ABCMdb

PMID: 17542813

Takahashi N, Morita M, Maeda T, Harayama Y, Shimozawa N, Suzuki Y, Furuya H, Sato R, Kashiwayama Y, Imanaka T
Adrenoleukodystrophy: subcellular localization and degradation of adrenoleukodystrophy protein (ALDP/ABCD1) with naturally occurring missense mutations.
J Neurochem. 2007 Jun;101(6):1632-43., [PubMed]

Sentences

No. Mutations Sentence Comment

2 ABCD1 p.Tyr174Cys ABCD1 p.Gly116Arg ABCD1 p.Ser606Pro ABCD1 p.His667Asp ABCD1 p.Arg617His ABCD1 p.Ser606Leu ABCD1 p.Gln544Arg ABCD1 p.Arg104Cys ABCD1 p.Ser342Pro In this study, we chose nine arbitrary mutant human ALDP forms (R104C, G116R, Y174C, S342P, Q544R, S606P, S606L, R617H, and H667D) with naturally occurring missense mutations and examined the intracellular behavior. Login to comment 3 ABCD1 p.His667Asp ABCD1 p.Arg617His ABCD1 p.Ser606Leu When expressed in X-ALD fibroblasts lacking ALDP, the expression level of mutant His-ALDPs (S606L, R617H, and H667D) was lower than that of wild type and other mutant ALDPs. Login to comment 4 ABCD1 p.His667Asp ABCD1 p.Ser606Leu Furthermore, mutant ALDP-green fluorescence proteins (S606L and H667D) stably expressed in CHO cells were not detected due to rapid degradation. Login to comment 6 ABCD1 p.Arg617His In the case of X-ALD fibroblasts from an ALD patient (R617H), the mutant ALDP was not detected in the cells, but appeared upon incubation with a proteasome inhibitor. Login to comment 7 ABCD1 p.His667Asp When CHO cells expressing mutant ALDP-green fluorescence protein (H667D) were cultured in the presence of a proteasome inhibitor, both the mutant and wild type ALDP reappeared. Login to comment 8 ABCD1 p.Tyr174Cys In addition, mutant His-ALDP (Y174C), which has a mutation between transmembrane domain 2 and 3, did not exhibit peroxisomal localization by immunofluorescense study. Login to comment 9 ABCD1 p.His667Asp ABCD1 p.Arg617His ABCD1 p.Ser606Leu These results suggest that mutant ALDPs, which have a mutation in the COOH-terminal half of ALDP, including S606L, R617H, and H667D, were degraded by proteasomes after dimerization. Login to comment 35 ABCD1 p.Tyr174Cys ABCD1 p.Gly116Arg ABCD1 p.Ser606Pro ABCD1 p.His667Asp ABCD1 p.Arg617His ABCD1 p.Ser606Leu ABCD1 p.Gln544Arg ABCD1 p.Arg104Cys ABCD1 p.Ser342Pro We found that mutant ALDPs with the missense mutations in the G116R S342P Q544R R617H H667D Y174C NH2 COOH C sequence Cytosol Membrane Matrix Walker A Walker B S606P, S606L R104C Fig. 1 A putative secondary structure of adrenoleukodystrophy protein. Login to comment 71 ABCD1 p.Tyr174Cys ABCD1 p.Gly116Arg ABCD1 p.Ser606Pro ABCD1 p.His667Asp ABCD1 p.Arg617His ABCD1 p.Ser606Leu ABCD1 p.Gln544Arg ABCD1 p.Arg104Cys ABCD1 p.Ser342Pro CHO-K1 cells (5 · 105 cells) were cultured in Ham`s F-12 medium with 10% FBS, 70 lg/mL of penicillin, and 140 lg/mL of streptomycin and transfected with 5 lg of pMAM2/ Table 1 Oligonucleotide primer sequences used for the generation of mutant ALDP constructs Construct name Forward primer (5' to 3') (top) R104C GCCTTGGTGAGCTGCACCTTCCTGTCG G116R GCCCGCCTGGACAGAAGGCTGGCC Y174C GCCTACCGCCTCTGCTCCTCCCAG S342P TGGAGCGCCCCGGGCCTGCTCATG Q544R GCATGTTCTACATCCCGCGGAGGCCCTACATGTC S606P AAGGACGTCCTGCCGGGTGGCGAGAAG S606L AAGGACGTCCTGTTGGGTGGCGAGAAG R617H GCAGAGAATCGGCATGGCCCACATGTTCTACCACAGGC H667D TCCCTGTGGAAATACGACACACACTTGCTA The underlined letters indicate the single