ABCMdb

ABCA1 p.Val825Ile

Predicted by SNAP2:	A: N (78%), C: N (87%), D: D (53%), E: N (61%), F: D (71%), G: N (66%), H: N (61%), I: N (82%), K: D (85%), L: N (82%), M: N (87%), N: N (61%), P: N (57%), Q: N (72%), R: N (57%), S: N (78%), T: N (78%), W: N (78%), Y: N (82%),
Predicted by PROVEAN:	A: N, C: N, D: D, E: D, F: N, G: D, H: D, I: N, K: D, L: N, M: N, N: D, P: D, Q: N, R: D, S: N, T: N, W: D, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] The polymorphism of the ATP-binding cassette trans... Am J Geriatr Psychiatry. 2012 Jul;20(7):603-11. Sun YM, Li HL, Guo QH, Wu P, Hong Z, Lu CZ, Wu ZY
The polymorphism of the ATP-binding cassette transporter 1 gene modulates Alzheimer disease risk in Chinese Han ethnic population.
Am J Geriatr Psychiatry. 2012 Jul;20(7):603-11., [PMID:22377775]

Abstract [show]
BACKGROUND: Recent studies highlight a potential role of cholesterol metabolic disturbance in the pathophysiology of Alzheimer disease (AD). The adenosine triphosphate (ATP)-binding cassette transporter 1 (ABCA1) gene resides within proximity of linkage peaks on chromosome 9q influence AD and plays a key role in cellular cholesterol efflux in the brain. METHODS: We studied the role of R219K and V825I polymorphisms of ABCA1 in modulating the risk of AD in 321 AD patients and 349 comparisons of Chinese Han. Genotyping of R219K and V825I were performed by PCR-restriction fragment length polymorphism analysis. RESULTS: The genotype distribution of R219K was different with more RK in total AD group (chi(2) = 8.705, df = 2, p = 0.013), late-onset AD (LOAD) group (chi(2) = 10.636, df = 2, p = 0.005), APOE non-epsilon4epsilon4 group (chi(2) = 9.900, df = 2, p = 0.007), and female AD group (chi(2) = 8.369, df = 2, p = 0.015). Logistic regression manifested the risk of AD increased in RK carriers in total AD group (Wald = 6.102, df = 1, p = 0.014, odds ratio [OR]: 1.546, 95% confidence interval [95% CI]: 1.094-2.185), LOAD group (Wald = 7.746, df = 1, p = 0.005, OR: 1.921, 95% CI: 1.213-3.041), and APOE non-epsilon4epsilon4 group (Wald = 6.399, df = 1, p = 0.011, OR: 1.586, 95% CI: 1.109-2.266). K allele (RK + KK) also increased the risk of AD compared with RR allele in LOAD group (Wald = 4.750, df = 1, p = 0.029, OR: 1.619, 95% CI: 1.050-2.497). However, no discrepancy was found in V825I. In R219K, age at onset (AAO) was significantly lower by 4.9 years on average in patients of KK genotype than those of RK in APOE epsilon4 carrying group and higher by 5.5 years in patients of KK genotype than those of RR in APOE epsilon4 noncarrying group. In V825I, AAO was diseased by 4.3 years in II genotype compared with VV genotype in APOE epsilon4 noncarrying group and 3.4 years in APOE epsilon4epsilon4 noncarrying group. CONCLUSION: The results indicated that the RK genotype or K allele (RK + KK) of R219K may relate to the development of AD in the east of China.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Methods: We studied the role of R219K and V825I polymorphisms of ABCA1 in modulating the risk of AD in 321 AD patients and 349 comparisons of Chinese Han. Login to comment
4 Genotyping of R219K and V825I were performed by PCR-restriction fragment length polymorphism analysis. Login to comment
8 However, no discrepancy was found in V825I. Login to comment
10 In V825I, AAO was diseased by 4.3 years in II genotype compared with VV genotype in APOE ε4 noncarrying group and 3.4 years in APOE ε4ε4 noncarrying group. Login to comment
22 But clinical investigation of its relationship to AD has commenced in these years and the results were controversial.19 Also, the investigation in Chinese ethnic Han people is rare.20 Here, we examined two single nucleotide polymorphisms (SNPs) in the coding regions of ABCA1: R219K (rs2230806) located in exon 7 with a G to A nucleotide change, which is most popular SNP in both CAD and AD examinations; V825I (rs2066715) located in exon 17 with a G to A as well, which associated with HDL-C and played an important role in CAD but was rarely reported in AD patients.21,22 We conducted a case-control study to investigate the genetic association of these two SNPs with AD in a population of Chinese Han in eastern China. Login to comment
36 Genotyping of R219K, V825I, and APOE Genomic DNA was extracted from the sodium citrate treated blood samples of both AD patients and comparisons by TIANamp blood DNA Kit (TIAN- GEN). Login to comment
37 The genotypes of R219K and V825I were the same as the previous report.23 The APOE genotypes were determined as described by Donohoe et al.24 Statistical Analysis Statistical analyses were performed using SPSS version 12.0 (SPSS Inc., Chicago, IL). Login to comment
48 Genotype and Allele Frequency Distribution R219K and V825I were under Hardy-Weinberg equilibrium in both AD and comparison groups (p > 0.20) (see Table, Supplemental Digital Content 1, http://links.lww.com/AJGP/A26, which demonstrates Hardy-Weinberg equilibrium of the two SNPs inAD patientsandcomparisongroup). Login to comment
59 As for V825I, no differences were found in either genotypes or allele frequencies though stratified by AAO, gender, APOE ε4 carrying status, or APOEε4ε4 carrying status (Table 2). Login to comment
64 Influence of ABCA1 Polymorphisms on AAO and MMSE Score of AD As shown in Table 4, using ANOVA, we analyzed the effects of R219K and V825I genotypes on the AAO and MMSE scores of AD patients which were divided according to the onset age, gender, and APOE ε4 and ε4ε4 carrying status. Login to comment
66 In the V825I, AAO was diseased by 4.3 years in II genotype compared with VV genotype in APOE ε4 noncarrying group and 3.4 years in APOE ε4ε4 noncarrying group. Login to comment
69 V825I locates in the middle part of the protein corresponding to the sixth transmembrane α-helix and is highly conserved.25 From our results, we did not find the apparent differences either in genotypes or in allele frequencies in V825I though stratified by AAO, gender, and APOE ε4 and ε4ε4 status. Login to comment
70 Katzov et al.26 obtained the same results after genotyping 390 LOAD and 185 controls of Swedish population, but in their subjects of EOAD, the V825I was monomorphic. Login to comment
71 V825I polymorphism was rarely reported in AD patients, whereas it was associated with increased clinical events and severity of atherosclerosis in CAD patients,27,28 and significantly increased HDL-C in women. Login to comment
72 Wang et al.23 found no association of V825I with lipids levels in Chinese Han ethnic stroke patients. Login to comment
73 This may imply that V825I is conservative and exerts minor influence on cholesterol efflux activity. Login to comment
74 One recent research demonstrated the V825I substitution on ABCA1 function in cells, which indicated 825I variant having higher activity in mediating cholesterol efflux than the wild type (825V).29 They also observed a trend toward higher symptom onset age in 825I allele carriers in CAD patients, and unfortunately the AAO between the groups of genotypes did not reach significance. Login to comment
76 So V825I might not be that conservative and might have some effect on AD pathogenesis. Login to comment
82 Genotypes and Allele Frequencies of R219K and V825I Polymorphisms in ABCA1 Gene in AD Patients and Comparison Group Comparison Comparison R219K AD (%) Group (%) V825I AD (%) Group (%) Total, n 321 349 321 349 RR 93 (29.0) 125 (35.8) VV 92 (28.7) 109 (31.2) RK 180 (56.1) 156 (44.7) VI 158 (49.2) 170 (48.7) KK 48 (15.0) 68 (19.5) II 71 (22.1) 70 (20.1) χ2 (p) 8.705 (0.013)a 0.715 (0.699) R frequency 366 (57.0) 407 (58.2) V frequency 342 (53.3) 388 (55.6) K frequency 276 (43.0) 293 (41.8) I frequency 300 (46.7) 310 (44.4) χ2 (p) 0.183 (0.669) 0.724 (0.395) EOAD, n 124 149 124 149 RR 42 (33.9) 53 (35.6) VV 31 (25.0) 50 (33.6) RK 66 (53.2) 73 (49.0) VI 62 (50.0) 66 (44.3) KK 16 (12.9) 23 (15.4) II 31 (25.0) 33 (22.1) χ2 (p) 0.598 (0.741) 2.375 (0.305) R frequency 150 (60.5) 179 (60.1) V frequency 124 (50.0) 166 (55.7) K frequency 98 (39.5) 119 (39.9) I frequency 124 (50.0) 132 (44.3) χ2 (p) 0.1 (0.921) 1.769 (0.184) LOAD, n 197 200 197 200 RR 51 (25.9) 72 (36.0) VV 61 (31.0) 59 (29.5) RK 114 (57.9) 83 (41.5) VI 96 (48.7) 104 (52.0) KK 32 (16.2) 45 (22.5) II 40 (20.3) 37 (18.5) χ2 (p) 10.636 (0.005)b 0.448 (0.799) R frequency 216 (54.8) 227 (56.8) V frequency 218 (55.3) 222 (55.5) K frequency 178 (45.2) 173 (43.2) I frequency 176 (44.7) 178 (44.5) χ2 (p) 0.229 (0.584) 0.002 (0.962) Male, n 123 125 123 125 RR 41 (33.3) 42 (33.6) VV 31 (25.2) 41 (32.8) RK 66 (53.7) 58 (46.4) VI 64 (52.0) 60 (48.0) KK 16 (13.0) 25 (20.0) II 28 (22.8) 24 (19.2) χ2 (p) 2.488 (0.288) 1.81 (0.405) R frequency 148 (60.2) 142 (56.8) V frequency 126 (51.2) 142 (56.8) K frequency 98 (39.8) 108 (43.2) I frequency 120 (48.8) 108 (43.2) χ2 (p) 0.577 (0.447) 1.555 (0.212) Female, n 198 224 198 224 RR 52 (26.3) 83 (37.1) VV 61 (30.8) 68 (30.4) RK 114 (57.6) 98 (43.8) VI 94 (47.5) 110 (49.1) KK 32 (16.2) 43 (19.2) II 43 (21.7) 46 (20.5) χ2 (p) 8.369 (0.015)a 0.134 (0.935) R frequency 218 (55.1) 264 (58.9) V frequency 216 (54.5) 246 (54.9) K frequency 178 (44.9) 184 (41.1) I frequency 180 (45.5) 202 (45.1) χ2 (p) 1.291 (0.256) 0.11 (0.915) APOE ε4 carrying, n 150 143 150 143 RR 48 (32.0) 52 (36.4) VV 37 (24.7) 44 (30.8) RK 82 (54.7) 62 (43.4) VI 78 (52.0) 74 (51.7) KK 20 (13.3) 29 (20.3) II 35 (23.3) 25 (17.5) χ2 (p) 4.426 (0.109) 2.211 (0.331) R frequency 178 (59.3) 166 (58.0) V frequency 152 (50.7) 162 (56.6) K frequency 122 (40.7) 120 (42.0) I frequency 148 (49.3) 124 (43.4) χ2 (p) 0.101 (0.751) 2.103 (0.147) APOE ε4 noncarrying, n 171 206 171 206 RR 45 (26.3) 73 (35.4) VV 55 (32.2) 65 (31.6) RK 98 (57.3) 94 (45.6) VI 80 (46.8) 96 (46.6) KK 28 (16.4) 39 (18.9) II 36 (21.1) 45 (21.8) χ2 (p) 5.33 (0.070) 0.039 (0.981) R frequency 188 (55.0) 240 (58.3) V frequency 190 (55.6) 226 (54.9) K frequency 154 (45.0) 172 (41.7) I frequency 152 (44.4) 186 (45.1) χ2 (p) 0.82 (0.365) 0.037 (0.847) APOE ε4ε4 carrying, n 35 3 35 3 RR 11 (31.4) 1 (33.3) VV 7 (20.0) 1 (33.3) RK 17 (48.6) 2 (66.7) VI 20 (57.1) 1 (33.3) KK 7 (20.0) 0 (0.0) II 8 (22.9) 1 (33.3) (Continued ) TABLE 2. Login to comment
83 (Continued ) Comparison Comparison R219K AD (%) Group (%) V825I AD (%) Group (%) χ2 (p) 0.656 (1.000)c 1.321 (0.577)c R frequency 39 (55.7) 4 (66.7) V frequency 34 (48.6) 3 (50.0) K frequency 31 (44.3) 2 (33.3) I frequency 36 (51.4) 3 (50.0) χ2 (p) (0.692)c (1.000)c APOE ε4ε4 noncarrying, n 286 346 286 346 RR 82 (28.7) 124 (35.8) VV 85 (29.7) 108 (31.2) RK 163 (57.0) 154 (44.5) VI 138 (48.3) 169 (48.8) KK 41 (14.3) 68 (19.7) II 63 (22.0) 69 (19.9) χ2 (p) 9.9 (0.007)b 0.452 (0.798) R frequency 327 (57.2) 402 (58.1) V frequency 308 (53.8) 385 (55.6) K frequency 245 (42.8) 290 (41.9) I frequency 264 (46.2) 307 (44.4) χ2 (p) 0.11 (0.741) 0.405 (0.525) Notes: For all the χ2 of genotypes, df = 2; for all the χ2 of allele frequencies, df = 1. Login to comment
92 Effects of Two Single Nucleotide Polymorphisms (R219K and V825I) of ABCA1 Gene on AAO and MMSE Score in AD Patients R219K V825I RR (%) RK (%) KK (%) F (p) VV (%)g VI (%) II (%) F (p) Total, n 93 (29.0) 180 (56.1) 48 (15.0) 92 (28.7) 158 (49.2) 71 (22.1) AAO 65.4 ± 10.42 67.8 ± 9.46 67.3 ± 9.36 1.813 (0.165) 68.4 ± 9.34 66.8 ± 9.84 65.6 ± 10.01 1.764 (0.173) MMSE 14.1 ± 6.44 14.4 ± 6.00 14.5 ± 6.25 0.113 (0.893) 14.8 ± 5.87 14.0 ± 6.31 14.4 ± 5.87 0.545 (0.580) EOAD, n 42 (33.9) 66 (53.2) 16 (12.9) 31 (25.0) 62 (50.0) 31 (25.0) AAO 55.5 ± 5.33 57.0 ± 4.97 55.7 ± 4.92 1.222 (0.298) 57.0 ± 5.20 56.3 ± 5.04 55.7 ± 5.19 0.470 (0.626) MMSE 13.6 ± 6.84 13.0 ± 6.63 14.3 ± 8.62 0.237 (0.790) 13.9 ± 7.38 12.2 ± 6.92 15.2 ± 6.21a 2.119 (0.125) LOAD, n 51 (25.9) 114 (57.9) 32 (16.2) 61 (40.0) 96 (48.7) 40 (20.3) AAO 73.5 ± 5.23 74 ± 4.57 73.1 ± 4.1 0.523 (0.594) 74.2 ± 4.11 73.6 ± 4.99 73.2 ± 4.70 0.628 (0.535) MMSE 14.4 ± 6.14 15.2 ± 5.48 14.6 ± 4.81 0.427 (0.653) 15.3 ± 5.37 15.2 ± 5.63 13.7 ± 5.58 1.179 (0.310) Male, n 41 (33.3) 66 (53.7) 16 (13.0) 31 (25.2) 64 (52.0) 28 (22.8) AAO 65.1 ± 9.65 67.2 ± 9.38 67.9 ± 9.81 0.850 (0.430) 68.0 ± 10.50 66.8 ± 9.04 64.7 ± 9.51 0.887 (0.415) MMSE 15.2 ± 6.27 16.1 ± 6.21 15.0 ± 5.72 0.404 (0.668) 16.7 ± 5.67 14.9 ± 6.49 16.4 ± 5.77 1.110 (0.333) Female, n 52 (26.3) 114 (57.6) 32 (16.1) 61 (30.8) 94 (47.5) 43 (21.7) AAO 65.7 ± 11.80 68.1 ± 9.53 67.0 ± 9.27 1.036 (0.357) 68.7 ± 8.78 66.9 ± 10.39 66.2 ± 10.38 0.960 (0.385) MMSE 13.2 ± 6.50 13.4 ± 5.67 14.2 ± 6.57 0.301 (0.740) 13.9 ± 6.03 13.4 ± 6.15 13.1 ± 5.63 0.255 (0.775) APOE ε4 carrying, n 48 (32.0) 82 (54.7) 20 (13.3) 37 (24.7) 78 (52.0) 35 (23.3) AAO 65.7 ± 9.95 67.8 ± 8.64 62.7 ± 8.85b 2.798 (0.064) 67.9 ± 8.92 65.7 ± 9.41 66.7 ± 9.14 0.742 (0.478) MMSE 13.8 ± 6.04 14.8 ± 5.69 14.5 ± 7.13 0.369 (0.692) 15.3 ± 6.15 13.7 ± 6.32 15.2 ± 4.86 1.212 (0.301) APOE ε4 noncarrying, n 45 (26.3) 98 (57.3) 28 (16.4) 55 (32.2) 80 (46.8) 36 (21.1) AAO 65.1 ± 11.01 67.8 ± 10.14 70.6 ± 8.37c 2.627 (0.075) 68.8 ± 9.68 68.0 ± 10.16 64.5 ± 10.79d 2.160 (0.119) MMSE 14.3 ± 6.90 14.1 ± 6.27 14.5 ± 5.68 0.036 (0.964) 14.6 ± 6.13 14.3 ± 6.34 13.4 ± 6.69 0.252 (0.778) APOE ε4ε4 carrying, n 11 (31.4) 17 (48.6) 7 (20.0) 7 (20.0) 20 (57.1) 8 (22.9) AAO 64.8 ± 9.67 66.5 ± 6.79 67.6 ± 7.41 0.283 (0.756) 65.0 ± 8.37 66.0 ± 7.70 67.6 ± 8.16 0.215 (0.807) MMSE 14.9 ± 6.99 14.4 ± 4.70 13.4 ± 5.29 0.162 (0.851) 13.9 ± 4.41 14.5 ± 6.43 15.0 ± 4.03 0.077 (0.926) APOE ε4ε4 noncarrying, n 82 (28.7) 163 (57.0) 41 (14.3) 85 (29.7) 138 (48.3) 63 (22.0) AAO 65.5 ± 10.57 67.9 ± 9.70 67.2 ± 9.73 1.597 (0.204) 68.7 ± 9.41 67.0 ± 10.12 65.3 ± 10.24e 2.132 (0.121) MMSE 13.9 ± 6.40 14.4 ± 6.13 14.7 ± 6.44 0.206 (0.814) 14.9 ± 6.24 13.9 ± 6.31 14.3 ± 6.08 0.667 (0.514) Notes: MMSE score and AAO were analyzed by ANOVA and post-hoc LSD multiple comparisons and were expressed in mean ± SD. Login to comment
115 However, there was no association of V825I with AD in spite of stratification. Login to comment

[hide] The non-synonymous Arg230Cys variant (R230C) of th... Atherosclerosis. 2011 May;216(1):146-50. Epub 2011 Jan 22. Aguilar-Salinas CA, Canizales-Quinteros S, Rojas-Martinez R, Mehta R, Rodriguez-Guillen R, Ordonez-Sanchez ML, Riba L, Tusie-Luna MT
The non-synonymous Arg230Cys variant (R230C) of the ATP-binding cassette transporter A1 is associated with low HDL cholesterol concentrations in Mexican adults: a population based nation wide study.
Atherosclerosis. 2011 May;216(1):146-50. Epub 2011 Jan 22., [PMID:21315358]

Abstract [show]
OBJECTIVE: To search for an association between the non-synonymous Arg230Cys variant (R230C) of the ATP-binding cassette transporter A1 and low HDL cholesterol levels in a Mexican, population-based nation wide survey. METHODS: The 2000 National Health Survey is a cross sectional study that included individuals from 400 cities. All individuals who had a 9-12-h fasted blood sample and a DNA sample were selected (n = 1729). These cases were randomly distributed; no bias was detected for sex, education, region or socioeconomic status. The R230C variant was genotyped using TaqMan assays. RESULTS: In individuals with the R230C/C230C genotypes (39.03 mg/dl (36.63-41.43)) lower HDL-C levels (p < 0.001) were observed compared to those with the R230R genotype (44.7 mg/dl (43.31-46.24)). The difference remained significant after adjusting for gender, body mass index and waist circumference; the mean difference in HDL cholesterol levels between alleles was 5.73 +/- 1.4 mg/dl. The magnitude of the effect was significantly greater in males. The C230 allele of ABCA1 was associated with an increased risk for hypoalphalipoproteinemia (OR 1.66 (95%CI 1.08-2.54), p < 0.05). The population attributable risk (PAR) for having hypoalphalipoproteinemia of the C230 allele of the ABCA1, after considering the confounding effect of waist circumference and gender, was 12.2% (95%CI 1.4-24.2%). CONCLUSION: The non-synonymous Arg230Cys variant of ABCA1 is associated with low levels of HDL cholesterol levels in Mexican adults. The HDL cholesterol lowering effect of the variant is greater in males. The size of the effect is greater compared to that reported for other ABCA1 variants.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 Only two sequence variants (I883 M and V825I) were associated with plasma HDL-C levels in both white men and black men, but the effect of these variants on HDL-C levels was modest (<4 mg/dl). Login to comment

[hide] Genetic variant of V825I in the ATP-binding casset... Lipids Health Dis. 2011 Jan 19;10:14. Cao XL, Yin RX, Wu DF, Miao L, Aung LH, Hu XJ, Li Q, Yan TT, Lin WX, Pan SL
Genetic variant of V825I in the ATP-binding cassette transporter A1 gene and serum lipid levels in the Guangxi Bai Ku Yao and Han populations.
Lipids Health Dis. 2011 Jan 19;10:14., [PMID:21247457]

