, Kosaki R, Kasahara M, Fukuda A, Sakamoto S, Shigeta T, Uemoto S, Nakazawa A, Kakiuchi T, Arai K
Living-related liver transplantation for siblings with progressive familial intrahepatic cholestasis 2, with novel genetic findings.
Am J Transplant. 2011 Feb;11(2):394-8. doi: 10.1111/j.1600-6143.2010.03397.x. Epub 2011 Jan 10., [PMID:21219577]

Abstract [show]
Progressive familial intrahepatic cholestasis is a syndrome of severe cholestasis progressing to biliary cirrhosis and liver failure that develops in childhood. This report describes two siblings with PFIC-2 who underwent living-related liver transplantation from their genetically proven heterozygous parents. Both patients had normal gamma-glutamyl transpeptidase levels, but showed severe pruritus with sleep disturbance, cholestasis, jaundice and growth failure. Genetic testing of each patient revealed two missense mutations of the bile salt export pump, S901R and C1083Y, which have not previously been associated with PFIC-2. Usual medical treatment failed to improve their clinical symptoms, and the two siblings underwent living-related liver transplantation from their heterozygous parents. The transplants improved their clinical symptoms significantly, and the patients have since shown age-appropriate growth. Electron microscopic findings of the explanted liver of the younger sister revealed dense and amorphous bile, which is characteristic of PFIC-2. In the cases presented here, living-related liver transplantation from a heterozygous donor was associated with better quality of life and improvement of growth, and thus appears to be a feasible option for PFIC-2 patients. Mutation analysis is a useful tool to help decide the course of treatment of PFIC.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Results Mutation screening in ABCB11 identified three missense changes in the proband (II-2): V444A, S901R and C1083Y. Login to comment
72 Variant V444A was described earlier in a population-based sample (10). Login to comment

[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]

Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6485 Three highly conserved mutants/variants (V444A, D676Y, G855R) strongly associate with susceptibility to drug-induced cholestasis (Table 14) (Lang et al., 2007). Login to comment
6486 Likewise, the V444A polymorphism is a risk factor for intrahepatic cholestasis of pregnancy in European patients as well as patients with contraceptive-induced cholestasis (Keitel et al., 2006; Dixon et al., 2008; Meier et al., 2008). Login to comment
6508 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/ Localization ABCB11 BSEP N.D. G238V N.D. Intracellular A890G E297G 2 Intracellular N.D. C336S ↔ Normal G1296C R432T 2 Reduced T1331C V444A ↔ Normal/Reduced A1445G D482G 2 Normal/Reduced G2026T D676Y 2 Reduced G2563A G855R 2 Reduced G2944A G982R 2 Intracellular C3457T R1153C 2 Intracellular G3803A R1268Q 2 Intracellular searchers were able to identify functional roles for Mrp2 using rats lacking this transporter (Eisai hyperbilirubinemic rats on a Sprague-Dawley background and transport-deficient (TR-) on a Wistar background) (Paulusma et al., 1996; Ito et al., 1997). Login to comment

[hide] Liver diseases unique to pregnancy: a 2010 update. Clin Res Hepatol Gastroenterol. 2011 Mar;35(3):182-93. Bacq Y
Liver diseases unique to pregnancy: a 2010 update.
Clin Res Hepatol Gastroenterol. 2011 Mar;35(3):182-93., [PMID:21310683]

Abstract [show]
Liver disorders occurring during pregnancy may be specifically pregnancy-related, or may be due to an intercurrent or chronic liver disease, which may present in anyone, pregnant or not. This review focuses on the liver diseases unique to pregnancy. Hyperemesis gravidarum, which occurs during early pregnancy, may be associated with liver dysfunction. Intrahepatic cholestasis of pregnancy typically occurs during the second or third trimester. Pruritus and the associated biological signs of cholestasis improve rapidly after delivery. Mutations in gene encoding biliary transporters, especially ABCB4 encoding the multidrug resistance 3 protein, have been found to be associated with this complex disease. Ursodeoxycholic acid is currently the most effective medical treatment in improving pruritus and liver tests. Pre-eclampsia, which presents in late pregnancy frequently involves the liver, and HELLP syndrome (Hemolysis-Elevated Liver enzymes-Low Platelets) is a life-threatening complication. Prognosis of acute fatty liver of pregnancy has been radically transformed by early delivery, and clinicians must have a high index of suspicion for this condition when a woman presents nausea or vomiting, epigastric pain, jaundice, or polyuria-polydipsia during the third trimester. Acute fatty liver of pregnancy has been found to be associated with a defect of long-chain 3-hydroxyacyl coenzyme A dehydrogenase in the fetus, and mothers and their offspring should undergo DNA testing at least for the main associated genetic mutation (c.1528G>C).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
141 However, one particular polymorphism in ABCB11 (c.1331C > T, p.Val444Ala) has been identified as a risk factor for ICP, suggesting a role of this gene in the pathogenesis of ICP [72]. Login to comment

[hide] Familial cholestasis: progressive familial intrahe... Best Pract Res Clin Gastroenterol. 2010 Oct;24(5):541-53. van der Woerd WL, van Mil SW, Stapelbroek JM, Klomp LW, van de Graaf SF, Houwen RH
Familial cholestasis: progressive familial intrahepatic cholestasis, benign recurrent intrahepatic cholestasis and intrahepatic cholestasis of pregnancy.
Best Pract Res Clin Gastroenterol. 2010 Oct;24(5):541-53., [PMID:20955958]

Abstract [show]
Progressive familial intrahepatic cholestasis (PFIC) type 1, 2 and 3 are due to mutations in ATP8B1, ABCB11 and ABCB4, respectively. Each of these genes encodes a hepatocanalicular transporter, which is essential for the proper formation of bile. Mutations in ABCB4 can result in progressive cholestatic disease, while mutations in ATP8B1 and ABCB11 can result both in episodic cholestasis, referred to as benign recurrent intrahepatic cholestasis (BRIC) type 1 and 2, as well as in progressive cholestatic disease. This suggests a clinical continuum and these diseases are therefore preferably referred to as ATP8B1 deficiency and ABCB11 deficiency. Similarly PFIC type 3 is designated as ABCB4 deficiency. Heterozygous mutations in each of these transporters can also be associated with intrahepatic cholestasis of pregnancy. This review summarizes the pathophysiology, clinical features and current as well as future therapeutic options for progressive familial- and benign recurrent intrahepatic cholestasis as well as intrahepatic cholestasis of pregnancy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
182 In addition, the common BSEP polymorphism V444A also is a risk factor. Login to comment

[hide] Hepatobiliary phospholipid transporter ABCB4, MDR3... Dig Liver Dis. 2008 May;40(5):366-70. Epub 2007 Dec 20. Floreani A, Carderi I, Paternoster D, Soardo G, Azzaroli F, Esposito W, Montagnani M, Marchesoni D, Variola A, Rosa Rizzotto E, Braghin C, Mazzella G
Hepatobiliary phospholipid transporter ABCB4, MDR3 gene variants in a large cohort of Italian women with intrahepatic cholestasis of pregnancy.
Dig Liver Dis. 2008 May;40(5):366-70. Epub 2007 Dec 20., [PMID:18083082]

Abstract [show]
BACKGROUND: Intrahepatic cholestasis of pregnancy is a multifactorial disorder of pregnancy associated with a genetic background. AIM: To evaluate the genetic contribution of ABCB4, MDR3 gene in the development of intrahepatic cholestasis of pregnancy in a large cohort of Italian subjects. METHODS: This study represents an extension of a previous multicentre-prospective study including three Italian referral centres. In all, we enrolled 96 women at the 3rd trimester of pregnancy. Genomic DNA was extracted from peripheral venous blood leucocytes by standard procedures. Polymerase chain reaction was used to amplify exon 14, 15 and 16 of MDR3 gene. RESULTS: We found 3 non-synonymous heterozygous mutations in exon 14 (E528D, R549H, G536A), 1 in exon 15 (R590Q) and 2 in exon 16 (R652G, T6671). MDR3 gene variants in exons 14, 15 and 16 occurred in 7/96 of pregnant mothers with intrahepatic cholestasis of pregnancy (7.2%), and in none of 96 pregnant controls matched for age and parity. All seven patients had normal gamma-glutamyl transpeptidase, normal bilirubin, but high levels of both alanine transferase and serum bile acids. One had cholesterol biliary lithiasis. The outcome of pregnancy was normal in four cases (with vaginal delivery), while there was one fetal distress. CONCLUSIONS: MDR3 mutations are responsible for the development of intrahepatic cholestasis of pregnancy in only a small percentage of Italian women. Further genetic studies are warranted, however, to clarify the role of different mutations in intrahepatic cholestasis of pregnancy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
91 The patient was also homozygous for the common BSEP polymorphism V444A. Login to comment
92 The patient was also homozygous for the common BSEP polymorphism V444A. Login to comment

[hide] Combined mutations of canalicular transporter prot... Gastroenterology. 2006 Aug;131(2):624-9. Keitel V, Vogt C, Haussinger D, Kubitz R
Combined mutations of canalicular transporter proteins cause severe intrahepatic cholestasis of pregnancy.
Gastroenterology. 2006 Aug;131(2):624-9., [PMID:16890614]

Abstract [show]
Intrahepatic cholestasis of pregnancy (ICP) is a cholestatic disorder that usually develops in the third trimester of pregnancy and persists until delivery. The cause of ICP remains elusive, but there is evidence that mutations in the canalicular ABC transporter phospholipid flippase (MDR3) and in the bile salt export pump (BSEP) can predispose for the development of ICP. MDR3 and BSEP were investigated by gene sequencing and immunofluorescence microscopy in a patient with severe ICP of early onset. ICP was diagnosed in a patient in the first trimester of pregnancy with severe pruritus, elevated levels of bile salts, and 48-fold elevation of transaminase levels. A liver biopsy specimen showed diminished canalicular expression of the bile salt export pump BSEP, while the expression and localization of the phospholipid flippase MDR3 was normal. Gene sequencing revealed a homozygous MDR3 gene mutation (S320F). The patient was also homozygous for the common BSEP polymorphism V444A. Treatment with ursodeoxycholate normalized transaminase levels but could not prevent further elevation of bile salt levels and preterm delivery. The combined homozygous alterations of the canalicular transporters may explain the early onset and severity of ICP in this patient. The common BSEP polymorphism V444A accounts for the reduced canalicular BSEP expression. Reduced bile salt secretion through BSEP may explain the persistence of elevated bile salt levels and incomplete efficacy of ursodeoxycholate treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 The patient was also homozygous for the common BSEP polymorphism V444A. Login to comment
9 The common BSEP polymorphism V444A accounts for the reduced canalicular BSEP expression. Login to comment
32 A single nucleotide exchange from cytidine to thymidine at position 959 in exon 9 of MDR3 (959C¡T) led to a change from serine to phenylalanine (S320F) (Figure 2A), which has been described to be ICP specific.6 The second homozygous polymorphism was detected in the BSEP gene at the complementary DNA position 1331 with a thymidine replaced by a cytidine (1331T¡C), leading to an exchange of valine to alanine (V444A) (Figure 2B). Login to comment
36 The mother was heterozygous for the BSEP polymorphism V444A, while the aunt was homozygous for V444A (Figure 2). Login to comment
63 The mutations found in this patient are within the fifth transmembrane domain (MDR3, S320F) and in the nucleotide binding fold (BSEP, V444A). Login to comment
65 1331 of the BSEP complementary DNA results in an exchange from valine to alanine (V444A). Login to comment
66 This exchange is detected in 51.3% of alleles of healthy women, while it was found in 83.3% of alleles of patients with ICP.6 This difference in allele frequency was not statistically significant; however, the association of V444A with ICP suggests that this mutation may become disease relevant under certain conditions such as pregnancy. Login to comment
67 The patient described in this report was homozygous for V444A. Login to comment
68 The reduced amount of canalicular BSEP implies that homozygous V444A has a major impact on bile formation despite its frequent occurrence in the healthy population. Login to comment
70 We have recently described a 16-year-old male pa- tient8 with BRIC-2.13 He was compound heterozygous for the BSEP mutations E186G and V444A. Login to comment
71 This patient also had reduced canalicular BSEP expression, emphasizing the association between the common variant V444A and a decrease in canalicular BSEP. Login to comment
73 However, in the patient with BRIC-2 described previ- ously8 with the E186G/V444A genotype, the amount of BSEP messenger RNA was normal despite reduced canalicular BSEP expression. Login to comment
75 These possibilities include impaired protein maturation leading to increased ER-associated degradation as shown for some frequent BSEP mutations underlying PFIC-2.14 Furthermore, an increased retention of BSEP within the secretory pathway15 or reduced accessibility of BSEP from intracellular pools16 may be the result of the V444A polymorphism. Login to comment
79 In addition to changes in protein localization, V444A may alter transport activity as described recently for 2 BRIC-associated BSEP mutations (R432T and E297G).19 Another possibility of reduced transporter activity includes an increased susceptibility of V444A toward the inhibitory effect of estrogens.20 Homozygous V444A can be expected in 25% of the population, but homozygous V444A alone cannot explain the severity of ICP in our patient. Login to comment
83 It may be speculated that reduced activity of mutated MDR3 induces changes in the lipid composition of the canalicular membrane, which consecutively causes altered BSEP expression when the V444A polymorphism is present. Login to comment
97 Homozygosity for both the S320F MDR3 mutation and the V444A BSEP mutation may account for the severity and early onset of ICP in our patient. Login to comment
99 Our findings show that the common BSEP polymorphism V444A becomes disease relevant when precipitating factors occur. Login to comment