base mutation leading to an amino acid replacement. Login to comment 119 ABCD1 p.Tyr174Cys ABCD1 p.Gly116Arg ABCD1 p.Ser606Pro ABCD1 p.Gln544Arg ABCD1 p.Arg104Cys ABCD1 p.Ser342Pro Six mutant His-ALDPs (R104C, G116R, Y174C, S342P, Q544R, and S606P) were expressed in an equal amount to the wild type His-ALDP. Login to comment 120 ABCD1 p.His667Asp ABCD1 p.Arg617His ABCD1 p.Ser606Leu However, the ratios of certain His-ALDPs (S606L, R617H, and H667D) were significantly lower than those of wild type His-ALDP and other mutant His-ALDPs. Login to comment 123 ABCD1 p.His667Asp ABCD1 p.Arg617His ABCD1 p.Ser606His Therefore, we focused our attention on mutant ALDP (S606H, R617H, and H667D) and examined the expression level with co-expression of GFP. Login to comment 125 ABCD1 p.His667Asp ABCD1 p.Arg617His ABCD1 p.Ser606Leu Taken together, it appears His-ALDP (S606L, R617H, and H667D) might be degraded after translation. Login to comment 127 ABCD1 p.Gly116Arg ABCD1 p.Ser606Pro ABCD1 p.Ser606Leu ABCD1 p.Gln544Arg ABCD1 p.Arg104Cys ABCD1 p.Ser342Pro As shown in Fig. 3d, His-ALDPs (R104C, G116R, S342P, Q544R, S606P, and S606L) exhibited a punctate staining pattern in the cells, which was superimposable on the distribution of catalase in the same cells, suggesting that these mutant His-ALDPs were correctly localized to peroxisomes. Login to comment 128 ABCD1 p.Tyr174Cys ABCD1 p.His667Asp In contrasts, His-ALDPs (Y174C and H667D) appear to be mislocated to other organelles. Login to comment 129 ABCD1 p.Arg617His Immunofluorescent dots of His-ALDP (R617H) were scarcely detected in the cells because of the low level of expression. Login to comment 135 ABCD1 p.Tyr174Cys ABCD1 p.Gly116Arg ABCD1 p.Ser606Pro ABCD1 p.His667Asp ABCD1 p.Ser606Leu ABCD1 p.Arg104Cys In this experiment, we chose R104C, G116R, and S606P (with normal localization in peroxisomes), Y174C (mislocalization), and S606L and H667D (degradation). Login to comment 139 ABCD1 p.Ser606Pro ABCD3 p.Gly116Arg Wild type ALDP-GFP and mutant ALDP-GFP (G116R and S606P) were recovered mainly in the fractions 3 and 4 and the distribution was similar to those of PMP70 and catalase, suggesting that these ALDP-GFPs had located to peroxisomes as had the corresponding His-ALDPs in 163T cells. Login to comment 141 ABCD1 p.His667Asp ABCD1 p.Ser606Leu In contrast, mutant ALDP-GFP (S606L and H667D) was not detected in any subcellular fractions although PMP70 and catalase were recovered in fractions 2 and 3. Login to comment 149 ABCD1 p.Arg104Cys On the other hand, mutant ALDP-GFP (R104C) was recovered in fractions 3 and 4, but some fragmentation of the ALDP-GFP was found in the fractions. Login to comment 150 ABCD1 p.Tyr174Cys ABCD1 p.Ser606Pro ABCD1 p.His667Asp ABCD1 p.Arg617His ABCD1 p.Ser606Leu ABCD1 p.Ser606Leu ABCD1 p.Gln544Arg ABCD1 p.Arg104Cys ABCD1 p.Ser342Pro ABCD3 p.Gly116Arg The fragments were not extractable with 0.1 mol/L sodium carbonate, indicating (a) (c) (b) (d) 400 140 120 100 Expressionratio(%) 80 60 40 His-ALDP R104C G116R Y174C S342P Q544R S606P S606L R617H H667D Catalase 20 0 100 Expressionratio(%) 80 60 40 20 0 350 300 250 200 150 pmol/h/mgprotein 100 50 0 Normal (139T) X-ALD (163T) M ock M ock W ild W ild N one S606L His-ALDP GFP Catalase R 617H H 667D R 104CG 116RY174C S342PQ 544RS606PS606LR 617HH 667D M ock W ildR 104CG 116RY174CS342PQ 544RS606PS606LR 