Abstract [show]
BACKGROUND: Several genetic variants in the ATP-binding cassette transporter A1 (ABCA1) gene have associated with modifications of serum high-density lipoprotein cholesterol (HDL-C) levels and the susceptibility for coronary heart disease, but the findings are still controversial in diverse racial/ethnic groups. Bai Ku Yao is an isolated subgroup of the Yao minority in southern China. The present study was undertaken to detect the possible association of V825I (rs2066715) polymorphism in the ABCA1 gene and several environmental factors with serum lipid levels in the Guangxi Bai Ku Yao and Han populations. METHODS: A total of 677 subjects of Bai Ku Yao and 646 participants of Han Chinese were randomly selected from our previous stratified randomized cluster samples. Polymerase chain reaction and restriction fragment length polymorphism assay combined with gel electrophoresis were performed for the genotyping of V825I variant, and then confirmed by direct sequencing. RESULTS: The levels of serum total cholesterol (TC), HDL-C, apolipoprotein (Apo) AI and ApoB were lower in Bai Ku Yao than in Han (P < 0.01 for all). The frequency of G and A alleles was 57.4% and 42.6% in Bai Ku Yao, and 57.7% and 42.3% in Han (P > 0.05); respectively. The frequency of GG, GA and AA genotypes was 33.7%, 47.4% and 18.9% in Bai Ku Yao, and 33.4%, 48.6% and 18.0% in Han (P > 0.05); respectively. There was no difference in the genotypic and allelic frequencies between males and females in the both ethnic groups. The subjects with AA genotype in Bai Ku Yao had higher serum TC levels than the subjects with GG and GA genotypes (P < 0.05). The participants with AA genotype in Han had lower serum HDL-C and ApoAI levels than the participants with GG and GA genotypes (P < 0.05 for each), but these results were found in males but not in females. Multivariate linear regression analysis showed that the levels of TC in Bai Ku Yao and HDL-C and ApoAI in male Han were correlated with genotypes (P < 0.05 for all). Serum lipid parameters were also correlated with sex, age, body mass index, alcohol consumption, and blood pressure in both ethnic groups (P < 0.05-0.001). CONCLUSION: The present study suggests that the V825I polymorphism in the ABCA1 gene is associated with male serum HDL-C and ApoAI levels in the Han, and serum TC levels in the Bai Ku Yao populations. The difference in the association of V825I polymorphism and serum lipid levels between the two ethnic groups might partly result from different ABCA1 gene-environmental interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 RESEARCH Open Access Genetic variant of V825I in the ATP-binding cassette transporter A1 gene and serum lipid levels in the Guangxi Bai Ku Yao and Han populations Xiao-Li Cao1,2 , Rui-Xing Yin1* , Dong-Feng Wu1 , Lin Miao1 , Lynn Htet Htet Aung1 , Xi-Jiang Hu1 , Qing Li1 , Ting-Ting Yan1 , Wei-Xiong Lin3 , Shang-Ling Pan4 Abstract Background: Several genetic variants in the ATP-binding cassette transporter A1 (ABCA1) gene have associated with modifications of serum high-density lipoprotein cholesterol (HDL-C) levels and the susceptibility for coronary heart disease, but the findings are still controversial in diverse racial/ethnic groups. Login to comment
2 The present study was undertaken to detect the possible association of V825I (rs2066715) polymorphism in the ABCA1 gene and several environmental factors with serum lipid levels in the Guangxi Bai Ku Yao and Han populations. Login to comment
4 Polymerase chain reaction and restriction fragment length polymorphism assay combined with gel electrophoresis were performed for the genotyping of V825I variant, and then confirmed by direct sequencing. Login to comment
13 Conclusion: The present study suggests that the V825I polymorphism in the ABCA1 gene is associated with male serum HDL-C and ApoAI levels in the Han, and serum TC levels in the Bai Ku Yao populations. Login to comment
14 The difference in the association of V825I polymorphism and serum lipid levels between the two ethnic groups might partly result from different ABCA1 gene-enviromental interactions. Login to comment
32 A common variant of V825I in the ABCA1 gene is a missense SNP in the exon 17 that locates in the middle part of the protein corresponding to sixth transmembrane a-helix with mutation of GTC®ATC. Login to comment
33 The ABCA1 V825I polymorphism has been found to be associated with modifications of serum HDL-C levels in some studies [26-29] but not in others [30-33]. Login to comment
41 Therefore, the aim of the present study was to detect the association of V825I polymorphism in the ABCA1 gene and several environmental factors with serum lipid phenotypes in the Guangxi Bai Ku Yao and Han populations. Login to comment
107 Genotypic and allelic frequencies Table 2 gives the genotypic and allelic frequencies of V825I polymorphism in the ABCA1 gene. Login to comment
111 The nucleotide sequence of V825I polymorphism The results were shown as GG, GA and AA genotypes by PCR-RFLP, the GG, GA and AA genotypes were also confirmed by sequencing (Figure 3); respectively. Login to comment
119 Figure 2 Genotyping of V825I polymorphism in the ABCA1 gene. Login to comment
132 Table 2 Genotypic and allelic frequencies of the ABCA1 V825I polymorphism between the Bai Ku Yao and Han populations [n (%)] Group n Genotype Allele GG GA AA G A Bai Ku Yao 677 228 (33.7) 321 (47.4) 128 (18.9) 777 (57.4) 577 (42.6) Han Chinese 646 216 (33.4) 314 (48.6) 116 (18.0) 746 (57.7) 546 (42.3) c2 - 0.265 0.034 P - 0.876 0.854 Bai Ku Yao Male 324 110 (34.0) 153 (47.2) 61 (18.8) 373 (57.6) 275 (42.4) Female 353 118 (33.4) 168 (47.6) 67 (19.0) 404 (57.2) 302 (42.8) c2 - 0.210 0.016 P - 0.990 0.900 Han Chinese Male 315 104 (33.0) 154 (48.9) 57 (18.1) 362 (57.5) 268 (42.5) Female 331 112 (33.8) 160 (48.3) 59 (17.8) 384 (58.0) 278 (42.0) c2 - 0.490 0.030 P - 0.976 0.863 Figure 3 A part of the nucleotide sequence of the ABCA1 V825I polymorphism. Login to comment
142 These results indicate that the prevalence of the A allele variation of Table 3 Genotypic frequencies of the ABCA1 V825I polymorphism and serum lipid levels between the Bai Ku Yao and Han populations Genotype n TC (mmol/L) TG (mmol/L) HDL-C (mmol/L) LDL-C (mmol/L) ApoAI (g/L) ApoB (g/L) ApoAI/ApoB Bai Ku Yao GG 228 4.28 ± 0.79 1.09 (0.80) 1.63 ± 0.39 2.52 ± 0.65 1.30 ± 0.34 0.84 ± 0.21 1.65 ± 0.69 GA 321 4.26 ± 0.82 0.96 (0.61) 1.64 ± 0.41 2.52 ± 0.68 1.28 ± 0.29 0.83 ± 0.22 1.64 ± 0.63 AA 128 4.52 ± 1.26 0.95 (0.61) 1.72 ± 0.45 2.69 ± 1.04 1.33 ± 0.35 0.86 ± 0.26 1.73 ± 0.91 F - 3.839 4.621 2.073 2.358 1.460 0.663 0.862 P - 0.022 0.099 0.127 0.095 0.233 0.516 0.423 Male GG 110 4.29 ± 0.80 1.25 (0.91) 1.65 ± 045 2.43 ± 0.68 1.36 ± 0.39 0.82 ± 0.21 1.81 ± 0.86 GA 153 4.26 ± 0.88 1.00 (0.66) 1.67 ± 0.45 2.47 ± 0.73 1.32 ± 0.33 081 ± 021 1.76 ± 0.74 AA 61 4.53 ± 1.62 1.02 (0.68) 1.74 ± 0.56 2.63 ± 1.33 1.40 ± 0.44 0.83 ± 0.30 1.96 ± 1.19 F - 1.850 4.969 0.974 1.377 1.040 0.081 1.370 P - 0.159 0.083 0.379 0.254 0.355 0.922 0.256 Female GG 118 4.26 ± 0.80 0.97(0.62) 1.60 ± 0.33 2.59 ± 0.62 1.25 ± 0.26 0.87 ± 0.20 1.50 ± 0.44 GA 168 4.26 ± 0.77 0.94(0.56) 1.62 ± 0.36 2.57 ± 0.63 1.24 ± 0.25 0.85 ± 0.22 1.53 ± 0.47 AA 67 4.50 ± 0.80 0.92(0.49) 1.69 ± 0.31 2.73 ± 0.68 1.27 ± 0.22 0.89 ± 0.20 1.51 ± 0.45 F - 2.860 0.595 1.530 2.080 0.474 1.150 0.578 P - 0.059 0.743 0.220 0.126 0.623 0.320 0.560 Han Chinese GG 216 4.77 ± 0.99 1.00 (0.57) 1.92 ± 0.51 2.61 ± 0.72 1.43 ± 0.27 0.89 ± 0.22 1.70 ± 0.58 GA 314 4.71 ± 1.06 1.01 (0.68) 1.90 ± 0.48 2.62 ± 0.81 1.42 ± 0.28 0.89 ± 0.24 1.69 ± 0.57 AA 116 4.63 ± 0.90 1.02 (0.70) 1.78 ± 0.48 2.64 ± 0.67 1.36 ± 0.27 0.90 ± 0.21 1.58 ± 0.51 F - 0.600 0.682 3.797 0.190 3.650 0.220 1.930 P - 0.540 0.711 0.023 0.674 0.027 0.800 0.145 Male GG 104 4.77 ± 1.03 1.01 (0.59) 1.89 ± 0.55 2.62 ± 0.73 1.42 ± 0.30 0.90 ± 0.23 1.69 ± 0.68 GA 154 4.59 ± 1.13 1.01 (0.64) 1.80 ± 0.49 2.56 ± 0.86 1.36 ± 0.29 0.87 ± 0.25 1.68 ± 0.61 AA 57 4.50 ± 1.04 1.03 (0.78) 1.71 ± 0.49 2.58 ± 0.72 1.32 ± 0.30 0.88 ± 0.22 1.61 ± 0.59 F - 1.039 0.062 3.590 0.037 3.020 0.102 0.575 P - 0.355 0.970 0.029 0.964 0.049 0.903 0.564 Female GG 112 4.72 ± 0.96 0.96 (0.56) 1.94 ± 0.47 2.59 ± 0.71 1.43 ± 0.24 0.89 ± 0.21 1.70 ± 0.48 GA 160 4.83 ± 0.97 1.02 (0.77) 1.99 ± 0.45 2.68 ± 0.75 1.43 ± 0.26 0.91 ± 0.22 1.72 ± 0.53 AA 59 4.76 ± 0.75 0.99(0.58) 1.85 ± 0.47 2.70 ± 0.63 1.39 ± 0.23 0.93 ± 0.20 1.55 ± 0.42 F - 0.390 1.182 2.150 0.538 2.640 0.760 2.133 P - 0.677 0.554 0.118 0.585 0.073 0.469 0.120 TC, total cholesterol; TG, triglyceride; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; ApoAI, apolipoprotein AI; ApoB, apolipoprotein B; ApoAI/ApoB, the ratio of apolipoprotein AI to apolipoprotein B. Login to comment
145 Table 4 Correlative factors for serum lipid parameters between the Bai Ku Yao and Han populations Lipid parameter Relative factor Standardized coefficient Standard error t P Bai plus Han TC Body mass index 0.100 0.150 2.318 0.021 Age 0.194 0.002 7.234 0.000 Ethnic group -1.159 0.050 -6.200 0.001 Diastolic blood pressure 0.094 0.003 3.400 0.001 Weight 0.164 0.006 0.164 0.000 Sex 0.087 0.061 0.087 0.005 TG Weight 0.216 0.004 7.889 0.000 Alcohol consumption 0.114 0.042 4.168 0.000 HDL-C Age 0.211 0.001 8.214 0.000 Ethnic group -0.235 0.023 -9.336 0.000 Alcohol consumption 0.233 0.018 8.246 0.000 Sex 0.127 0.026 4.541 0.000 Body mass index -0.069 0.004 -2.689 0.007 LDL-C Body mass index 0.093 0.012 2.097 0.036 Age 0.188 0.001 6.975 0.000 Alcohol consumption -0.090 0.029 -3.092 0.002 Weight 0.209 0.004 4.412 0.000 Sex 0.084 0.051 2.491 0.013 ApoAI Age 0.221 0.001 8.308 0.000 Alcohol consumption 0.230 0.012 8.126 0.000 Ethnic group -0.171 0.015 -6.759 0.000 Diastolic blood pressure 0.061 0.001 2.272 0.023 Sex 0.057 0.017 2.021 0.044 ApoB Body mass index 0.237 0.002 8.922 0.000 Age 0.160 0.000 5.999 0.000 Ethnic group -0.087 0.012 -3.393 0.001 Diastolic blood pressure 0.105 0.001 3.784 0.000 Sex 0.081 0.012 3.098 0.002 ApoAI/ApoB Alcohol consumption 0.165 0.023 6.103 0.000 Body mass index -0.155 0.006 -5.722 0.000 Bai Ku Yao TC Body mass index 0.216 0.014 5.821 0.000 Age 0.139 0.002 3.730 0.000 Genotype 0.076 0.048 2.051 0.041 TG Alcohol consumption 0.197 0.068 4.194 0.000 Body mass index 0.133 0.016 3.505 0.000 Sex -0.154 0.099 -3.099 0.002 Smoking -0.125 0.066 -2.485 0.013 HDL-C Alcohol consumption 0.204 0.022 5.502 0.000 Age 0.177 0.001 4.765 0.000 LDL-C Body mass index 0.219 0.012 5.812 0.000 Age 0.114 0.002 3.034 0.003 Alcohol consumption -0.080 0.042 -2.107 0.035 ApoAI Alcohol consumption 0.310 0.017 8.602 0.000 Age 0.167 0.001 4.639 0.000 ApoB Alcohol consumption 0.287 0.039 7.748 0.000 Body mass index -0.153 0.011 -4.138 0.000 ApoAI/ApoB Body mass index 0.207 0.004 5.463 0.000 Age 0.102 0.001 2.674 0.008 Sex 0.106 0.017 2.800 0.005 V825I in the ABCA1 gene may have an ethnic specificity. Login to comment
147 Conversely, several previous studies found that the V825I polymorphism in the ABCA1 gene was associated with increased serum HDL-C levels [26-29]. Login to comment
149 They thought that the lack of significant association in men for V825I was partly due to less-significant effects on HDL-C in men. Login to comment
153 Li et al. [29] found that the V825I polymorphism may affect ApoAI levels in Han Chinese population, but the influence depended on the haplotype generated from V825I and R1587K. Login to comment
155 In the current study, the association of V825I polymorphism and serum ApoAI levels, to some extent at least, was in agreement with a previous study in Han Chinese [29], but the influence on decreased serum HDL-C level in Han Chinese was reverse to that from Danish general population and European ancestry population [26-29]. Login to comment
156 However, several previous reports failed to find a significant association between the V825I polymorphism in the ABCA1 gene and serum HDL-C levels [30-33]. Login to comment
158 Tan et al. [31] reported that no obviously changes in serum lipid levels were observed in G or A allele carriers in Singapore CHD and CHD-free males (Chinese, Malays and Indian), but the V825I polymorphism clearly associated Table 4 Correlative factors for serum lipid parameters between the Bai Ku Yao and Han populations (Continued) Diastolic blood pressure 0.094 0.001 2.365 0.018 Han Chinese TC Age 0.254 0.002 6.807 0.000 Diastolic blood pressure 0.128 0.004 3.264 0.001 Weight 0.281 0.004 7.109 0.000 Sex 0.165 0.076 4.387 0.000 TG Weight 0.278 0.005 7.293 0.000 Alcohol consumption 0.078 0.060 2.033 0.043 HDL-C Age 0.260 0.001 7.014 0.000 Alcohol consumption 0.218 0.023 5.628 0.000 Sex 0.151 0.039 3.770 0.000 Weight -0.100 0.002 -2.606 0.009 Genotype -0.088 0.025 -2.444 0.015 LDL-C Age 0.249 0.002 6.620 0.000 Weight 0.196 0.005 3.524 0.000 Alcohol consumption -0.124 0.035 -3.299 0.001 ApoAI Age 0.307 0.001 8.091 0.000 Alcohol consumption 0.170 0.013 4.441 0.000 Sex 0.169 0.021 4.464 0.000 Diastolic blood pressure 0.085 0.001 2.231 0.026 Genotype -0.071 0.014 -1.988 0.047 ApoB Body mass index 0.261 0.003 6.957 0.000 Age 0.228 0.001 6.086 0.000 Diastolic blood pressure 0.106 0.001 2.732 0.006 ApoAI/ApoB Body mass index -0.167 0.007 -4.305 0.000 TC, total cholesterol; TG, triglyceride; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; ApoAI, apolipoprotein AI; ApoB, apolipoprotein B. Table 5 Correlative factors for serum lipid parameters between males and females in both ethnic groups Lipid parameter Relative factor Standardized coefficient Standard error t P Bai Ku Yao Male TC Body mass index 0.268 0.023 5.036 0.000 Age 0.130 0.007 2.434 0.015 TG Body mass index 0.216 0.031 3.973 0.000 HDL-C Alcohol consumption 0.229 0.037 5.033 0.000 Age 0.275 0.002 4.286 0.000 Body mass index -0.116 0.011 -0.201 0.028 LDL-C Body mass index 0.261 0.021 4.854 0.000 ApoAI Alcohol consumption 0.313 0.028 5.887 0.000 Age 0.187 0.001 3.519 0.000 ApoB Body mass index 0.293 0.006 5.496 0.000 ApoAI/ApoB Alcohol consumption 0.272 0.068 4.983 0.000 Body mass index -0.188 0.022 -3.449 0.001 Female TC Body mass index 0.170 0.016 3.253 0.001 Age 0.148 0.003 2.824 0.005 TG Alcohol consumption 0.205 0.080 3.919 0.000 LDL-C Body mass index 0.168 0.013 3.209 0.001 Age 0.162 0.002 3.012 0.002 ApoAI Age 0.159 0.001 2.300 0.003 Body mass index 0.160 0.001 2.030 0.022 ApoB Systolic blood pressure 0.328 0.008 3.067 0.002 Body mass index 0.202 0.003 3.321 0.001 Weight 0.025 0.117 2.053 0.041 ApoAI/ApoB Diastolic blood pressure -0.155 0.003 -2.937 0.004 Han Chinese Male TC Weight 0.334 0.006 6.638 0.000 Age 0.228 0.003 4.424 0.000 Alcohol consumption 0.152 0.065 2.932 0.004 TG Weight 0.385 0.009 7.379 0.000 HDL-C Age 0.336 0.002 6.729 0.000 Alcohol consumption 0.309 0.031 6.148 0.000 Weight -0.016 0.003 -3.278 0.007 Genotype -0.131 0.035 -2.711 0.000 LDL-C Weight 0.287 0.004 5.389 0.000 Age 0.174 0.007 3.273 0.001 ApoAI Age 0.377 0.001 7.609 0.000 Alcohol consumption 0.278 0.017 5.622 0.000 Genotype -0.125 0.020 -2.599 0.010 ApoB Body mass index 0.295 0.004 5.718 0.000 Age 0.208 0.001 3.930 0.000 Smoking 0.124 0.014 2.422 0.016 Alcohol consumption 0.106 0.015 2.005 0.046 ApoAI/ApoB Age 0.118 0.020 2.100 0.037 Body mass index -0.172 0.011 -3.054 0.002 Female TC Age 0.278 0.007 5.317 0.000 Weight 0.210 0.006 4.075 0.000 Diastolic blood pressure 0.152 0.005 2.855 0.005 with CHD status in male Malays. Login to comment
160 To our knowledge, the association of the V825I polymorphism and serum TC levels has not been described previously. Login to comment
174 But the V825I polymorphism in the ABCA1 gene is found to be associated with male serum HDL-C and ApoAI levels in the Han, and serum TC levels in the Bai Ku Yao populations. Login to comment
176 The difference in the association of V825I polymorphism and serum lipid levels between the two ethnic groups might partly result from different ABCA1 gene-enviromental interactions. Login to comment
31 A common variant of V825I in the ABCA1 gene is a missense SNP in the exon 17 that locates in the middle part of the protein corresponding to sixth transmembrane a-helix with mutation of GTC&#ae;ATC. Login to comment
40 Therefore, the aim of the present study was to detect the association of V825I polymorphism in the ABCA1 gene and several environmental factors with serum lipid phenotypes in the Guangxi Bai Ku Yao and Han populations. Login to comment
106 Genotypic and allelic frequencies Table 2 gives the genotypic and allelic frequencies of V825I polymorphism in the ABCA1 gene. Login to comment
110 The nucleotide sequence of V825I polymorphism The results were shown as GG, GA and AA genotypes by PCR-RFLP, the GG, GA and AA genotypes were also confirmed by sequencing (Figure 3); respectively. Login to comment
118 Figure 2 Genotyping of V825I polymorphism in the ABCA1 gene. Login to comment
131 Table 2 Genotypic and allelic frequencies of the ABCA1 V825I polymorphism between the Bai Ku Yao and Han populations [n (%)] Group n Genotype Allele GG GA AA G A Bai Ku Yao 677 228 (33.7) 321 (47.4) 128 (18.9) 777 (57.4) 577 (42.6) Han Chinese 646 216 (33.4) 314 (48.6) 116 (18.0) 746 (57.7) 546 (42.3) c2 - 0.265 0.034 P - 0.876 0.854 Bai Ku Yao Male 324 110 (34.0) 153 (47.2) 61 (18.8) 373 (57.6) 275 (42.4) Female 353 118 (33.4) 168 (47.6) 67 (19.0) 404 (57.2) 302 (42.8) c2 - 0.210 0.016 P - 0.990 0.900 Han Chinese Male 315 104 (33.0) 154 (48.9) 57 (18.1) 362 (57.5) 268 (42.5) Female 331 112 (33.8) 160 (48.3) 59 (17.8) 384 (58.0) 278 (42.0) c2 - 0.490 0.030 P - 0.976 0.863 Figure 3 A part of the nucleotide sequence of the ABCA1 V825I polymorphism. Login to comment
141 These results indicate that the prevalence of the A allele variation of Table 3 Genotypic frequencies of the ABCA1 V825I polymorphism and serum lipid levels between the Bai Ku Yao and Han populations Genotype n TC (mmol/L) TG (mmol/L) HDL-C (mmol/L) LDL-C (mmol/L) ApoAI (g/L) ApoB (g/L) ApoAI/ApoB Bai Ku Yao GG 228 4.28 &#b1; 0.79 1.09 (0.80) 1.63 &#b1; 0.39 2.52 &#b1; 0.65 1.30 &#b1; 0.34 0.84 &#b1; 0.21 1.65 &#b1; 0.69 GA 321 4.26 &#b1; 0.82 0.96 (0.61) 1.64 &#b1; 0.41 2.52 &#b1; 0.68 1.28 &#b1; 0.29 0.83 &#b1; 0.22 1.64 &#b1; 0.63 AA 128 4.52 &#b1; 1.26 0.95 (0.61) 1.72 &#b1; 0.45 2.69 &#b1; 1.04 1.33 &#b1; 0.35 0.86 &#b1; 0.26 1.73 &#b1; 0.91 F - 3.839 4.621 2.073 2.358 1.460 0.663 0.862 P - 0.022 0.099 0.127 0.095 0.233 0.516 0.423 Male GG 110 4.29 &#b1; 0.80 1.25 (0.91) 1.65 &#b1; 045 2.43 &#b1; 0.68 1.36 &#b1; 0.39 0.82 &#b1; 0.21 1.81 &#b1; 0.86 GA 153 4.26 &#b1; 0.88 1.00 (0.66) 1.67 &#b1; 0.45 2.47 &#b1; 0.73 1.32 &#b1; 0.33 081 &#b1; 021 1.76 &#b1; 0.74 AA 61 4.53 &#b1; 1.62 1.02 (0.68) 1.74 &#b1; 0.56 2.63 &#b1; 1.33 1.40 &#b1; 0.44 0.83 &#b1; 0.30 1.96 &#b1; 1.19 F - 1.850 4.969 0.974 1.377 1.040 0.081 1.370 P - 0.159 0.083 0.379 0.254 0.355 0.922 0.256 Female GG 118 4.26 &#b1; 0.80 0.97(0.62) 1.60 &#b1; 0.33 2.59 &#b1; 0.62 1.25 &#b1; 0.26 0.87 &#b1; 0.20 1.50 &#b1; 0.44 GA 168 4.26 &#b1; 0.77 0.94(0.56) 1.62 &#b1; 0.36 2.57 &#b1; 0.63 1.24 &#b1; 0.25 0.85 &#b1; 0.22 1.53 &#b1; 0.47 AA 67 4.50 &#b1; 0.80 0.92(0.49) 1.69 &#b1; 0.31 2.73 &#b1; 0.68 1.27 &#b1; 0.22 0.89 &#b1; 0.20 1.51 &#b1; 0.45 F - 2.860 0.595 1.530 2.080 0.474 1.150 0.578 P - 0.059 0.743 0.220 0.126 0.623 0.320 0.560 Han Chinese GG 216 4.77 &#b1; 0.99 1.00 (0.57) 1.92 &#b1; 0.51 2.61 &#b1; 0.72 1.43 &#b1; 0.27 0.89 &#b1; 0.22 1.70 &#b1; 0.58 GA 314 4.71 &#b1; 1.06 1.01 (0.68) 1.90 &#b1; 0.48 2.62 &#b1; 0.81 1.42 &#b1; 0.28 0.89 &#b1; 0.24 1.69 &#b1; 0.57 AA 116 4.63 &#b1; 0.90 1.02 (0.70) 1.78 &#b1; 0.48 2.64 &#b1; 0.67 1.36 &#b1; 0.27 0.90 &#b1; 0.21 1.58 &#b1; 0.51 F - 0.600 0.682 3.797 0.190 3.650 0.220 1.930 P - 0.540 0.711 0.023 0.674 0.027 0.800 0.145 Male GG 104 4.77 &#b1; 1.03 1.01 (0.59) 1.89 &#b1; 0.55 2.62 &#b1; 0.73 1.42 &#b1; 0.30 0.90 &#b1; 0.23 1.69 &#b1; 0.68 GA 154 4.59 &#b1; 1.13 1.01 (0.64) 1.80 &#b1; 0.49 2.56 &#b1; 0.86 1.36 &#b1; 0.29 0.87 &#b1; 0.25 1.68 &#b1; 0.61 AA 57 4.50 &#b1; 1.04 1.03 (0.78) 1.71 &#b1; 0.49 2.58 &#b1; 0.72 1.32 &#b1; 0.30 0.88 &#b1; 0.22 1.61 &#b1; 0.59 F - 1.039 0.062 3.590 0.037 3.020 0.102 0.575 P - 0.355 0.970 0.029 0.964 0.049 0.903 0.564 Female GG 112 4.72 &#b1; 0.96 0.96 (0.56) 1.94 &#b1; 0.47 2.59 &#b1; 0.71 1.43 &#b1; 0.24 0.89 &#b1; 0.21 1.70 &#b1; 0.48 GA 160 4.83 &#b1; 0.97 1.02 (0.77) 1.99 &#b1; 0.45 2.68 &#b1; 0.75 1.43 &#b1; 0.26 0.91 &#b1; 0.22 1.72 &#b1; 0.53 AA 59 4.76 &#b1; 0.75 0.99(0.58) 1.85 &#b1; 0.47 2.70 &#b1; 0.63 1.39 &#b1; 0.23 0.93 &#b1; 0.20 1.55 &#b1; 0.42 F - 0.390 1.182 2.150 0.538 2.640 0.760 2.133 P - 0.677 0.554 0.118 0.585 0.073 0.469 0.120 TC, total cholesterol; TG, triglyceride; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; ApoAI, apolipoprotein AI; ApoB, apolipoprotein B; ApoAI/ApoB, the ratio of apolipoprotein AI to apolipoprotein B. Login to comment
144 Table 4 Correlative factors for serum lipid parameters between the Bai Ku Yao and Han populations Lipid parameter Relative factor Standardized coefficient Standard error t P Bai plus Han TC Body mass index 0.100 0.150 2.318 0.021 Age 0.194 0.002 7.234 0.000 Ethnic group -1.159 0.050 -6.200 0.001 Diastolic blood pressure 0.094 0.003 3.400 0.001 Weight 0.164 0.006 0.164 0.000 Sex 0.087 0.061 0.087 0.005 TG Weight 0.216 0.004 7.889 0.000 Alcohol consumption 0.114 0.042 4.168 0.000 HDL-C Age 0.211 0.001 8.214 0.000 Ethnic group -0.235 0.023 -9.336 0.000 Alcohol consumption 0.233 0.018 8.246 0.000 Sex 0.127 0.026 4.541 0.000 Body mass index -0.069 0.004 -2.689 0.007 LDL-C Body mass index 0.093 0.012 2.097 0.036 Age 0.188 0.001 6.975 0.000 Alcohol consumption -0.090 0.029 -3.092 0.002 Weight 0.209 0.004 4.412 0.000 Sex 0.084 0.051 2.491 0.013 ApoAI Age 0.221 0.001 8.308 0.000 Alcohol consumption 0.230 0.012 8.126 0.000 Ethnic group -0.171 0.015 -6.759 0.000 Diastolic blood pressure 0.061 0.001 2.272 0.023 Sex 0.057 0.017 2.021 0.044 ApoB Body mass index 0.237 0.002 8.922 0.000 Age 0.160 0.000 5.999 0.000 Ethnic group -0.087 0.012 -3.393 0.001 Diastolic blood pressure 0.105 0.001 3.784 0.000 Sex 0.081 0.012 3.098 0.002 ApoAI/ApoB Alcohol consumption 0.165 0.023 6.103 0.000 Body mass index -0.155 0.006 -5.722 0.000 Bai Ku Yao TC Body mass index 0.216 0.014 5.821 0.000 Age 0.139 0.002 3.730 0.000 Genotype 0.076 0.048 2.051 0.041 TG Alcohol consumption 0.197 0.068 4.194 0.000 Body mass index 0.133 0.016 3.505 0.000 Sex -0.154 0.099 -3.099 0.002 Smoking -0.125 0.066 -2.485 0.013 HDL-C Alcohol consumption 0.204 0.022 5.502 0.000 Age 0.177 0.001 4.765 0.000 LDL-C Body mass index 0.219 0.012 5.812 0.000 Age 0.114 0.002 3.034 0.003 Alcohol consumption -0.080 0.042 -2.107 0.035 ApoAI Alcohol consumption 0.310 0.017 8.602 0.000 Age 0.167 0.001 4.639 0.000 ApoB Alcohol consumption 0.287 0.039 7.748 0.000 Body mass index -0.153 0.011 -4.138 0.000 ApoAI/ApoB Body mass index 0.207 0.004 5.463 0.000 Age 0.102 0.001 2.674 0.008 Sex 0.106 0.017 2.800 0.005 V825I in the ABCA1 gene may have an ethnic specificity. Login to comment
146 Conversely, several previous studies found that the V825I polymorphism in the ABCA1 gene was associated with increased serum HDL-C levels [26-29]. Login to comment
148 They thought that the lack of significant association in men for V825I was partly due to less-significant effects on HDL-C in men. Login to comment
152 Li et al. [29] found that the V825I polymorphism may affect ApoAI levels in Han Chinese population, but the influence depended on the haplotype generated from V825I and R1587K. Login to comment
154 In the current study, the association of V825I polymorphism and serum ApoAI levels, to some extent at least, was in agreement with a previous study in Han Chinese [29], but the influence on decreased serum HDL-C level in Han Chinese was reverse to that from Danish general population and European ancestry population [26-29]. Login to comment
157 Tan et al. [31] reported that no obviously changes in serum lipid levels were observed in G or A allele carriers in Singapore CHD and CHD-free males (Chinese, Malays and Indian), but the V825I polymorphism clearly associated Table 4 Correlative factors for serum lipid parameters between the Bai Ku Yao and Han populations (Continued) Diastolic blood pressure 0.094 0.001 2.365 0.018 Han Chinese TC Age 0.254 0.002 6.807 0.000 Diastolic blood pressure 0.128 0.004 3.264 0.001 Weight 0.281 0.004 7.109 0.000 Sex 0.165 0.076 4.387 0.000 TG Weight 0.278 0.005 7.293 0.000 Alcohol consumption 0.078 0.060 2.033 0.043 HDL-C Age 0.260 0.001 7.014 0.000 Alcohol consumption 0.218 0.023 5.628 0.000 Sex 0.151 0.039 3.770 0.000 Weight -0.100 0.002 -2.606 0.009 Genotype -0.088 0.025 -2.444 0.015 LDL-C Age 0.249 0.002 6.620 0.000 Weight 0.196 0.005 3.524 0.000 Alcohol consumption -0.124 0.035 -3.299 0.001 ApoAI Age 0.307 0.001 8.091 0.000 Alcohol consumption 0.170 0.013 4.441 0.000 Sex 0.169 0.021 4.464 0.000 Diastolic blood pressure 0.085 0.001 2.231 0.026 Genotype -0.071 0.014 -1.988 0.047 ApoB Body mass index 0.261 0.003 6.957 0.000 Age 0.228 0.001 6.086 0.000 Diastolic blood pressure 0.106 0.001 2.732 0.006 ApoAI/ApoB Body mass index -0.167 0.007 -4.305 0.000 TC, total cholesterol; TG, triglyceride; HDL-C, high-density lipoprotein cholesterol; LDL-C, low-density lipoprotein cholesterol; ApoAI, apolipoprotein AI; ApoB, apolipoprotein B. Login to comment

