ABCMdb

ABCB11 p.Arg832Cys

Reviews:	p.Arg832Cys D p.Arg832His D
Predicted by SNAP2:	A: D (91%), C: D (85%), D: D (95%), E: D (91%), F: D (91%), G: D (91%), H: D (91%), I: D (91%), K: D (85%), L: D (91%), M: D (91%), N: D (91%), P: D (95%), Q: D (85%), S: D (91%), T: D (91%), V: D (91%), W: D (95%), Y: D (91%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Missense mutations and single nucleotide polymorph... Hepatology. 2009 Feb;49(2):553-67. Byrne JA, Strautnieks SS, Ihrke G, Pagani F, Knisely AS, Linton KJ, Mieli-Vergani G, Thompson RJ
Missense mutations and single nucleotide polymorphisms in ABCB11 impair bile salt export pump processing and function or disrupt pre-messenger RNA splicing.
Hepatology. 2009 Feb;49(2):553-67., [PMID:19101985]

Abstract [show]
The gene encoding the human bile salt export pump (BSEP), ABCB11, is mutated in several forms of intrahepatic cholestasis. Here we classified the majority (63) of known ABCB11 missense mutations and 21 single-nucleotide polymorphisms (SNPs) to determine whether they caused abnormal ABCB11 pre-messenger RNA splicing, abnormal processing of BSEP protein, or alterations in BSEP protein function. Using an in vitro minigene system to analyze splicing events, we found reduced wild-type splicing for 20 mutations/SNPs, with normal mRNA levels reduced to 5% or less in eight cases. The common ABCB11 missense mutation encoding D482G enhanced aberrant splicing, whereas the common SNP A1028A promoted exon skipping. Addition of exogenous splicing factors modulated several splicing defects. Of the mutants expressed in vitro in CHO-K1 cells, most appeared to be retained in the endoplasmic reticulum and degraded. A minority had BSEP levels similar to wild-type. The SNP variant A444 had reduced levels of protein compared with V444. Treatment with glycerol and incubation at reduced temperature overcame processing defects for several mutants, including E297G. Taurocholate transport by two assessed mutants, N490D and A570T, was reduced compared with wild-type. Conclusion: This work is a comprehensive analysis of 80% of ABCB11 missense mutations and single-nucleotide polymorphisms at pre-mRNA splicing and protein processing/functional levels. We show that aberrant pre-mRNA splicing occurs in a considerable number of cases, leading to reduced levels of normal mRNA. Thus, primary defects at either the protein or the mRNA level (or both) contribute significantly to BSEP deficiency. These results will help to develop mutation-specific therapies for children and adults suffering from intrahepatic cholestasis due to BSEP deficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 Differential splice products were seen for six predicted ABCB11 missense mutations, leading to very low levels of wild-type splicing (indicated in parentheses): E297K (c.889GϾA; 50%; Fig. 2B), D482G (c.1445AϾG; 5%; Fig. 2C), R832C (c.2494CϾT; 50%; Fig. 2E), and S1144R (c.3432CϾA; 3%), R1153H (c.3458GϾA; 3%), and S1154P (c.3460TϾC; 3%; Fig. 2F). Login to comment
111 Positive-acting and negative-act- Exon 14 D482G Aberrant product Exon 14Minigene Cryptic acceptor splice Exon 14 CTACCACCATTGCAGAAAATATTCGCTATG ATACCATCATCCCAGAAAATATTCGCTATG ATCTCTTTTCACCCAATTTCTACAGGGCAATGCTGGGGCAAGAT Exon 21Exon 20 R832C Aberrant product AAGGCTACGTAAATTTGGTTTCAGGGCAATGCTGGGGCAAGAT AAGGCTATGTAAATTTGGTTTCAGGGCAATGCTGGGGCAAGAT Exon 21 R832C Exon 21 Cryptic acceptor splice Exon 9 E297K Aberrant product CTGCTTTTGGTGGTGAGAAAAGAGAGGTTGAAAGgttggtta Normal donor splice siteCryptic donor splice site CTGCTTTTGGTGGTAAGAAAAGAGAGGTTGAAAGgttggttaE297K Exon 9 CTGCTTTTGGTGCTGTTCCTCCTCCCACTGACCTGCGATT MinigeneExon 9 Intron 9 Intron 9 S1144R, R1153H, S1154P Aberrant product Exon 26 ATACCATCATCCCAGGAACCAGTGTTGTTTGCCT Exon 26Minigene AATTGTTTCCCAGGAACCAGTGTTGTTTGCCTCAG Cryptic acceptor splice D Fig. 3. Login to comment
112 (A-D) Illustration of variant splice forms associated with ABCB11 mutations (A) E297K, (B) D482G, (C) R832C, and (D) S1144R, R1153H, and S1154P. Login to comment