[hide] Polymorphisms in drug transporter genes (ABCB1, SL... Tuberculosis (Edinb). 2012 Jan;92(1):100-4. Epub 2011 Dec 16. Kim SH, Kim SH, Lee JH, Lee BH, Kim YS, Park JS, Jee YK
Polymorphisms in drug transporter genes (ABCB1, SLCO1B1 and ABCC2) and hepatitis induced by antituberculosis drugs.
Tuberculosis (Edinb). 2012 Jan;92(1):100-4. Epub 2011 Dec 16., [PMID:22178260]

Abstract [show]
Unusual drug accumulation is a common mechanism underlying serious drug-induced liver injury. Polymorphisms in three drug transporter genes (ABCB1, SLCO1B1 and ABCC2) may be risk markers for hepatitis induced by the unusual accumulation of anti-tuberculosis drugs (ATDs). We therefore investigated whether polymorphisms and haplotypes of these genes are associated with ATD-induced hepatitis by comparing the frequencies and distributions of single nucleotide polymorphisms and haplotypes of these three drug transporter genes among 67 patients with ATD-induced hepatitis and 159 patients tolerant to ATDs using a multivariate logistic regression analysis. We found that the frequencies of polymorphisms and haplotypes of ABCB1, SLCO1B1 and ABCC2 were similar in patients with ATD-induced hepatitis and ATD-tolerant controls. The present results suggest that these drug transporters do not play important roles in the pathogenesis of ATD-induced hepatitis in Korean patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 Previous studies revealed that hepatocellular-type hepatitis was associated with ABCC2 À24C > T polymorphism, whereas cholestatic-type was associated with the ABCB11 V444A and ABCC2 À1774delG variation.13,15,24 In this study, we focused on just ATD-induced hepatitis, instead of various DILIs, and the DILI patterns were hepatocellular in all cases. Login to comment

[hide] Functional hot spots in human ATP-binding cassette... Protein Sci. 2010 Nov;19(11):2110-21. Kelly L, Fukushima H, Karchin R, Gow JM, Chinn LW, Pieper U, Segal MR, Kroetz DL, Sali A
Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains.
Protein Sci. 2010 Nov;19(11):2110-21., [PMID:20799350]

Abstract [show]
The human ATP-binding cassette (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP binding and hydrolysis to the transport of diverse substrates across cellular membranes. Defects in 18 transporters have been implicated in human disease. In hundreds of cases, disease phenotypes and defects in function can be traced to nonsynonymous single nucleotide polymorphisms (nsSNPs). The functional impact of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine experimental mutational studies with sequence and structural analysis to describe the impact of nsSNPs in human ABC transporters. First, the disease associations of 39 nsSNPs in 10 transporters were rationalized by identifying two conserved loops and a small alpha-helical region that may be involved in interdomain communication necessary for transport of substrates. Second, an approach to discriminate between disease-associated and neutral nsSNPs was developed and tailored to this superfamily. Finally, the functional impact of 40 unannotated nsSNPs in seven ABC transporters identified in 247 ethnically diverse individuals studied by the Pharmacogenetics of Membrane Transporters consortium was predicted. Three predictions were experimentally tested using human embryonic kidney epithelial (HEK) 293 cells stably transfected with the reference multidrug resistance transporter 4 and its variants to examine functional differences in transport of the antiviral drug, tenofovir. The experimental results confirmed two predictions. Our analysis provides a structural and evolutionary framework for rationalizing and predicting the functional effects of nsSNPs in this clinically important membrane transporter superfamily.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 Predictions of the Functional Effects of 40 nsSNPs in ABC Transporters Comon name HUGO name Mutation NBD Prediction BSEP ABCB11 E592Q NBD1 Neutral BSEP ABCB11 N591S NBD1 Neutral BSEP ABCB11 Q558H NBD1 Neutral BSEP ABCB11 V444A NBD1 Neutral BSEP ABCB11 E1186K NBD2 Disease MDR1 ABCB1 P1051A NBD2 Neutral MDR1 ABCB1 S1141T NBD2 Neutral MDR1 ABCB1 T1256K NBD2 Disease MDR1 ABCB1 V1251I NBD2 Neutral MDR1 ABCB1 W1108R NBD2 Disease MRP2 ABCC2 I670T NBD1 Disease MRP2 ABCC2 L849R NBD1 Disease MRP2 ABCC2 C1515Y NBD2 Disease MRP3 ABCC3 D770N NBD1 Neutral MRP3 ABCC3 K718M NBD1 Neutral MRP3 ABCC3 T809M NBD1 Disease MRP3 ABCC3 V765L NBD1 Disease MRP3 ABCC3 Q1365R NBD2 Disease MRP3 ABCC3 R1297H NBD2 Disease MRP3 ABCC3 R1348C NBD2 Disease MRP3 ABCC3 R1381S NBD2 Disease MRP4 ABCC4 G487E NBD1 Disease MRP4 ABCC4 K498E NBD1 Neutral MRP4 ABCC4 R1220Q NBD2 Neutral MRP4 ABCC4 T1142M NBD2 Neutral MRP4 ABCC4 V1071I NBD2 Neutral MRP6 ABCC6 I1330L NBD1 Neutral MRP6 ABCC6 I742V NBD1 Neutral MRP6 ABCC6 P664S NBD1 Neutral MRP6 ABCC6 R724K NBD1 Neutral MRP6 ABCC6 R769K NBD1 Neutral MRP6 ABCC6 A1291T NBD2 Neutral MRP6 ABCC6 E1369K NBD2 Neutral MRP6 ABCC6 G1327E NBD2 Disease MRP6 ABCC6 L1416R NBD2 Disease MRP6 ABCC6 R1268Q NBD2 Disease MRP6 ABCC6 R1461H NBD2 Disease MXR ABCG2 I206L NBD1 Neutral MXR ABCG2 P269S NBD1 Disease MXR ABCG2 Q141K NBD1 Neutral nsSNPs. Login to comment

[hide] ABCB4 and ABCB11 mutations in intrahepatic cholest... Dig Liver Dis. 2013 Mar;45(3):226-32. doi: 10.1016/j.dld.2012.08.011. Epub 2012 Sep 27. Anzivino C, Odoardi MR, Meschiari E, Baldelli E, Facchinetti F, Neri I, Ruggiero G, Zampino R, Bertolotti M, Loria P, Carulli L
ABCB4 and ABCB11 mutations in intrahepatic cholestasis of pregnancy in an Italian population.
Dig Liver Dis. 2013 Mar;45(3):226-32. doi: 10.1016/j.dld.2012.08.011. Epub 2012 Sep 27., [PMID:23022423]

Abstract [show]
BACKGROUND: Genetic alterations in the ATP-binding cassette subfamily B member 4 (ABCB4) and ATP-binding cassette subfamily B member 11 (ABCB11) have been associated to the onset of intrahepatic cholestasis of pregnancy (ICP) in predisposed women. AIMS: To identify new and/or frequent ABCB4 and ABCB11 genes variants in a cohort of Italian patients with ICP and to evaluate the possible pathogenetic role for the novel mutations identified. METHODS: DNA of 33 unrelated Italian women with obstetric cholestasis were screened for mutations in the entire coding sequence of ABCB4 and ABCB11 genes. Polymerase chain reaction and automated sequencing was performed on the 27 coding exons of both genes. RESULTS: Genotyping revealed 11 mutations, 5 of whom were novel variants: 2 localized on ABCB4 (p.I587DfsX603, p.I738LfsX744) and 3 on ABCB11 (p.V284D, p.Q558H, p.P731S). The most severe phenotypes were associated with the variants p.I587DfsX603, p.I738LfsX744 and p.V284D. Moreover, the already described mutation p.N510S found in ABCB4 seems to be strictly involved in the onset of ICP in that particular patient. CONCLUSIONS: Our data support the hypothesis of a significant involvement of ABCB4 mutations in the onset of ICP, but also confirm an important role for ABCB11 mutations in increasing the susceptibility to cholestasis of pregnancy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
137 Moreover, the remarkable increase in patient`s serum bile acids could be explained considering that a decrease in the flippase activity of MDR3 might induce a modification in the lipid composition of the canalicular membrane, consequently altering BSEP function; besides, the presence of the p.V444A polymorphism in one allele of the ABCB11 gene might play an additional role. Login to comment
138 The missense variant p.N510S was found for the first time in a patients with ICP in this study. Login to comment
150 Our study also takes into consideration a possible involvement of some polymorphisms in the development of ICP: variants p.V444A (c.1331 T > C) and p.A1028A (c.3084 A > G) in ABCB11 and variant p.N168N (c.504 C > T) in ABCB4 are frequently present in our patients (88%, 76% and 79%, respectively). Login to comment
151 Variant p.V444A is localised in a functional domain (nucleotide binding domain 1) of the protein and it was correlated, in previous reports in the literature, with a considerable number of possible BSEP alterations [30]. Login to comment
156 Anyway, considering the V444A polymorphism, we cannot exclude it could represent a susceptibility factor for ICP, as it was associated with 9 of the 11 mutations identified and it was found in 30 of the 33 ICP patients screened, 22 of whom did not present any mutation on ABCB4 or ABCB11. Login to comment
163 However, the absence of any disease-causing mutation in 22/33 patients, apart from the presence of the p.V444A and p.R652G polymorphisms (data not shown), suggest that other genes or other factors (comorbility) may play a role in the aetiology of ICP. Login to comment
152 Variant p.V444A is localised in a functional domain (nucleotide binding domain 1) of the protein and it was correlated, in previous reports in the literature, with a considerable number of possible BSEP alterations [30]. Login to comment
157 Anyway, considering the V444A polymorphism, we cannot exclude it could represent a susceptibility factor for ICP, as it was associated with 9 of the 11 mutations identified and it was found in 30 of the 33 ICP patients screened, 22 of whom did not present any mutation on ABCB4 or ABCB11. Login to comment
164 However, the absence of any disease-causing mutation in 22/33 patients, apart from the presence of the p.V444A and p.R652G polymorphisms (data not shown), suggest that other genes or other factors (comorbility) may play a role in the aetiology of ICP. Login to comment