617HH 667D Fig. 3 Expression of wild type and mutant His-adrenoleukodystrophy proteins (ALDPs) in X-linked adrenoleukodystrophy (X-ALD) fibroblasts (163T). Login to comment 159 ABCD1 p.His667Asp ABCD1 p.Arg617His ABCD1 p.Ser606Leu (c) Co-expression of wild or mutant His-ALDP (S606L, R617H, or H667D) with green fluorescence proteins (GFP). Login to comment 167 ABCD1 p.Arg104Cys It is likely that a part of the mutant ALDP-GFP (R104C) was degraded on the peroxisomal membranes. Login to comment 168 ABCD1 p.Tyr174Cys In the case of mutant ALDP-GFP (Y174C), only a small amount of ALDP-GFP was recovered in fractions 3 and 4 where the peroxisomes were recovered. Login to comment 169 ABCD1 p.His667Asp ABCD1 p.Arg617His ABCD1 p.Ser606Leu ABCD1 p.Arg104Cys Effect of proteasome inhibitors on mutant ALDP The transient and stable expression experiments of mutant ALDPs suggest that mutant ALDPs such as S606L, R617H, H667D, and R104C are degraded by proteases. Login to comment 170 ABCD1 p.His667Asp ABCD1 p.His667Asp As CHO cells stably expressed wild type ALDP and mutant ALDP-GFP (H667D) did not show any immunodetectable proteins corresponding to ALDP or ALDP-GFP, we attempted to inhibit the degradation of ALDP-GFP (H667D) by treatment with several protease inhibitors. Login to comment 175 ABCD1 p.His667Asp Furthermore, we analyzed where ALDP-GFP (H667D) was located in the cells after treatment with MG132. Login to comment 177 ABCD1 p.His667Asp In the absence of MG132, CHO cells expressing mutant ALDP-GFP (H667D) did not show any fluorescent dots after the permeabilization by digitonin (data not shown). Login to comment 178 ABCD1 p.His667Asp As in Fig. 6, in the presence of MG132, immunofluorescent dots of mutant ALDP-GFP (H667D) were detected and the dots were superimposable on the pattern of PMP70. Login to comment 179 ABCD1 p.His667Asp Newly synthesized ALDP-GFP (H667D) might escape from degradation in cytosol and target peroxisomes or localize on peroxisomal membranes after targeting to peroxisomes. Login to comment 180 ABCD1 p.Tyr174Cys ABCD1 p.Ser606Pro ABCD1 p.His667Asp ABCD1 p.Ser606Leu ABCD1 p.Ser606Leu ABCD1 p.Arg104Cys ABCD3 p.Gly116Arg Degradation of mutant ALDP (S606L) was similarly inhibited by lactacystin, but not by leupeptin, wild R104C G116R ALDP-GFP ALDP PMP70 1 5 10 1 5 10 1 5 10 1 5 10 1 5 10 1 5 10 1 5 10 Non specific ALDP-GFP ALDP PMP70 Non specific ALDP-GFP ALDP PMP70 Non specific Y174C H667D S606P S606L Fig. 4 Subcellular localization of wild type and mutant adrenoleukodystrophy protein (ALDP) -green fluorescence proteins (GFP) in CHO cells. Login to comment 181 ABCD1 p.Tyr174Cys ABCD1 p.Ser606Pro ABCD1 p.His667Asp ABCD1 p.Ser606Leu ABCD1 p.Arg104Cys ABCD3 p.Gly116Arg The mitochondrial and light mitochondrial fraction from CHO cells expressing wild type ALDP and ALDP-GFP or each mutant ALDP-GFP (R104C, G116R, Y174C, S606P, S606L, or H667D) was fractionated by equilibrium density centrifugation on sucrose. Login to comment 184 ABCD1 p.Arg104Cys Dots in R104C show the band corresponding to the ALDP-GFP fragments. Login to comment 186 ABCD1 p.Arg104Cys On the other hand, fragmentation of ALDP-GFP (R104C) was not inhibited by lactacystin, MG132, leupeptin, AEBSF, or E-64d (data not shown). Login to comment 187 ABCD1 p.Arg617His To confirm that endogenous mutant ALDP is also degraded by proteasomes, we