[hide] Mutations in APOA-I and ABCA1 in Norwegians with l... Clin Chim Acta. 2010 Dec 14;411(23-24):2019-23. Epub 2010 Aug 25. Berge KE, Leren TP
Mutations in APOA-I and ABCA1 in Norwegians with low levels of HDL cholesterol.
Clin Chim Acta. 2010 Dec 14;411(23-24):2019-23. Epub 2010 Aug 25., [PMID:20800056]

Abstract [show]
BACKGROUND: Epidemiological studies have shown that low levels of plasma high density lipoprotein (HDL) cholesterol are associated with increased risk of ischemic heart disease (IHD), but it appears that genetic forms of low HDL cholesterol levels, as opposed to lifestyle-induced low levels of HDL cholesterol, do not result in increased risk of IHD. Therefore, the etiology of reduced levels of plasma HDL cholesterol may represent a factor that should be considered in risk stratification with respect to primary prevention. Genes encoding proteins involved in HDL metabolism, such as the ATP-binding cassette transporter A1 (ABCA1) and apolipoprotein (apo) A-I genes, are candidate genes for harboring mutations that lead to low HDL cholesterol levels. METHODS: The ABCA1 and apoA-I genes in 56 Norwegian patients, with a mean HDL cholesterol level of 0.53 (+/-0.15) mmol/l, were subjected to DNA sequencing. RESULTS: Several mutations were identified in the ABCA1 gene, and two mutations were identified in the apoA-I gene. A total of 18 patients (32%) were carriers of mutations considered to be pathogenic. Their mean HDL cholesterol level was 0.45 (+/-0.15) mmol/l compared to 0.57 (+/-0.14) mmol/l in noncarriers (p<0.005). CONCLUSION: Mutations in the genes encoding ABCA1 and apoA-I are common in Norwegians, with a markedly decreased HDL cholesterol level.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 of patients (het/hom)a Mutation Nucleotide Exon/Intron (i) PolyPhen prediction (score) SNP rs ID, ref.# ABCA1 Missense 8/3 R219K c.656, GNA 7 Benign (0.489) rs2230806 0/1 R282Q c.845, GNA 9 Benign (0.592) Novel 1/0 V399A c.1196, TNC 11 Benign (0.040) rs9282543 1/0 M636V c.1906, ANG 15 Benign (0.418) Novel 3/0 V771M c.2311, GNA 16 Benign (0.931) rs2066718 2/0 V825I c.2473, GNA 17 Benign (0.440) rs2066715 3/1 I883M c.2649, ANG 18 Benign (0.147) rs2066714 1/0 C887F c.2660, GNT 19 Benign (0.888) Novel 3/0 E1172D c.3516, GNC 24 Benign (0.546) rs33918808 1/0 G1216V c.3647, GNT 25 Prob damb (2.154) Ref. [18] 1/0 L1244Q c.3731, TNA 25 Prob dam (2.269) Novel 1/0 C1477F c.4430, TNA 31 Prob dam (3.688) Ref. [17] 14/1 R1587K c.4760, ANT 35 Benign (0.284) rs2230808 1/0 V1674I c.5020, GNA 37 Benign (0.821) Novel 1/0 R1680Q c.5039, GNA 37 Poss damc (1.926) Ref. [17] 1/0 N1800H c.5398, ANC 40 Poss dam (1.845) Ref. [19] Nonsense/splice 1/0 IVS4+1, GNA c.302+1, GNA i4 - 1/0 C1429X c.4287, CNA 31 - 1/0 IVS32+1, GNA c.4559+1, GNA i32 - APOA-I 7/0 R160L c.551, GNT 4 Prob dam (2.491) Ref. [21] 1/0 del182K del c.616-618 AAG 4 - Novel a Het: heterozygote, hom: homozygote. Login to comment
78 Variants R219K, V399A, V771M, V825I, I883M, E1172D, and R1587K have been reported as single nucleotide polymorphisms (SNPs) (Table 1). Login to comment
80 In addition, R219K, V771M, V825I, I883M, E1172D, and R1587K have been found in similar frequencies in patients with low or high HDL cholesterol levels [18], indicating that these variants do not cause low HDL cholesterol levels. Login to comment

[hide] Associations between common polymorphisms of adeno... Arch Cardiovasc Dis. 2010 Oct;103(10):530-7. Epub 2010 Nov 20. Rejeb J, Omezzine A, Rebhi L, Boumaiza I, Kchock K, Belkahla R, Rejeb NB, Nabli N, Abdelaziz AB, Boughzala E, Bouslama A
Associations between common polymorphisms of adenosine triphosphate-binding cassette transporter A1 and coronary artery disease in a Tunisian population.
Arch Cardiovasc Dis. 2010 Oct;103(10):530-7. Epub 2010 Nov 20., [PMID:21130966]

Abstract [show]
BACKGROUND: The adenosine triphosphate-binding cassette transporter A1 (ABCA1) protein plays an important role in the first step of the reverse cholesterol transport system. AIMS: We studied the association of four polymorphisms in the ABCA1 gene (G1051A, G2706A, G2868A and -565C/T) with lipid profile and coronary artery disease. METHODS: Overall, 316 Tunisian patients underwent coronary angiography. Genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism analysis. Lipid and apolipoprotein concentrations were measured. RESULTS: Only carriers of the G2706A allele were associated with a decreased risk of significant stenosis (odds ratio [OR] 0.66, 95% confidence interval [CI] 0.22-0.92, p = 0.029), without pronounced effects on high-density lipoprotein (HDL) cholesterol. This protective effect was significant in smokers and diabetes. Carriers of the G1051A allele were associated only with increased concentrations of HDL cholesterol (p = 0.032). G2868A and -565C/T did not show any association with lipids or risk of significant stenosis. When ABCA1 polymorphisms were combined in haplotypes possessing G1051A, G2706A, G2868A and -565C/T, (AAGC) seemed to be most protective against significant stenosis (OR 0.5, 95% CI 0.29-0.96, p = 0.048) whereas (GGAT) was probably the most atherogenic (OR 1.26, 95% CI 1.03-1.56, p = 0.025). CONCLUSION: Only the G2706A allele seems to be associated with a reduced risk of significant stenosis without important modification of HDL-cholesterol concentration, and appears to be more protective for smokers and diabetic patients. We found that (AAGC) seems to be a protective haplotype whereas (GGAT) has an atherogenic effect in a Tunisian population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 The genotypes for each ABCA1 polymorphism (G1051A [R219K], G2706A [V771M], G2868A [V825I] and -565C/T [-477C/T]) were determined by polymerase chain reaction-restriction fragment length polymorphism analysis. Login to comment

[hide] The R219K polymorphism in the ATP-binding cassette... Neurobiol Aging. 2010 Apr;31(4):647-53. Epub 2008 Jul 14. Wang N, Xue XH, Lin Y, Fang L, Murong S, Wu ZY
The R219K polymorphism in the ATP-binding cassette transporter 1 gene has a protective effect on atherothrombotic cerebral infarction in Chinese Han ethnic population.
Neurobiol Aging. 2010 Apr;31(4):647-53. Epub 2008 Jul 14., [PMID:18621447]

Abstract [show]
The association of R219K and V825I polymorphisms of ABCA1 gene with cerebral infarction has been rarely reported. Here we wish to address this issue. A total of 476 subjects from Chinese Han ethnic population were investigated, including 152 control individuals and 324 patients with cerebral infarction. Genotyping of R219K and V825I were performed by PCR-RFLP analysis. Data were analyzed using a statistical package. The R219K genotype frequency distributions were significantly different between patients with atherothrombotic cerebral infarction (ACI) and control individuals, with fewer KK genotypes and more RR genotypes in ACI patients (chi(2)=9.89, P<0.01). The K allele is less frequent among ACI patients than in controls (chi(2)=9.16, P<0.005). A significant association of KK with decreased ACI risk was exhibited, especially in male patients, aged patients and individuals with hypertension. These results indicate that the K allele of R219K polymorphism is an independent protective factor against ACI. In addition, though there is no association of V825I with ACI, this polymorphism may have certain synergistic effect with hypertension in susceptibility to ACI.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Neurobiology of Aging 31 (2010) 647-653 The R219K polymorphism in the ATP-binding cassette transporter 1 gene has a protective effect on atherothrombotic cerebral infarction in Chinese Han ethnic population Ning Wanga, Xie-Hua Xuea, Yi Lina, Ling Fanga, Shenxing Muronga, Zhi-Ying Wua,b,* a Department of Neurology and Institute of Neurology, First Affiliated Hospital, Center of Neuroscience, Fujian Medical University, 20 Chazhong Road, Fuzhou 350005, China b Department of Neurology and Institute of Neurology, Huashan Hospital, Institutes of Brain Science and State Key Laboratory of Medical Neurobiology, Shanghai Medical College, Fudan University, 12 Wulumuqi Middle Road, Shanghai 200040, China Received 30 November 2007; received in revised form 29 April 2008; accepted 28 May 2008 Available online 14 July 2008 Abstract The association of R219K and V825I polymorphisms of ABCA1 gene with cerebral infarction has been rarely reported. Login to comment
3 Genotyping of R219K and V825I were performed by PCR-RFLP analysis. Login to comment
9 In addition, though there is no association of V825I with ACI, this polymorphism may have certain synergistic effect with hypertension in susceptibility to ACI. Login to comment
11 Keywords: Cerebral infarction; ATP-binding cassette transporter 1; R219K; V825I 1. Login to comment
19 The more common SNPs are R219K in exon 7 and V825I in exon 17. Login to comment
26 Taken together, these controversial findings indicate that the function of R219K and V825I may be significant in certain environmental factors and population backgrounds. Login to comment
27 Although the association of R219K and/or V825I with CAD has been widely reported in different ethnic populations, the association of them with cerebral infarction has been reported rarely (Andrikovics et al., 2006; Pasdar et al., 2007). Login to comment
30 The aim of this study is to investigate the association of R219K and V825I with cerebral infarction and levels of plasma lipids in the Han ethnic group in Chinese population. Login to comment
55 Genotyping of R219K and V825I Genotyping of R219K (primers: 5 -AAAGACTTCAA- GGACCCAG-3 and 5 -ACAAAGTCATGCTGTCCAAG- 3 ) and V825I (primers: 5 -GAGACTGACCAGGAAATGG- 3 and 5 -ATGCACTGCAGAGATTCTAG-3 ) was performed by PCR-RFLP analysis. Login to comment
56 PCR product was digested with EcoNI for R219K and BsaI for V825I according to the manufacturer`s recommendations (New England Biolabs, Beverly, MA, USA), then followed by a 2.5% agarose gel electrophoresis. Login to comment
58 Statistical analysis A chi-square analysis was performed to determine the Hardy-Weinberg equilibrium of R219K and V825I in the groups. Login to comment
60 The influence of R219K and V825I on plasma lipids were evaluated using analysis of variance with genotype as group variable and total cholesterol, triglycerides, HDL-C, LDL-C, ApoA1 and ApoB as dependent variables. Login to comment
63 * P < 0.05 Table 2 Genotype and allele frequency distributions of R219K and V825I R219K V825I Control ACI LI Control ACI LI All n = 152 (%) n = 193 (%) n = 131 (%) n = 152 (%) n = 193 (%) n = 131 (%) RR 41 (26.97) 75 (38.86) 32 (24.43) VV 41 (26.97) 45 (23.32) 39 (29.77) RK 77 (50.66) 96 (49.74) 76 (58.01) VI 76 (50.00) 110 (57.00) 71 (54.20) KK 34 (22.37) 22 (11.40)* 23 (17.56) II 35 (23.03) 38 (19.69) 21 (16.03) R frequency 52.3 63.73 53.43 V frequency 51.97 51.81 56.87 K frequency 47.7 36.27** 46.57 I frequency 48.03 48.19 43.13 Male n = 97 (%) n = 136 (%) n = 81 (%) n = 97 (%) n = 136 (%) n = 81 (%) RR 28 (28.86) 51 (37.50) 22 (27.16) VV 28 (28.86) 31 (22.80) 20 (24.69) RK 41 (42.28) 71 (52.21) 44 (54.32) VI 42 (43.30) 76 (55.88) 49 (60.49) KK 28 (28.86) 14 (10.29)** 15 (18.52) II 27 (27.84) 29 (21.32) 12 (14.82) R frequency 50 63.6 54.32 V frequency 50.52 50.09 54.94 K frequency 50 36.40** 45.68 I frequency 49.48 49.24 45.06 Female n = 55 (%) n = 57 (%) n = 50 (%) n = 55 (%) n = 57 (%) n = 50 (%) RR 13 (23.64) 24 (42.11) 10 (20.00) VV 13 (23.64) 14 (24.56) 19 (38.00) RK 36 (65.45) 25 (43.86) 32 (64.00) VI 34 (61.82) 34 (59.65) 22 (44.00) KK 6 (10.91) 8 (14.03) 8 (16.00) II 8 (15.54) 9 (15.79) 9 (18.00) R frequency 56.36 64.04 52 V frequency 54.55 54.39 60 K frequency 43.64 35.97 48 I frequency 45.45 45.61 40 <60 years n = 78 (%) n = 56 (%) n = 37 (%) n = 78 (%) n = 56 (%) n = 37 (%) RR 24 (30.77) 23 (41.07) 15 (40.54) VV 20 (25.64) 14 (25.00) 10 (22.73) RK 41 (52.56) 25 (44.64) 17 (45.95) VI 37 (47.44) 32 (57.14) 21 (47.73) KK 13 (16.67) 8 (14.29) 5 (13.51) II 21 (26.92) 10 (17.86) 6 (13.64) R frequency 57.05 63.39 63.51 V frequency 49.36 53.57 55.41 K frequency 42.95 36.61 36.49 I frequency 50.64 46.43 45.59 ≥60 years n = 74 (%) n = 137 (%) n = 94 (%) n = 74 (%) n = 137 (%) n = 94 (%) RR 17 (22.97) 52 (37.96) 20 (21.28) VV 21 (28.39) 31 (22.63) 29 (30.85) RK 36 (48.65) 71 (51.82) 56 (59.57) VI 39 (52.70) 78 (56.93) 50 (53.19) KK 21 (28.39) 14 (10.22)* 18 (19.15) II 14 (18.91) 28 (20.44) 15 (15.96) R frequency 46.30 63.87 51.06 V frequency 54.73 51.09 57.45 K frequency 52.70 36.13* 48.94 I frequency 45.27 48.91 42.55 ACI, atherothrombotic cerebral infarction; LI, lacunar infarction; *P < 0.01, **P < 0.005. culated. Login to comment
75 Genotype and allele frequency distributions R219K and V825I were in Hardy-Weinberg equilibrium in the ACI, LI and control groups (P > 0.05, see Supplemental data). Login to comment
84 In addition, V825I was not associated with absence/presence of ACI or LI. Login to comment
89 The interaction between R219K/V825I and risk factors was showed in Table 5. Login to comment
91 * P < 0.05 Table 5 The interaction among R219K, V825I and risk factors Genotypes and RF P OR 95% CI KK and hypertension Reference RK and hypertension* 0.002 3.09 1.54-6.19 RR and hypertension* 0.001 4.81 1.94-11.94 KK and DM2 Reference RK and DM2 0.108 2.822 0.79-10.01 RR and DM2 0.99 0.00 0.00 II and hypertension Reference VI and hypertension* 0.001 3.91 1.93-7.93 VV and hypertension* 0.04 2.42 1.04-5.62 II and DM2 Reference VI and DM2 0.105 2.33 0.64-9.91 VV and DM2 0.406 1.963 0.400-9.648 KK and II Reference RR and VI* 0.003 2.69 1.39-5.22 RR and VV 0.52 1.36 0.53-3.45 RK and VI 0.56 1.17 0.69-1.99 RK and VV 0.56 1.23 0.61-2.49 DM2, diabetes mellitus type 2; RF, risk factor. Login to comment
94 There was no interaction between R219K/V825I and diabetes mellitus 2 (DM2). Login to comment
97 This result further confirms that there is no association between V825I and ACI. Login to comment
107 In addition, there was no association between V825I and lipids levels. Login to comment
108 Table 6 Association of R219K and V825I with plasma lipid levels Lipid All Male Female RR n = 148 RK n = 249 KK n = 79 RR n = 101 RK + KK n = 213 RR n = 47 RK + KK n = 115 BMI (kg/m2) 23.35 ± 2.76 23.60 ± 2.46 23.62 ± 2.42 23.34 ± 2.94 23.65 ± 2.26 Hypertension (%) 43.24 46.18 37.97 43.56 45.07 42.55 42.61 DM2 (%) 11.49 12.05 13.92 9.9 13.15 14.89 11.3 Smoking (%) 8.78 6.43 7.6 12.87 9.39 0 1.74 Alcohol (%) 4.05 3.21 3.80 3.96 4.23 4.26 1.74 TC 4.79 ± 0.95 4.85 ± 1.07 4.88 ± 0.93 4.74 ± 0.87 4.68 ± 0.94 4.90 ± 1.12 5.23 ± 1.11 TG 1.78 ± 0.96 1.74 ± 0.98 1.53 ± 0.61* 1.79 ± 1.05 1.67 ± 0.97 1.75 ± 0.68 1.70 ± 0.99 HDL-C 1.07 ± 0.29 1.11 ± 0.30 1.12 ± 0.31 1.07 ± 0.29 1.05 ± 0.29 1.05 ± 0.03 1.22 ± 0.29**** LDL-C 3.03 ± 0.87 3.03 ± 0.92 2.98 ± 0.77 2.98 ± 0.79 2.86 ± 0.79 3.16 ± 1.04 3.32 ± 0.98 ApoA1 1.12 ± 0.24 1.18 ± 0.22** 1.22 ± 0.24*** 1.13 ± 0.24 1.14 ± 023 1.10 ± 0.25 1.28 ± 0.19**** ApoB 1.02 ± 0.28 1.06 ± 0.29 1.02 ± 0.24 1.00 ± 0.25 1.02 ± 0.28 1.05 ± 0.33 1.10 ± 0.27 Lipids VV n = 125 VI n = 257 II n = 94 VV + VI n = 246 II n = 68 VV + VI n = 136 II n = 26 BMI (kg/m2) 24.50 ± 2.75 23.17 ± 2.36 23.24 ± 2.47 23.59 ± 2.49 23.43 ± 2.47 23.62 ± 2.77 22.01 ± 2.60 Hypertension (%) 44.80 44.36 41.49 44.71 39.71 44.12 46.15 DM2 (%) 12.8 10.9 14.89 11.79 14.71 11.03 15.38 Smoking (%) 7.20 7.78 6.38 9.76 8.82 3.68 0 Alcohol (%) 2.40 3.89 4.26 2.44 4.41 2.21 3.84 TC 4.82 ± 0.99 4.91 ± 0.99 4.66 ± 1.06 4.72 ± 0.89 4.62 ± 0.99 5.17 ± 1.09 4.83 ± 1.36 TG 1.67 ± 0.92 1.70 ± 0.96 1.75 ± 0.91 1.71 ± 1.01 1.73 ± 0.95 1.7 ± 0.93 1.84 ± 0.76 HDL-C 1.12 ± 0.29 1.1 ± 0.30 1.05 ± 0.33 1.06 ± 0.28 1.05 ± 0.34 1.19 ± 0.30 1.04 ± 0.30 LDL-C 3.04 ± 0.92 3.06 ± 0.82 2.86 ± 0.96 2.95 ± 0.77 2.75 ± 0.85 3.27 ± 0.97 3.38 ± 1.26 ApoA1 1.19 ± 0.22 1.17 ± 0.23 1.12 ± 0.26 1.14 ± 0.23 1.12 ± 0.25 1.24 ± 0.21 1.14 ± 0.31 ApoB 1.04 ± 0.30 1.06 ± 0.26 1.01 ± 0.32 1.03 ± 0.26 0.97 ± 0.31 1.09 ± 0.28 1.11 ± 0.34 *P = 0.06, **P = 0.046, ***P = 0.03, ****P = 0.01. Login to comment
112 V825I is located in the middle part of the protein corresponding to the sixth transmembrane ␣-helix. Login to comment
132 This result is consistent with that of Andrikovics et al. but contrary to that of Pasdar et al. The data about the association of V825I with lipids levels are controversial. Login to comment
133 Both Clee et al. and Tan et al. reported that there was no association of V825I with lipids levels (Clee et al., 2001; Tan et al., 2003). Login to comment
135 However, our results did not exhibit any association of V825I with lipids levels and cerebral infarction. Login to comment
136 This may be due to the substitution of V825I is conservative and the polymorphism may only exert minimal influence on cholesterol efflux activity (Tan et al., 2003). Login to comment
137 There was few report associated with the synergistic effects among R219K, V825I and risk factors. Login to comment
141 Although there is no association of V825I with ACI, this polymorphism may have certain synergistic effect with hypertension in susceptibility to ACI. Login to comment
131 This result is consistent with that of Andrikovics et al. but contrary to that of Pasdar et al. The data about the association of V825I with lipids levels are controversial. Login to comment
134 However, our results did not exhibit any association of V825I with lipids levels and cerebral infarction. Login to comment
140 Although there is no association of V825I with ACI, this polymorphism may have certain synergistic effect with hypertension in susceptibility to ACI. Login to comment

[hide] Genetic variation in the ABCA1 gene, HDL cholester... Atherosclerosis. 2010 Feb;208(2):305-16. Epub 2009 Jun 11. Frikke-Schmidt R
Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population.
Atherosclerosis. 2010 Feb;208(2):305-16. Epub 2009 Jun 11., [PMID:19596329]