[hide] NR1H4 analysis in patients with progressive famili... Clin Res Hepatol Gastroenterol. 2012 Dec;36(6):569-73. doi: 10.1016/j.clinre.2012.08.008. Epub 2012 Nov 9. Davit-Spraul A, Gonzales E, Jacquemin E
NR1H4 analysis in patients with progressive familial intrahepatic cholestasis, drug-induced cholestasis or intrahepatic cholestasis of pregnancy unrelated to ATP8B1, ABCB11 and ABCB4 mutations.
Clin Res Hepatol Gastroenterol. 2012 Dec;36(6):569-73. doi: 10.1016/j.clinre.2012.08.008. Epub 2012 Nov 9., [PMID:23142591]

Abstract [show]
Farnesoid X receptor (FXR, NR1H4) controls bile acid homeostasis. NR1H4 variants may predispose to intrahepatic cholestasis of pregnancy (ICP). We report on NR1H4 analysis in eight patients with progressive familial intrahepatic cholestasis (PFIC) and in eight women with either ICP and/or drug-induced cholestasis (DIC) in whom no disease causing mutation in ATP8B1, ABCB11 and/or ABCB4 were found. No NR1H4 mutation was found in PFIC patients. In one woman with ICP/DIC, a NR1H4 heterozygous variant (c.-1G>T) was found. This suggests that a NR1H4 mutation is not or rarely involved in hepatocellular cholestasis of unknown cause.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
55 Table 1 Main clinical characteristics and ATP8B1, ABCB11 and NR1H4 genotypes in eight normal GGT PFIC patients of unknown cause. Patient Phenotype ATP8B1 genotype ABCB11 genotype NR1H4 genotype Liver histology and canalicular immunostaining Patient 1 Severe permanent cholestasis since age 5 mo, Serum BS = 208 òe;mol/L, deafness, UDCA and BD not tested, LT at 4.5 yr, alive at 25 yr No mutation p.V444A Heterozygous No mutation Hepatocellular cholestasis, septal fibrosis BSEP+ MDR3+ Patient 2 Severe permanent cholestasis since age 1 mo, Serum BS = 161 òe;mol/L, Biliary BS = 5.7 mmol/L, Success of UDCA but persistent pruritus Alive at 5 yr p.R952Q Heterozygous p.V444A, p.M677V Heterozygous No mutation Hepatocellular cholestasis, septal fibrosis BSEP+ MDR3+ Patient 3 Severe recurrent cholestasis since age 7 mo, Serum BS = 375 òe;mol/L, Biliary BS = 0.39 mmol/L, Success of UDCA, then of BD at 7.5 yr, Chronic diarrhea, and liver steatosis post BD, Alive at 19 yr p.R952Q Heterozygous No mutation No mutation Hepatocellular cholestasis, septal fibrosis BSEP+ MDR3+ Patient 4 Severe permanent cholestasis since age 1 mo, Serum BS = 291 òe;mol/L, UDCA failure, BD not tested, LT at 3.2 yr, died post-LT p.R952Q Heterozygous p.V444A Heterozygous No mutation Hepatocellular cholestasis, septal fibrosis BSEP+ MDR3+ Patient 5 Severe cholestasis since age 3 mo, Serum BS = 262 òe;mol/L, UDCA failure, BD success at 4.7 yr, Alive at 14 yr p.R952Q Heterozygous p.V444A Heterozygous No mutation Hepatocellular cholestasis, septal fibrosis BSEP+ MDR3+ Patient 6 Severe permanent cholestasis since age 1 mo, Serum BS = 191 òe;mol/L, biliary BS = 0.09 mmol/L, TC = 7 mmol/L, TG = 4.5 mmol/L, UDCA and BD failure, LT at 6 yr, died post-LT No mutation No mutation No mutation Hepatocellular cholestasis, septal fibrosis BSEP+ MDR3+ Patient 7 Cholestasis since age 2.5 yr, Serum BS = 42 òe;mol/L, Success of UDCA, Alive at 20 yr No mutation p.M677V, p.G319G Homozygous p.V444A Heterozygous No mutation Hepatocellular cholestasis, septal fibrosis BSEP+ MDR3+ Patient 8 Severe cholestasis since age 1 week, Serum BS = 240 òe;mol/L, UDCA and BD not tested, Liver failure and LT at age 5 mo, Alive at 21 yr No mutation p.V444A Heterozygous No mutation Hepatocellular cholestasis, septal fibrosis Giant cells BSEP-, MDR3+ GGT: gammaglutamyl transferase; PFIC: progressive familial intrahepatic cholestasis; BS: bile salt concentration; UDCA: ursodeoxycholic acid; BD: biliary diversion; LT: liver transplantation; mo: month; yr: year; BSEP+: normal immunostaining; BSEP-: negative immunostaining; MDR3+: normal immunostaining; TC: serum fasting total cholesterol; TG: serum fasting triglycerides. Login to comment
59 Table 2 Main clinical characteristics and ATP8B1, ABCB11, ABCB4 and NR1H4 genotypes in eight patients with normal or elevated GGT ICP or DIC of unknown cause. Patient Phenotype ATP8B1 genotype ABCB11 genotype ABCB4 genotype NR1H4 genotype Patient 9 DIC (OP): P, I, ALT = 3ULN, GGT = N. Normalisation after OP withdrawal Sister: cytolysis and P under OP, ICP Grand mother: cholecystitis No mutation No mutation No mutation No mutation Patient 10 ICP: P, I, discoloured stools, GGT = N, ALT = 18ULN, Ultrasonography: biliary sludge No mutation p.V444A Homozygous No mutation No mutation Patient 11 ICP: P, GGT = N, serum BS 270 òe;M, in utero fetal death No mutation p.V444A Homozygous No mutation No mutation Patient 12 ICP: P, GGT = N, ALT = N Mother: ICP No mutation p.V444A Homozygous No mutation No mutation Patient 13 DIC (OP): I, P, biliary lithiasis with recurrence after cholecystectomy GGT = 14ULN, ALT = 20ULN Not done p.V444A Heterozygous No mutation No mutation Patient 14 ICP: P, GGT = N Daughter: NC (ductular paucity) elevated GGT Mother: chronic cholestasis, P, elevated GGT No mutation No mutation No mutation No mutation Patient 15 ICP: P, elevated GGT Not done Not done No mutation No mutation Patient 16 ICP: P, GGT = 4ULN, DIC (PTU): P, GGT = 8ULN, ALT = 33ULN, GL = 7.8 mmol/L, CT = 7.3 mmol/L, TG = 1.64 mmol/L Not done Not done No mutation c-1G > T Heterozygous ICP: intrahepatic cholestasis of pregnancy; DIC: drug-induced cholestasis; OP: oestroprogestatif; PTU: propylthiouracil; NC: neonatal cholestasis; GGT: serum gammaglutamyl transferase; N: normal; ULN: fold the upper limit of normal; BS: bile salt concentration; ALT: serum alanine aminotransferase; TC: serum fasting total cholesterol; TG: serum fasting triglycerides; Glc: fasting glycemia; P: pruritus; I: icterus. Login to comment
60 Normalisation after OP withdrawal Sister: cytolysis and P under OP, ICP Grand mother: cholecystitis No mutation No mutation No mutation No mutation Patient 10 ICP: P, I, discoloured stools, GGT = N, ALT = 18ULN, Ultrasonography: biliary sludge No mutation p.V444A Homozygous No mutation No mutation Patient 11 ICP: P, GGT = N, serum BS 270 òe;M, in utero fetal death No mutation p.V444A Homozygous No mutation No mutation Patient 12 ICP: P, GGT = N, ALT = N Mother: ICP No mutation p.V444A Homozygous No mutation No mutation Patient 13 DIC (OP): I, P, biliary lithiasis with recurrence after cholecystectomy GGT = 14ULN, ALT = 20ULN Not done p.V444A Heterozygous No mutation No mutation Patient 14 ICP: P, GGT = N Daughter: NC (ductular paucity) elevated GGT Mother: chronic cholestasis, P, elevated GGT No mutation No mutation No mutation No mutation Patient 15 ICP: P, elevated GGT Not done Not done No mutation No mutation Patient 16 ICP: P, GGT = 4ULN, DIC (PTU): P, GGT = 8ULN, ALT = 33ULN, GL = 7.8 mmol/L, CT = 7.3 mmol/L, TG = 1.64 mmol/L Not done Not done No mutation c-1G > T Heterozygous ICP: intrahepatic cholestasis of pregnancy; DIC: drug-induced cholestasis; OP: oestroprogestatif; PTU: propylthiouracil; NC: neonatal cholestasis; GGT: serum gammaglutamyl transferase; N: normal; ULN: fold the upper limit of normal; BS: bile salt concentration; ALT: serum alanine aminotransferase; TC: serum fasting total cholesterol; TG: serum fasting triglycerides; Glc: fasting glycemia; P: pruritus; I: icterus. Login to comment

[hide] Prevalence of low phospholipid-associated cholelit... Dig Liver Dis. 2013 Nov;45(11):915-9. doi: 10.1016/j.dld.2013.04.002. Epub 2013 May 16. Condat B, Zanditenas D, Barbu V, Hauuy MP, Parfait B, El Naggar A, Collot V, Bonnet J, Ngo Y, Maftouh A, Dugue L, Balian C, Charlier A, Blazquez M, Rosmorduc O
Prevalence of low phospholipid-associated cholelithiasis in young female patients.
Dig Liver Dis. 2013 Nov;45(11):915-9. doi: 10.1016/j.dld.2013.04.002. Epub 2013 May 16., [PMID:23684896]

Abstract [show]
BACKGROUND AND AIMS: We evaluated the prevalence of low phospholipid-associated cholelithiasis, a specific form of cholelithiasis associated with at least 2 of the 3 following criteria: first symptoms before the age of 40; intrahepatic comet tail artefacts, sludge or microlithiasis on ultrasound imaging; and recurrence of symptoms after cholecystectomy. METHODS: We prospectively studied the cases of 60 consecutive female patients under 30 with symptomatic cholelithiasis. RESULTS: A diagnosis of low phospholipid-associated cholelithiasis was made in 14/60 patients (23%). The molecular analysis showed ABCB4 (n=4) and ABCB11 (n=4) gene mutations. Low phospholipid-associated cholelithiasis was frequently observed in non-overweight patients [13/27 (48%)], was present in most patients whose biliary symptoms occurred before the age of 18 [7/10 (70%)] and was often associated with cholangitis or acute pancreatitis [9/14 (64%), p<0.05] while "common" cholelithiasis was mainly associated with cholecystitis [16/46 (35%), p<0.05]. CONCLUSION: Nearly one quarter of the female patients under the age of 30 admitted for symptomatic cholelithiasis had low phospholipid-associated cholelithiasis; particularly if body weight was normal, the symptoms began before the age of 18 or in the presence of severe biliary complications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
62 Molecular analysis of the ABCB11 gene also showed variants in 4 patients (29%): a homozygous known polymorphic mutation (NP 003733: p.Val444Ala) in three cases and a heterozygous point mutation (NP 003733: p.Val43Ile) reported as a tolerated variant by protein prediction software in one case. Login to comment
101 [18] 1 Exon 10 c.1006-162 1119+706del p.Val336 Asn373del Absence of 6th transmembrane domain [12] 1 Exon 13 c.1529A>G HTZ p.Asn510Ser HTZ Missense; IC3 Domain; deleterious according to SIFT None 1 Exon 15 c.1769G>A HTZ p.Arg590Gln HTZ Missense IC3 Domain; deleterious according to SIFT; rs45575636 [19] Exon involved NM 003742.2 (ABCB11) NP 003733 (BSEP) Consequences Bibliography 1 Exon 4 c.127G>A HTZ p.Val43Ile HTZ Missense; N-Ter Domain; tolerated according to SIFT None 3 Exon 13 c.1331T>C HMZ p.Val444Ala HMZ Missense IC3 Domain; tolerated according to SIFT; rs2287622 [14] Table 3 Characteristics of patients with low phospholipid associated cholelithiasis with and without ABCB4 or ABCB11 mutations. Login to comment
63 Molecular analysis of the ABCB11 gene also showed variants in 4 patients (29%): a homozygous known polymorphic mutation (NP 003733: p.Val444Ala) in three cases and a heterozygous point mutation (NP 003733: p.Val43Ile) reported as a tolerated variant by protein prediction software in one case. Login to comment
102 [18] 1 Exon 10 c.1006-162 1119+706del p.Val336 Asn373del Absence of 6th transmembrane domain [12] 1 Exon 13 c.1529A>G HTZ p.Asn510Ser HTZ Missense; IC3 Domain; deleterious according to SIFT None 1 Exon 15 c.1769G>A HTZ p.Arg590Gln HTZ Missense IC3 Domain; deleterious according to SIFT; rs45575636 [19] Exon involved NM 003742.2 (ABCB11) NP 003733 (BSEP) Consequences Bibliography 1 Exon 4 c.127G>A HTZ p.Val43Ile HTZ Missense; N-Ter Domain; tolerated according to SIFT None 3 Exon 13 c.1331T>C HMZ p.Val444Ala HMZ Missense IC3 Domain; tolerated according to SIFT; rs2287622 [14] Table 3 Characteristics of patients with low phospholipid associated cholelithiasis with and without ABCB4 or ABCB11 mutations. Login to comment