[hide] Progressive familial intrahepatic cholestasis. Orphanet J Rare Dis. 2009 Jan 8;4:1. Davit-Spraul A, Gonzales E, Baussan C, Jacquemin E
Progressive familial intrahepatic cholestasis.
Orphanet J Rare Dis. 2009 Jan 8;4:1., [PMID:19133130]

Abstract [show]
Progressive familial intrahepatic cholestasis (PFIC) refers to heterogeneous group of autosomal recessive disorders of childhood that disrupt bile formation and present with cholestasis of hepatocellular origin. The exact prevalence remains unknown, but the estimated incidence varies between 1/50,000 and 1/100,000 births. Three types of PFIC have been identified and related to mutations in hepatocellular transport system genes involved in bile formation. PFIC1 and PFIC2 usually appear in the first months of life, whereas onset of PFIC3 may also occur later in infancy, in childhood or even during young adulthood. Main clinical manifestations include cholestasis, pruritus and jaundice. PFIC patients usually develop fibrosis and end-stage liver disease before adulthood. Serum gamma-glutamyltransferase (GGT) activity is normal in PFIC1 and PFIC2 patients, but is elevated in PFIC3 patients. Both PFIC1 and PFIC2 are caused by impaired bile salt secretion due respectively to defects in ATP8B1 encoding the FIC1 protein, and in ABCB11 encoding the bile salt export pump protein (BSEP). Defects in ABCB4, encoding the multi-drug resistant 3 protein (MDR3), impair biliary phospholipid secretion resulting in PFIC3. Diagnosis is based on clinical manifestations, liver ultrasonography, cholangiography and liver histology, as well as on specific tests for excluding other causes of childhood cholestasis. MDR3 and BSEP liver immunostaining, and analysis of biliary lipid composition should help to select PFIC candidates in whom genotyping could be proposed to confirm the diagnosis. Antenatal diagnosis can be proposed for affected families in which a mutation has been identified. Ursodeoxycholic acid (UDCA) therapy should be initiated in all patients to prevent liver damage. In some PFIC1 or PFIC2 patients, biliary diversion can also relieve pruritus and slow disease progression. However, most PFIC patients are ultimately candidates for liver transplantation. Monitoring of hepatocellular carcinoma, especially in PFIC2 patients, should be offered from the first year of life. Hepatocyte transplantation, gene therapy or specific targeted pharmacotherapy may represent alternative treatments in the future.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 Thus detectable BSEP expression (i.e. p.N490D, p.G562D, p.R832C, p.A1110E) does not exclude functional BSEP deficiency. Login to comment

[hide] Severe bile salt export pump deficiency: 82 differ... Gastroenterology. 2008 Apr;134(4):1203-14. doi: 10.1053/j.gastro.2008.01.038. Epub 2008 Jan 18. Strautnieks SS, Byrne JA, Pawlikowska L, Cebecauerova D, Rayner A, Dutton L, Meier Y, Antoniou A, Stieger B, Arnell H, Ozcay F, Al-Hussaini HF, Bassas AF, Verkade HJ, Fischler B, Nemeth A, Kotalova R, Shneider BL, Cielecka-Kuszyk J, McClean P, Whitington PF, Sokal E, Jirsa M, Wali SH, Jankowska I, Pawlowska J, Mieli-Vergani G, Knisely AS, Bull LN, Thompson RJ
Severe bile salt export pump deficiency: 82 different ABCB11 mutations in 109 families.
Gastroenterology. 2008 Apr;134(4):1203-14. doi: 10.1053/j.gastro.2008.01.038. Epub 2008 Jan 18., [PMID:18395098]