Abstract [show]
Epidemiological studies consistently demonstrate a strong inverse association between low levels of high-density lipoprotein (HDL) cholesterol and increased risk of ischemic heart disease (IHD). This review focuses on whether both rare and common genetic variation in ABCA1 contributes to plasma levels of HDL cholesterol and to risk of IHD in the general population, and further seeks to understand whether low levels of HDL cholesterol per se are causally related to IHD. Studies of the ABCA1 gene demonstrate a general strategy for detecting functional genetic variants, and show that both common and rare ABCA1 variants contribute to levels of HDL cholesterol and risk of IHD in the general population. The association between ABCA1 variants and risk of IHD appears, however, to be independent of plasma levels of HDL cholesterol. With the recent identification of the largest number of individuals heterozygous for loss-of-function mutations in ABCA1 worldwide, population studies suggests that genetically low HDL cholesterol per se does not predict an increased risk of IHD, and thus questions the causality of isolated low levels of HDL cholesterol for the development of IHD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2387 Common ABCA1 variants in the general population 5.1. Frequency of common variants in the extreme tails of the HDL distribution Several resequencing studies have identified a number of common non-synonymous variations in ABCA1 [57,58,81-84]: R219K, V771M, V825I, I883M, E1172D and R1587K. Login to comment
2389 In the largest resequencing study to date of Caucasians in the general population, two of the non-synonymous SNPs (V771M and R1587K) and/or their haplotypes differed in frequency between the population extremes of HDL cholesterol levels [52,57]. Login to comment
2390 Further, the frequency of V825I differed when women were considered separately. Login to comment
2395 Frequencies of common variants and association with variation in lipid levels in the general population Frequencies for the most common non-synonymous ABCA1 SNPs (R219K, V825I, I883M, R1587K) are largely similar across studies that partly or as a whole represent general populations [57,58,81,82,86-88], whereas the less common SNPs (V771M, and E1172D) are reported in some [57,58,81,82,86,88], but not in all studies [58,87]. Login to comment
2398 The V771M and V825I SNPs were associated with increases in HDL cholesterol in women, whereas the R1587K SNP was associated with decreased HDL cholesterol levels in both genders. Login to comment
2399 This corresponded well with the findings from the initial screening where V771M and V825I (in women) were overrepresented in the high extreme, and R1587K was overrepresented in the low extreme of HDL cholesterol [57]. Login to comment
2402 The HDL cholesterol and/or apoAI lowering effect of the rare allele of the very common R1587K SNP has now been observed in several different studies [57,81,82], whereas the HDL cholesterol increasing effect of the V771M and V825I/I883M SNPs appears to be confined to specific genders in different populations [57,58,87-89]. Login to comment
2404 The isolated single site analysis by Frikke-Schmidt et al. revealed that the V825I, and not the I883M SNP, was responsible for the HDL increments [57]. Login to comment
2386 Common ABCA1 variants in the general population 5.1. Frequency of common variants in the extreme tails of the HDL distribution Several resequencing studies have identified a number of common non-synonymous variations in ABCA1 [57,58,81-84]: R219K, V771M, V825I, I883M, E1172D and R1587K. Login to comment
2394 Frequencies of common variants and association with variation in lipid levels in the general population Frequencies for the most common non-synonymous ABCA1 SNPs (R219K, V825I, I883M, R1587K) are largely similar across studies that partly or as a whole represent general populations [57,58,81,82,86-88], whereas the less common SNPs (V771M, and E1172D) are reported in some [57,58,81,82,86,88], but not in all studies [58,87]. Login to comment
2397 The V771M and V825I SNPs were associated with increases in HDL cholesterol in women, whereas the R1587K SNP was associated with decreased HDL cholesterol levels in both genders. Login to comment
2401 The HDL cholesterol and/or apoAI lowering effect of the rare allele of the very common R1587K SNP has now been observed in several different studies [57,81,82], whereas the HDL cholesterol increasing effect of the V771M and V825I/I883M SNPs appears to be confined to specific genders in different populations [57,58,87-89]. Login to comment
2403 The isolated single site analysis by Frikke-Schmidt et al. revealed that the V825I, and not the I883M SNP, was responsible for the HDL increments [57]. Login to comment

[hide] Effect of ABCA1 mutations on risk for myocardial i... Curr Atheroscler Rep. 2008 Oct;10(5):413-26. Iatan I, Alrasadi K, Ruel I, Alwaili K, Genest J
Effect of ABCA1 mutations on risk for myocardial infarction.
Curr Atheroscler Rep. 2008 Oct;10(5):413-26., [PMID:18706283]

Abstract [show]
The adenosine triphosphate-binding cassette A1 (ABCA1) gene codes for a cellular phospholipid and cholesterol transporter that mediates the initial and essential step in high-density lipoprotein (HDL) biogenesis: the formation of nascent HDL particles. Mutations at the ABCA1 gene locus cause severe familial HDL deficiency and, in the homozygous form, cause Tangier disease. Several studies have investigated the influence of ABCA1 variation on lipid metabolism and coronary heart disease, but they have resulted in controversial and inconsistent results. Genetic variability at the ABCA1 gene has also been associated with increased risk of myocardial infarction. In one study, this association was independent of HDL cholesterol levels, raising the possibility that the measurement of HDL cholesterol levels may not provide adequate information on the functional roles of HDL particles. Nevertheless, genomic screening for complex diseases, such as coronary heart disease, and HDL deficiency in particular, may not add additional information to that gained from conventional global cardiovascular risk stratification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
112 Additional insights into the effects of ABCA1 on MI have recently been described by Frikke-Schmidt et al. [35•] in a study where six nonsynonymous ABCA1 SNPs, R219K, V771M, V825I, I883M, E1172D, and R1587K (identified by resequencing ABCA1 in 190 individuals of Danish ancestry [24]), were genotyped in 9259 individuals from the Copenhagen City Heart Study to assess their risk of CHD (Table 2). Login to comment
113 The principal finding of the study indicated that common genetic variation in ABCA1 predicts risk of CHD in the general population, but that their association was independent of plasma HDL-C levels: SNPs predicting increased MI risk were associated with either increases (V771 and V825I) or decreases (R1587K) in HDL-C, or no effect on HDL-C (R219K, I883M, E1172D). Login to comment
135 Genetic variation in ABCA1 and risk of myocardial infarction Study* / year Population screened HDL-C, mmol/L ABCA1 variants Conclusions Evans and Beil [41] / 2003 Patients attending a lipid outpatient clinic ( n = 813) R219K genotype: R219K † The K219 allele was signifi cantly protective against CHD in patients with hyperlipidemia and elevated Lp(a), as well as decreasing TG levels RR: 1.32 ± 0.03 RK: 1.34 ± 0.03 KK: 1.27 ± 0.31 Harada et al. [29] / 2003 Japanese patients ( n = 410) I883M genotype: I883M, R219K The I883M polymorphism was signifi cantly associated with higher HDL-C in Japanese patients, but not with CHD II: 1.16 ± 0.30 IM: 1.26 ± 0.42 MM: 1.27 ± 0.37; P = 0.05 R219K genotype: RR: 1.26 ± 0.41 RK: 1.25 ± 0.40 KK: 1.24 ± 0.35 Tan et al. [42] / 2003 Cases: Chinese ( n = 512), Malay ( n = 110), and Indian ( n = 164) men with established CHD Chinese: CAD: 0.89 ± 0.28, Ctl: 1.19 ± 0.32; P < 0.0005 C-14T, 237indelG, V825I † , M883I † , A8994G The V825I and M883I polymorphisms are positive markers for the CHD phenotype in Malays, but with no effect on HDL-C Malays: CAD: 0.83 ± 0.27, Ctl: 1.15 ± 0.27; P < 0.0005 Controls: Chinese ( n = 271), Malay ( n = 179), and Indian ( n = 231) men Indians: CAD: 0.79 ± 0.24, Ctl: 1.00 ± 0.26; P < 0.0005 Tregouet et al. [31] / 2004 Subgroup of ECTIM cohort ( n = 452 cases and n = 465 controls) NA C-564T, R219K † , R1587K ABCA1 polymorphisms, but not haplotypes, are involved in variability of apoA-I and the susceptibility to CHD. Login to comment
155 Genetic variation in ABCA1 and risk of myocardial infarction Study* / year Population screened HDL-C, mmol/L ABCA1 variants Conclusions Frikke-Schmidt et al. [35••] / 2008 Copenhagen City Heart Study: Women: R219K, V771M † , V825I † , I883M † , E1172D † , R1587K † Common genetic variation at the ABCA1 locus predicts IHD risk independently of plasma HDL-C levels. Login to comment

[hide] Novel rare mutations and promoter haplotypes in AB... Clin Genet. 2008 Feb;73(2):179-84. Slatter TL, Jones GT, Williams MJ, van Rij AM, McCormick SP
Novel rare mutations and promoter haplotypes in ABCA1 contribute to low-HDL-C levels.
Clin Genet. 2008 Feb;73(2):179-84., [PMID:18199144]

Abstract [show]
The ATP-binding cassette A1 (ABCA1) protein regulates plasma high-density lipoprotein (HDL) levels. Mutations in ABCA1 can cause HDL deficiency and increase the risk of premature coronary artery disease. Single nucleotide polymorphisms (SNPs) in ABCA1 are associated with variation in plasma HDL levels. We investigated the prevalence of mutations and common SNPs in ABCA1 in 154 low-HDL individuals and 102 high-HDL individuals. Mutations were identified in five of the low-HDL subjects, three having novel variants (I659V, R2004K, and A2028V) and two with a previously identified variant (R1068H). Analysis of four SNPs in the ABCA1 gene promoter (C-564T, G-407C, G-278C, and C-14T) identified the C-14T SNP and the TCCT haplotype to be over-represented in low-HDL individuals. The R1587K SNP was over-represented in low-HDL individuals, and the V825I and I883M SNPs over-represented in high-HDL individuals. We conclude that sequence variation in ABCA1 contributes significantly to variation in HDL levels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
9 The R1587K SNP was over-represented in low-HDL individuals, and the V825I and I883M SNPs over-represented in high-HDL individuals. Login to comment
20 The C-14T promoter SNP (17), and the R1587K coding SNP (9) have been associated with low HDL-C, while the V771M (9), V825I (9, 10) and I883M (10, 18) coding SNPs have been associated with elevated HDL-C. Login to comment
41 Genotyping of ABCA1 SNPs by RFLP Fourteen SNPs including five promoter SNPs (C-564T, G-407C, G-278C, G-99C, and C-14T), one 5#-UTR SNP [-76(-75) insG], six non-synonymous coding SNPs (R219K, V771M, V825I, I883M, E1172D, and R1587K) and two 3#-UTR SNPs [A-960G -383(-381)delGTT] were genotyped in the low-, mid-, and high-HDL-C groups by restriction fragment length polymorphism (RFLP) analysis. Login to comment
55 Six of the non-synonymous variants were previously reported SNPs (R219K, V771M, V825I, I883M, E1172D and R1587K). Login to comment
64 Two SNPs (V825I and I883M) were significantly over-represented in the high-HDL group [p ¼ 0.031 for I825 and p ¼ 0.030 for M883 (high vs low HDL-C)]. Login to comment
98 Our study also identified two ABCA1 SNPs (V825I and I883M) that were over-represented in high-HDL individuals. Login to comment
105 a Coding haplotypes were derived from the following six non-synonymous SNPs (left to right): R219K (G.A), V771M (G.A), V825I (G.A), I883M (A.G), E1172D (G.C), and R1587K (G.A). Login to comment

[hide] Genetic variation in ABCA1 predicts ischemic heart... Arterioscler Thromb Vasc Biol. 2008 Jan;28(1):180-6. Epub 2007 Oct 19. Frikke-Schmidt R, Nordestgaard BG, Jensen GB, Steffensen R, Tybjaerg-Hansen A
Genetic variation in ABCA1 predicts ischemic heart disease in the general population.
Arterioscler Thromb Vasc Biol. 2008 Jan;28(1):180-6. Epub 2007 Oct 19., [PMID:17951323]

Abstract [show]
OBJECTIVE: We tested the hypothesis that 6 nonsynonymous single nucleotide polymorphisms (SNPs) in ATP-Binding-Cassette transporter A1 (ABCA1) affect risk of ischemic heart disease (IHD) in the general population. METHODS AND RESULTS: We genotyped 9259 individuals from the Danish general population followed for 25 years. Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels. Despite this, 5 out of 6 SNPs (V771M, V825I, I883M, E1172D, R1587K) predicted increased risk of IHD. Similar results were obtained in a verification sample with 932 IHD cases versus 7999 controls. A stepwise regression approach identified V771M, I883M, and E1172D as the most important predictors of IHD and additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs. CONCLUSIONS: We show that 3 of 6 nonsynonymous SNPs in ABCA1 predict risk of IHD in the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels. Login to comment
8 Despite this, 5 out of 6 SNPs (V771M, V825I, I883M, E1172D, R1587K) predicted increased risk of IHD. Login to comment
10 A stepwise regression approach identified V771M, I883M, and E1172D as the most important predictors of IHD and additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs. Login to comment
16 In the present study we included 9259 individuals from the 1991 to 1994 examination, whom we genotyped for all nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals of Danish ancestry.8 Information on diagnosis of IHD (nϭ1170; World Health Organization; International Classification of Diseases, 8th edition: codes 410 to 414; 10th edition: codes I20-I25) was collected and verified until 31st December 2000 by reviewing all hospital admissions and diagnoses entered in the national Danish Patient Registry, all causes of death entered in the national Danish Causes of Death Registry, and medical records from hospitals and general practitioners. Login to comment
29 The cohort was participants in The Copenhagen City Heart Study who attended the 1991 to 1994 examination, and for whom combined genotypes for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) were available as well as all clinical and biochemical data (nϭ9028 out of nϭ9259; Table 1). Login to comment
38 SNP Genotyping The ABI PRISM 7900HT Sequence Detection System (Applied Biosystem Inc) was used to genotype for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals, as previously described.8 Biochemical Analyses Colorimetric and turbidimetric assays (Hitachi autoanalyzer) were used to measure plasma levels of total cholesterol, HDL-C, triglycerides, and apolipoproteins B and -AI (all Boehringer Mannheim GmbH). Login to comment
55 Frikke-Schmidt et al ABCA1 and Ischemic Heart Disease 181 the entire ABCA1 gene in 190 individuals of Danish descent were: 0.26 (R219K), 0.03 (V771M), 0.03 (E1172D), 0.06 (V825I), 0.12 (I883M), and 0.24 (R1587K).8 Similar allele frequencies have been reported for other White populations.14 Please see Data Supplements, Expanded Results for description of Hardy-Weinberg equilibrium. Login to comment
57 A strong positive DЈ was present for R219K/V771M, M825I/I883M, and E1172D/ R1587K (DЈϾ0.9), whereas a strong negative DЈ was present for R219K/V825I, V771M/V825I, and V771M/I883M (DЈϽ-0.9). Login to comment
60 Risk of IHD Prospective Study The cumulative incidence of IHD as a function of age was increased for V771M (GAϩAA versus GG, borderline Pϭ0.06), V825I (GAϩAA versus GG; Pϭ0.02), I883M (AGϩGG versus AA, Pϭ0.01), E1172D (GCϩCC versus GG, Pϭ0.03), and for R1587K (AA versus GG, borderline Pϭ0.06), but not for R219K (Figure 2). Login to comment
61 The age adjusted hazard ratios (HRs) for IHD were: V771M (GAϩAA versus GG) 1.2 (95% confidence interval [CI] 1.0 to 1.5), V825I (GAϩAA versus GG) 1.2 (1.0 to 1.5), I883M (AGϩGG versus AA) 1.2 (1.0 to 1.4), E1172D (GCϩCC versus GG) 1.3 (1.0 to 1.6) and R1587K (AA versus GG) 1.2 (1.0 to 1.6), respectively (Table 2). Login to comment
68 Probability values are for overall log-rank tests. For V771M, V825I, I883M, and E1172D, heterozygotes and homozygotes for the variant allele were pooled (combined genotype in red, common genotype in green). Login to comment
74 The age-adjusted odds ratios (ORs) were: V771M (GAϩAA versus GG) 1.2 (0.9 to 1.5), V825I (GAϩAA versus GG) 1.2 (0.9 to 1.4), I883M (AGϩGG versus AA) 1.2 (1.0 to 1.4), E1172D (GCϩCC versus GG) 1.1 (0.8 to 1.4), and R1587K (GA versus GG) 1.2 (1.0 to 1.4). Login to comment
81 ABCA1 SNPs and HDL-C Levels In genders combined, V771M and V825I were associated with increases in HDL-C of 0.04 and 0.05 mmol/L, respectively (Figure 3, upper panel). Login to comment
89 Rs numbers: R219K (rs2230806); V771M (rs2066718); V825I (rs2066715); I883M (rs4149313); E1172D (rs33918808); R1587K (rs2230808). Login to comment
97 Several studies have reported associations between V825I/ I883M and increased plasma HDL-C levels8,15,16 and associations between R1587K and a decreased HDL-C or apoAI.8,14,17 For in silico prediction of ABCA1 SNPs please see the Data Supplements Expanded Results. Login to comment
103 However, the single site result on IHD risk for V825I is most likely attributable to LD with I883M, and the findings for R1587K are most likely attributable to LD with E1172D, the latter also supported by the haplotype analysis presented in the Data Supplements, Table III and Expanded Results. Login to comment
1 Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels. Login to comment
2 Despite this, 5 out of 6 SNPs (V771M, V825I, I883M, E1172D, R1587K) predicted increased risk of IHD. Login to comment
23 The cohort was participants in The Copenhagen City Heart Study who attended the 1991 to 1994 examination, and for whom combined genotypes for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) were available as well as all clinical and biochemical data (nafd;9028 out of nafd;9259; Table 1). Login to comment
32 SNP Genotyping The ABI PRISM 7900HT Sequence Detection System (Applied Biosystem Inc) was used to genotype for all 6 nonsynonymous SNPs (R219K, V771M, V825I, I883M, E1172D, R1587K) identified by resequencing ABCA1 in 190 individuals, as previously described.8 Biochemical Analyses Colorimetric and turbidimetric assays (Hitachi autoanalyzer) were used to measure plasma levels of total cholesterol, HDL-C, triglycerides, and apolipoproteins B and -AI (all Boehringer Mannheim GmbH). Login to comment
49 Frikke-Schmidt et al ABCA1 and Ischemic Heart Disease 181 at Semmelweis University (Egyetem) on December 3, 2015 http://atvb.ahajournals.org/ Downloaded from the entire ABCA1 gene in 190 individuals of Danish descent were: 0.26 (R219K), 0.03 (V771M), 0.03 (E1172D), 0.06 (V825I), 0.12 (I883M), and 0.24 (R1587K).8 Similar allele frequencies have been reported for other White populations.14 Please see Data Supplements, Expanded Results for description of Hardy-Weinberg equilibrium. Login to comment
51 A strong positive Db18; was present for R219K/V771M, M825I/I883M, and E1172D/ R1587K (Db18;b0e;0.9), whereas a strong negative Db18; was present for R219K/V825I, V771M/V825I, and V771M/I883M (Db18;b0d;afa;0.9). Login to comment
54 Risk of IHD Prospective Study The cumulative incidence of IHD as a function of age was increased for V771M (GAaf9;AA versus GG, borderline Pafd;0.06), V825I (GAaf9;AA versus GG; Pafd;0.02), I883M (AGaf9;GG versus AA, Pafd;0.01), E1172D (GCaf9;CC versus GG, Pafd;0.03), and for R1587K (AA versus GG, borderline Pafd;0.06), but not for R219K (Figure 2). Login to comment
62 Probability values are for overall log-rank tests. For V771M, V825I, I883M, and E1172D, heterozygotes and homozygotes for the variant allele were pooled (combined genotype in red, common genotype in green). Login to comment
75 ABCA1 SNPs and HDL-C Levels In genders combined, V771M and V825I were associated with increases in HDL-C of 0.04 and 0.05 mmol/L, respectively (Figure 3, upper panel). Login to comment
83 Rs numbers: R219K (rs2230806); V771M (rs2066718); V825I (rs2066715); I883M (rs4149313); E1172D (rs33918808); R1587K (rs2230808). Login to comment
91 Several studies have reported associations between V825I/ I883M and increased plasma HDL-C levels8,15,16 and associations between R1587K and a decreased HDL-C or apoAI.8,14,17 For in silico prediction of ABCA1 SNPs please see the Data Supplements Expanded Results. Login to comment

[hide] Genetic determinants of HDL: monogenic disorders a... Curr Opin Cardiol. 2007 Jul;22(4):344-51. Klos KL, Kullo IJ
Genetic determinants of HDL: monogenic disorders and contributions to variation.
Curr Opin Cardiol. 2007 Jul;22(4):344-51., [PMID:17556888]

Abstract [show]
PURPOSE OF REVIEW: This review focuses on recent progress towards the characterization of genetic variations that contribute to interindividual variation in plasma high-density lipoprotein cholesterol levels in the general population. RECENT FINDINGS: Many of the genes that harbor rare mutations leading to extreme high-density lipoprotein cholesterol levels contain common variation that influences plasma high-density lipoprotein cholesterol in several study populations. Candidate gene association studies provide evidence that some of these variations have an effect on high-density lipoprotein cholesterol, dependent on epistatic interactions or environmental context. Both rare and common variations contribute to interindividual high-density lipoprotein cholesterol variation. Recent comparisons of candidate gene sequences between individuals in the tails of the high-density lipoprotein cholesterol distributions (the upper or lower 1-5%) of several study populations indicate that as many as 20% of individuals with low high-density lipoprotein cholesterol harbor a rare mutation in an investigated gene. For example, the ABCA1 gene region harbors rare mutations and common variants that contribute to interindividual high-density lipoprotein cholesterol variation in the general population. SUMMARY: The genetic control of high-density lipoprotein cholesterol level is complex. Maximizing the utility of genetic knowledge for predicting an individual's high-density lipoprotein cholesterol level or response to intervention will require a better understanding of the action of combinations of genetic variants and environmental exposures.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 Sequence analyses, most notably of the ABCA1 region, suggest that both common variants and rare mutations contribute to interindividual variation in Genetic determinants of HDL Klos and Kullo 347 Table1Commonpolymorphisms(minorallelefrequency>5%)reportedtobeassociatedwithplasmaHDL-Cinmorethanonestudy;thereporteddirectionofeffectoftheless commonallele,andtheircontributionstocovariate-adjustedHDL-Cvariationaloneandincombinationwithotherpolymorphismsofthesamegene GenesymbolGenenamePolymorphismEffecta Single-sitevariationMultisitevariation ABCA1ATP-bindingcassette,sub-familyA (ABC1),member1 596G>A"HDL-C[52,53]4%[52] R219K"HDL-C[28,29 ,30 ]6%[54] V771M"HDL-C[30 ,33] V825I/V825L"HDL-C[30 ];#HDL-C[32 ] APOA5ApolipoproteinA-VÀ1131T>C#HDL-C[55-57] APOC3ApolipoproteinC-III482C>T#HDL-C[55,58 ]0.2-1.4%[58 ]1-6%[58 ,59] SstIS2allelewith#HDL-C[60,61] APOEApolipoproteinEÀ219G>T#HDL-C[27 ,62] e2/e3/e40.8-6.5%[63,64 ]8.3-15.3%[65] ARAndrogenreceptorEx1CAGrepeat"HDL-Cwithlength[66] CETPCholesterol-estertransferproteinÀ1946VNTR"HDL-Cwiththeshortallele[36,67] À629C>A"HDL-C[36,38,39,67-69]4.6-5.2%[39,64 ]5.5-9.8%[39,68] Taq1B"HDL-C[35]3.9%[39]5.5-15%[39,54] MspIin8#HDL-C[36,67] A373P/R451Q#HDL-C[67,68]8%[70] I405V"HDL-C[35] LIPCHepaticlipaseÀ514C>T"HDL-C[45]Upto31%[54] À250G>A"HDL-C[41,43]4.7%[67] LIPGEndotheliallipaseT111I"HDL-C[72,73 ];#HDL-C[74] LPLLipoproteinlipaseHindIII#HDL-CwiththeHþallele[49,75] N291S#HDL-C[50 ] S447X"HDL-C[48,75]0.8%[64 ]3%[35] PON1Paraoxonase1À107T>C"HDL-C[76-78] Q192R"HDL-C[77,79 ];#HDL-C[79 ] PPARDPeroxisomeproliferatorsactivatedreceptordelta294T>C#HDL-C[80] PPARGPeroxisomeproliferatorsactivatedreceptorgammaPro12Ala"HDL-C[81,82] SCARB1ScavengerreceptorclassB,member1A350A"HDL-C[64 ,83]1.3%[64 ] IVS5/A350A(/IVS10)haplotype#HDL-C[84 ] a Citationsrepresentaselectionofavailablestudiesprioritizedbasedonmeta-analysesofassociationresultsinnumerousstudygroups,andrecentstudiescontainingcomprehensivereviewsofpreviously reportedassociations. Login to comment

[hide] Functional polymorphism in ABCA1 influences age of... Hum Mol Genet. 2007 Jun 15;16(12):1412-22. Epub 2007 Apr 5. Kyriakou T, Pontefract DE, Viturro E, Hodgkinson CP, Laxton RC, Bogari N, Cooper G, Davies M, Giblett J, Day IN, Simpson IA, Albrecht C, Ye S
Functional polymorphism in ABCA1 influences age of symptom onset in coronary artery disease patients.
Hum Mol Genet. 2007 Jun 15;16(12):1412-22. Epub 2007 Apr 5., [PMID:17412755]