[hide] ABCB4 mutations underlie hormonal cholestasis but ... World J Gastroenterol. 2014 May 21;20(19):5867-74. doi: 10.3748/wjg.v20.i19.5867. Jirsa M, Bronsky J, Dvorakova L, Sperl J, Smajstrla V, Horak J, Nevoral J, Hrebicek M
ABCB4 mutations underlie hormonal cholestasis but not pediatric idiopathic gallstones.
World J Gastroenterol. 2014 May 21;20(19):5867-74. doi: 10.3748/wjg.v20.i19.5867., [PMID:24914347]

Abstract [show]
AIM: To investigate the contribution of ABCB4 mutations to pediatric idiopathic gallstone disease and the potential of hormonal contraceptives to prompt clinical manifestations of multidrug resistance protein 3 deficiency. METHODS: Mutational analysis of ABCB4, screening for copy number variations by multiplex ligation-dependent probe amplification, genotyping for low expression allele c.1331T>C of ABCB11 and genotyping for variation c.55G>C in ABCG8 previously associated with cholesterol gallstones in adults was performed in 35 pediatric subjects with idiopathic gallstones who fulfilled the clinical criteria for low phospholipid-associated cholelithiasis syndrome (LPAC, OMIM #600803) and in 5 young females with suspected LPAC and their families (5 probands, 15 additional family members). The probands came to medical attention for contraceptive-associated intrahepatic cholestasis. RESULTS: A possibly pathogenic variant of ABCB4 was found only in one of the 35 pediatric subjects with idiopathic cholesterol gallstones whereas 15 members of the studied 5 LPAC kindreds were confirmed and another one was highly suspected to carry predictably pathogenic mutations in ABCB4. Among these 16, however, none developed gallstones in childhood. In 5 index patients, all young females carrying at least one pathogenic mutation in one allele of ABCB4, manifestation of LPAC as intrahepatic cholestasis with elevated serum activity of gamma-glutamyltransferase was induced by hormonal contraceptives. Variants ABCB11 c.1331T>C and ABCG8 c.55G>C were not significantly overrepresented in the 35 examined patients with suspect LPAC. CONCLUSION: Clinical criteria for LPAC syndrome caused by mutations in ABCB4 cannot be applied to pediatric patients with idiopathic gallstones. Sexual immaturity even prevents manifestation of LPAC.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 In our previous study[10] we focused on the role of the common variants c.523A>G (p.Thr175Ala) and c.1954A>G (p.Arg652Gly) in ABCB4, c.1331T>C (p.Val444Ala) in ABCB11 and c.55 G>C (p.Asp19His) in ABCG8 in pediatric gallstone disease. Login to comment
85 Two probands were homozygous and the other three probands were heterozygous for the low-expression ABCB11 variant c.1331T>C (p.Val444Ala) (Figure 2). Login to comment
99 Interestingly, the ABCB4 variation c.523A>G (p. Thr175Ala), found in three index patients with LPAC, Patient. Login to comment
100 ID Variations in the coding sequence of ABCB4 ABCB11 low expression allele ABCG8 variation c.147C>T c.175C>T c.459T>C c.504C>T c.711A>T c.1954A>G c.1331T>C c.55G>C Ser49Ser Leu59Leu Phe153Phe Asn168Asn Ile237Ile Arg652Gly Val444Ala Asp19His rs8187789 rs2302387 rs2230027 rs1202283 rs2109505 rs2230028 rs2287622 rs11887534 1 CC CC TT TT AA AA CC GG 2 CC CC TT CT AA AA TC GG 3 CC CC TT CT AA AA TC GG 4 CC CC TT CT AT AG TC GG 5 CC CC TT TT AA AA CC GG 6 CC CC TT CC AA AA TC GG 7 CC CC TT CT AA AA TC GG 8 CC CC TT CC AA AG TC GG 9 CC CC TT TT AA AA TT GG 10 CC CC TT TT AA AA CC GG 11 CC CC TT TT AA AA TC GG 12 CC CC TT TT AA AA CC GG 13 CC CC TT CT AA AA TC GG 14 CC CC TT CC AA AA CC GG 15 CC CC TT TT AA AA TC GC 16 CC CC TT CC AA AA TC GC 17 CC CC TT CC AA AA TC GG 18 CC CC TT TT AA AA TC GC 19 CC CC TT CT AA AA TC GC 20 CC CC TT CT AA AA TT GG 21 CC CC TT TT AA AA TC GG 22 CC CC TT CT AA AA TT GG 23 CC CC TT CT AA AA TT GG 24 CC CT TT CC AT AA CC GG 25 CC CC TT CC AA AA TC GG 26 CT CT TC CC AA AG TC GG 27 CC CC TT TT AA AA TC GG 28 CC CC TT TT AA AA TT GG 29 CC CC TT CT AA AA TT GG 30 CC CC TT TT AA AA CC GC 31 CC CC TT CT AA AA TT GC 32 CC CC TT CT AA AA TT GG 33 CC CC TT TT AA AA TC GG 34 CC CC TT CC AA AA TT GG 35 CC CC TT TT AA AA CC GG Allelic frequency of variant alleles in patients with gallstones, HapMap populations and Czech population controls Allele T T C T T G C G Gallstone patients 0.014 0.029 0.014 0.571 0.029 0.043 0.471 0.086 HapMap CEU 0 0.112 01 0.664 0.175 0.075 0.408 0.085 HapMap HCB 0 0.167 01 0.344 0.222 0.023 0.333 0.022 HapMap JPT 0 0.273 01 0.442 0.300 0.023 0.261 0.011 HapMap YRI 0.042 0.525 0.11 0 0.362 0.392 0.425 0.042 Czech controls (n = 150) n.d. n.d. n.d. n.d. n.d. 0.090 0.400 0.0672 1 Results from corresponding populations studied in Environmental Genome Project (NIEHS ES15478 project). Login to comment
25 In our previous study[10] we focused on the role of the common variants c.523A>G (p.Thr175Ala) and c.1954A>G (p.Arg652Gly) in ABCB4, c.1331T>C (p.Val444Ala) in ABCB11 and c.55 G>C (p.Asp19His) in ABCG8 in pediatric gallstone disease. Login to comment
84 Two probands were homozygous and the other three probands were heterozygous for the low-expression ABCB11 variant c.1331T>C (p.Val444Ala) (Figure 2). Login to comment

[hide] ABCB11 and ABCB1 gene polymorphisms impact on tela... Biomed Pharmacother. 2015 Feb;69:63-9. doi: 10.1016/j.biopha.2014.11.007. Epub 2014 Nov 15. Cusato J, Allegra S, De Nicolo A, Boglione L, Fatiguso G, Cariti G, Ciancio A, Smedile A, Strona S, Troshina G, Rizzetto M, Di Perri G, D'Avolio A
ABCB11 and ABCB1 gene polymorphisms impact on telaprevir pharmacokinetic at one month of therapy.
Biomed Pharmacother. 2015 Feb;69:63-9. doi: 10.1016/j.biopha.2014.11.007. Epub 2014 Nov 15., [PMID:25661339]

Abstract [show]
In 2011 direct-acting antivirals, including telaprevir, have been developed to achieve a better antiviral effect. It was reported that telaprevir is a substrate of P-glycoprotein (ABCB1) and cytochrome P450 3A4. The aim of this retrospective study was the evaluation of the influence of some single nucleotide polymorphisms (SNPs) of genes (ABCB1, SLC28A2/3, SLC29A1) involved in TLV and RBV transport and their correlation with plasma TLV drug exposure at 1 month of therapy. We also investigated the association of a SNP in ABCB11 gene, whose role in TLV transport was not yet shown. Twenty-nine HCV-1 patients treated with telaprevir, ribavirin and pegylated-interferon-alpha were retrospectively analyzed; allelic discrimination was performed by real-time PCR. Telaprevir Ctrough levels were influenced by Metavir score (P=0.023), ABCB1 2677 G>T (P=0.006), ABCB1 1236 C>T (P=0.015) and ABCB11 1131 T>C (P=0.033) SNPs. Regarding ABCB1 3435 C>T, a not statistically significant trend in telaprevir plasma concentration was observed. Metavir score (P=0.002, OR -336; 95% CI -535;-138), ABCB1 2677 (P=0.020, OR 497; 95% CI 86; 910), ABCB11 1131 (P=0.002, OR 641; 95% CI 259;1023) and CNT2 -146 (P=0.006, OR -426; 95% CI -721;-132) were able to predict telaprevir plasma levels in the regression analysis. Other SNPs showed no association. This study reveals BSEP implication in telaprevir transport and confirms the involvement and influence of P-glycoprotein on telaprevir plasma levels. To date, no similar data concerning pharmacogenetics and pharmacokinetics were published, but further studies in different and bigger cohorts are needed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
157 Among them, the common non-synonymous SNP 1331 T>C (Val444Ala) may be associated with reduced BSEP transporter levels in healthy human liver samples and in vitro expression system [60]. Login to comment
153 Among them, the common non-synonymous SNP 1331 T>C (Val444Ala) may be associated with reduced BSEP transporter levels in healthy human liver samples and in vitro expression system [60]. Login to comment

[hide] Relapsing features of bile salt export pump defici... J Hepatol. 2010 Nov;53(5):981-6. doi: 10.1016/j.jhep.2010.05.025. Epub 2010 Jul 29. Maggiore G, Gonzales E, Sciveres M, Redon MJ, Grosse B, Stieger B, Davit-Spraul A, Fabre M, Jacquemin E
Relapsing features of bile salt export pump deficiency after liver transplantation in two patients with progressive familial intrahepatic cholestasis type 2.
J Hepatol. 2010 Nov;53(5):981-6. doi: 10.1016/j.jhep.2010.05.025. Epub 2010 Jul 29., [PMID:20800306]