Abstract [show]
BACKGROUND & AIMS: Patients with severe bile salt export pump (BSEP) deficiency present as infants with progressive cholestatic liver disease. We characterized mutations of ABCB11 (encoding BSEP) in such patients and correlated genotypes with residual protein detection and risk of malignancy. METHODS: Patients with intrahepatic cholestasis suggestive of BSEP deficiency were investigated by single-strand conformation polymorphism analysis and sequencing of ABCB11. Genotypes sorted by likely phenotypic severity were correlated with data on BSEP immunohistochemistry and clinical outcome. RESULTS: Eighty-two different mutations (52 novel) were identified in 109 families (9 nonsense mutations, 10 small insertions and deletions, 15 splice-site changes, 3 whole-gene deletions, 45 missense changes). In 7 families, only a single heterozygous mutation was identified despite complete sequence analysis. Thirty-two percent of mutations occurred in >1 family, with E297G and/or D482G present in 58% of European families (52/89). On immunohistochemical analysis (88 patients), 93% had abnormal or absent BSEP staining. Expression varied most for E297G and D482G, with some BSEP detected in 45% of patients (19/42) with these mutations. Hepatocellular carcinoma or cholangiocarcinoma developed in 15% of patients (19/128). Two protein-truncating mutations conferred particular risk; 38% (8/21) of such patients developed malignancy versus 10% (11/107) with potentially less severe genotypes (relative risk, 3.7 [confidence limits, 1.7-8.1; P = .003]). CONCLUSIONS: With this study, >100 ABCB11 mutations are now identified. Immunohistochemically detectable BSEP is typically absent, or much reduced, in severe disease. BSEP deficiency confers risk of hepatobiliary malignancy. Close surveillance of BSEP-deficient patients retaining their native liver, particularly those carrying 2 null mutations, is essential.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
150 Missense Mutations in ABCB11 Nucleotide change Predicted effect Exon CpG site Location Change in: Size Charge Hyd/Pol Shape c.149Tb0e;C p.Leu50Ser 4 No NH2 term Y Y Y c.470Ab0e;G p.Tyr157Cys 6 No TM2 Y Y Y c.725Cb0e;T p.Thr242Ile 8 No TM4 Y Y c.890Ab0e;G p.Glu297Gly 9 No IC2 Y Y Y c.908Gb0e;A p.Arg303Lys 9 No IC2 c.937Cb0e;A p.Arg313Ser 10 Yes IC2 Y Y Y Y c.980Gb0e;A p.Gly327Glu 10 No TM5 Y Y Y c.1168Gb0e;C p.Ala390Pro 11 No TM/NBF Y c.1229Gb0e;A p.Gly410Asp 12 No TM/NBF Y Y c.1238Tb0e;G p.Leu413Trp 12 No TM/NBF c.1388Cb0e;T p.Thr463Ile 13 No Adj Walker A Y Y Y c.1396Cb0e;A p.Gln466Lys 13 No Adj Walker A Y c.1409Gb0e;A p.Arg470Gln 13 Yes Adj Walker A Y c.1415Ab0e;G p.Tyr472Cys 13 No Adj Walker A Y Y Y c.1442Tb0e;A p.Val481Glu 14 No NBF1 Y Y Y c.1445Ab0e;G p.Asp482Gly 14 No NBF1 Y Y c.1460Gb0e;C p.Arg487Pro 14 Yes NBF1 Y Y Y Y c.1468Ab0e;G p.Asn490Asp 14 No NBF1 Y c.1535Tb0e;C p.Ile512Thr 14 No NBF1 Y Y Y c.1544Ab0e;C p.Asn515Thr 14 No NBF1 Y Y c.1550Gb0e;A p.Arg517His 14 Yes NBF1 Y Y c.1621Ab0e;C p.Ile541Leu 14 No NBF1 c.1622Tb0e;C p.Ile541Thr 14 No NBF1 Y Y Y c.1643Tb0e;A p.Phe548Tyr 15 No Adj ABC c.1685Gb0e;A p.Gly562Asp 15 No ABC Y Y c.1708Gb0e;A p.Ala570Thr 15 Yes ABC/Walker B Y c.1763Cb0e;T p.Ala588Val 15 No Adj Walker B Y c.2272Gb0e;C p.Gly758Arg 19 No NBF/TM Y Y Y c.2296Gb0e;A p.Gly766Arg 19 Yes TM7 Y Y Y c.2494Cb0e;T p.Arg832Cys 21 Yes IC3 Y Y Y Y c.2576Cb0e;G p.Thr859Arg 21 No IC3 Y Y Y Y c.2842Cb0e;T p.Arg948Cys 23 Yes IC4 Y Y Y Y c.2935Ab0e;G p.Asn979Asp 23 No TM11 Y c.2944Gb0e;A p.Gly982Arg 23 Yes TM11 Y Y Y c.3086Cb0e;A p.Thr1029Lys 24 No TM12 Y Y Y Y c.3329Cb0e;A p.Ala1110Glu 25 Yes Adj Walker A Y Y Y c.3382Cb0e;T p.Arg1128Cys 25 Yes Adj Walker A Y Y Y Y c.3457Cb0e;T p.Arg1153Cys 26 Yes NBF2 Y Y Y Y c.3458Gb0e;A p.Arg1153His 26 Yes NBF2 Y Y c.3460Tb0e;C p.Ser1154Pro 26 No NBF2 Y c.3628Ab0e;C p.Thr1210Pro 27 No Adj ABC Y c.3691Cb0e;T p.Arg1231Trp 27 Yes ABC/Walker B Y Y c.3692Gb0e;A p.Arg1231Gln 27 Yes ABC/Walker B Y c.3724Cb0e;A p.Leu1242Ile 27 No Walker B c.3892Gb0e;A p.Gly1298Arg 28 No NBF2 Y Y Y NOTE. Login to comment
189 (E) BSEP staining in patient 29, homozygote for ABCB11 mutation yielding R832C. Login to comment
207 Ten mutations occurred in multiple families: R470Q, R832C,33 R948C, A1110E, and R1231Q53 have now been reported in 2 families; R1090X2 in 3 families; G982R,1,2 R1153C,1,47 and R1153H in 4 families; and R575X in 6 families.1,2,32,45 Six common missense and nonsense changes occurred at non-CpG sites: R520X and A588V33 in 2 European families and E1302X and I541L33,54 in 3 European families each. Login to comment
233 Abnormal BSEP staining was seen with L50S, Q466K, N515T, R517H, I541L, and F548Y and normal with N490D, G562D, R832C, and A1110E. Login to comment