Abstract [show]
ATP-binding-cassette-transporter-A1 (ABCA1) plays a pivotal role in intracellular cholesterol removal, exerting a protective effect against atherosclerosis. ABCA1 gene severe mutations underlie Tangier disease, a rare Mendelian disorder that can lead to premature coronary artery disease (CAD), with age of CAD onset being two decades earlier in mutant homozygotes and one decade earlier in heterozygotes than in mutation non-carriers. It is unknown whether common polymorphisms in ABCA1 could influence age of symptom onset of CAD in the general population. We examined common promoter and non-synonymous coding polymorphisms in relation to age of symptom onset in a group of CAD patients (n = 1164), and also carried out in vitro assays to test effects of the promoter variations on ABCA1 promoter transcriptional activity and effects of the coding variations on ABCA1 function in mediating cellular cholesterol efflux. Age of symptom onset was found to be associated with the promoter - 407G > C polymorphism, being 2.82 years higher in C allele homozygotes than in G allele homozygotes and intermediate in heterozygotes (61.54, 59.79 and 58.72 years, respectively; P = 0.002). In agreement, patients carrying ABCA1 haplotypes containing the -407C allele had higher age of symptom onset. Patients of the G/G or G/C genotype of the -407G > C polymorphism had significant coronary artery stenosis (>75%) at a younger age than those of the C/C genotype (P = 0.003). Reporter gene assays showed that ABCA1 haplotypes bearing the -407C allele had higher promoter activity than haplotypes with the -407G allele. Functional analyses of the coding polymorphisms showed an effect of the V825I substitution on ABCA1 function, with the 825I variant having higher activity in mediating cholesterol efflux than the wild-type (825V). A trend towards higher symptom onset age in 825I allele carriers was observed. The data indicate an influence of common ABCA1 functional polymorphisms on age of symptom onset in CAD patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 Functional analyses of the coding polymorphisms showed an effect of the V825I substitution on ABCA1 function, with the 825I variant having higher activity in mediating cholesterol efflux than the wild-type (825V). Login to comment
53 The relationships were still observed after adjusting for age, gender, smoking, body mass index, hypertension, type 1 diabetes, type 2 diabetes and family history of CAD (P ¼ 0.048 for V825I and P ¼ 0.001 for I883M). Login to comment
54 Gender ratio, percentage of smokers, body mass index, total cholesterol and triglyceride levels, hypertension, type 1 and type 2 diabetes and family history of CAD did not significantly differ among the different genotypes of the V825I and I883M SNPs. No significant association was observed between HDL level and the other SNPs studied. Login to comment
74 Coefficients (D 0 ) of pair-wise linkage disequilibrium between ABCA1 SNPs 21801 21652 21506 21395 21252 21217 21034 2940 2803 2565 2407 2302 2278 299 214 R219K V825I I883M 21652A.G 20.97 Ã 21506G.C 20.97 Ã 20.86 Ã 21395C.T 0.94 Ã 20.94 Ã 20.91 Ã 21252G.A 20.90 Ã 0.89 Ã 20.64 † 20.95 Ã 21217C.T 21.00 Ã 0.96 Ã 20.94 Ã 20.97 Ã 20.91 † 21034ATins/del 20.91 Ã 20.90 Ã 0.89 Ã 20.94 Ã 20.80 Ã 20.94 Ã 2940T.G 20.95 Ã 0.40 Ã 0.90 Ã 20.95 Ã 20.79 Ã 0.96 Ã 0.84 Ã 2803G.A 0.93 Ã 20.91 Ã 20.95 Ã 0.96 Ã 20.83 † 21.00 Ã 20.95 Ã 20.98 Ã 2565C.T 20.95 Ã 20.42 Ã 0.71 Ã 20.97 Ã 20.81 Ã 1.00 Ã 0.74 Ã 0.92 Ã 20.98 Ã 2407G.C 20.87 Ã 0.39 Ã 0.71 Ã 20.86 Ã 20.74 Ã 0.88 Ã 0.73 Ã 0.86 Ã 20.95 Ã 0.92 Ã 2302C.T 20.85 Ã 20.90 Ã 0.87 Ã 20.88 Ã 20.77 Ã 20.87 Ã 0.90 Ã 0.84 Ã 20.89 Ã 0.94 Ã 0.98 Ã 2278G.C 20.94 Ã 0.41 Ã 0.72 Ã 20.94 Ã 20.83 Ã 0.96 Ã 0.77 Ã 0.93 Ã 20.98 Ã 0.99 Ã 0.91 Ã 0.92 Ã 299G.C 0.79 Ã 20.81 Ã 20.84 Ã 0.82 Ã 20.96 Ã 20.88 Ã 20.80 Ã 20.82 Ã 20.96 Ã 20.85 Ã 20.75 Ã 20.88 Ã 20.85 Ã 214C.T 20.93 Ã 0.10 † 0.78 Ã 20.94 Ã 20.81 Ã 20.89 Ã 0.77 Ã 0.91 Ã 21.00 Ã 0.98 Ã 0.90 Ã 0.84 Ã 0.98 Ã 20.86 Ã R219K 0.14 † 20.17 † 20.18 ‡ 0.14 † 20.62 Ã 0.01 ‡ 20.16 ‡ 0.00 ‡ 0.09 ‡ 20.11 † 0.10 ‡ 20.17 ‡ 0.11 ‡ 0.04 ‡ 0.05 ‡ V825I 20.03 ‡ 20.39 † 0.14 † 0.19 ‡ 20.35 ‡ 20.62 ‡ 0.17 † 20.06 ‡ 0.02 ‡ 0.12 ‡ 0.15 ‡ 0.03 ‡ 20.12 ‡ 0.09 ‡ 0.04 ‡ 20.88 Ã I883M 0.08 ‡ 20.38 † 0.09 † 0.05 ‡ 20.24 ‡ 20.18 ‡ 0.11 † 0.02 ‡ 20.05 ‡ 0.04 ‡ 20.04 ‡ 0.04 ‡ 0.02 ‡ 20.12 ‡ 0.01 ‡ 0.25 Ã 0.81 Ã R1587K 0.00 ‡ 0.03 ‡ 20.04 ‡ 20.05 ‡ 0.06 ‡ 0.00 ‡ 0.01 ‡ 20.04 ‡ 20.08 ‡ 20.07 ‡ 20.08 ‡ 20.08 † 20.06 ‡ 0.01 ‡ 20.03 ‡ 0.14 † 20.27 ‡ 20.01 ‡ Ã P , 0.001. Login to comment
85 The V825I and I883M SNPs were found to be in strong LD in our sample and other European populations (14,15). Login to comment
86 In the in vitro assays, we found that the rate of cholesterol efflux in cells expressing the 825I variant was higher than in cells expressing the ABCA1 wild-type (825V), indicating a potential effect of V825I on ABCA1 function in facilitating cellular cholesterol efflux, which could potentially explain its association with HDL level. Login to comment
92 It is plausible that the relationship of this SNP with plasma HDL level might have arisen from its LD with other SNPs such as V825I. Login to comment
95 A G/G 59.94 (9.79), 708 0.57 299G.C (rs2740483) G/G 60.41 (9.90), 505 0.12 G/A 59.80 (9.88), 180 G/C 59.41 (9.68), 363 A/A 57.80 (8.82), 15 C/C 59.18 (9.35), 78 21217C.T (rs10991420) C/C 59.47 (9.82), 769 0.05 214C.T (rs1800977) C/C 59.80 (9.69), 460 0.54 C/T 61.11 (9.48), 209 C/T 59.74 (9.80), 401 T/T 59.82 (11.39), 11 T/T 60.68 (10.5), 113 21034ATins/del (rs34669957) AT/AT 59.63 (9.71), 621 0.37 R219K (rs2230806) R/R 60.07 (9.94), 503 0.52 AT/ 2 60.14 (9.73), 350 R/K 59.82 (9.84), 392 2/2 60.49 (11.13), 43 K/K 59.33 (8.81), 78 2940T.G (rs2980083) T/T 59.11 (9.51), 273 0.03 V825I (rs28587567) V/V 59.70 (9.86), 866 0.24 T/G 59.85 (9.68), 430 V/I 60.75 (9.52), 100 G/G 61.07 (9.86), 200 I/I 63.46 (9.07), 4 2803G.A (rs10991419) G/G 59.83 (9.74), 812 0.79 I883M (rs4149313) I/I 60.38 (9.66), 644 0.23 G/A 59.73 (9.91), 192 I/M 59.10 (9.65), 217 A/A 58.94 (10.85), 14 M/M 62.12 (6.36), 19 R1587K (rs2230808) R/R 60.23 (9.95), 496 0.30 R/K 58.90 (9.50), 301 K/K 60.93 (9.12), 41 1416 association was detected between the R219K SNP and plasma level of HDL. Login to comment
119 Plasma HDL levels (mmol/L) according to ABCA1 genotypes Polymorphism Genotype Mean (SD), n P-value Polymorphism Genotype Mean (SD), n P-value 21801C.T (rs2487046) C/C 1.26 (0.31), 93 0.88 2565C.T (rs2422493) C/C 1.25 (0.32), 81 0.78 C/T 1.23 (0.31), 122 C/T 1.24 (0.30), 137 T/T 1.29 (0.33), 40 T/T 1.23 (0.28), 54 21652A.G (rs10124728) A/A 1.22 (0.29), 99 0.37 2407G.C (rs2246293) G/G 1.24 (0.32), 76 0.80 A/G 1.25 (0.31), 131 G/C 1.23 (0.30), 123 G/G 1.29 (0.35), 30 C/C 1.24 (0.27), 52 21506G.C (rs2487047) G/G 1.26 (0.33), 156 0.47 2302C.T (rs2246298) C/C 1.26 (0.32), 165 0.67 G/C 1.21 (0.28), 90 C/T 1.21 (0.27), 68 C/C 1.24 (0.29), 14 T/T 1.27 (0.26), 13 21395C.T (rs2487048) C/C 1.26 (0.31), 96 0.83 2278G.C (rs1800976) G/G 1.25 (0.32), 80 0.79 C/T 1.22 (0.29), 115 G/C 1.24 (0.30), 126 T/T 1.26 (0.32), 45 C/C 1.23 (0.28), 51 21252G.A G/G 1.23 (0.29), 193 0.13 299G.C (rs2740483) G/G 1.25 (0.29), 139 0.83 G/A 1.27 (0.29), 44 G/C 1.23 (0.31), 93 A/A 1.27 (0.34), 7 C/C 1.30 (0.28), 21 21217C.T (rs10991420) C/C 1.25 (0.32), 202 0.64 214C.T (rs1800977) C/C 1.25 (0.31), 126 0.59 C/T 1.23 (0.28), 56 C/T 1.25 (0.32), 99 T/T 0.97 (2), 1 T/T 1.20 (0.23), 30 21034ATins/del (rs34669957) AT/AT 1.27 (0.33), 157 0.36 R219K (rs2230806) R/R 1.26 (0.30), 129 0.58 AT/ 2 1.21 (0.26), 89 R/K 1.23 (0.30), 104 2/2 1.24 (0.29), 14 K/K 1.25 (0.34), 18 2940T.G (rs2980083) T/T 1.24 (0.32), 70 0.77 V825I (rs28587567) V/V 1.23 (0.30), 232 0.01 T/G 1.24 (0.31), 117 V/I 1.34 (0.31), 26 G/G 1.22 (0.29), 53 I/I 1.54 (0.07), 3 2803G.A (rs10991419) G/G 1.26 (0.31), 208 0.40 I883M (rs4149313) I/I 1.20 (0.27), 172 0.0004 G/A 1.20 (0.28), 51 I/M 1.39 (0.36), 56 A/A 1.32 (0.47), 4 M/M 1.34 (0.34), 9 R1587K (rs2230808) R/R 1.27 (0.31), 142 0.39 R/K 1.24 (0.30), 84 K/K 1.18 (0.20), 9 Figure 2. Login to comment
126 Single nucleotide polymorphism selection and determination of genotypes The subjects of this study were genotyped for 15 common SNPs in the proximal promoter region, i.e. 21801C.T (rs2487046), 21652A.G (rs10124728), 21506G.C (rs2487047), 21395C.T (rs2487048), 21252G.A (rs number unavailable), 21217C.T (rs10991420), 21034A Tins/del (rs34669957), 2940T.G (rs2980083), 2803G.A (rs10991419), 2565C.T (rs2422493), 2407G.C (rs2246293), 2302C.T (rs2246298), 2278G.C (rs1800976), 299G.C (rs2740483) and 214C.T (rs1800977), respectively, and four common non-synonymous SNPs, i.e. R219K (rs2230806), V825I (rs28587567), I883M (rs4149313) and R1587K (rs2230808) (Fig. 1). Login to comment
55 The relationships were still observed after adjusting for age, gender, smoking, body mass index, hypertension, type 1 diabetes, type 2 diabetes and family history of CAD (P &#bc; 0.048 for V825I and P &#bc; 0.001 for I883M). Login to comment
56 Gender ratio, percentage of smokers, body mass index, total cholesterol and triglyceride levels, hypertension, type 1 and type 2 diabetes and family history of CAD did not significantly differ among the different genotypes of the V825I and I883M SNPs. No significant association was observed between HDL level and the other SNPs studied. Login to comment
76 Coefficients (D 0 ) of pair-wise linkage disequilibrium between ABCA1 SNPs 21801 21652 21506 21395 21252 21217 21034 2940 2803 2565 2407 2302 2278 299 214 R219K V825I I883M 21652A.G 20.97 21506G.C 20.97 20.86 21395C.T 0.94 20.94 20.91 21252G.A 20.90 0.89 20.64 ߤ 20.95 21217C.T 21.00 0.96 20.94 20.97 20.91 ߤ 21034ATins/del 20.91 20.90 0.89 20.94 20.80 20.94 2940T.G 20.95 0.40 0.90 20.95 20.79 0.96 0.84 2803G.A 0.93 20.91 20.95 0.96 20.83 ߤ 21.00 20.95 20.98 2565C.T 20.95 20.42 0.71 20.97 20.81 1.00 0.74 0.92 20.98 2407G.C 20.87 0.39 0.71 20.86 20.74 0.88 0.73 0.86 20.95 0.92 2302C.T 20.85 20.90 0.87 20.88 20.77 20.87 0.90 0.84 20.89 0.94 0.98 2278G.C 20.94 0.41 0.72 20.94 20.83 0.96 0.77 0.93 20.98 0.99 0.91 0.92 299G.C 0.79 20.81 20.84 0.82 20.96 20.88 20.80 20.82 20.96 20.85 20.75 20.88 20.85 214C.T 20.93 0.10 ߤ 0.78 20.94 20.81 20.89 0.77 0.91 21.00 0.98 0.90 0.84 0.98 20.86 R219K 0.14 ߤ 20.17 ߤ 20.18 ߥ 0.14 ߤ 20.62 0.01 ߥ 20.16 ߥ 0.00 ߥ 0.09 ߥ 20.11 ߤ 0.10 ߥ 20.17 ߥ 0.11 ߥ 0.04 ߥ 0.05 ߥ V825I 20.03 ߥ 20.39 ߤ 0.14 ߤ 0.19 ߥ 20.35 ߥ 20.62 ߥ 0.17 ߤ 20.06 ߥ 0.02 ߥ 0.12 ߥ 0.15 ߥ 0.03 ߥ 20.12 ߥ 0.09 ߥ 0.04 ߥ 20.88 I883M 0.08 ߥ 20.38 ߤ 0.09 ߤ 0.05 ߥ 20.24 ߥ 20.18 ߥ 0.11 ߤ 0.02 ߥ 20.05 ߥ 0.04 ߥ 20.04 ߥ 0.04 ߥ 0.02 ߥ 20.12 ߥ 0.01 ߥ 0.25 0.81 R1587K 0.00 ߥ 0.03 ߥ 20.04 ߥ 20.05 ߥ 0.06 ߥ 0.00 ߥ 0.01 ߥ 20.04 ߥ 20.08 ߥ 20.07 ߥ 20.08 ߥ 20.08 ߤ 20.06 ߥ 0.01 ߥ 20.03 ߥ 0.14 ߤ 20.27 ߥ 20.01 ߥ P , 0.001. Login to comment
87 In the in vitro assays, we found that the rate of cholesterol efflux in cells expressing the 825I variant was higher than in cells expressing the ABCA1 wild-type (825V), indicating a potential effect of V825I on ABCA1 function in facilitating cellular cholesterol efflux, which could potentially explain its association with HDL level. Login to comment
93 It is plausible that the relationship of this SNP with plasma HDL level might have arisen from its LD with other SNPs such as V825I. Login to comment
96 A G/G 59.94 (9.79), 708 0.57 299G.C (rs2740483) G/G 60.41 (9.90), 505 0.12 G/A 59.80 (9.88), 180 G/C 59.41 (9.68), 363 A/A 57.80 (8.82), 15 C/C 59.18 (9.35), 78 21217C.T (rs10991420) C/C 59.47 (9.82), 769 0.05 214C.T (rs1800977) C/C 59.80 (9.69), 460 0.54 C/T 61.11 (9.48), 209 C/T 59.74 (9.80), 401 T/T 59.82 (11.39), 11 T/T 60.68 (10.5), 113 21034ATins/del (rs34669957) AT/AT 59.63 (9.71), 621 0.37 R219K (rs2230806) R/R 60.07 (9.94), 503 0.52 AT/ 2 60.14 (9.73), 350 R/K 59.82 (9.84), 392 2/2 60.49 (11.13), 43 K/K 59.33 (8.81), 78 2940T.G (rs2980083) T/T 59.11 (9.51), 273 0.03 V825I (rs28587567) V/V 59.70 (9.86), 866 0.24 T/G 59.85 (9.68), 430 V/I 60.75 (9.52), 100 G/G 61.07 (9.86), 200 I/I 63.46 (9.07), 4 2803G.A (rs10991419) G/G 59.83 (9.74), 812 0.79 I883M (rs4149313) I/I 60.38 (9.66), 644 0.23 G/A 59.73 (9.91), 192 I/M 59.10 (9.65), 217 A/A 58.94 (10.85), 14 M/M 62.12 (6.36), 19 R1587K (rs2230808) R/R 60.23 (9.95), 496 0.30 R/K 58.90 (9.50), 301 K/K 60.93 (9.12), 41 association was detected between the R219K SNP and plasma level of HDL. Login to comment
120 Plasma HDL levels (mmol/L) according to ABCA1 genotypes Polymorphism Genotype Mean (SD), n P-value Polymorphism Genotype Mean (SD), n P-value 21801C.T (rs2487046) C/C 1.26 (0.31), 93 0.88 2565C.T (rs2422493) C/C 1.25 (0.32), 81 0.78 C/T 1.23 (0.31), 122 C/T 1.24 (0.30), 137 T/T 1.29 (0.33), 40 T/T 1.23 (0.28), 54 21652A.G (rs10124728) A/A 1.22 (0.29), 99 0.37 2407G.C (rs2246293) G/G 1.24 (0.32), 76 0.80 A/G 1.25 (0.31), 131 G/C 1.23 (0.30), 123 G/G 1.29 (0.35), 30 C/C 1.24 (0.27), 52 21506G.C (rs2487047) G/G 1.26 (0.33), 156 0.47 2302C.T (rs2246298) C/C 1.26 (0.32), 165 0.67 G/C 1.21 (0.28), 90 C/T 1.21 (0.27), 68 C/C 1.24 (0.29), 14 T/T 1.27 (0.26), 13 21395C.T (rs2487048) C/C 1.26 (0.31), 96 0.83 2278G.C (rs1800976) G/G 1.25 (0.32), 80 0.79 C/T 1.22 (0.29), 115 G/C 1.24 (0.30), 126 T/T 1.26 (0.32), 45 C/C 1.23 (0.28), 51 21252G.A G/G 1.23 (0.29), 193 0.13 299G.C (rs2740483) G/G 1.25 (0.29), 139 0.83 G/A 1.27 (0.29), 44 G/C 1.23 (0.31), 93 A/A 1.27 (0.34), 7 C/C 1.30 (0.28), 21 21217C.T (rs10991420) C/C 1.25 (0.32), 202 0.64 214C.T (rs1800977) C/C 1.25 (0.31), 126 0.59 C/T 1.23 (0.28), 56 C/T 1.25 (0.32), 99 T/T 0.97 (2), 1 T/T 1.20 (0.23), 30 21034ATins/del (rs34669957) AT/AT 1.27 (0.33), 157 0.36 R219K (rs2230806) R/R 1.26 (0.30), 129 0.58 AT/ 2 1.21 (0.26), 89 R/K 1.23 (0.30), 104 2/2 1.24 (0.29), 14 K/K 1.25 (0.34), 18 2940T.G (rs2980083) T/T 1.24 (0.32), 70 0.77 V825I (rs28587567) V/V 1.23 (0.30), 232 0.01 T/G 1.24 (0.31), 117 V/I 1.34 (0.31), 26 G/G 1.22 (0.29), 53 I/I 1.54 (0.07), 3 2803G.A (rs10991419) G/G 1.26 (0.31), 208 0.40 I883M (rs4149313) I/I 1.20 (0.27), 172 0.0004 G/A 1.20 (0.28), 51 I/M 1.39 (0.36), 56 A/A 1.32 (0.47), 4 M/M 1.34 (0.34), 9 R1587K (rs2230808) R/R 1.27 (0.31), 142 0.39 R/K 1.24 (0.30), 84 K/K 1.18 (0.20), 9 Figure 2. Login to comment
127 Single nucleotide polymorphism selection and determination of genotypes The subjects of this study were genotyped for 15 common SNPs in the proximal promoter region, i.e. 21801C.T (rs2487046), 21652A.G (rs10124728), 21506G.C (rs2487047), 21395C.T (rs2487048), 21252G.A (rs number unavailable), 21217C.T (rs10991420), 21034A Tins/del (rs34669957), 2940T.G (rs2980083), 2803G.A (rs10991419), 2565C.T (rs2422493), 2407G.C (rs2246293), 2302C.T (rs2246298), 2278G.C (rs1800976), 299G.C (rs2740483) and 214C.T (rs1800977), respectively, and four common non-synonymous SNPs, i.e. R219K (rs2230806), V825I (rs28587567), I883M (rs4149313) and R1587K (rs2230808) (Fig. 1). Login to comment

[hide] Genetic etiology of isolated low HDL syndrome: inc... Arterioscler Thromb Vasc Biol. 2007 May;27(5):1139-45. Epub 2007 Feb 15. Kiss RS, Kavaslar N, Okuhira K, Freeman MW, Walter S, Milne RW, McPherson R, Marcel YL
Genetic etiology of isolated low HDL syndrome: incidence and heterogeneity of efflux defects.
Arterioscler Thromb Vasc Biol. 2007 May;27(5):1139-45. Epub 2007 Feb 15., [PMID:17303779]

Abstract [show]
OBJECTIVE: We have used a multitiered approach to identify genetic and cellular contributors to high-density lipoprotein (HDL) deficiency in 124 human subjects. METHODS AND RESULTS: We resequenced 4 candidate genes for HDL regulation and identified several functional nonsynonymous mutations including 2 in apolipoprotein A-I (APOA1), 4 in lecithin:cholesterol acyltransferase (LCAT), 1 in phospholipid transfer protein (PLTP), and 7 in the ATP-binding cassette transporter ABCA1, leaving 88% (110/124) of HDL deficient subjects without a genetic diagnosis. Cholesterol efflux assays performed using cholesterol-loaded monocyte-derived macrophages from the 124 low HDL subjects and 48 control subjects revealed that 33% (41/124) of low HDL subjects had low efflux, despite the fact that the majority of these subjects (34/41) were not carriers of dysfunctional ABCA1 alleles. In contrast, only 2% of control subjects presented with low efflux (1/48). In 3 families without ABCA1 mutations, efflux defects were found to cosegregate with low HDL. CONCLUSIONS: Efflux defects are frequent in low HDL syndromes, but the majority of HDL deficient subjects with cellular cholesterol efflux defects do not harbor ABCA1 mutations, suggesting that novel pathways contribute to this phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N. Login to comment
42 In ABCA1, a total of 19 nonsynonymous coding sequence variants; some of these we reported previously.22 Of these, 9 sequence variants were common polymorphisms (ie, reported in the literature as common or of similar prevalence in control subjects): P85L, P85A, R219K, V399A, V771M, V825I, I883M, E1172D, R1587K.14,32-35 Another 5 sequence variants, identified here, were previously reported to be disease causing: W590L (reported as W590S)14; C1477F (reported as C1477R)13; S1731C (only found in French-Canadian populations)36; N1800H32; and 1851X.37 Five sequence variants were novel: K199F, H551D, R965C, E1386Q, and D1706N. Login to comment

[hide] Apolipoprotein E levels in cerebrospinal fluid and... Mol Neurodegener. 2007 Apr 12;2:7. Wahrle SE, Shah AR, Fagan AM, Smemo S, Kauwe JS, Grupe A, Hinrichs A, Mayo K, Jiang H, Thal LJ, Goate AM, Holtzman DM
Apolipoprotein E levels in cerebrospinal fluid and the effects of ABCA1 polymorphisms.
Mol Neurodegener. 2007 Apr 12;2:7., [PMID:17430597]

Abstract [show]
BACKGROUND: Animal studies suggest that brain apolipoprotein E (apoE) levels influence amyloid-beta (Abeta) deposition and thus risk for Alzheimer's disease (AD). We have previously demonstrated that deletion of the ATP-binding cassette A1 transporter (ABCA1) in mice causes dramatic reductions in brain and cerebrospinal fluid (CSF) apoE levels and lipidation. To examine whether polymorphisms in ABCA1 affect CSF apoE levels in humans, we measured apoE in CSF taken from 168 subjects who were 43 to 91 years old and were either cognitively normal or who had mild AD. We then genotyped the subjects for ten previously identified ABCA1 single nucleotide polymorphisms (SNPs). RESULTS: In all subjects, the mean CSF apoE level was 9.09 microg/ml with a standard deviation of 2.70 microg/ml. Levels of apoE in CSF samples taken from the same individual two weeks apart were strongly correlated (r2 = 0.93, p < 0.01). In contrast, CSF apoE levels in different individuals varied widely (coefficient of variation = 46%). CSF apoE levels did not vary according to AD status, APOE genotype, gender or race. Average apoE levels increased with age by approximately 0.5 microg/ml per 10 years (r2 = 0.05, p = 0.003). We found no significant associations between CSF apoE levels and the ten ABCA1 SNPs we genotyped. Moreover, in a separate sample of 1225 AD cases and 1431 controls, we found no association between the ABCA1 SNP rs2230806 and AD as has been previously reported. CONCLUSION: We found that CSF apoE levels vary widely between individuals, but are stable within individuals over a two-week interval. AD status, APOE genotype, gender and race do not affect CSF apoE levels, but average CSF apoE levels increase with age. Given the lack of association between CSF apoE levels and genotypes for the ABCA1 SNPs we examined, either these SNPs do not affect ABCA1 function or if they do, they do not have strong effects in the CNS. Finally, we find no evidence for an association between the ABCA1 SNP rs2230806 and AD in a large sample set.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 In particular, studies have implicated the following SNPs in affecting levels of plasma HDL-C: rs2230806 (R219K) [33], rs2066718 (V771M) [31,32], rs2066715 (V825I) [31], rs4149313 (I883M) [34], rs2230808 (R1587K) [31]. Login to comment
70 The subjects for whom we had CSF apoE data were genotyped for the following ABCA1 SNPs: rs2230806 (R219K), rs2066718 (V771M), rs2066715 (V825I), rs4149313 (I883M), rs2230808 (R1587K), rs1883025 (intron), rs2275544 (intron), rs2777799 (intron), rs3904999 (intron) and rs6479283 (intron). Login to comment
149 Genotyping The following SNPS in ABCA1 were genotyped in the Washington University sample of 168 subjects: rs2230806 (R219K), rs2066718 (V771M), rs2066715 (V825I), rs4149313 (I883M), rs2230808 (R1587K), rs1883025 (intron), rs2275544 (intron), rs2777799 (intron), rs3904999 (intron) and rs6479283 (intron). Login to comment