Abstract [show]
BACKGROUND & AIMS: PFIC2 is caused by mutations in ABCB11 encoding BSEP. In most cases affected children need liver transplantation that is thought to be curative. We report on two patients who developed recurrent normal GGT cholestasis mimicking primary BSEP disease, after liver transplantation. METHODS: PFIC2 diagnosis was made in infancy in both patients on absence of canalicular BSEP immunodetection and on ABCB11 mutation identification. Liver transplantation was performed at age 9 (patient 1) and 2.8 (patient 2) years without major complications. Cholestasis with normal GGT developed 17 and 4.8years after liver transplantation, in patient 1 and patient 2, respectively, during an immunosuppression reduction period. RESULTS: Liver biopsies showed canalicular cholestasis, giant hepatocytes, and slight lobular fibrosis, without evidence of rejection or biliary complications. An increase in immunosuppression resulted in cholestasis resolution in only one patient. Both patients developed atrial fibrillation, and one melanonychia. The newborn of patient 1 developed transient neonatal normal GGT cholestasis. Immunofluorescence staining of normal human liver sections with patient's sera, collected at the time of cholestasis, and using an anti-human IgG antibody to detect serum antibodies, showed reactivity to a canalicular epitope, likely to be BSEP. Indeed, Western blot analysis showed that patient 2 serum recognized rat Bsep. CONCLUSIONS: Allo-immune mediated BSEP dysfunction may occur after liver transplantation in PFIC2 patients leading to a PFIC2 like phenotype. Extrahepatic features and/or offspring transient neonatal cholestasis of possible immune mediated mechanisms, may be associated. Increasing the immunosuppressive regimen might be an effective therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 Patient Gender Patient 1 Female ABCB11 mutations Compound heterozygous c.301delCA p.Q101DfsX8 and c.2944G>A p.G982R with c.1331T>C p.V444A Negative 0.1 mmol/L 9 years SC P Growth failure Cirrhosis Hepatocellular cholestasis Giant hepatocytes Portal inflammation 36 234 N 17 Patient 2 Male Homozygous c.77-19T>A leading to abnormal splicing*: p.Y26Ifs7X Homozygous c.1331T>C p.V444A Negative NA 2.8 years SC P Growth failure Cirrhosis Hepatocellular cholestasis Giant hepatocytes 139 100 76 420 2xN 20 Canalicular BSEP staining Age at LT Indication Native liver histology PT (N >70%) Total bilirubin (N <17&#b5;mol/L) ALT (N <40 IU/L) AFP Serum liver tests at LT GGT (N <60 IU/L) Biliary bile acids (N >10 mmol/L) SC, severe cholestasis; P, pruritus refractory to medical management; PT, prothrombin time; ALT, alanine aminotransferase; AFP; alpha fetoprotein; GGT, gamma-glutamyl transpeptidase; BSEP, bile salt export pump, LT, liver transplantation; NA, not available; *, in silico test predicts abnormal splicing [2]. Login to comment

[hide] Genetic variations in bile acid homeostasis are no... Mutagenesis. 2012 Sep;27(5):567-72. doi: 10.1093/mutage/ges020. Epub 2012 Apr 19. Many N, Stickel F, Schmitt J, Stieger B, Soyka M, Frei P, Gotze O, Mullhaupt B, Geier A
Genetic variations in bile acid homeostasis are not overrepresented in alcoholic cirrhosis compared to patients with heavy alcohol abuse and absent liver disease.
Mutagenesis. 2012 Sep;27(5):567-72. doi: 10.1093/mutage/ges020. Epub 2012 Apr 19., [PMID:22522591]

Abstract [show]
Increased serum bile salt levels have been associated to a single-nucleotide polymorphism in the bile salt export pump (BSEP; ABCB11) in several acquired cholestatic liver diseases but there is little evidence in alcoholic liver disease (ALD). Furthermore, a crosstalk between vitamin D and bile acid synthesis has recently been discovered. Whether this crosstalk has an influence on the course of ALD is unclear to date. Our aim was to analyse the role of genetic polymorphisms in BSEP and the vitamin D receptor gene (NR1I1) on the emergence of cirrhosis in patients with ALD. Therefore, 511 alcoholic patients (131 with cirrhosis and 380 without cirrhosis) underwent ABCB11 genotyping (rs2287622). Of these, 321 (131 with cirrhosis and 190 without cirrhosis) were also tested for NR1I1 polymorphisms (bat-haplotype: BsmI rs1544410, ApaI rs7975232 and TaqI rs731236). Frequencies of ABCB11 and NR1I1 genotypes and haplotypes were compared between alcoholic patients with and without cirrhosis and correlated to serum bile salt, bilirubin and aspartate aminotransferase levels in those with cirrhosis. Frequencies of ABCB11 and NR1I1 genotypes and haplotypes did not differ between the two subgroups and no significant association between genotypes/haplotypes and liver function tests could be determined for neither polymorphism. We conclude that ABCB11 and NR1I1 polymorphisms are obviously not associated with development of cirrhosis in patients with ALD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
49 G (p.V444A, rs2287622) as well as of NR1I1 polymorphisms forming the bat-haplotype (rs1544410, rs7975232 and rs731236) (27) was performed using standard TaqMan technology. Login to comment
147 572 Although the present study could not detect a significant genetic influence of the ABCB11 p.V444A polymorphism and the common NR1I1 bAt[CCA]-haplotype on the presence of liver cirrhosis in patients with chronic alcohol abuse, our findings do not preclude a relevant role of bile salts and vitamin D in acute ALD. Login to comment

[hide] A frequent variant in the human bile salt export p... BMC Gastroenterol. 2012 Jun 8;12:63. Mullenbach R, Weber SN, Krawczyk M, Zimmer V, Sarrazin C, Lammert F, Grunhage F
A frequent variant in the human bile salt export pump gene ABCB11 is associated with hepatitis C virus infection, but not liver stiffness in a German population.
BMC Gastroenterol. 2012 Jun 8;12:63., [PMID:22681771]

Abstract [show]
BACKGROUND: The human ATP-binding cassette, subfamily B, member 11 (ABCB11) gene encodes the bile salt export pump, which is exclusively expressed at the canalicular membrane of hepatocytes. A frequent variant in the coding region, c.1331 T>C, leading to the amino acid exchange p.V444A, has been associated with altered serum bile salt levels in healthy individuals and predisposes homozygous carriers of the [C] allele for obstetric cholestasis. Recently, elevated bile salt levels were shown to be significantly associated with rates and risk of cirrhosis in patients with chronic hepatitis C virus (HCV) infection treated with pegylated interferon-alpha2 and ribavirin, suggesting a potential role for bile salt levels in HCV treatment outcomes and in the fibrogenic evolution of HCV-related liver disease. The aim of this study was to investigate a possible association of ABCB11 c.1331 T>C with hepatitis C virus (HCV) infection and fibrosis stages as assessed by non-invasive transient elastography in a German cohort of patients. METHODS: ABCB11 c.1331 T>C genotype was determined by allelic discrimination assay in 649 HCV infected cases and 413 controls. Overall, 444 cases were staged for fibrotic progression by measurement of liver stiffness. RESULTS: Homo- or heterozygous presence of the frequent [C] allele was associated with HCV positivity (OR = 1.41, CI = 1.02 - 1.95, p = 0.037). No association was detectable between the ABCB11 c.1331 T>C genotype and increased liver stiffness. CONCLUSIONS: Our data confirm that homozygous presence of the major [C] allele of ABCB11 c.1331 T>C is a genetic susceptibility factor for HCV infection, but not for liver fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 A frequent variant in the coding region, c.1331 T > C, leading to the amino acid exchange p.V444A, has been associated with altered serum bile salt levels in healthy individuals and predisposes homozygous carriers of the [C] allele for obstetric cholestasis. Login to comment
26 Previously a common, non-conservative polymorphism c.1331 T >C (p.V444A) in the hepatobiliary bile salt transporter ABCB11 (also known as bile salt export pump, BSEP) was identified as a risk factor for cholestatic liver diseases, in particular drug-induced cholestasis [16] and intrahepatic cholestasis of pregnancy [17,18]. Login to comment
76 Figure 1 illustrates that scatterplot analysis is indicative of a higher frequency of individuals with more Table 2 Genotyping results for ABCB11 c.1331 T > C from patients and controls ABCB11 p.V444A (c.1331 T > C) alleles/ genotypes Counts (frequencies) of alleles/genotypes Cases (N = 649) Controls (N = 413) [T] 511 (0.39) 359 (0.43) [C] 787 (0.61) 467 (0.57) [TT] 97 (0.15) 82 (0.20) [TC] 317 (0.49) 195 (0.47) [CC] 235 (0.36) 136 (0.33) Tests for association chi2 P Allele frequency difference 3.50 0.061 Armitage`s trend test 3.49 0.062 OR statistics OR (95% CI) P [C] ࢒ [T] 1.18 (0.99 - 1.41) 0.061 [CC] ࢒ [TT] 1.46 (1.02 - 2.10) 0.040 [CC + CT] ࢒ [TT] 1.41 (1.02 - 1.95) 0.037 Patients with HCV infections are regarded as cases. Login to comment

[hide] The bile salt export pump (BSEP) in health and dis... Clin Res Hepatol Gastroenterol. 2012 Dec;36(6):536-53. doi: 10.1016/j.clinre.2012.06.006. Epub 2012 Jul 12. Kubitz R, Droge C, Stindt J, Weissenberger K, Haussinger D
The bile salt export pump (BSEP) in health and disease.
Clin Res Hepatol Gastroenterol. 2012 Dec;36(6):536-53. doi: 10.1016/j.clinre.2012.06.006. Epub 2012 Jul 12., [PMID:22795478]