[hide] Small intestinal bacterial overgrowth in patients ... Acta Biochim Pol. 2014;61(1):103-7. Epub 2014 Mar 17. Lisowska A, Kobelska-Dubiel N, Jankowska I, Pawlowska J, Moczko J, Walkowiak J
Small intestinal bacterial overgrowth in patients with progressive familial intrahepatic cholestasis.
Acta Biochim Pol. 2014;61(1):103-7. Epub 2014 Mar 17., [PMID:24644547]

Abstract [show]
BACKGROUND & AIMS: To date, no studies concerning the presence of small intestinal bacterial overgrowth in patients with progressive familial intrahepatic cholestasis were published. Based upon characteristic of progressive familial intrahepatic cholestasis one can expect the coexistence of small intestinal bacterial overgrowth. The aim of the study was to assess the incidence of small intestinal bacterial overgrowth in patients with progressive familial intrahepatic cholestasis. METHODS: 26 patients aged 8 to 25 years with progressive familial intrahepatic cholestasis were included in the study. Molecular analysis of ABCB11 gene was performed in the vast majority of patients. In all patients Z-score for body weight and height, biochemical tests (bilirubin, bile acid concentration, fecal fat excretion) were assessed. In all patients hydrogen-methane breath test was performed. RESULTS: On the basis of first hydrogen-methane breath test, diagnosis of small intestinal bacterial overgrowth was confirmed in 9 patients (35%), 5 patients (19%) had borderline results. The second breath test was performed in 10 patients: in 3 patients results were still positive and 2 patients had a borderline result. The third breath test was conducted in 2 patients and positive results were still observed. Statistical analysis did not reveal any significant correlations between clinical, biochemical and therapeutic parameters in patients with progressive familial intrahepatic cholestasis and coexistence of small intestinal bacterial overgrowth. CONCLUSIONS: Our results suggest that small intestinal bacterial overgrowth is frequent in patients with progressive familial intrahepatic cholestasis. Moreover, it seems that this condition has the tendency to persist or recur, despite the treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 c.2494 C>T; p.Arg832Cys N/-/- 11.9 -1.73 -3.27 BD 0.9 5.6 13 M c.890 A>G; p.Glu297Gly. Login to comment