[hide] Genotypic variation in ATP-binding cassette transp... Transl Res. 2007 Apr;149(4):205-10. Mantaring M, Rhyne J, Ho Hong S, Miller M
Genotypic variation in ATP-binding cassette transporter-1 (ABCA1) as contributors to the high and low high-density lipoprotein-cholesterol (HDL-C) phenotype.
Transl Res. 2007 Apr;149(4):205-10., [PMID:17383594]

Abstract [show]
The ATP-binding cassette transporter-1 (ABCA1) mediates cholesterol efflux and genotypic variation in ABCA1 and may impact reverse cholesterol transport and influence cardiovascular disease (CVD) risk. However, although mutations in ABCA1 have generally been identified with low HDL-C, few have undertaken a comparative evaluation between high and low high-density lipoprotein-cholesterol (HDL-C). Therefore, to evaluate for potential gain-of-function polymorphisms/mutations in ABCA1, 56 consecutive subjects were screened presenting with high (60-99 mg/dL [1.6-2.6 mmol/L]) or very high HDL-C (>100 mg/dL [2.6 mmol/L]) and were compared with subjects with average or low HDL-C (n = 68). Carrier frequencies of common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K were also assessed. All 50 exons and exon-intron boundaries of ABCA1 were screened using single-stranded conformation polymorphism (SSCP). DNA samples with SSCP-shifts or differing band patterns were sequenced. For the 6 common polymorphisms, genotyping was determined by polymerase chain reaction (PCR)-restriction fragment length polymorphism. Overall, 5 novel nonsynonymous mutations were identified, all of which were associated with low HDL-C. Of the 6 common ABCA1 polymorphisms, very high HDL-C was associated with a higher genotype frequency for R219K (P(trend) = 0.04) and higher genotype and allelic frequency for E1172D (P(trend) = 0.0004, P(trend) = 0.0002, respectively) compared with lower HDL-C. These data reaffirm that rare mutations in ABCA1 are associated with low HDL-C. However, at least 1 ABCA1 polymorphism (eg, E1172D) may contribute to the high HDL-C phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Carrier frequencies of common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K were also assessed. Login to comment
36 DNA was PCR amplified and digested using standard methods and the frequency of the 6 common polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K) in ABCA1, which was determined as described by Clee et al.8 Sequencing of PCR-amplified DNA. Login to comment
54 The prevalence of 6 common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K was also evaluated. Login to comment
77 Genotype and allele frequencies for 6 common ABCA1 polymorphisms in subgroups with HDL-C defined as very high (n ϭ 22), high (n ϭ 34), average (n ϭ 36), or low (n ϭ 32) R219K Genotype frequencies P value Allele frequencies P valueR/R R/K K/K R K Very high 31.8% 45.5% 22.7% 0.04 0.55 0.45 0.20 High 45.7% 51.4% 2.9% 0.71 0.29 Average 43.2% 56.8% 0.0% 0.72 0.28 Low 50.0% 40.0% 10.0% 0.70 0.30 V771M V/V V/M M/M V M Very high 59.0% 36.0% 4.5% 0.11 0.77 0.23 0.04 High 85.7% 14.3% 0.0% 0.93 0.07 Average 86.1% 13.9% 0.0% 0.93 0.07 Low 80.0% 20.0% 0.0% 0.90 0.10 V825I V/V V/I I/I V I Very high 77.3% 22.7% 0.0% 0.58 0.89 0.11 0.62 High 88.6% 11.4% 0.0% 0.94 0.06 Average 88.9% 11.1% 0.0% 0.94 0.06 Low 82.8% 17.2% 0.0% 0.92 0.08 I883M I/I I/M M/M I M Very high 40.9% 45.5% 13.6% 0.29 0.64 0.36 0.05 High 60.0% 34.3% 5.7% 0.78 0.22 Average 73.0% 24.3% 2.7% 0.85 0.15 Low 66.7% 26.7% 6.7% 0.80 0.20 E1172D E/E E/D D/D E D Very high 68.2% 31.8% 0.0% 0.0004 0.82 0.18 0.0002 High 94.3% 5.7% 0.0% 0.97 0.03 Average 94.6% 5.4% 0.0% 0.97 0.03 Low 100.00% 0.0% 0.0% 1.00 0.00 R1587K R/R R/K K/K R K Very high 31.8% 50.0% 18.2% 0.16 0.57 0.43 0.07 High 65.6% 25.0% 9.4% 0.78 0.22 Average 55.6% 41.7% 2.8% 0.76 0.24 Low 51.9% 33.3% 14.8% 0.69 0.31 of R219K may have a basis for reduced CVD risk as previously suggested.8-11,24 CONCLUSION The data extend previous findings that novel mutations in ABCA1 are associated with the low rather than the high HDL-C (FHA) phenotype. Login to comment
35 DNA was PCR amplified and digested using standard methods and the frequency of the 6 common polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K) in ABCA1, which was determined as described by Clee et al.8 Sequencing of PCR-amplified DNA. Login to comment
53 The prevalence of 6 common ABCA1 polymorphisms, R219K, V771M, V825I, I883M, E1172D, and R1587K was also evaluated. Login to comment

[hide] Variations on a gene: rare and common variants in ... Annu Rev Nutr. 2006;26:105-29. Brunham LR, Singaraja RR, Hayden MR
Variations on a gene: rare and common variants in ABCA1 and their impact on HDL cholesterol levels and atherosclerosis.
Annu Rev Nutr. 2006;26:105-29., [PMID:16704350]

Abstract [show]
Cholesterol and its metabolites play a variety of essential roles in living systems. Virtually all animal cells require cholesterol, which they acquire through synthesis or uptake, but only the liver can degrade cholesterol. The ABCA1 gene product regulates the rate-controlling step in the removal of cellular cholesterol: the efflux of cellular cholesterol and phospholipids to an apolipoprotein acceptor. Mutations in ABCA1, as seen in Tangier disease, result in accumulation of cellular cholesterol, reduced plasma high-density lipoprotein cholesterol, and increased risk for coronary artery disease. To date, more than 100 coding variants have been identified in ABCA1, and these variants result in a broad spectrum of biochemical and clinical phenotypes. Here we review genetic variation in ABCA1 and its critical role in cholesterol metabolism and atherosclerosis in the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
612 The V825I and V771M SNPs were associated with increased HDL cholesterol in one, but not both, genders. Login to comment

[hide] Quantitative trait loci in ABCA1 modify cerebrospi... J Hum Genet. 2006;51(3):171-9. Epub 2005 Dec 22. Katzov H, Bennet AM, Hoglund K, Wiman B, Lutjohann D, Brookes AJ, Andreasen N, Blennow K, De Faire U, Prince JA
Quantitative trait loci in ABCA1 modify cerebrospinal fluid amyloid-beta 1-42 and plasma apolipoprotein levels.
J Hum Genet. 2006;51(3):171-9. Epub 2005 Dec 22., [PMID:16372134]

Abstract [show]
The ATP-binding cassette transporter A1 encoded by ABCA1 plays an integral role in the efflux of cellular cholesterol and phospholipids, but may also be a central mediator of beta-amyloid (Abeta) processing. Here, genetic association of the common R219K variant of ABCA1 is shown with cerebrospinal fluid (CSF) Abeta 1-42 levels, reinforcing emerging evidence of a connection between lipid and Abeta metabolism. In support of this finding we demonstrate for the first time that CSF cholesterol and Abeta 1-42 are correlated. To affirm the plausible impact of ABCA1 variation on cholesterol and related traits as well as to empower a survey of possible interactions (e.g. age, gender, and smoking), a large Swedish population consisting of over 2,700 individuals was enlisted and extensive measures of plasma lipid parameters carried out. These analyses revealed that R219K has a strong effect on apolipoprotein B (APOB) and LDL-cholesterol (LDL-C) among smokers (P = 0.000055 and P = 0.00059, respectively), but not among non-smokers. In contrast, no effect was evident with apolipoprotein A (APOA1) or HDL-cholesterol (HDL-C) levels. Plasma APOB and LDL-C, but not APOA1 and HDL-C, were shown to be markedly elevated in smokers versus non-smokers, affirming that smoking may selectively impact the former pathway. No other genetic markers in ABCA1 exhibit effects as large as R219K, although a modest independent effect of R1587K was observed. Our data illuminate a possible genetic link between Abeta and cholesterol metabolism, but also provide an intriguing example of an environmental exposure that may modify a genotype-phenotype relationship.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 The number of individuals in each category is shown in parenthesis. Comparisons were performed by ANOVATC total cholesterol, LDL-C low density lipoprotein cholesterol Traits KK RK RR F value P value APOA1a (g/l) 1.46±0.02 (157) 1.48±0.01 (966) 1.47±0.01 (1,439) 0.23 0.79 APOB (g/l) 1.64±0.03 (157) 1.53±0.01 (966) 1.55±0.01 (1,439) 5.4 0.0046 HDL-C (mmol/l) 1.16±0.26 (156) 1.20±0.01 (961) 1.20±0.01 (1,427) 1.1 0.34 LDL-C (mmol/l) 4.26±0.86 (154) 4.08±0.03 (951) 4.05±0.03 (1,415) 0.26 0.038 TC (mmol/l) 6.24±0.09 (157) 6.04±0.04 (969) 6.01±0.03 (1,439) 3.02 0.049 TGa (mmol/l) 1.87±0.11 (157) 1.71±0.04 (969) 1.72±0.03 (1,441) 1.38 0.25 a Log-transformed traits k.embl-heidelberg.de/PolyPhen/) (Ramensky et al. 2002) for five coding SNPs (cSNPs) in ABCA1 (R219K rs2230806; V771M rs2066718; V825I rs4149312; I883M rs2066714; R1587K rs2230808) (Frikke-Schmidt et al. 2004). Login to comment
129 The number of individuals in each category is shown in parenthesis. Comparisons were performed by ANOVATC total cholesterol, LDL-C low density lipoprotein cholesterol Traits KK RK RR F value P value APOA1a (g/l) 1.46&#b1;0.02 (157) 1.48&#b1;0.01 (966) 1.47&#b1;0.01 (1,439) 0.23 0.79 APOB (g/l) 1.64&#b1;0.03 (157) 1.53&#b1;0.01 (966) 1.55&#b1;0.01 (1,439) 5.4 0.0046 HDL-C (mmol/l) 1.16&#b1;0.26 (156) 1.20&#b1;0.01 (961) 1.20&#b1;0.01 (1,427) 1.1 0.34 LDL-C (mmol/l) 4.26&#b1;0.86 (154) 4.08&#b1;0.03 (951) 4.05&#b1;0.03 (1,415) 0.26 0.038 TC (mmol/l) 6.24&#b1;0.09 (157) 6.04&#b1;0.04 (969) 6.01&#b1;0.03 (1,439) 3.02 0.049 TGa (mmol/l) 1.87&#b1;0.11 (157) 1.71&#b1;0.04 (969) 1.72&#b1;0.03 (1,441) 1.38 0.25 a Log-transformed traits k.embl-heidelberg.de/PolyPhen/) (Ramensky et al. 2002) for five coding SNPs (cSNPs) in ABCA1 (R219K rs2230806; V771M rs2066718; V825I rs4149312; I883M rs2066714; R1587K rs2230808) (Frikke-Schmidt et al. 2004). Login to comment

[hide] Common polymorphisms of ATP binding cassette trans... Atherosclerosis. 2005 Dec;183(2):199-212. Epub 2005 Jun 2. Hodoglugil U, Williamson DW, Huang Y, Mahley RW
Common polymorphisms of ATP binding cassette transporter A1, including a functional promoter polymorphism, associated with plasma high density lipoprotein cholesterol levels in Turks.
Atherosclerosis. 2005 Dec;183(2):199-212. Epub 2005 Jun 2., [PMID:15935359]

Abstract [show]
The role of high levels of high density lipoprotein cholesterol (HDL-C) in protection against development of atherosclerosis is generally attributed to its role in reverse cholesterol transport, and the ATP binding cassette transporter A1 (ABCA1) is a key element of this process. We examined polymorphisms in ABCA1 in Turks, a population characterized by very low HDL-C levels. We discovered 36 variations in ABCA1 and genotyped informative polymorphisms in over 2,300 subjects. The rare alleles of C-14T and V771M polymorphisms were associated with higher HDL-C levels in men and, in combination with the rare alleles of R219K and I883M, respectively, with higher HDL-C in both sexes. Rare alleles of the C-14T and V771M polymorphisms were more frequent in the high HDL-C (>OR=40mg/dl) than in the low HDL-C group (<OR=30mg/dl) in men (P<0.05). Moreover, the T allele of C-14T had more in vitro transcriptional activity than the C allele (20-88%), depending on the cell line (P<0.05), suggesting its functionality. Haplotype construction and haplotype association with phenotype were performed in the promoter and coding region of ABCA1 separately. Analysis of the promoter haplotype block supported the association with the C-14T polymorphism. The C-14T and R219K polymorphisms were on different haplotype blocks. Analysis of the coding region structure revealed that the rare M allele of V771M was distributed predominantly among three common haplotypes, but the sum of their frequencies comprise only two-thirds of the frequency of the M allele. The rare alleles of the V771M and the I883M polymorphisms do not exist together on any of the common haplotypes. In conclusion, we describe a functional promoter polymorphism (C-14T) and a coding sequence variant (V771M) of ABCA1 and their interactions with two other variants (R219K and I883M) on plasma HDL-C levels in Turks.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
24 Recently, it was shown that some polymorphisms of ABCA1 were associated with increases (V771M and V825I) or decreases (R1587K) in HDL-C in women and with some consistent trends in men in a large random Danish population [17]. Login to comment
104 The G-803A Table 2 ABCA1 polymorphisms Nucleotide changea Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in 5 and promoter regions G-803A ~10 92/141 [19] T-564C 72.7 47.7 728/1268 [18] G-407C 62.5 40.7 220/233 [18] G-99C 42.2 24.2 875/1130 [46] C-14T 61.2 37.7 916/1416 [46] InsG 319 26.6 14.2 848/1288 [46] Nucleotide changed Amino acid change Exon Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in coding sequence Nonsynonymous G(70943)A R219K 7 62.3 38.5 996/1466 db 2230806 G(102555)A V771M 16 10.0 5.1 981/1477 db 2066718 G(103777)A V825I 17 12.3 6.2 960/1145 db 4149312 A(105057)G I883M 18 38.1 21.8 1084/1448 db 4149313 G(112177)C E1172D 24 9.0 4.6 1001/1237 [12,13] A(116887)G Q1328R 28 0.003e 0.0015 172/156 NR G(129004)A R1587K 35 55.1 33.0 937/1351 db 2230808 T(133402)C Y1767H 39 ~1.0e 40/55 NR G(133420)A V1773M 39 ~1.0e 40/55 NR Synonymous C(100538)A I620I 15 ~4.0 40/55 NR C(109469)T V990V 21 ~3.0 87/90 [17] T(109861)G V1053V 22 ~1.0 90/90 [12] C(109868)T L1056L 22 ~5.0 90/90 NR C(109906)T R1068R 22 ~3.0 90/90 NR A(113280)G E1211E 25 ~4.0 40/55 [17] A(116879)G T1325T 28 ~1.0 40/55 NR T(137043)C Y1921Y 43 ~1.0 40/55 NR Nucleotide changed Intron Carrier of rare allele (%) Intronic location nb Referencesc Frequency in noncoding sequence G(23816)A 1 ~1.0 11 bp 5 exon 1b 94 NR G(23819)C 1 42 8 bp 5 exon 1b 94 NR A(22997)T 1 46 90 bp 5 exon 1d 91 NR A(23004)G 1 ~1.0 83 bp 5 exon 1d 91 NR G(23058)C 1 46 29 bp 5 exon 1d 91 NR G(40504)A 3 2.6 26 bp 3 of exon 3 192 NR C(45217)T 4 0.7 64 bp 3 of exon 4 142 NR T(98628)A 14 35-40 24 bp 3 of exon 14 190 db 4743763 C(100332)T 14 4.3 59 bp 5 of exon 15 90 db 2066717 C(108020)T 19 0.7 3 bp 5 of exon 20 144 NR DelTTT(134503-6) 39 7.0 20-23 bp 5 of exon 40 90 NR C(142026)T 46 8.6 34 bp 5 of exon 47 116 NR A(142751)G 48 15.9 13 bp 3 of exon 48 107 NR a Relative to transcriptional start. Login to comment
109 Table 3 ABCA1 polymorphisms and mean plasma HDL-C levels (mg/dl ± S.D.) in a random Turkish population Females Males AAa AB BB AAa AB BB Promoter and 5 region T-564C 40.4 ± 8.4 (205) 41.0 ± 7.9 (365) 39.9 ± 7.6 (158) 35.6 ± 7.4 (339) 35.5 ± 6.5 (635) 34.9 ± 6.5 (294) G-407C 41.3 ± 11.2 (82) 40.7 ± 7.7 (101) 40.7 ± 12.2 (37) 35.7 ± 6.9 (88) 35.3 ± 6.7 (96) 35.4 ± 7.4 (49) G-99C 40.7 ± 7.5 (505) 41.0 ± 7.2 (317) 41.3 ± 8.4 (53) 35.1 ± 6.5 (654) 35.0 ± 6.3 (405) 34.9 ± 6.5 (71) C-14T 41.3 ± 9.0 (361) 41.0 ± 9.0 (417) 41.0 ± 9.4 (138) 34.8 ± 7.0b (547) 35.5 ± 7.5 (675) 36.7 ± 8.1b (194) InsG 319 41.3 ± 8.1 (641) 40.5 ± 7.7 (193) 43.1 ± 8.0 (14) 35.3 ± 6.4 (933) 34.7 ± 6.4 (332) 34.5 ± 6.5 (23) Nonsynonymous R219K 41.2 ± 9.4 (364) 40.8 ± 8.6 (480) 41.2 ± 10 (152) 35.2 ± 7.3 (574) 35.3 ± 7.3 (688) 35.2 ± 7.6 (204) V771M 40.9 ± 9.2 (896) 42.8 ± 9.3 (82) 38.7 ± 10 (3) 35.1 ± 7.2c (1330) 37.1 ± 8.0c (144) 45.7 ± 10.7 (3) V825I 40.6 ± 9.4 (842) 38.9 ± 8.5 (117) 42 (1) 35.8 ± 8.7 (1005) 37.1 ± 9.5 (140) (-) I883M 41.1 ± 9.5 (643) 40.8 ± 8.4 (372) 41.4 ± 9.1 (69) 35.0 ± 7.0 (922) 35.7 ± 8.0 (457) 35.6 ± 7.4 (69) E1172D 40.5 ± 8.8 (907) 40.5 ± 7.6 (93) 29 (1) 34.6 ± 7.3 (1129) 35.4 ± 7.6 (105) 30.7 ± 8.7 (3) R1587K 41.1 ± 9.4 (410) 40.8 ± 9.6 (433) 41.0 ± 10.1 (94) 35.9 ± 8.1 (617) 35.1 ± 7.6 (579) 35.3 ± 8.6 (155) Numbers of subjects are shown in parenthesis. Login to comment
204 However, further analysis Table 5 Allele frequency and significant (P < 0.01) pair-wise linkage disequilibrium coefficients between the ABCA1 polymorphisms in a random Turkish population Position Allele % T-564C G-99C C-14T InsG 319 R219K V771M V825I I883M E1172D R1587K T-564C 52.3/47.7 - G-99C 75.8/24.2 0.36 - C-14T 62.3/37.7 -0.96 -0.98 - InsG 319 85.8/14.2 - - - - R219K 61.5/38.5 - - - - V771M 94.9/5.1 - - - 0.99 - V825I 93.8/6.2 -0.40 -0.69 - - -0.76 - - I883M 78.2/21.8 - -0.42 - - 0.20 -0.79 0.91 - E1172D 95.4/4.6 - - - - - 0.34 - - - R1587K 67.0/33.0 - - -0.23 - - 0.56 - - 0.87 - Table 6 Common haplotypes of promoter and coding regions of ABCA1 gene in a random Turkish population Promoter region haplotypes % T-564C G-99C C-14T InsG 319 1 31.7 0 0 1 0 2 20.1 1 1 0 0 3 19.9 1 0 0 0 4 12.7 0 0 0 0 5 4.6 0 0 1 1 6 4.2 1 1 0 1 7 3.2 1 0 0 1 8 2.5 0 0 0 1 Sum 98.9 Coding region haplotypes % R219K V771M V825I I883M E1172D R1587K 1 39.3 0 0 0 0 0 0 2 12.6 1 0 0 0 0 0 3 12.0 0 0 0 0 0 1 4 8.7 1 0 0 1 0 0 5 8.3 1 0 0 0 0 1 6 4.0 0 0 1 1 0 0 7 3.4 0 0 0 0 1 1 8 1.6 1 0 0 1 0 1 9 1.3 1 1 0 0 0 0 10 1.3 0 1 0 0 1 1 11 1.3 0 0 1 1 0 1 12 1.1 1 1 0 0 0 1 Sum 95.1 0: common allele; 1: rare allele. Login to comment
215 Haplotype structure and haplotype-phenotype association of polymorphisms in the coding region of ABCA1 When the haplotype structure of the coding region was constructed using six polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K; Table 6), 12 haplotypes with a frequency >1% accounted for 95.1% of all haplotypes. Login to comment
230 (rare allele in LD with rare allele) was observed between pairs of V771M and InsG 319, V825I and I883M, and R1587K and E1172D. Login to comment
302 The association with V825I and R1587K on plasma HDL-C levels were found in a large general Danish population [17]; however, it was not observed in Dutch men with CAD [18] or in our population. Login to comment
103 The G-803A Table 2 ABCA1 polymorphisms Nucleotide changea Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in 5 and promoter regions G-803A ~10 92/141 [19] T-564C 72.7 47.7 728/1268 [18] G-407C 62.5 40.7 220/233 [18] G-99C 42.2 24.2 875/1130 [46] C-14T 61.2 37.7 916/1416 [46] InsG 319 26.6 14.2 848/1288 [46] Nucleotide changed Amino acid change Exon Carrier of rare allele (%) Rare allele (%) nb Referencesc Frequency in coding sequence Nonsynonymous G(70943)A R219K 7 62.3 38.5 996/1466 db 2230806 G(102555)A V771M 16 10.0 5.1 981/1477 db 2066718 G(103777)A V825I 17 12.3 6.2 960/1145 db 4149312 A(105057)G I883M 18 38.1 21.8 1084/1448 db 4149313 G(112177)C E1172D 24 9.0 4.6 1001/1237 [12,13] A(116887)G Q1328R 28 0.003e 0.0015 172/156 NR G(129004)A R1587K 35 55.1 33.0 937/1351 db 2230808 T(133402)C Y1767H 39 ~1.0e 40/55 NR G(133420)A V1773M 39 ~1.0e 40/55 NR Synonymous C(100538)A I620I 15 ~4.0 40/55 NR C(109469)T V990V 21 ~3.0 87/90 [17] T(109861)G V1053V 22 ~1.0 90/90 [12] C(109868)T L1056L 22 ~5.0 90/90 NR C(109906)T R1068R 22 ~3.0 90/90 NR A(113280)G E1211E 25 ~4.0 40/55 [17] A(116879)G T1325T 28 ~1.0 40/55 NR T(137043)C Y1921Y 43 ~1.0 40/55 NR Nucleotide changed Intron Carrier of rare allele (%) Intronic location nb Referencesc Frequency in noncoding sequence G(23816)A 1 ~1.0 11 bp 5 exon 1b 94 NR G(23819)C 1 42 8 bp 5 exon 1b 94 NR A(22997)T 1 46 90 bp 5 exon 1d 91 NR A(23004)G 1 ~1.0 83 bp 5 exon 1d 91 NR G(23058)C 1 46 29 bp 5 exon 1d 91 NR G(40504)A 3 2.6 26 bp 3 of exon 3 192 NR C(45217)T 4 0.7 64 bp 3 of exon 4 142 NR T(98628)A 14 35-40 24 bp 3 of exon 14 190 db 4743763 C(100332)T 14 4.3 59 bp 5 of exon 15 90 db 2066717 C(108020)T 19 0.7 3 bp 5 of exon 20 144 NR DelTTT(134503-6) 39 7.0 20-23 bp 5 of exon 40 90 NR C(142026)T 46 8.6 34 bp 5 of exon 47 116 NR A(142751)G 48 15.9 13 bp 3 of exon 48 107 NR a Relative to transcriptional start. Login to comment
108 Table 3 ABCA1 polymorphisms and mean plasma HDL-C levels (mg/dl &#b1; S.D.) in a random Turkish population Females Males AAa AB BB AAa AB BB Promoter and 5 region T-564C 40.4 &#b1; 8.4 (205) 41.0 &#b1; 7.9 (365) 39.9 &#b1; 7.6 (158) 35.6 &#b1; 7.4 (339) 35.5 &#b1; 6.5 (635) 34.9 &#b1; 6.5 (294) G-407C 41.3 &#b1; 11.2 (82) 40.7 &#b1; 7.7 (101) 40.7 &#b1; 12.2 (37) 35.7 &#b1; 6.9 (88) 35.3 &#b1; 6.7 (96) 35.4 &#b1; 7.4 (49) G-99C 40.7 &#b1; 7.5 (505) 41.0 &#b1; 7.2 (317) 41.3 &#b1; 8.4 (53) 35.1 &#b1; 6.5 (654) 35.0 &#b1; 6.3 (405) 34.9 &#b1; 6.5 (71) C-14T 41.3 &#b1; 9.0 (361) 41.0 &#b1; 9.0 (417) 41.0 &#b1; 9.4 (138) 34.8 &#b1; 7.0b (547) 35.5 &#b1; 7.5 (675) 36.7 &#b1; 8.1b (194) InsG 319 41.3 &#b1; 8.1 (641) 40.5 &#b1; 7.7 (193) 43.1 &#b1; 8.0 (14) 35.3 &#b1; 6.4 (933) 34.7 &#b1; 6.4 (332) 34.5 &#b1; 6.5 (23) Nonsynonymous R219K 41.2 &#b1; 9.4 (364) 40.8 &#b1; 8.6 (480) 41.2 &#b1; 10 (152) 35.2 &#b1; 7.3 (574) 35.3 &#b1; 7.3 (688) 35.2 &#b1; 7.6 (204) V771M 40.9 &#b1; 9.2 (896) 42.8 &#b1; 9.3 (82) 38.7 &#b1; 10 (3) 35.1 &#b1; 7.2c (1330) 37.1 &#b1; 8.0c (144) 45.7 &#b1; 10.7 (3) V825I 40.6 &#b1; 9.4 (842) 38.9 &#b1; 8.5 (117) 42 (1) 35.8 &#b1; 8.7 (1005) 37.1 &#b1; 9.5 (140) (-) I883M 41.1 &#b1; 9.5 (643) 40.8 &#b1; 8.4 (372) 41.4 &#b1; 9.1 (69) 35.0 &#b1; 7.0 (922) 35.7 &#b1; 8.0 (457) 35.6 &#b1; 7.4 (69) E1172D 40.5 &#b1; 8.8 (907) 40.5 &#b1; 7.6 (93) 29 (1) 34.6 &#b1; 7.3 (1129) 35.4 &#b1; 7.6 (105) 30.7 &#b1; 8.7 (3) R1587K 41.1 &#b1; 9.4 (410) 40.8 &#b1; 9.6 (433) 41.0 &#b1; 10.1 (94) 35.9 &#b1; 8.1 (617) 35.1 &#b1; 7.6 (579) 35.3 &#b1; 8.6 (155) Numbers of subjects are shown in parenthesis. Login to comment
203 However, further analysis Table 5 Allele frequency and significant (P < 0.01) pair-wise linkage disequilibrium coefficients between the ABCA1 polymorphisms in a random Turkish population Position Allele % T-564C G-99C C-14T InsG 319 R219K V771M V825I I883M E1172D R1587K T-564C 52.3/47.7 - G-99C 75.8/24.2 0.36 - C-14T 62.3/37.7 -0.96 -0.98 - InsG 319 85.8/14.2 - - - - R219K 61.5/38.5 - - - - V771M 94.9/5.1 - - - 0.99 - V825I 93.8/6.2 -0.40 -0.69 - - -0.76 - - I883M 78.2/21.8 - -0.42 - - 0.20 -0.79 0.91 - E1172D 95.4/4.6 - - - - - 0.34 - - - R1587K 67.0/33.0 - - -0.23 - - 0.56 - - 0.87 - Table 6 Common haplotypes of promoter and coding regions of ABCA1 gene in a random Turkish population Promoter region haplotypes % T-564C G-99C C-14T InsG 319 1 31.7 0 0 1 0 2 20.1 1 1 0 0 3 19.9 1 0 0 0 4 12.7 0 0 0 0 5 4.6 0 0 1 1 6 4.2 1 1 0 1 7 3.2 1 0 0 1 8 2.5 0 0 0 1 Sum 98.9 Coding region haplotypes % R219K V771M V825I I883M E1172D R1587K 1 39.3 0 0 0 0 0 0 2 12.6 1 0 0 0 0 0 3 12.0 0 0 0 0 0 1 4 8.7 1 0 0 1 0 0 5 8.3 1 0 0 0 0 1 6 4.0 0 0 1 1 0 0 7 3.4 0 0 0 0 1 1 8 1.6 1 0 0 1 0 1 9 1.3 1 1 0 0 0 0 10 1.3 0 1 0 0 1 1 11 1.3 0 0 1 1 0 1 12 1.1 1 1 0 0 0 1 Sum 95.1 0: common allele; 1: rare allele. Login to comment
214 Haplotype structure and haplotype-phenotype association of polymorphisms in the coding region of ABCA1 When the haplotype structure of the coding region was constructed using six polymorphisms (R219K, V771M, V825I, I883M, E1172D, and R1587K; Table 6), 12 haplotypes with a frequency >1% accounted for 95.1% of all haplotypes. Login to comment
229 (rare allele in LD with rare allele) was observed between pairs of V771M and InsG 319, V825I and I883M, and R1587K and E1172D. Login to comment
301 The association with V825I and R1587K on plasma HDL-C levels were found in a large general Danish population [17]; however, it was not observed in Dutch men with CAD [18] or in our population. Login to comment