Abstract [show]
The bile salt export pump (BSEP) is the major transporter for the secretion of bile acids from hepatocytes into bile in humans. Mutations of BSEP are associated with cholestatic liver diseases of varying severity including progressive familial intrahepatic cholestasis type 2 (PFIC-2), benign recurrent intrahepatic cholestasis type 2 (BRIC-2) and genetic polymorphisms are linked to intrahepatic cholestasis of pregnancy (ICP) and drug-induced liver injury (DILI). Detailed analysis of these diseases has considerably increased our knowledge about physiology and pathophysiology of bile secretion in humans. This review focuses on expression, localization, and function, short- and long-term regulation of BSEP as well as diseases association and treatment options for BSEP-associated diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
165 A role of BSEP for the development of CC was also suggested on the basis of an association to the BSEP polymorphism p.V444A in a study of 172 CC-patients [127]. Login to comment
176 Interestingly, the very common polymorphism p.V444A of BSEP (allele frequency > 50%), which may occur isoallelic to mutations, strongly increases ERAD, as shown in expression studies of cloned BSEP [23]; thirdly, a decrease in half-life may shorten residency of BSEP at the canalicular membrane as shown for the two common PFIC-2 mutations p.E297G and p.D482G in Madin-Darby canine kidney (MDCK) cells [134]. Login to comment
185 PFIC BRIC/NFC ICP Other liver diseases Genetic variants without disease association Missense mutations M1V C336S D549V L1055P E135K E137K T87R V43I S701P G19R W342G G556R C1083Y E137K L198P M123T S56L L712L L50S A382G G562D A1110E E186G E297G S194P Q121K A865D M62K R387H A570T S1114R L198P R415Q L198P R128H A865G C68Y A390P L581F G1116E E297G V444A G260D I206V S874P C107R G410D A588V G1116F G374S D482G E297K V284A I939M I112T L413W S593R G1116R A390P N591S V444A G295C R958Q W114R I420T I627T S1120N R432T T655I T510T G295R F959C Y157C D440E E636G R1128C V444A T655I G295S F959V A167T G455E R698C S1144R I498T D676Y R299K T965S A167V K461E S699P R1153C A570T P710P R303K F971L I182K T463I E709K R1153H T586I L827I L339V F971Y M183T Q466K G758R S1154P G648V G855R H423R L1006F M183V R470Q G766R N1173D T655I E1186K V444A N1009H G188W Y472C Y818F T1210P T923P V444D K1145N M217R V481E R832C N1211D A926P V444G I1183T R223C D482G R832H V1212F R948C A459V S226L R487H T859R R1231Q G1004D I468I G238V R487P A865V R1231W R1050C R487L T242I N490D Q869P L1242I G1116R Q546K A257G I498T G877R D1243G R1128H Q558H V284L G499E S901R R1268Q L1197G E592Q E297G I512T R948C A1283V R1231Q V597M R303G N515T N979D G1292V R616G R303K R517H G982R G1298R T619A Q312H F540L G1004D M677L R313S I541L T1029K M677V G327E I541T G1032R R696Q W330R F548Y A1044P R698H Nonsense mutations (premature stop-codons) S25X Y472X Y772X R1090X E96X W493X Q791X V1147X W330X R520X R928X Q1215X Y354X I528X Y1041X R1235X R415X R575X R1057X E1302X R470X Q702X Q1058X Table 1 (Continued) PFIC BRIC/NFC ICP Other liver diseases Genetic variants without disease association Splice site mutations 76 + 3G > T 908 + 1delG 2178 + 1G > T 3057-2A > G Q159Q 77-1G > C 908 + 1G > T 2179-2A > G 3213 + 1delG Q361Q 99-1G > T 908 + 1G > A 2343 + 1G > T 3213 + 4A > G 150 + 3A > C 1435-13 -8del 2343 + 2T > C 3213 + 5G > A 390-1G > A 2012-8T > G 2611-2A > T 611 + 1G > A 2178 + 1G > A R1001R Deletions/insertions/frame shifts Q101Dfs8X L380Wfs18X G648Vfs5X Q1058Hfs38X F959Hfs1X T127Hfs6X A382 A388del K700Sfs12X I1061Vfs34X F959Gfs48X N199Ifs14X P456Pfs24X T919del L1165del L232Cfs9X H484Rfs5X K930Efs92X A1192Efs50X R303Sfs17X I528Sfs21X K930Efs79X T1256Tfs40X V368Rfs27X I610Qfs45X K969 K972del Synonymous variants without disease association R33R F90F L232L I416I G557G I876I A1028A K1145K D36D I134I Y269Y G418G V597V G937G K1070K R52R S136S Q312Q F427F A804A Y981Y T1086T D58D V195V G319G E395E A535A G817G G1004G A1110A The overview shows ࣈ 290 known variants of BSEP on the protein level, except splice site mutations, which are shown on cDNA level. Login to comment
213 Apart from rare mutations, the common BSEP polymorphism p.V444A (c.1331T > C, rs2287622, valine to alanine at position 444) has been linked to ICP. Login to comment
215 Contraceptive-induced cholestasis (CIC) is similar to ICP and presents with pruritus, and may be more strongly associated with p.V444A [153]. Login to comment
227 Drug-induced liver injury The common BSEP polymorphism p.V444A (c.1331T > C) is not only associated to ICP (see above), but predisposes for the development of drug-induced liver injury (DILI). Login to comment
229 The common explanation for the relation between p.V444A and ICP or DILI is a decreased expression of BSEP in the presence of the polymorphism as shown in a small cohort [132,163], whereas no differences in the transport kinetics of the two variants (valine or alanine at position 444 of BSEP) were observed [162]. Login to comment
235 However, BSEP expression may be severely reduced in MDR3- dependent ICP when p.V444A is present [167]. Login to comment
236 Furthermore, p.V444A may influence development of liver fibrosis in patients with chronic hepatitis C infection. Login to comment
239 The polymorphism p.V444A has a less stringent impact on HCV treatment as compared to IL-28B polymorphisms [170-173] and further studies are needed [174] to more precisely define the role of BSEP in interferon-based therapy regimens of HCV. Login to comment
241 In a recent study a higher prevalence of p.V444A was observed in CC-patients [127]. Login to comment
242 Restricted BSEP expression due to the genetic polymorphism p.V444A or due to BSEP mutations may result in altered biliary bile salt concentrations, which in turn may have an impact of cholangiocyte proliferation or apoptosis [175]. Login to comment

[hide] Hepatobiliary transport in health and disease. Clin Lipidol. 2012 Apr;7(2):189-202. Chan J, Vandeberg JL
Hepatobiliary transport in health and disease.
Clin Lipidol. 2012 Apr;7(2):189-202., [PMID:22859919]

Abstract [show]
Bile salts, cholesterol and phosphatidylcholine are secreted across the canalicular membrane of hepatocytes into bile by ATP-binding cassette (ABC) transporters. Secretion of bile salts by ABCB11 is essential for bile flow and for absorption of lipids and fat-soluble vitamins. ABCG5 and ABCG8 eliminate excess cholesterol and sterols from the body by secreting them into bile. There are two mechanisms to protect the canalicular membrane from solubilization by bile salts; ABCB4 secretes phosphatidylcholine into bile to form mixed micelles with bile salts, and ATP8B1 maintains the canalicular membrane in a liquid-ordered state. Three different forms of progressive familial intrahepatic cholestasis (PFIC) disorders, PFIC1, PFIC2 and PFIC3, are caused by mutations in ATP8B1, ABCB11 and ABCB4, respectively. Sitosterolemia is caused by mutations in ABCG5 and ABCG8. This article reviews the physiological roles of these canalicular transporters, and the pathophysiological processes and clinical features associated with their mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
91 The V444A polymorphism is associated with susceptibility to drug-induced cholestasis and has been shown to be associated with lower ABCB11 expression levels. Login to comment
94 The V444A variant is also associated with ICP type 2 patients [28]. Login to comment
92 The V444A polymorphism is associated with susceptibility to drug-induced cholestasis and has been shown to be associated with lower ABCB11 expression levels. Login to comment
95 The V444A variant is also associated with ICP type 2 patients [28]. Login to comment

[hide] Biosynthesis and trafficking of the bile salt expo... Mol Aspects Med. 2014 Jun;37:3-14. doi: 10.1016/j.mam.2013.05.001. Epub 2013 May 15. Soroka CJ, Boyer JL
Biosynthesis and trafficking of the bile salt export pump, BSEP: therapeutic implications of BSEP mutations.
Mol Aspects Med. 2014 Jun;37:3-14. doi: 10.1016/j.mam.2013.05.001. Epub 2013 May 15., [PMID:23685087]

Abstract [show]
The bile salt export pump (BSEP, ABCB11) is the primary transporter of bile acids from the hepatocyte to the biliary system. This rate-limiting step in bile formation is essential to the formation of bile salt dependent bile flow, the enterohepatic circulation of bile acids, and the digestion of dietary fats. Mutations in BSEP are associated with cholestatic diseases such as progressive familial intrahepatic cholestasis type 2 (PFIC2), benign recurrent intrahepatic cholestasis type 2 (BRIC2), drug-induced cholestasis, and intrahepatic cholestasis of pregnancy. Development of clinical therapies for these conditions necessitates a clear understanding of the cell biology of biosynthesis, trafficking, and transcriptional and translational regulation of BSEP. This chapter will focus on the molecular and cell biological aspects of this critical hepatic membrane transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
168 The BSEP variants, V444A and M677V, have been reported to consistently occur with frequencies of greater that 50% (Lang et al., 2006; Saito et al., 2002). Login to comment
169 The V444A variant has been found in patients with DILI (Lang et al., 2007) and intrahepatic cholestasis of pregnancy (Dixon et al., 2009; Meier et al., 2008) with greater frequency than controls. Login to comment
170 In contrast, preliminary study from Japan reported a lower frequency of the V444A variant in DILI (Kagawa et al., 2012). Login to comment

[hide] Diagnosis of ABCB11 gene mutations in children wit... Mol Med Rep. 2014 Sep;10(3):1264-74. doi: 10.3892/mmr.2014.2349. Epub 2014 Jun 20. Hu G, He P, Liu Z, Chen Q, Zheng B, Zhang Q
Diagnosis of ABCB11 gene mutations in children with intrahepatic cholestasis using high resolution melting analysis and direct sequencing.
Mol Med Rep. 2014 Sep;10(3):1264-74. doi: 10.3892/mmr.2014.2349. Epub 2014 Jun 20., [PMID:24969679]