[hide] Genetic variations of bile salt transporters. Drug Discov Today Technol. 2014 Jun;12:e55-67. doi: 10.1016/j.ddtec.2014.03.006. Kubitz R, Droge C, Kluge S, Stindt J, Haussinger D
Genetic variations of bile salt transporters.
Drug Discov Today Technol. 2014 Jun;12:e55-67. doi: 10.1016/j.ddtec.2014.03.006., [PMID:25027376]

Abstract [show]
Bile salt transporters directly or indirectly influence biological processes through physicochemical or signalling properties of bile salts. The coordinated action of uptake and efflux transporters in polarized epithelial cells of the liver, biliary tree, small intestine and kidney determine bile salt concentrations in different compartments of the body. Genetic variations of bile salt transporters lead to clinical relevant phenotypes of varying severity ranging from a predisposition for drug-induced liver injury to rapidly progressing end-stage liver disease. This review focuses on the impact of genetic variations of bile salt transporters including BSEP, NTCP, ASBT and OSTalpha/beta and discusses approaches for transporter analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
137 BSEP/Bsep NTCP ASBT Exon skipping E186G G1116R G319G R1128C T463I R1128H A926P E1186K A1028Aa R1231W A1110E Aberrant splicing E297K R1153H R832C S1154P S1144R No splice product T586I R1231Q Reduced plasma membrane expression E135K A570T I223T E297Gb N591Sb V444A R1050C Intracellular retention Y818F G982R Reduced or absent bile salt transport A570T R432T A64T K314E V98Ic M264V I206V Q558H I223T C144Y P290S E297Gb N591Sb S267F L243P G374S E1186K I279T T262M a A1028A induces significant exon skipping in vitro but probably not in vivo (unpublished data; Dro &#a8;ge, Ha &#a8;ussinger, Kubitz). Login to comment

[hide] Two Case Reports of Successful Treatment of Choles... Pediatrics. 2015 May;135(5):e1326-32. doi: 10.1542/peds.2014-2376. Epub 2015 Apr 6. Engelmann G, Wenning D, Herebian D, Sander O, Droge C, Kluge S, Kubitz R
Two Case Reports of Successful Treatment of Cholestasis With Steroids in Patients With PFIC-2.
Pediatrics. 2015 May;135(5):e1326-32. doi: 10.1542/peds.2014-2376. Epub 2015 Apr 6., [PMID:25847799]

Abstract [show]
Mutations in the gene encoding the canalicular bile salt export pump (BSEP) can result in progressive familial intrahepatic cholestasis type 2 (PFIC-2). Treatment options are limited, and PFIC-2 often necessitates liver transplantation. We report on a young woman and a boy who clinically presented with PFIC-2 phenotypes and dramatically improved with steroid treatment. Gene sequencing of ABCB11 encoding for BSEP revealed 2 relevant mutations in both patients. The young woman was compound heterozygous for p.T919del and p.R1235X. At the age of 5 years, partial biliary diversion was performed and rescued liver function but left serum bile salt levels elevated. At age 23 she developed systemic lupus erythematosus. Unexpectedly, steroid therapy normalized serum bile salt levels, with a strong correlation with the steroid dose. She is currently in clinical remission. The boy was compound heterozygous for the ABCB11 mutations c.150+3A>C and p.R832C and presented with intractable pruritus. When he developed colitis, he was treated with steroids. The pruritus completely disappeared and relapsed when steroids were withdrawn. To date, with low-dose budesonide, the boy has been symptom-free for >3 years. In conclusion, the clinical courses suggest that patients with BSEP deficiency and residual BSEP activity may benefit from steroid-based therapy, which represents a new treatment option.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
9 The boy was compound heterozygous for the ABCB11 mutations c.150+3A.C and p.R832C and presented with intractable pruritus. Login to comment
61 In the 20th coding exon a heterozygotic missense mutation c.2494C.T (p.R832C, inherited by the mother) was detected together with the heterozygotic splice site mutation c.150+3A.C distally to exon 3 (inherited by the father). Login to comment
82 Patient 2 and his brother (our patient`s younger brother with the same phenotype but much lesser symptoms has not been treated with steroids so far) are compound heterozygous for the splice site mutation c.150+3A.C in intervening sequence 4 (IVS4) and the missense mutation c.2494C.T (p.R832C) in ABCB11 coding exon 20. Login to comment