[hide] Accurate prediction of the functional significance... PLoS Genet. 2005 Dec;1(6):e83. Epub 2005 Dec 30. Brunham LR, Singaraja RR, Pape TD, Kejariwal A, Thomas PD, Hayden MR
Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene.
PLoS Genet. 2005 Dec;1(6):e83. Epub 2005 Dec 30., [PMID:16429166]

Abstract [show]
The human genome contains an estimated 100,000 to 300,000 DNA variants that alter an amino acid in an encoded protein. However, our ability to predict which of these variants are functionally significant is limited. We used a bioinformatics approach to define the functional significance of genetic variation in the ABCA1 gene, a cholesterol transporter crucial for the metabolism of high density lipoprotein cholesterol. To predict the functional consequence of each coding single nucleotide polymorphism and mutation in this gene, we calculated a substitution position-specific evolutionary conservation score for each variant, which considers site-specific variation among evolutionarily related proteins. To test the bioinformatics predictions experimentally, we evaluated the biochemical consequence of these sequence variants by examining the ability of cell lines stably transfected with the ABCA1 alleles to elicit cholesterol efflux. Our bioinformatics approach correctly predicted the functional impact of greater than 94% of the naturally occurring variants we assessed. The bioinformatics predictions were significantly correlated with the degree of functional impairment of ABCA1 mutations (r2 = 0.62, p = 0.0008). These results have allowed us to define the impact of genetic variation on ABCA1 function and to suggest that the in silico evolutionary approach we used may be a useful tool in general for predicting the effects of DNA variation on gene function. In addition, our data suggest that considering patterns of positive selection, along with patterns of negative selection such as evolutionary conservation, may improve our ability to predict the functional effects of amino acid variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 This SNP has been reported to be associated with decreased HDL cholesterol and increased severity of atherosclerosis in Table 1. subPSEC Scores and Probability of Functional Impairment (Pdeleterious) for ABCA1 Mutations and SNPs Mutations SNPs Variant SubPSEC Pdeleterious Variant subPSEC Pdeleterious P85L À4.62 0.83 R219K À0.57 0.08 H160F À2.79 0.45 V399A À2.26 0.32 R230C À4.27 0.78 V771M À2.86 0.46 A255T À1.81 0.23 T774P À1.99 0.27 E284K À;2.34 0.34 K776N À3.53 0.63 Y482C À4.21 0.77 V825I À1.06 0.13 R587W À6.04 0.95 I883M À1.38 0.17 W590S À5.19 0.9 E1172D À1.96 0.26 W590L À4.48 0.82 R1587K À0.58 0.08 Q597R À7.15 0.98 S1731C À4.21 0.77 T929I À4.29 0.78 N935H À8.54 1 N935S À7.53 0.99 A937V À6.6 0.97 A1046D À7.52 0.99 M1091T À3.56 0.64 D1099Y À6.09 0.96 D1289N À2.48 0.37 L1379F À3.81 0.69 C1477R À5.44 0.92 S1506L À5.17 0.9 N1611D À5.69 0.94 R1680W À6.02 0.95 V1704D À3.21 0.55 N1800H À4.23 0.77 R1901S À5.06 0.89 F2009S À2.73 0.43 R2081W À8.08 0.99 P2150L À2.88 0.47 Q2196H À2.74 0.43 DOI: 10.1371/journal.pgen.0010083.t001 PLoS Genetics | www.plosgenetics.org December 2005 | Volume 1 | Issue 6 | e83 0740 Accurate Prediction of ABCA1 Variants Synopsis A major goal of human genetics research is to understand how genetic variation leads to differences in the function of genes. Login to comment

[hide] Mutation in ABCA1 predicted risk of ischemic heart... J Am Coll Cardiol. 2005 Oct 18;46(8):1516-20. Epub 2005 Sep 23. Frikke-Schmidt R, Nordestgaard BG, Schnohr P, Steffensen R, Tybjaerg-Hansen A
Mutation in ABCA1 predicted risk of ischemic heart disease in the Copenhagen City Heart Study Population.
J Am Coll Cardiol. 2005 Oct 18;46(8):1516-20. Epub 2005 Sep 23., [PMID:16226177]

Abstract [show]
OBJECTIVES: We tested whether heterozygosity for the K776N mutation (frequency: 0.4%) in ATP-binding cassette transporter A1 (ABCA1) predicted ischemic heart disease (IHD) in the Copenhagen City Heart Study population. BACKGROUND: In a complex trait like IHD, genetic variation is considered to be conferred by common DNA polymorphisms, although rare mutations may have a larger impact. Tangier disease, a rare high-density lipoprotein cholesterol (HDL-C) deficiency syndrome with IHD, is caused by homozygous ABCA1 mutations. METHODS: We analyzed blood samples from a large cohort study of 9,076 Danish individuals followed for 24 years (167,287 person-years), during which 1,033 incident IHD events occurred. The hypothesis was retested in an independent case-control study comparing 562 IHD patients with 3,103 controls. RESULTS: The cumulative incidence of IHD as a function of age was increased in K776N heterozygotes compared with non-carriers (log-rank test: p = 0.005). At the age of 80 years, 48% of heterozygotes and 23% of non-carriers had IHD. Incidence rates in non-carriers and K776N heterozygotes were 61 and 157 per 10,000 person-years. The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5). Adjusting for HDL-C, or for smoking, diabetes, and hypertension did not change the result, suggesting that genotype predicted risk of IHD beyond that offered by HDL-C, and by other conventional risk factors. Similar trends were obtained in an independent case-control study. CONCLUSIONS: Heterozygosity for an ABCA1 mutation (K776N) conferred two- to three-fold risk of IHD in 37 participants in the Copenhagen City Heart study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 However, at the individual level, K776N appears to have a marked impact on risk. Login to comment
109 However, several arguments favor a true observation: 1) the involved amino acid residue is completely conserved between species and relatively conserved between 12 ABCAs with very different transport functions; 2) the amino acid substitution changes the charge of the side-chain, potentially leading to structural alterations of the protein, and consequently to altered protein interactions or transport properties; 3) in the CFTR (or ABCC7), a disease-causing mutation (R347P) has been identified at a site that corresponds to residue 764 in ABCA1 (15), and thus in close vicinity to K776N; 4) the present study is of a large cohort, and therefore includes only incident cases, avoiding the normal pitfalls of case reports and case-control studies (30); 5) we observed a similar trend on risk of IHD in a separate case-control study; 6) we have previously determined effects on lipids and lipoproteins of all non-synonymous SNPs identified in ABCA1 (R219K, V771M, V825I, I883M, E1172D, R1587K). Login to comment

[hide] ATP-binding cassette transporter A1: a cell choles... Physiol Rev. 2005 Oct;85(4):1343-72. Oram JF, Heinecke JW
ATP-binding cassette transporter A1: a cell cholesterol exporter that protects against cardiovascular disease.
Physiol Rev. 2005 Oct;85(4):1343-72., [PMID:16183915]

Abstract [show]
Blood high-density lipoprotein (HDL) levels are inversely related to risk for cardiovascular disease, implying that factors associated with HDL metabolism are atheroprotective. One of these factors is ATP-binding cassette transporter A1 (ABCA1), a cell membrane protein that mediates the transport of cholesterol, phospholipids, and other metabolites from cells to lipid-depleted HDL apolipoproteins. ABCA1 transcription is highly induced by sterols, a major substrate for cellular export, and its expression and activity are regulated posttranscriptionally by diverse processes. Liver ABCA1 initiates formation of HDL particles, and macrophage ABCA1 protects arteries from developing atherosclerotic lesions. ABCA1 mutations can cause a severe HDL deficiency syndrome characterized by cholesterol deposition in tissue macrophages and prevalent atherosclerosis. Genetic manipulations of ABCA1 expression in mice also affect plasma HDL levels and atherogenesis. Metabolites elevated in individuals with the metabolic syndrome and diabetes destabilize ABCA1 protein and decrease cholesterol export from macrophages. Moreover, oxidative modifications of HDL found in patients with cardiovascular disease reduce the ability of apolipoproteins to remove cellular cholesterol by the ABCA1 pathway. These observations raise the possibility that an impaired ABCA1 pathway contributes to the enhanced atherogenesis associated with common inflammatory and metabolic disorders. The ABCA1 pathway has therefore become an important new therapeutic target for treating cardiovascular disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
431 The most studied of these SNPs is the R219K variant, with the K allele being associated with higher levels of HDL (255). Login to comment
432 V771M and V825I SNPs have also been reported to be associated with increased HDL levels, whereas R1587K is associated with low levels of HDL (78, 255). Login to comment

[hide] Genotypic effect of the -565C>T polymorphism in th... Arterioscler Thromb Vasc Biol. 2005 Feb;25(2):418-23. Epub 2004 Nov 4. Kyriakou T, Hodgkinson C, Pontefract DE, Iyengar S, Howell WM, Wong YK, Eriksson P, Ye S
Genotypic effect of the -565C>T polymorphism in the ABCA1 gene promoter on ABCA1 expression and severity of atherosclerosis.
Arterioscler Thromb Vasc Biol. 2005 Feb;25(2):418-23. Epub 2004 Nov 4., [PMID:15528481]

Abstract [show]
OBJECTIVE: Loss-of-function mutations of the ATP-binding cassette transporter A1 (ABCA1) gene cause Tangier disease, a rare genetic disorder with accumulation of lipid-laden macrophages and increased risk of atherosclerosis. Common variants of this gene may be a genetic factor for atherosclerosis in the general population. This study was performed to test the reported association between the -565C>T polymorphism and atherosclerosis severity and to investigate whether this variant per se had an effect on promoter activity of the ABCA1 gene. METHODS AND RESULTS: A cohort of patients with coronary atherosclerosis were genotyped for the -565C>T polymorphism. Logistic regression analyses showed that homozygotes of the -565T allele had greatest mean number of diseased coronary arteries, particular in nonsmokers. Real-time reverse-transcriptase polymerase chain reaction showed that in atherosclerotic plaques removed from patients undergoing endarteretomy, ABCA1 expression levels were lowest in those who had the T/T genotype and highest in those of the C/C genotype. Transfection and reporter assays demonstrated that in cultured macrophages, the -565T allelic promoter had a lower activity in driving gene expression than the -565C allelic promoter. Electrophoretic mobility shift assays displayed differential binding of nuclear proteins to the 2 alleles. CONCLUSIONS: These results indicate that the -565C>T polymorphism has an allele-specific effect on ABCA1 gene expression and provide further evidence of a genotypic effect on coronary atherosclerosis severity. The study showed that the ABCA1 gene -565C>T polymorphism was associated with severity of coronary atherosclerosis in a cohort of patients from Southern England and that this sequence variant per se had an effect on promoter activity of the ABCA1 gene. The data support the notion that common ABCA1 gene variants can contribute to interindividual variability in atherosclerosis susceptibility and severity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 An interaction between another ABCA1 gene polymorphism (ie, R219K) and smoking has been reported previously, although the underlying mechanisms remain unknown.16 TABLE 2. Login to comment
93 For example, the R219K polymorphism has been shown to be associated with risk of myocardial infarction and/or severity of atherosclerosis,15-19 the V825I, M883I, and R1587K polymorphisms with various cardiovascular traits,17,20,21 the -191GϾC, -17CϾG, and 69CϾT polymorphisms with risk of coronary events in patients with coronary atherosclerosis,22 and the 319insG polymorphism with severity of atherosclerosis.22 Taken together, these data suggest that the development and outcome of atherosclerosis might be influenced by a qualitative change of the ABCA1 protein caused by coding region variants and a quantitative change in ABCA1 expression caused by regulatory region variants. Login to comment

[hide] In-depth haplotype analysis of ABCA1 gene polymorp... Arterioscler Thromb Vasc Biol. 2004 Apr;24(4):775-81. Epub 2004 Feb 12. Tregouet DA, Ricard S, Nicaud V, Arnould I, Soubigou S, Rosier M, Duverger N, Poirier O, Mace S, Kee F, Morrison C, Denefle P, Tiret L, Evans A, Deleuze JF, Cambien F
In-depth haplotype analysis of ABCA1 gene polymorphisms in relation to plasma ApoA1 levels and myocardial infarction.
Arterioscler Thromb Vasc Biol. 2004 Apr;24(4):775-81. Epub 2004 Feb 12., [PMID:14962947]

Abstract [show]
OBJECTIVE: By regulating the cellular cholesterol efflux from peripheral cells to high-density lipoprotein, the ABCA1 protein is suspected to play a key role in lipid homeostasis and atherosclerosis. Twenty-six polymorphisms of the ABCA1 gene were genotyped and tested for association with plasma levels of ApoA1 and myocardial infarction (MI) in the ECTIM study. METHODS AND RESULTS: In addition to single-locus analysis, a systematic exploration of all possible haplotype effects was performed, with this exploration being performed on a minimal set of "tag" polymorphisms that define the haplotype structure of the gene. Two polymorphisms were associated with plasma levels of ApoA1, 1 in the promoter (C-564T) and 1 in the coding (R1587K) regions, whereas only 1 polymorphism (R219K) was associated with the risk of MI. However, no haplotype effect was detected on ApoA1 variability or on the risk of MI. CONCLUSIONS: ABCA1 gene polymorphisms but not haplotypes are involved in the variability of plasma ApoA1 and the susceptibility to coronary artery disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 Strong LD was also present in the coding region for 1 cluster of polymorphisms (R219K, G316G, I680I, V771 M, V825I, I883 M) located in exons 8 to 17. Login to comment
84 Description and Frequency of ABCA1 Gene Polymorphisms in the 2 Centers From the United Kingdom Sequence Allele Frequency† Name 5Ј Flanking Nucleotide Change 3Ј Flanking Belfast (Nϭ888) Glasgow (Nϭ725) A-1814G CAGCCTCCTG A/g GATAACAGGC 0.339 0.366 C-1801T TAACAGGCGC C/t CGCCACCACA 0.443 0.433 A-1652G CACTGCGCCC A/g GCTCAGATCC 0.350 0.364 G-1506C CTCTTCTATG G/c GTCTGTCCTG 0.203 0.205 C-1395T TGAATGTCTG C/t ATGCAGGTGG 0.428 0.425 G-1252A TGCCCTTCAA G/a GTGGCTACAA 0.095 0.088 C-1217T AGGTAGGAGA C/t CTTGTGGCCT 0.120 0.121 -1034ins/del ATATTTAGAC ϮAT ATGGTGTGTA 0.210 0.220 T-940G GGCAAACAGA T/g AAGTTGGAGG 0.486 0.483 G-803A AAATTAAAAG G/a GGGCTGGTCC 0.108 0.093 -777rpt/23nt* CTGTGTTTTTGTTTGTTTGTTTC 0.527 0.518 -777rpt/28nt CTGTGTTTTTGTTTGTTTTGTTTGTTTC 0.267 0.272 -777rpt/32nt CTGTGTTTTTGTTTGTTTGTTTTGTTTGTTTC 0.206 0.210 C-564T GAGGACTGTC C/t GCCTTCCCCT 0.456 0.472 G-407C GCGGAAAGCA G/c GATTTAGAGG 0.455 0.459 C-302T CGTCTTAGGC C/t GGCGGGCCCG 0.196 0.189 G-278C GGGGGAAGGG G/c ACGCAGACCG 0.435 0.424 C-14T GGAACTAGTC C/t CGGCAAAAAC 0.335 0.346 R219K GGCCTACCAA G/a GGAGAAACTG 0.283 0.278 G316G AGGGAGGGGG G/a CTGAAGATCA 0.114 0.095 I680I ACAACAGCAT C/a CTCTGGTTTA 0.129 0.118 V771 M GCAGGACTAC G/a TGGGCTTCAC 0.029 0.034 V825I CACCACTTCG G/a TCTCCATGAT 0.056 0.060 I883 M AGAAGAGAAT A/g TCAGAAAGTA 0.137 0.126 L1122L GAAGAACCAG C/t TGGGAACAGG 0.023 0.017 E1172D GCGACCATGA G/c AGTGACACGC 0.026 0.027 T1427T GCAGAGACAC G/a CCCTGCCAGG 0.069 0.083 R1587K CTGGACACCA G/a AAATAATGTC 0.216 0.226 *1 subject carried an additional GTTT deletion, leading to an allele of 19 nucleotides. Login to comment
124 Discussion Much attention has been focused on the association of ABCA1 gene polymorphisms with different phenotypes including lipid variables and clinical endpoints.23,25-29,39 Several studies have consistently reported an association between the R219K polymorphism and coronary artery disease.23,26,27 This polymorphism has been shown to be associated with triglycerides23 but not with HDL-C.26,27 Inconsistent results were also observed for other ABCA1 gene polymorphisms including V825I, I883 M, and E1172D. Login to comment
133 Haplotype Structure Defined by the Polymorphisms of the ABCA1 Gene Coding Region (N‫)6921؍‬ Polymorphisms Estimated Haplotype Frequencies R219K G316G (G/A) I680I (C/A) V771 M V825I I883 M L1122L (C/T) E1172D T1427T (G/A) R1587K Controls (Nϭ639) Cases (Nϭ657) R G C V V I C E G R 0.470 0.522 R G C V V I C E G K 0.089 0.085 R G C V V I C E A R 0.026 0.031 R G C V V I C D G K 0.018 0.019 R G C V V I T E G R 0.016 0.017 R G A V I M C E G R 0.015 0.015 R G A V I M C E G K 0.015 0.015 R G A V I M C E A R 0.028 0.026 K G C V V I C E G R 0.077 0.063 K G C V V I C E G K 0.041 0.037 K G A V V M C E G R 0.026 0.020 K G A V V M C E G K 0.014 0.012 K G A V V M C E A R 0.016 0.019 K A C V V I C E G R 0.042 0.035 K A C V V I C E G K 0.034 0.027 K A C M V I C E G R 0.028 0.027 The haplotype structure of the coding region of the ABCA1 gene can be completely defined by a minimal subset of 8 "tag" polymorphisms indicated in boxes. Login to comment
75 Strong LD was also present in the coding region for 1 cluster of polymorphisms (R219K, G316G, I680I, V771 M, V825I, I883 M) located in exons 8 to 17. Login to comment
80 Description and Frequency of ABCA1 Gene Polymorphisms in the 2 Centers From the United Kingdom Sequence Allele Frequencyߤ Name 5b18; Flanking Nucleotide Change 3b18; Flanking Belfast (Nafd;888) Glasgow (Nafd;725) A-1814G CAGCCTCCTG A/g GATAACAGGC 0.339 0.366 C-1801T TAACAGGCGC C/t CGCCACCACA 0.443 0.433 A-1652G CACTGCGCCC A/g GCTCAGATCC 0.350 0.364 G-1506C CTCTTCTATG G/c GTCTGTCCTG 0.203 0.205 C-1395T TGAATGTCTG C/t ATGCAGGTGG 0.428 0.425 G-1252A TGCCCTTCAA G/a GTGGCTACAA 0.095 0.088 C-1217T AGGTAGGAGA C/t CTTGTGGCCT 0.120 0.121 afa;1034ins/del ATATTTAGAC afe;AT ATGGTGTGTA 0.210 0.220 T-940G GGCAAACAGA T/g AAGTTGGAGG 0.486 0.483 G-803A AAATTAAAAG G/a GGGCTGGTCC 0.108 0.093 afa;777rpt/23nt* CTGTGTTTTTGTTTGTTTGTTTC 0.527 0.518 afa;777rpt/28nt CTGTGTTTTTGTTTGTTTTGTTTGTTTC 0.267 0.272 afa;777rpt/32nt CTGTGTTTTTGTTTGTTTGTTTTGTTTGTTTC 0.206 0.210 C-564T GAGGACTGTC C/t GCCTTCCCCT 0.456 0.472 G-407C GCGGAAAGCA G/c GATTTAGAGG 0.455 0.459 C-302T CGTCTTAGGC C/t GGCGGGCCCG 0.196 0.189 G-278C GGGGGAAGGG G/c ACGCAGACCG 0.435 0.424 C-14T GGAACTAGTC C/t CGGCAAAAAC 0.335 0.346 R219K GGCCTACCAA G/a GGAGAAACTG 0.283 0.278 G316G AGGGAGGGGG G/a CTGAAGATCA 0.114 0.095 I680I ACAACAGCAT C/a CTCTGGTTTA 0.129 0.118 V771 M GCAGGACTAC G/a TGGGCTTCAC 0.029 0.034 V825I CACCACTTCG G/a TCTCCATGAT 0.056 0.060 I883 M AGAAGAGAAT A/g TCAGAAAGTA 0.137 0.126 L1122L GAAGAACCAG C/t TGGGAACAGG 0.023 0.017 E1172D GCGACCATGA G/c AGTGACACGC 0.026 0.027 T1427T GCAGAGACAC G/a CCCTGCCAGG 0.069 0.083 R1587K CTGGACACCA G/a AAATAATGTC 0.216 0.226 *1 subject carried an additional GTTT deletion, leading to an allele of 19 nucleotides. Login to comment
120 Discussion Much attention has been focused on the association of ABCA1 gene polymorphisms with different phenotypes including lipid variables and clinical endpoints.23,25-29,39 Several studies have consistently reported an association between the R219K polymorphism and coronary artery disease.23,26,27 This polymorphism has been shown to be associated with triglycerides23 but not with HDL-C.26,27 Inconsistent results were also observed for other ABCA1 gene polymorphisms including V825I, I883 M, and E1172D. Login to comment
129 Haplotype Structure Defined by the Polymorphisms of the ABCA1 Gene Coding Region (Nd1d;1296) Polymorphisms Estimated Haplotype Frequencies R219K G316G (G/A) I680I (C/A) V771 M V825I I883 M L1122L (C/T) E1172D T1427T (G/A) R1587K Controls (Nafd;639) Cases (Nafd;657) R G C V V I C E G R 0.470 0.522 R G C V V I C E G K 0.089 0.085 R G C V V I C E A R 0.026 0.031 R G C V V I C D G K 0.018 0.019 R G C V V I T E G R 0.016 0.017 R G A V I M C E G R 0.015 0.015 R G A V I M C E G K 0.015 0.015 R G A V I M C E A R 0.028 0.026 K G C V V I C E G R 0.077 0.063 K G C V V I C E G K 0.041 0.037 K G A V V M C E G R 0.026 0.020 K G A V V M C E G K 0.014 0.012 K G A V V M C E A R 0.016 0.019 K A C V V I C E G R 0.042 0.035 K A C V V I C E G K 0.034 0.027 K A C M V I C E G R 0.028 0.027 The haplotype structure of the coding region of the ABCA1 gene can be completely defined by a minimal subset of 8 "tag" polymorphisms indicated in boxes. Login to comment