analyzed the effect of proteasomes inhibitors on the stability of mutant ALDP (R617H) (Imamura et al. 1997) in X-ALD fibroblasts. Login to comment 188 ABCD1 p.Gln544Arg As a control, we used normal fibroblasts and X-ALD fibroblasts where mutant ALDP (Q544R) was present at a normal level (Imamura et al. 1997). Login to comment 189 ABCD1 p.Arg617His ABCD1 p.Gln544Arg As shown in Fig. 7, a band corresponding to ALDP was not detected in the X-ALD fibroblasts (R617H) under the conditions where ALDP was detected in normal fibroblasts and X-ALD fibroblasts (Q544R). Login to comment 190 ABCD1 p.Arg617His However, in the presence of MG132, immunoreactive bands corresponding to ALDP appeared in the X-ALD fibroblasts (R617H). Login to comment 191 ABCD1 p.His667Asp ABCD1 p.Arg617His These results suggest that missense mutations, including R617H and H667D, were also degraded by proteasomes. Login to comment 195 ABCD1 p.His667Asp ABCD1 p.His667Asp ABCD1 p.His667Asp ABCD1 p.His667Asp Some mutations in the first extracellular domain of ABCA1 have been shown to cause impaired localization of the mutant ABCA1 to plasma membranes from the ALDP-GFP(H667D) ALDP 100 Lactacystin MG132 kDa kDa 0 100 75 2.5 5 10 10 20 kDa 0 100 75 2.5 5 10 20 ALDP-GFP(H667D) ALDP ALDP-GFP(H667D) ALDP µmol/L h 75 70 (a) (b) (c) Leupeptin AEBSF E-64-dLactacystin None PMP70 Fig. 5 Effect of protease inhibitors on the stability of adrenoleukodystrophy protein (ALDP)-green fluorescence proteins (GFPs) (H667D) and wild type ALDP in CHO cells. Login to comment 196 ABCD1 p.His667Asp (a) CHO cells co-expressing wild type ALDP and ALDP-GFP (H667D) were cultured with leuteptin (50 lmol/L), AEBSF (300 lmol/L), E64-d (10 lmol/L), or lactacystin (10 lmol/L) for 20 h. Cell homogenates (100 lg of protein) were analyzed by immunoblotting using anti-ALDP and anti-PMP70 antibodies. Login to comment 197 ABCD1 p.His667Asp (b) CHO cells co-expressing wild type ALDP and ALDP-GFP (H667D) were incubated with different concentrations of lactacystin or MG132 for 20 h and subjected to immunoblot analysis as in (a). Login to comment 198 ABCD1 p.His667Asp ABCD1 p.His667Asp (c) CHO cells co-expressing wild type ALDP and ALDP-GFP (H667D) were incubated with 10 lmol/L MG132 for 0-20 h. ALDP-GFP (a) (b) (c) (d) (e) (f) PMP70 MERGE Fig. 6 Distribution of mutant adrenoleukodystrophy protein (ALDP) -green fluorescence proteins (GFPs) (H667D) in CHO cells incubated with MG132. Login to comment 199 ABCD1 p.His667Asp CHO cells co-expressing wild type ALDP and mutant ALDP-GFP (H667D) were incubated with 10 lmol/L MG132 for 20 h. They were then incubated with or without digitonin (25 lg/mL) for 10 min followed by immunostaining. Login to comment 200 ABCD1 p.His667Asp CHO cells expressing mutant ALDP-GFP (H667D). Login to comment 206 ABCD1 p.Arg617His ABCD1 p.Arg617His ABCD1 p.Gln544Arg ABCD1 p.Gln544Arg Q544R R617H MG132 Mutant ALDP Catalase -- + Fig. 7 Immunoblot analysis of endogenous mutant adrenoleukodystrophy proteins (ALDPs) (Q544R and R617H) incubated with or without MG132. Login to comment 207 ABCD1 p.Arg617His ABCD1 p.Gln544Arg The fibroblasts were incubated with 10 lmol/L MG132 for 20 h. Cell homogenates (100 lg of protein) from the X-linked adrenoleukodystrophy fibroblasts with mutation of ALDP (Q544R) and X-linked adrenoleukodystrophy fibroblasts with mutation of ALDP (R617H) were subjected to immunoblot analysis with anti-ALDP antibody or anti-catalase antibody. Login to comment 216 ABCC7 p.Arg104Cys ABCD1 p.Gln544Arg ABCD1 p.Ser342Pro ABCD3 p.Gly116Arg The mutation of R104C and G116R is located in loop1 between TMD1 and 2, Y174 is in loop2 between TMD2 and 3, S342P and Q544R are located in TMD6 and the helical region between Walker A and B, respectively. Login to comment 217 ABCD1 p.Ser606Pro ABCD1 p.Ser606Leu S606P and S606L are in the ABC signature motif. Login to comment 218 ABCD1 p.Arg617His ABCC7 p.His667Asp R617H and H667D are located in the Walker B region and in the COOH-terminal region, respectively (Fig. 1). Login to comment 220 ABCD1 p.Arg617His ABCC7 p.His667Asp First, we found for the first time that mutant ALDPs (R617H and H667D) were degraded by proteasomes based on the following evidence: (i) The expression levels of these mutant His-ALDPs were relatively low in X-ALD fibroblasts in terms of transient expression (Figs 3b and c, and Table 2). Login to comment 222 ABCD1 p.Arg617His ABCC7 p.His667Asp (iii) ALDP-GFP (H667D) in the CHO cells and endogenous ALDP (R617H) in X-ALD fibroblasts were detectable by immunoblotting after treatment with lactacystin or MG132 (Figs 5a and 7). Login to comment 223 ABCD1 p.Ser606Leu Mutant ALDP-GFP (S606L) showed similar results (date not shown). Login to comment 224 ABCC7 p.His667Asp We tried to detect ubiqutination of the mutant ALDP (H667D) in the presence of a proteasome inhibitor, but no polyubiqitinated forms of the mutant ALDP were detected in the present study. Login to comment 226 ABCC7 p.His667Asp In addition, interestingly, we found that wild type ALDP disappeared in CHO cells expressing mutant ALDP-GFP (H667D), but reappeared with mutant ALDP-GFP by the treatment with a proteasome inhibitor. Login to comment 228 ABCC7 p.His667Asp In fact, mutant ALDP-GFP (H667D) was found to be located in peroxisomes with treatment by a proteasome inhibitor (Fig. 6). Login to comment 229 ABCD1 p.Tyr174Cys ABCD1 p.Ser606Pro ABCD1 p.Arg617His ABCD1 p.Ser606Leu ABCD1 p.Gln544Arg ABCD1 p.Ser342Pro ABCD3 p.Gly116Arg ABCC7 p.His667Asp Recently Lie et al. investigated the dimerization of the COOH-terminal half of ALDP by a yeast two-hybrid assay and found that it could dimerize Table 2 Expression and localization of missense ALDPs Mutant ALDP Transient Stable Expressiona Localizationb b-Oxidationc Expressiona Localizationb Wild +++ Px + ++ Px R104Cd , G116R, S342P, Q544R, S606P +++ Px ) ++ Px Y174C +++ mis ) + mis S606L ++ Px ) ) ) R617H, H667D + ) ) ) ) Wild and mutant His-ALDPs or ALDP-GFPs were transiently expressed in X-ALD fibroblasts or stably expressed in CHO cells, respectively. Login to comment 234 ABCC7 p.Arg104Cys d R104C was degraded to several fragments when stably expressed in CHO cells (Fig. 4). Login to comment 238 ABCD1 p.Pro484Arg ABCD1 p.Arg591Gln Actually, in their experiments the mutation of P484R and R591Q reduced the interaction of the COOH-terminal half of ALDP. Login to comment 239 ABCD1 p.Arg617His ABCC7 p.His667Asp Therefore, mutant ALDP (R617H and H667D) might be misfolded on the peroxisomal membranes and unable to interact correctly with each other or with wild type ALDP and are recruited to proteasomes for degradation. Login to comment 244 ABCD1 p.Ser606Leu ABCC7 p.His667Asp In Fig. 4, the wild type