Abstract [show]
Intrahepatic cholestasis represents a heterogeneous group of disorders that begin during childhood, most commonly manifesting as neonatal cholestasis, and lead to ongoing liver dysfunction in children and adults. For children, inherited pathogenic factors of cholestasis have gained increasing attention owing to the rapid development of molecular biology technology. However, these methods have their advantages and disadvantages in terms of simplicity, sensitivity, specificity, time required and expense. In the present study, an effective, sensitive and economical method is recommended, termed high-resolution melting (HRM) analysis and direct sequencing, based on general polymerase chain reaction, to detect mutations in diseasecausing genes. As one type of inherited intrahepatic cholestasis, progressive familial intrahepatic cholestasis type 2 (PFIC2) is caused by pathogenic mutations in the ABCB11 gene, HRM was used to detect mutations in the ABCB11 gene in the present study, and the diagnosis for PFIC2 was made by comprehensive analysis of genetic findings and clinical features. Furthermore, the characteristics of mutations and single nucleotide polymorphisms (SNPs) in the ABCB11 gene were elucidated. A total of 14 types of mutations/polymorphisms were identified in 20 patients from mainland China, including six missense mutations (p.Y337H, p.Y472C, p.R696W, p.Q931P, p.D1131V and p.H1198R), one nonsense mutation (p.R928X) and seven SNPs (p.D36D/rs3815675, p.F90F/rs4148777, p.Y269Y/rs2287616, p.I416I/rs183390670, p.V444A/rs2287622, p.A865V/rs118109635 and p.A1028A/rs497692). Five mutations were novel. The majority of the mutations were different from those detected in other population groups. A total of 4/20 patients (1/5) were diagnosed to be PFIC2 by combining genetic findings with the clinical features. Polymorphisms V444A and A1028A, with an allele frequency of 74.5 and 67.2%, respectively, were highly prevalent in the mainland Chinese subjects. No differences were found between the patients with cholestasis and the control subjects. Efficient genetic screening facilitates the clinical diagnosis of genetic disorders. The present study demonstrated that HRM analysis was efficient and effective in detecting mutations and expanded the known spectrum of ABCB11 gene mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 A total of 14 types of mutations/polymorphisms were identified in 20 patients from mainland China, including six missense mutations (p.Y337H, p.Y472C, p.R696W, p.Q931P, p.D1131V and p.H1198R), one nonsense mutation (p.R928X) and seven SNPs (p.D36D/rs3815675, p.F90F/rs4148777, p.Y269Y/rs2287616, p.I416I/rs183390670, p.V444A/rs2287622, p.A865V/rs118109635 and p.A1028A/rs497692). Login to comment
11 Polymorphisms V444A and A1028A, with an allele frequency of 74.5 and 67.2%, respectively, were highly prevalent in the mainland Chinese subjects. Login to comment
28 One is V444A (HGVS name: NM_003742.2:c.1331T>C; refSNP: rs2287622) in exon 13, which has been reported to be correlated with cholestasis (12) and chronic hepatititis C virus infection (13). Login to comment
79 To avoid false-negative results from HRM screening, confirmative direct sequencing was performed for exons 13 and 24 in which SNPs V444A (in exon 13) and A1028A (in exon 24) were common and rendered the interpretation of melting patterns difficult. Login to comment
105 Analysis of V444A and A1028A in patients and controls. Login to comment
107 These samples were tested using HRM analysis of exons 13 and 24, followed by direct sequencing to identify the V444A and A1028A polymorphisms. Login to comment
112 Results MutationsandSNPsdetectedinpatients.Amongthe20 patients with cholestasis, 14 types of variants were detected, including seven mutations in the coding region (p.Y337H, p.Y472C, p.R696W, p.R928X, p.Q931P, p.D1131V and p.H1198R) and seven SNPs (p.D36D/rs3815675, p.F90F/rs4148777, p.Y269Y/rs2287616, p.I416I/rs183390670, p.V444A/rs2287622, p.A865V/rs118109635 and p.A1028A/rs497692). Login to comment
118 Amino acid Carrier rate Variant Exon change RefSNP Patients and status in control (%) c.108T>C 4 D36D rs3815675 Heterozygous: P7, P11, P16 - c.270T>C 5 F90F rs4148777 Heterozygous: P6, P13 - c.807T>C 9 Y269Y rs2287616 Heterozygous: P7, P11, P16 - c.1009T>C 10 Y337H - Heterozygous: P5 0 c.1248C>A 12 I416I rs183390670 Heterozygous: P13 - c.1331T>C 13 V444A rs2287622 Heterozygous: P1, P5, P12, P16, P17, P19 94.5 Homozygous: P2, P3, P4, P6, P7, P8, P9, P10, P11, P14, P15, P18, P20 c.1415A>G 13 Y472C - Heterozygous: P3 0 c.2086C>T 18 R696W - Heterozygous: P11 0 c.2594C>T 21 A865V rs118109635 Heterozygous: P7, P17 - c.2782C>T 22 R928X - Heterozygous: P1 0 c.2792A>C 22 Q931P - Heterozygous: P4 0 c.3084A>G 24 A1028A rs497692 Heterozygous: P1, P8, P12, P13, P15, P16, P17, P20 90.5 Homozygous: P2, P3, P4, P5, P6, P7, P9, P10, P14, P18, P19 c.3392A>T 25 D1131V - Heterozygous: P3 0 c.3593A>G 26 H1198R - Heterozygous: P1 0 RefSNP refers to the reference SNP in the Single Nucleotide Polymorphism Database of NCBI. Login to comment
122 The results based on comprehensive evaluation of SIFT, PolyPhen-2, SNPs&GO and evolution conservation indicated that p.Y337H, p.Y472C, p.R696W, p.D1131V and p.H1198R were likely damaging, p.Q931P and p.A865V were possibly damaging and p.V444A was predicted to be benign. Login to comment
128 The two SNPs of p.V444A and p.A1028A were also detected in the four patients, except that P11 only had p.V444A. Login to comment
141 Variant SIFT PolyPhen-2 SNPs&GO EC/EN c.1009T>C (Y337H) 0.01 0.996 Disease EC c.1331T>C (V444A) 0.34 0.001 Neutral EC c.1415A>G (Y472C) 0 1.000 Disease EC c.2086C>T (R696W) 0.02 0.999 Disease EC c.2594C>T (A865V) 0.07 0.880 Disease EC c.2792A>C (Q931P) 0.02 0.178 Disease EN c.3392A>T (D1131V) 0 1.000 Disease EC c.3593A>G (H1198R) 0 1.000 Disease EC SIFT, Sorting Intolerant From Tolerant (mutation of residues with SIFT scores <0.05 are predicted to be deleterious); PolyPhen-2, Polymorphism Phenotyping version 2 (a score <0.2 denotes benign variants, between 0.2 and 0.85 is possibly damaging and >0.85 is highly likely damaging); SNPs&GO, a web tool to predict function of SNPs with a result of neutral or disease-related variants for human; EC, evolutionarily conserved; EN, evolutionarily non-conserved; SNP, single nucleotide polymorphism. Table VI. Login to comment
143 A, p.V444A (c.1331T>C) Variable PFIC2 (%) Cholestasis (non-PFIC2) (%) Control (%) Pa Pb Pc Polymorphism 0.847 0.493 0.580 TT 0 (0.0) 1 (6.3) 11 (5.5) TC 2 (50.0) 4 (25.0) 80 (40.0) CC 2 (50.0) 11 (68.7) 109 (54.5) Total no. Login to comment
147 The genotype distribution of control subjects was in HardyߛWeinberg equilibrium (V444A, P=0.46; A1028A, P=0.43). Login to comment
159 Two previously reported SNPs, p.V444A and p.A1028A, were identified in a number of the patients and control subjects. Login to comment
161 The distribution of p.V444A and p.A1028A polymorphisms, as well as allele frequencies, are revealed in Table VI. Login to comment
162 It was identified that V444A and A1028A were more prevalent polymorphisms in the control subjects, and had an allele frequency of 74.5 and 67.2%, respectively. Login to comment
163 This was consistent with previously reported data, which identified an allele frequency of 75.6% for V444A (19). Login to comment
164 However, neither V444A nor A1028A were associated with PFIC2 or cholestasis of undefined etiology in the patients. Login to comment
165 The distribution of alleles at the two SNPs in control group was in Hardy-Weinberg equilibrium (V444A, P=0.46; A1028A, P=0.43). Login to comment
204 V444A and A1028A are two highly prevalent polymorphisms. Login to comment
205 The allele frequency of V444A and A1028A has been reported in Japanese and Caucasian populations (44). Login to comment
206 According to the present study, the allele frequencies of V444A and A1028A were 74.5% and 67.2%, respectively, in mainland Chinese populations. Login to comment
207 V444A has previously been implicated in ICP and DIC with a higher allele frequency than normal controls suggesting that this polymorphism may become disease relevant in certain conditions, such as pregnancy and the use of ethinylestradiol and levonorgestrel (11,45). Login to comment
209 However, as the number of patients tested in the present study is small, it is not conclusive whether V444A or A1028A has a role in PFIC2 or cholestasis. Login to comment
214 V444A and A1028A were two highly prevalent SNPs found in ABCB11 exons in the study population; however, whether they are associated with pediatric cholestatic diseases remains unclear. Login to comment

[hide] Genetic variations of bile salt transporters. Drug Discov Today Technol. 2014 Jun;12:e55-67. doi: 10.1016/j.ddtec.2014.03.006. Kubitz R, Droge C, Kluge S, Stindt J, Haussinger D
Genetic variations of bile salt transporters.
Drug Discov Today Technol. 2014 Jun;12:e55-67. doi: 10.1016/j.ddtec.2014.03.006., [PMID:25027376]

Abstract [show]
Bile salt transporters directly or indirectly influence biological processes through physicochemical or signalling properties of bile salts. The coordinated action of uptake and efflux transporters in polarized epithelial cells of the liver, biliary tree, small intestine and kidney determine bile salt concentrations in different compartments of the body. Genetic variations of bile salt transporters lead to clinical relevant phenotypes of varying severity ranging from a predisposition for drug-induced liver injury to rapidly progressing end-stage liver disease. This review focuses on the impact of genetic variations of bile salt transporters including BSEP, NTCP, ASBT and OSTalpha/beta and discusses approaches for transporter analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 Patients with ICP or CIC have a higher prevalence of the BSEP polymorphism p.V444A/c.1331T>C (exchange of valine to alanine at amino acid position 444; 'p` stands for 'protein`, 'c` stands for 'coding DNA`) [17,72]. Login to comment
114 When in addition to these two mutations the common BSEP polymorphism p.V444A was present, complete degradation of triple-mutated BSEP via ERAD was observed [46], suggesting that p.V444A contributes to impaired stability of BSEP. Login to comment
115 A Vol. 12, 2014 Drug Discovery Today: Technologies | Transporter assays patient homozygous for p.V444A of BSEP and p.S320F of MDR3 (ABCB4), suffered from a severe form of ICP. Login to comment
116 BSEP expression (but not MDR3 expression) was massively reduced during cholestasis [49] underscoring the potential role of p.V444A for half-life of BSEP. Furthermore, transporter recycling at the canalicular membrane may influence the expression level. Login to comment
129 The frequent BSEP polymorphism p.V444A represents the mildest form of BSEP deficiency. Login to comment
130 An association between p.V444A and drug-induced liver injury [61] has been demonstrated. Login to comment
132 The association of p.V444A with such disturbances may be explained by the decreased expression of BSEP in the presence of the polymorphism [71], leading to increased bile salt concentrations in hepatocytes. Login to comment
133 Furthermore, hepatitis C infected patients, who are homozygous for valine of p.V444A have less severe liver fibrosis [37] and some but not all HCV-cohorts show better treatment responses towards interferon/ribavirin treatment [54]. Login to comment
137 BSEP/Bsep NTCP ASBT Exon skipping E186G G1116R G319G R1128C T463I R1128H A926P E1186K A1028Aa R1231W A1110E Aberrant splicing E297K R1153H R832C S1154P S1144R No splice product T586I R1231Q Reduced plasma membrane expression E135K A570T I223T E297Gb N591Sb V444A R1050C Intracellular retention Y818F G982R Reduced or absent bile salt transport A570T R432T A64T K314E V98Ic M264V I206V Q558H I223T C144Y P290S E297Gb N591Sb S267F L243P G374S E1186K I279T T262M a A1028A induces significant exon skipping in vitro but probably not in vivo (unpublished data; Dro &#a8;ge, Ha &#a8;ussinger, Kubitz). Login to comment

[hide] Liver transcript analysis reveals aberrant splicin... Mol Genet Metab. 2014 Nov;113(3):225-9. doi: 10.1016/j.ymgme.2014.07.006. Epub 2014 Jul 15. Davit-Spraul A, Oliveira C, Gonzales E, Gaignard P, Therond P, Jacquemin E
Liver transcript analysis reveals aberrant splicing due to silent and intronic variations in the ABCB11 gene.
Mol Genet Metab. 2014 Nov;113(3):225-9. doi: 10.1016/j.ymgme.2014.07.006. Epub 2014 Jul 15., [PMID:25085279]

Abstract [show]
BACKGROUND: Progressive familial intrahepatic cholestasis type 2 (PFIC2) is an autosomal recessive disease due to mutations in ABCB11. ABCB11 encodes the bile salt export pump (BSEP), the major transporter responsible for biliary bile acid secretion, which expression is restricted to hepatocytes. In some patients, molecular analysis of ABCB11 revealed either exonic or intronic variations - including common polymorphisms - predicted to affect splicing according to in silico analysis or in vitro minigene studies. Transcript analysis in liver tissue is the best way to determine whether the variations predicted to affect splicing are deleterious or not. METHODS AND RESULTS: We performed ABCB11 transcript analysis in liver tissue from five PFIC2 patients who had variations which were predicted to either affect splicing or not. Among eleven variants tested, only the silent c.3003A>G variant and the intronic c.3213+4A>G variant led to abnormal splicing as suggested by in silico analysis. CONCLUSION: ABCB11 liver transcript analysis is a useful tool to confirm or invalidate the predicted splicing effect of a silent or intronic ABCB11 variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Byrne et al. [7] showed that the silent variants p.Gly319Gly and p.Ala1028Ala had respectively a mild and a severe exon skipping effect while p.Phe90Phe, p.Val444Ala, and p.Met677Val variants had no effect on splicing. Login to comment
72 Some variants were previously studied in minigene system [7] and predicted the following consequences: &#b0;no effect: p.Phe90Phe (rs4148777); p.Met677Val (rs11568364); p.Val444Ala (rs2287322); *mild exon skipping: p.Gly319Gly (rs7563233); p.Arg1128Cys (disease-causing mutation); **severe exon skipping: p.Ala1028Ala (rs497692). Login to comment
78 ESE Finder predicted modifications of ESE pattern (gain and/or loss) for most variants while RESCUE-ESE predicted loss of ESE for only 3 variants (c.3003ANG, p.Gly319Gly, p.Val444Ala). Login to comment
86 Table 3 ABCB11 exonic variations. Modification Location SSF NNSplice MaxEntScan HSF ESE Finder RESCUE-ESE Observed consequence on cDNA WT 3'ss N MUT 3'ss or WT 5'ss N MUT 5'ss WT N MUT c.3003ANG p.Arg1001Arg 54 nt from 5' ss 90.6 N 90.6 Creation of a cryptic donor 54 bp upstream scored 84.8 0.99 N 0.99 Creation of a cryptic donor 54 bp upstream scored 0.98 10.07 N 10.07 Creation of a cryptic donor 54 bp upstream scored 10 96.9 N 96.9 Creation of a cryptic donor 54 bp upstream scored 89.3 Loss: SRp55 Gain: 2 SF2/ ASF SRp40: 3.28 N 5.66 (72.5%) Loss 2 ESE Use of the cryptic 5'ss p.Tyr1002_Arg1019del c.3382CNT p.Arg1128Cys 30 nt from 5' ss 82.7 N 82.7 0.97 N 0.97 8.15 N 8.15 91.3 N 91.3 Loss: SC35 None found No change detected c.270TNC p.Phe90Phe In middle exon None found None found No change detected c.957ANG p.Gly319Gly 58 nt from 3' ss 95.9 N 95.9 0.98 N 0.98 8.61 N 8.61 94.4 N 94.4 SC35: 3.46 N 3.82 (+10%) Loss 2 ESE No change detected c.1331TNC p.Val444Ala 29 nt from 3' ss 92.9 N 92.9 0.99 N 0.99 12.39 N 12.39 94.7 N 94.7 SC35: 3.23 N 3.8 (+17%) Loss 1 ESE No change detected c.2029ANG p.Met677Val 46 nt from 5' ss 93.9 N 93.9 1.00 N 1.00 10.22 N 10.22 97.0 N 97.0 Loss: SRp40 Gain: SF2/ ASF None found No change detected c.3084ANG p.Ala1028Ala 27 nt from 3' ss 87.9 N 87.9 0.86 N 0.96 9.34 N 9.34 89.2 N 89.2 SRp55: 2.93 N 3.54 (+20%) SRp40: 2.86 N 4.30 (+50%) Loss 1 ESE No change detected c.3258ANG p.Thr1086Thr 44 nt from 3' ss 81.1 N 81.1 0.97 N 0.97 10.90 N 10.90 91.0 N 91.0 Gain SRp55 SRp55: 4.55 N 5.16 (-13%) None found No change detected In bold: disease-causing mutation. In italics: common variation. WT, wild type; MUT, mutant; ss, splice site; SRp, serine/arginine-rich protein, a family of conserved splicing factors. Login to comment
97 In accordance to in silico predictions and minigene system's results, no splice defect due to the p.Phe90Phe, p.Val444Ala and p.Met677Val polymorphic variants was observed. Login to comment