ALDP would dimerize each other or with endogenous ALDP and could be stabilized, but such complex could not be detected on sucrose gradient of CHO cells expressing mutant ALDP (S606L and H667D). Login to comment 248 ABCC7 p.Arg104Cys In the case of mutant ALDP (R104C), several degradation products were detected in the peroxisomal fraction on sucrose-gradient centrifugation (Fig. 4), suggesting that it might be degraded on peroxisomal membranes. Login to comment 255 ABCD1 p.Arg660Trp ABCD1 p.Gly512Ser In an early study, Yamada et al. showed that degradation of endogenous mutant ALDP (G512S and R660W) as well as wild type ALDP was suppressed by E-64 or leupeptin, which inhibit thiol proteases including lysosomal cathepsins and cytosolic calcium-activated neutral proteases in human fibroblasts (Yamada et al. 1997). Login to comment 257 ABCD1 p.Arg617His ABCC7 p.His667Asp Although we did not show any effects of E-64d on the mutant ALDP (R617H and H667D) stability, the possibility cannot be ruled out that other proteases are also involved in the degradation of some of the mutant ALDPs. Login to comment 259 ABCD1 p.Ser606Pro ABCD1 p.Gln544Arg ABCD1 p.Ser342Pro ABCD3 p.Gly116Arg Second, mutant ALDP (G116R, S342P, Q544R, and S606P) expressed similar levels to wild type ALDP in the experiment of transient expression as the corresponding His-ALDP in X-ALD fibroblasts (Fig. 3b and Table 2) and stable expression as ALDP-GFP in CHO cells (Fig. 4 and Table 2). Login to comment 262 ABCD1 p.Ser342Pro ABCD3 p.Gly116Arg As G116R and S342P are located to TMDs, substitution of these amino acids seems to affect substrate binding or transport through ALDP. Login to comment 263 ABCD1 p.Ser606Pro The substitution of Q554R and S606P located to NBD, which might affect the binding and hydrolysis of ATP in ALDP. Login to comment 264 ABCD1 p.Ser606Leu Recently, Roerig et al. suggested that mutation of S606L decreases affinity against ATP, although ATP hydrolyzing activity is normal using a NBD fragment expressed in Escherichia coli (Roerig et al. 2001). Login to comment 265 ABCD1 p.Ser606Leu Our results suggest that the stability of mutant ALDP (S606L) is also affected by (the) mutation. Login to comment 267 ABCD1 p.Tyr174Cys Third, mutant ALDP (Y174C) was shown to mistarget to other organelles (Fig. 3d). Login to comment 269 ABCD1 p.Tyr174Cys As the mutant ALDP (Y174C) was able to associate with Pex19p in in vitro translation experiments (data not shown), the targeting signal located in amino acids 67-164 (Landgraf et al. 2003) seems to be masked by the mutation. Login to comment 271 ABCD1 p.Arg617His ABCD1 p.Ser606Leu ABCC7 p.His667Asp In this study, we found that mutant ALDP (S606L, R617H, and H667D) was degraded by proteasomes together with wild type ALDP. Login to comment 273 ABCC7 p.His667Asp In the presence of proteasome inhibitors, H667D became to localize in peroxisomes (Fig. 6). Login to comment 276 ABCC7 p.Arg104Cys Furthermore, we found fragmentation of mutant ALDP (R104C) on peroxisomes which was not inhibited by proteasomes inhibitors, suggesting that additional protease(s) is also involved in the quality control of mutant ALDP. Login to comment 277 ABCD1 p.Tyr174Cys In addition, mutation of ALDP (Y174C) suggests that the loop between TMD2 and 3 is important for the targeting of ALDP to peroxisomes. Login to comment