[hide] Successful management of severe intrahepatic chole... BMC Gastroenterol. 2014 Sep 13;14:160. doi: 10.1186/1471-230X-14-160. Kamimura K, Abe H, Kamimura N, Yamaguchi M, Mamizu M, Ogi K, Takahashi Y, Mizuno K, Kamimura H, Kobayashi Y, Takeuchi M, Yoshida K, Yamada K, Enomoto T, Takakuwa K, Nomoto M, Obata M, Katsuragi Y, Mishima Y, Kominami R, Kamimura T, Aoyagi Y
Successful management of severe intrahepatic cholestasis of pregnancy: report of a first Japanese case.
BMC Gastroenterol. 2014 Sep 13;14:160. doi: 10.1186/1471-230X-14-160., [PMID:25218883]

Abstract [show]
BACKGROUND: Intrahepatic cholestasis of pregnancy (ICP) is a cholestasis condition caused by elevated levels of serum bile acids that mainly occurs in the third trimester of pregnancy. Maternal symptoms include pruritus; elevation of transaminases, biliary enzymes, and bilirubin levels; and abnormal liver function tests. Fetal symptoms include spontaneous preterm labor, fetal distress, and intrauterine death. It is more prevalent in the Caucasians and is rarely found in Asian countries, including Japan. The etiology of ICP has been reported as involving various factors such as, environmental factors, hormone balance, and genetic components. The genetic factors include single-nucleotide polymorphisms (SNPs) in the genes of canalicular transporters, including ABCB4 and ABCB11. It has also been reported that the combination of these SNPs induces severe cholestasis and liver dysfunction. CASE PRESENTATION: Here, we report for the first time a 24-year Japanese case of severe ICP diagnosed by typical symptoms, serum biochemical analysis, and treated with the administration of ursodeoxycholic acid which improved cholestasis and liver injury and prevented fetal death. The sequence analysis showed SNPs reported their association with ICP in the ABCB11 (rs2287622, V444A) and ABCB4 (rs1202283, N168N) loci. CONCLUSION: The risk of ICP has been reported to be population-specific, and it is rare in the Japanese population. Our case was successfully treated with ursodeoxycholic acid and the genetic sequence analysis has supported the diagnosis. Because genetic variation in ABCB4 and ABCB11 has also been reported in the Japanese population, we need to be aware of potential ICP cases in pregnant Japanese women although further studies are necessary.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 The sequence analysis showed SNPs reported their association with ICP in the ABCB11 (rs2287622, V444A) and ABCB4 (rs1202283, N168N) loci. Login to comment
23 For example, the combination of homozygous polymorphisms in ABCB11 at the complementary DNA position 1331 with a thymine replaced by a cytosine (1331 T > C, rs2287622), leading to an exchange from valine to alanine (V444A), and in ABCB4 at position 959 in exon 9 with a cytosine replaced by a thymine (959 C > T), leading to an exchange of serine to phenylalanine (S320F), and some other synonymous SNPs are considered to be related to the etiology of severe type of ICP [15]. Login to comment
27 The genetic sequence analysis showed a homozygous polymorphism in ABCB11 at 1331 T > C leading to V444A that is often reported in the conditions [1,15]. Login to comment
48 The nonsynonymous polymorphism in ABCB11 was a major single-nucleotide exchange from thymine to cytosine at the position 1331 (1331 T > C), leading to an exchange from valine to alanine (V444A). Login to comment
63 In addition, it has been reported that the SNP in ABCB11 (1331 T > C), leading to an exchange from valine to alanine (V444A), is related Figure 1 Single-nucleotide polymorphisms in ABCB11 and ABCB4 of the patient. Login to comment

[hide] Genetic susceptibility to hepatoxicity due to bose... Ann Hepatol. 2014 Nov-Dec;13(6):803-9. Seyfarth HJ, Favreau N, Tennert C, Ruffert C, Halank M, Wirtz H, Mossner J, Rosendahl J, Kovacs P, Wittenburg H
Genetic susceptibility to hepatoxicity due to bosentan treatment in pulmonary hypertension.
Ann Hepatol. 2014 Nov-Dec;13(6):803-9., [PMID:25332267]

Abstract [show]
BACKGROUND: Hepatotoxicity is a major side effect of treatment with bosentan in patients with pulmonary hypertension (PH). Bosentan is metabolized by the cytochrome CYP2C9 and inhibits the bile salt export pump, which is encoded by ABCB11. This suggests that genetic variants of CYP2C9 and/or ABCB11 may predispose patients to bosentan-induced liver injury. MATERIAL AND METHODS: PH patients with (n = 23) or without (n = 25) an increase of alanine aminotransferase (ALT) or aspartate-aminotransferase (AST) during bosentan therapy were included in our analysis. Functionally relevant alleles of CYP2C9 and 16 representative variants of ABCB11 were genotyped. Data were analyzed using logistic regression. RESULTS: Variants of ABCB11 were not associated with bosentan-induced liver injury. In contrast, variant alleles of CYP2C9 were more common in patients with elevated transaminases (allele frequency 52%) compared to controls (allele frequency 24%, P = 0.04, odds ratio 3.5, 95% confidence interval 1.01-11.8). CONCLUSION: Our data indicate hepatotoxicity of bosentan from decreased hepatic metabolism due to common variants of CYP2C9.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 One common variant of the ABCB11 gene (rs228762, p.V444A) leads to lower BSEP expression levels and is associated with drug induced liver injury from various drugs.15 The major transcription factor for ABCB11 is the nuclear bile salt receptor FXR, encoded by the NR1H4 gene.16 A polymorphism of NR1H4 (rs56163822, c.1G/T) was previously confirmed to influence transcription.17 Interestingly, a recent study suggested protection against acetaminophen-induced liver injury from activation of FXR.18 In the current study, we systematically investigated genetic variants of CYP2C9, ABCB11 and NR1H4 as possible genetic risk factors for the development of cholestasis in PH patients during treatment with bosentan. Login to comment

[hide] Autoimmune BSEP disease: disease recurrence after ... Clin Rev Allergy Immunol. 2015 Jun;48(2-3):273-84. doi: 10.1007/s12016-014-8457-4. Kubitz R, Droge C, Kluge S, Stross C, Walter N, Keitel V, Haussinger D, Stindt J
Autoimmune BSEP disease: disease recurrence after liver transplantation for progressive familial intrahepatic cholestasis.
Clin Rev Allergy Immunol. 2015 Jun;48(2-3):273-84. doi: 10.1007/s12016-014-8457-4., [PMID:25342496]

Abstract [show]
Severe cholestasis may result in end-stage liver disease with the need of liver transplantation (LTX). In children, about 10 % of LTX are necessary because of cholestatic liver diseases. Apart from bile duct atresia, three types of progressive familial intrahepatic cholestasis (PFIC) are common causes of severe cholestasis in children. The three subtypes of PFIC are defined by the involved genes: PFIC-1, PFIC-2, and PFIC-3 are due to mutations of P-type ATPase ATP8B1 (familial intrahepatic cholestasis 1, FIC1), the ATP binding cassette transporter ABCB11 (bile salt export pump, BSEP), or ABCB4 (multidrug resistance protein 3, MDR3), respectively. All transporters are localized in the canalicular membrane of hepatocytes and together mediate bile salt and phospholipid transport. In some patients with PFIC-2 disease, recurrence has been observed after LTX, which mimics a PFIC phenotype. It could be shown by several groups that inhibitory anti-BSEP antibodies emerge, which most likely cause disease recurrence. The prevalence of severe BSEP mutations (e.g., splice site and premature stop codon mutations) is very high in this group of patients. These mutations often result in the complete absence of BSEP, which likely accounts for an insufficient auto-tolerance against BSEP. Although many aspects of this "new" disease are not fully elucidated, the possibility of anti-BSEP antibody formation has implications for the pre- and posttransplant management of PFIC-2 patients. This review will summarize the current knowledge including diagnosis, pathomechanisms, and management of "autoimmune BSEP disease."

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The three mutations/variants Y818F, G982R, and V444A have been found on the same allele in a PFIC-2 patient. Login to comment
53 The combination with the common BSEP polymorphism V444A results in complete degradation by ERAD, which can only be unmasked by proteasomal inhibition [22]. Login to comment

[hide] Successful pregnancy after ileal exclusion in prog... Ann Hepatol. 2015 Jul-Aug;14(4):550-2. Czubkowski P, Jankowska I, Pawlowska J
Successful pregnancy after ileal exclusion in progressive familial intrahepatic cholestasis type 2.
Ann Hepatol. 2015 Jul-Aug;14(4):550-2., [PMID:26019043]

Abstract [show]
Progressive familial intrahepatic cholestasis type 2 (PFIC 2) results from mutations in ABCB11 gene coding bile salt export pump (BSEP). Medical treatment is usually unsuccessful and surgery intervention is necessary. Partial external biliary diversion (PEBD) is regarded as the first choice of surgical treatment. Ileal exclusion (IE) is an alternative operation if external stoma is not tolerated; however, a favorable outcome is uncertain. In chronic liver diseases pregnancy brings additional risk of deterioration of liver function and generally is not recommended. We present the first case report of successful pregnancy in a genetically confirmed PFIC 2 patient after surgical conversion from PEBD to IE.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Several estrogens and progesterone metabolites are able to induce trans-inhibition of BSEP and the subsequent toxicity induced by the accumulation of bile acids, which may also play a role in the etiopathogenesis of intrahepatic cholestasis of pregnancy (ICP).10,11 Mutations in MDR3 (ABCB4) gene coding transporter for phospholipids across the canalicular membrane may account for 15% of cases of ICP.12 Interestingly, a Czubkowski P, et al. , 2015; 14 (4): 550-552 few "common" BSEP mutations (including p.E297G, p.D482G, and p.N591S) have been detected in ICP-patients in heterozygous form, and common BSEP polymorphism (p.V444A) has been linked to ICP as well.13 The reoccurrence of BSEP cholestasis and development of ICP may be clinically indistinguishable, since both usually present with pruritus, elevated bile acids and aminotransferases, and normal hepatic imaging.11,12 Moreover, in ICP, mutations or polymorphisms of some hepatobiliary transport proteins may contribute to disease pathogenesis or severity, but on the other hand consideration must be given to the possibility of other rare underlying hepatic disorders that may be unmasked during pregnancy with cholestasis as its first manifestation.14 Thus, the diagnosis of ICP should be given after exclusion of preexisting liver disease.15 Pruritus remains the most important clinical symptom of PFIC-2. Login to comment