[hide] Genetic variants of ABCA1 modify Alzheimer disease... Hum Mutat. 2004 Apr;23(4):358-67. Katzov H, Chalmers K, Palmgren J, Andreasen N, Johansson B, Cairns NJ, Gatz M, Wilcock GK, Love S, Pedersen NL, Brookes AJ, Blennow K, Kehoe PG, Prince JA
Genetic variants of ABCA1 modify Alzheimer disease risk and quantitative traits related to beta-amyloid metabolism.
Hum Mutat. 2004 Apr;23(4):358-67., [PMID:15024730]

Abstract [show]
Linkage studies have provided evidence that one or more loci on chromosome 9q influence Alzheimer disease (AD). The gene encoding the ATP-binding cassette A1 transporter (ABCA1) resides within proximity of previously identified linkage peaks and represents a plausible biological candidate for AD due to its central role in cellular lipid homeostasis. Several single nucleotide polymorphisms (SNPs) spanning ABCA1 have been genotyped and haplotype-based association analyses performed in four independent case-control samples, consisting of over 1,750 individuals from three European populations representing both early and late-onset AD. Prominent effects were observed for a common (H2) and rarer haplotype (H5) that were enriched in AD cases across studied populations (odds ratio [OR] 1.59, 95% confidence interval [CI] 1.36-1.82; P<0.00001 and OR 2.90; 95% CI 2.54-3.27; P<0.00001, respectively). Two other common haplotypes in the studied region (H1 and H3) were significantly under-represented in AD cases, suggesting that they may harbor alleles that decrease disease risk (OR 0.79, 95% CI 0.64-0.94; P=0.0065 and OR 0.70, 95% CI 0.46-0.93; P=0.011, respectively). While findings were significant in both early and late-onset samples, haplotype effects were more distinct in early-onset materials. For late-onset samples, ancillary evidence was obtained that both single marker alleles and haplotypes of ABCA1 contribute to variable cerebrospinal fluid tau and beta amyloid (Abeta42) protein levels, and brain Abeta load. Results indicate that variants of ABCA1 may affect the risk of AD, providing further support for a genetic link between AD and cholesterol metabolism.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 Details of ABCA1 SNPs, and Oligos for PCR and DASHn Variant dbSNP rsID Base change Forward primer sequence (50 ^30 ) Reverse primer sequence (30 ^50 ) Probe sequence (50 ^30 ) p.R219K rs2230806 c.658G4A g.10300705G4A b-TTTCTGAGCTTTGTGGCCTACC GCTCTGCTGCAGCCAGTTTCTC GTTTCTCCCTTGGTAGG p.V771M rs2066718 c.2314G4A g.102969093G4A b-TGTGTGTGGCATGGCAGGACTA GCGAAGATCTTGAGTGTGAAGC GAAGCCCACGTAGTCCT p.V825I rs4149312 c.2476G4A g.102967871G4A b-ATGGCTTCAATCTCACCACTTG GGTGTCAAACAGCATCATGGAG CATGGAGACCCAAGTGG p.I883M rs4149313 c.2650A4G g.102966591A4G b-GAGGTCAACAGCACTTACTTTCT AGAAGAGCCACCCTTGTTCCAA AAGAGAATGTCAGAAAG p.R1587K rs2230808 c.4762G4A g.102942642G4A b-ATTTATGACAGGACTGGACACC AGCGGTTTACCTTGACATTATT CATTATTTCTGGTGTCC n Genotyping of SNPs was performed using dynamic allele speci'c hybridization (DASH) [Prince et al., 2001]. Login to comment
86 Marker rs4149312 (c.2476G4A, p.V825I) was found to be monomorphic in set B. Login to comment
93 Single MarkerAssociations forABCA1and Alzheimer Diseasew p.R219K (rs2230806) G/G G/A A/A P value Set A AD 238 (.62) 125 (.33) 21 (.05) 0.014n Controls 102 (.58) 51 (.29) 22 (.13) Set B AD 58 (.48) 53 (.44) 9 (.08) 0.76 Controls 76 (.53) 59 (.41) 9 (.06) Set C AD 82 (.57) 53 (.37) 8 (.06) 0.66 Controls 183 (.56) 117 (.36) 26 (.08) Set D AD 183 (.56) 122 (.37) 22 (.07) 0.93 Controls 60 (.57) 40 (.38) 6 (.06) p.I883M (rs4149313) C/C C/T T/T Set A AD 2 (.01) 81 (.21) 301 (.78) 0.39 Controls 0 (.00) 31 (.18) 145 (.82) Set B AD 0 (.00) 29 (.24) 91 (.76) 0.27 Controls 3 (.02) 32 (.21) 115 (.77) Set C AD 2 (.01) 27 (.19) 116 (.80) 0.84 Controls 3 (.01) 53 (.17) 256 (.82) Set D AD 3 (.01) 68 (.21) 253 (.78) 0.61 Controls 2 (.02) 19 (.19) 83 (.80) p.R1587K (rs2230808) G/G G/A A/A Set A AD 253 (.66) 114 (.30) 15 (.04) 0.13 Controls 101 (.57) 66 (.38) 9 (.05) Set B AD 56 (.46) 58 (.48) 7 (.06) 0.016n Controls 96 (.64) 48 (.32) 7 (.05) Set C AD 80 (.55) 56 (.39) 9 (.06) 0.70 Controls 189 (.58) 121 (.37) 15 (.05) Det D AD 185 (.57) 118 (.36) 24 (.07) 0.18 Controls 68 (.64) 28 (.26) 10 (.09) p.V771M (rs2066718) G/G G/A A/A Set A AD 365 (.95) 20 (.05) 0 (.00) 0.28 Controls 167 (.95) 7 (.04) 1 (.01) Set B AD 109 (.98) 2 (.02) 0 (.00) 0.029n Controls 126 (.92) 11 (.08) 0 (.00) p.V825I (rs4149312) G/G G/A A/A Set A AD 341 (.93) 20 (.05) 4 (.01) 0.17 Controls 164 (.92) 15 (.08) 0 (.00) w Genotype frequencies for all studied SNPs in ABCA1 are presented. Login to comment

[hide] Associations between serum high-density lipoprotei... Metabolism. 2004 Feb;53(2):182-6. Yamakawa-Kobayashi K, Yanagi H, Yu Y, Endo K, Arinami T, Hamaguchi H
Associations between serum high-density lipoprotein cholesterol or apolipoprotein AI levels and common genetic variants of the ABCA1 gene in Japanese school-aged children.
Metabolism. 2004 Feb;53(2):182-6., [PMID:14767869]

Abstract [show]
ATP-binding cassette transporter A1 (ABCA1) plays an important role in apolipoprotein AI (apoAI)-mediated cholesterol efflux from peripheral cells. The mild changes in ABCA1 activity due to genomic variation might be associated with interindividual variations in serum high-density lipoprotein cholesterol (HDL-C) and apoAI levels, or primary hypoalphalipoproteinemia in the general population. In the present study, we analyzed the relationships between 5 single nucleotide polymorphisms (SNPs) and 2 insertion/deletion polymorphisms in the 5' flanking region and 5 missense polymorphisms of the ABCA1 gene and serum lipid levels in healthy school-aged children. We detected significant associations between the K219R and V771M polymorphisms, and HDL-C or apoAI levels. The present data support the proposition that the K219 allele is an anti-atherogenic allele with increased cholesterol efflux activity. Similarly, the M771 allele appears to be anti-atherogenic, although the frequency of the M771 allele is low.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Missense Polymorphisms in the Coding Region To date, in the coding region of the ABCA1 gene, 9 SNPs inducing amino acid changes have been reported in the dbSNP database; we have ascertained that at least 5 of these missense mutations (K219R, V771M, V825I, M883I, and R1587K) are polymorphic in Japanese populations. Login to comment
40 Tight linkage disequilib- liums were observed between the V771M polymorphism and the M883I polymorphism, and the V825I polymorphism and the M883I polymorphism (data not shown). Login to comment
54 *Statistical tests for TG levels were calculated on log-transformed values. Table 4. Relations Between Genotypes of Missense Polymorphisms and the Serum Levels of HDL-C, TG, and apoAI Genotype n HDL-C (mg/dL) P TG (mg/dL)* P apoAI (mg/dL) P K219R KK 97 56.9 Ϯ 11.3 .016 74.3 Ϯ 36.6 .43 136.0 Ϯ 18.8 .012 KR 160 52.2 Ϯ 10.3 77.2 Ϯ 32.3 128.7 Ϯ 17.3 RR 70 54.3 Ϯ 9.7 71.8 Ϯ 31.9 131.2 Ϯ 15.7 V771M VV 265 53.4 Ϯ 10.5 .13 74.4 Ϯ 32.3 .76 130.1 Ϯ 17.5 .035 VM 59 56.8 Ϯ 10.5 79.3 Ϯ 39.2 137.5 Ϯ 17.3 MM 3 57.7 Ϯ 18.2 71.0 Ϯ 14.0 133.3 Ϯ 23.5 V825I VV 134 53.2 Ϯ 10.9 .53 76.3 Ϯ 35.3 .77 130.7 Ϯ 18.3 .54 VI 156 54.9 Ϯ 10.3 74.8 Ϯ 31.6 132.5 Ϯ 17.2 II 37 53.8 Ϯ 11.2 73.1 Ϯ 35.4 129.5 Ϯ 17.4 M8831 MM 120 53.9 Ϯ 11.4 .73 75.3 Ϯ 35.1 .24 131.2 Ϯ 18.0 .90 MI 162 53.8 Ϯ 10.2 76.5 Ϯ 32.3 131.1 Ϯ 18.1 II 45 55.3 Ϯ 10.6 70.6 Ϯ 33.7 133.0 Ϯ 15.7 R1587K RR 114 54.5 Ϯ 10.7 .52 75.2 Ϯ 34.8 .063 131.7 Ϯ 16.9 .49 RK 154 54.0 Ϯ 10.3 78.1 Ϯ 34.3 131.9 Ϯ 17.5 KK 59 53.4 Ϯ 11.7 67.7 Ϯ 27.7 129.5 Ϯ 19.7 NOTE. Values are shown as mean Ϯ SD. P values were calculated by multiple linear regression analyses incorporating sex, age, and BMI as covariates. Login to comment
59 However, no significant associations were observed between the remaining 3 missense polymorphisms (V825I, M883I, and R1587K) and serum HDL-C, TG, and apoAI levels (Table 4). Login to comment
55 *Statistical tests for TG levels were calculated on log-transformed values. Table 4. Relations Between Genotypes of Missense Polymorphisms and the Serum Levels of HDL-C, TG, and apoAI Genotype n HDL-C (mg/dL) P TG (mg/dL)* P apoAI (mg/dL) P K219R KK 97 56.9 afe; 11.3 .016 74.3 afe; 36.6 .43 136.0 afe; 18.8 .012 KR 160 52.2 afe; 10.3 77.2 afe; 32.3 128.7 afe; 17.3 RR 70 54.3 afe; 9.7 71.8 afe; 31.9 131.2 afe; 15.7 V771M VV 265 53.4 afe; 10.5 .13 74.4 afe; 32.3 .76 130.1 afe; 17.5 .035 VM 59 56.8 afe; 10.5 79.3 afe; 39.2 137.5 afe; 17.3 MM 3 57.7 afe; 18.2 71.0 afe; 14.0 133.3 afe; 23.5 V825I VV 134 53.2 afe; 10.9 .53 76.3 afe; 35.3 .77 130.7 afe; 18.3 .54 VI 156 54.9 afe; 10.3 74.8 afe; 31.6 132.5 afe; 17.2 II 37 53.8 afe; 11.2 73.1 afe; 35.4 129.5 afe; 17.4 M8831 MM 120 53.9 afe; 11.4 .73 75.3 afe; 35.1 .24 131.2 afe; 18.0 .90 MI 162 53.8 afe; 10.2 76.5 afe; 32.3 131.1 afe; 18.1 II 45 55.3 afe; 10.6 70.6 afe; 33.7 133.0 afe; 15.7 R1587K RR 114 54.5 afe; 10.7 .52 75.2 afe; 34.8 .063 131.7 afe; 16.9 .49 RK 154 54.0 afe; 10.3 78.1 afe; 34.3 131.9 afe; 17.5 KK 59 53.4 afe; 11.7 67.7 afe; 27.7 129.5 afe; 19.7 NOTE. Values are shown as mean afe; SD. P values were calculated by multiple linear regression analyses incorporating sex, age, and BMI as covariates. Login to comment
60 However, no significant associations were observed between the remaining 3 missense polymorphisms (V825I, M883I, and R1587K) and serum HDL-C, TG, and apoAI levels (Table 4). Login to comment

[hide] Efflux and atherosclerosis: the clinical and bioch... Arterioscler Thromb Vasc Biol. 2003 Aug 1;23(8):1322-32. Epub 2003 May 22. Singaraja RR, Brunham LR, Visscher H, Kastelein JJ, Hayden MR
Efflux and atherosclerosis: the clinical and biochemical impact of variations in the ABCA1 gene.
Arterioscler Thromb Vasc Biol. 2003 Aug 1;23(8):1322-32. Epub 2003 May 22., [PMID:12763760]

Abstract [show]
Approximately 50 mutations and many single nucleotide polymorphisms have been described in the ABCA1 gene, with mutations leading to Tangier disease and familial hypoalphalipoproteinemia. Homozygotes and heterozygotes for mutations in ABCA1 display a wide range of phenotypes. Identification of ABCA1 as the molecular defect in these diseases has allowed for ascertainment based on genetic status and determination of genotype-phenotype correlations and has permitted us to identify mutations conferring a range of severity of cellular, biochemical, and clinical phenotypes. In this study we review how genetic variation at the ABCA1 locus affects its role in the maintenance of lipid homeostasis and the natural progression of atherosclerosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
136 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon -1095A/G Promoter ⅐ ⅐ ⅐ -477C/T Promoter ⅐ ⅐ ⅐ -419A/C Promoter ⅐ ⅐ ⅐ -320G/C Promoter ⅐ ⅐ ⅐ -191G/C Promoter ⅐ ⅐ ⅐ C69T 5ЈUTR 1 C117G 5ЈUTR 1 InsG319 5ЈUTR 2 G378C 5ЈUTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
148 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ⅐ ⅐ ⅐ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ⅐ ⅐ ⅐ ⅐ ⅐ ⅐ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
153 The V825I, I883M, and E1172D SNPs have also been associated with increased clinical events and severity of atherosclerosis.75,77 The R219K Variant The R219K SNP has been most studied and highlights many of the difficulties associated with the study of SNPs in general. Login to comment
162 Functional Effects of cSNPs and Regulatory SNPs in the ABCA1 Gene Nucleotide Amino Acid/Position Lipids CAD/Atherosclerosis Antiatherogenic SNPs C-17G Promoter No change 2 InsG319 5ЈUTR No change 2 G1051A R219K 2 TG, 1 HDL, 1 ApoA-1, 1 ApoB, 1 LDL 2 A3044G I883M 2 TG, 1 HDL 1 Proatherogenic SNPs -191C/-320C/-477T haplotype Promoter No change 1 G-191C Promoter No change 1 A-1095G Promoter No change 1 C117G 5ЈUTR 1 TG No change G2706A V771M No change 1 G2868A V825I No change 1 G3911C E1172D 2 HDL, 2 ApoB 1 G5155A R1587K 2 HDL No change Associations with lipid levels and CAD are shown by arrows to represent the direction of association. Login to comment
171 The noncoding SNPs G-191C, C-69T, C-17G, and InsG319 and the cSNPs R219K, V771M, and V825I have all been found to be associated with differences in severity of atherosclerosis but not with changes in HDL-C levels in at least 1 study. Login to comment
128 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon afa;1095A/G Promoter ዼ ዼ ዼ afa;477C/T Promoter ዼ ዼ ዼ afa;419A/C Promoter ዼ ዼ ዼ afa;320G/C Promoter ዼ ዼ ዼ afa;191G/C Promoter ዼ ዼ ዼ C69T 5b18;UTR 1 C117G 5b18;UTR 1 InsG319 5b18;UTR 2 G378C 5b18;UTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 Singaraja et al Clinical and Biochemical Impact of ABCA1 Variants markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
140 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ዼ ዼ ዼ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ዼ ዼ ዼ ዼ ዼ ዼ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
145 The V825I, I883M, and E1172D SNPs have also been associated with increased clinical events and severity of atherosclerosis.75,77 The R219K Variant The R219K SNP has been most studied and highlights many of the difficulties associated with the study of SNPs in general. Login to comment
154 Functional Effects of cSNPs and Regulatory SNPs in the ABCA1 Gene Nucleotide Amino Acid/Position Lipids CAD/Atherosclerosis Antiatherogenic SNPs C-17G Promoter No change 2 InsG319 5b18;UTR No change 2 G1051A R219K 2 TG, 1 HDL, 1 ApoA-1, 1 ApoB, 1 LDL 2 A3044G I883M 2 TG, 1 HDL 1 Proatherogenic SNPs afa;191C/afa;320C/afa;477T haplotype Promoter No change 1 G-191C Promoter No change 1 A-1095G Promoter No change 1 C117G 5b18;UTR 1 TG No change G2706A V771M No change 1 G2868A V825I No change 1 G3911C E1172D 2 HDL, 2 ApoB 1 G5155A R1587K 2 HDL No change Associations with lipid levels and CAD are shown by arrows to represent the direction of association. Login to comment
163 The noncoding SNPs G-191C, C-69T, C-17G, and InsG319 and the cSNPs R219K, V771M, and V825I have all been found to be associated with differences in severity of atherosclerosis but not with changes in HDL-C levels in at least 1 study. Login to comment

[hide] ABCA1 gene polymorphisms and their associations wi... Hum Genet. 2003 Jul;113(2):106-17. Epub 2003 Apr 23. Tan JH, Low PS, Tan YS, Tong MC, Saha N, Yang H, Heng CK
ABCA1 gene polymorphisms and their associations with coronary artery disease and plasma lipids in males from three ethnic populations in Singapore.
Hum Genet. 2003 Jul;113(2):106-17. Epub 2003 Apr 23., [PMID:12709788]

Abstract [show]
Mutations in the ATP-binding cassette transporter ABCA1 underlie Tangier disease and familial hypoalphaliproteinemia (FHA), disorders that are characterised by reduced high-density lipoprotein-cholesterol (HDL-C) concentration and cholesterol efflux, and increased coronary artery disease (CAD). We explored if polymorphisms in the ABCA1 gene are associated with CAD and variations in plasma lipid levels, especially HDL-C, and whether the associations may depend on ethnicity. Male cases and controls from the Singapore Chinese, Malay and Indian populations were genotyped for five ABCA1 single nucleotide polymorphisms. Various single-locus frequency distribution differences between cases and controls were detected in different ethnic groups: the promoter -14C>T in Indians, exon 18 M883I in Malays, and 3'-untranslated (UTR) region 8994A>G in Chinese. For the Malay population, certain haplotypes carrying the I825- A (exon 17) and M883- G alleles were more frequent among cases than controls, whereas the converse was true for the alternative configuration of V825- G and I883- A, and this association was reinforced in multi-locus disequilibrium analysis that utilized genotypic data. In the healthy controls, associations were found for -14C>T genotypes with HDL-C in Chinese; 237indelG (5'UTR) with apolipoprotein A1 (apoA1) in Malays and total cholesterol (TC) in Indians; M883I with lipoprotein(a) [Lp(a)] in Malays and apolipoprotein B (apoB) in Chinese; and 8994A>G with Lp(a) in Malays, and TC, low-density lipoprotein-cholesterol (LDL-C) as well as apoB in Indians. While genotype-phenotype associations were not reproduced across populations and loci, V825I and M883I were clearly associated with CAD status in Malays with no effects on HDL-C or apoA1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 While genotype-phenotype associations were not reproduced across populations and loci, V825I and M883I were clearly associated with CAD status in Malays with no effects on HDL-C or apoA1. Login to comment
17 The ABCA1 SNPs studied were: -14C>T, located in the proximal promoter (Pullinger et al. 2000; Zwarts et al. 2002); 237indelG, an insertion/deletion of one G nucleotide in the 5'-untranslated region (UTR) (Pullinger et al. 2000; Zwarts et al. 2002); the missense SNPs, V825I in exon 17 (GTC→ATC) and M883I (ATG→ATA) in exon 18, both located upstream of the first nucleotide binding domain (Wang et al. 2000; Clee et al. 2001; Brousseau et al. 2001); and 8994A>G, a novel 3'UTR SNP discovered in the course of this study. Login to comment
20 The data from Malays showed a strong association of V825I and M883I with the CAD phenotype, especially when the two SNPs were considered simultaneously, and the association was not accompanied by changes in plasma HDL-C or apoA1 levels in the controls. Login to comment
24 The five SNPs and their alleles in this study were: -14C>T, 237indelG (2g, 3g alleles), V825I (GTC→ATC), M883I (ATG→ATA) (Pullinger et al. 2000; Wang et al. 2000; Clee et al. 2001; Brousseau et al. 2001; Zwarts et al. 2002), and 8994A>G, for which an association study is reported here for the first time. Login to comment
44 SNPs -14C>T, 237indelG, V825I and I883M were genotyped by restriction fragment length polymorphism (RFLP) assays. Login to comment
78 In Chinese and Malays, 108 Table 1 Genotyping methods Location SNP Forward primer, PCR size Genotyping reverse primer (bp)c Proximal promoter -14C>T 5'-CGGCTCCACGTGCTTTC-3', 177 BsmA1 5'-CCACTCACTCTCGTCCGCAATTAC-3' 2.5% agarose gel C: 177 bp T: 25, 144 bp Exon 2a 237indelG 5'-GCTGGATTAGCAGTCCTCATTG-3', 301, 302 Bsl1 5'UTR (2g/3g) 5'-CCCCAACTCAAAACCACAAAG-3' 10% polyacrylamide gel 2g: 148, 153 bp 3g: 93, 56, 153 bp Exon 17 V825I 5'-GGTAGCCCACCACTCCCCTAAAG-3', 525 DpnII 5'-ATCAGCTGCCTGTCCTTGGACTA-3' 2.5% agarose gel G: 62, 423, 40 bp A: 62, 241, 182, 40 bp Exon 18b M883I 5'-ATGATGCTGAGCTTGGCTCATAC-3', 171 BsmI 5'-AGGTCAACAGCACTTACTTTCTGG-3' 3% agarose gel A: 171 bp G: 150, 21 bp Exon 50 3'UTR 8994A>G 5'-ATGAGAGAACTATTGTTTGGG-3', 109 SSCP 5'-CTGAAGTCTTACACCTTTAGCG-3' 20% polyacrylamide + 5% glycerol native gel. Login to comment
82 There were strong ethnic contrasts in allele frequencies at V825I and M883I (Table 3). Login to comment
87 237indelG and V825I Comparisons of allele and genotype distributions at 237indelG and V825I loci did not indicate any association with CAD status in all three ethnic groups. Login to comment
104 Genomic distances separating the five SNPs are: -14C>T and 237indelG, 24 kb; 237indelG and V825I, 78 kb; V825I and M883I, 1.3 kb; and M883I and 8994A>G, 42 kb. Login to comment
105 With the exception of the pair V825I and M883I, the magnitude of LD was generally low (r2<0.06), although statistical significance was noted in some situations. Login to comment
106 Strong and statistical 110 Table 3 Genotype and allele frequency distributions of ABCA1 SNPs (n number of individuals, n.s. not significant) SNP Chinese males Malay males Indian males CAD Controls CAD Controls CAD Controls -14C>T CC 203 (41.4%) 90 (40.5%) 44 (40%) 52 (41.3%) 45 (28.3%) 78 (37%) CT 242 (49.4%) 107 (48.2%) 60 (54.5%) 68 (54%) 87 (54.7%) 117 (55.5%) TT 45 (9.2%) 25 (11.3%) 6 (5.5%) 6 (4.8%) 27 (17%) 16 (7.6%) n 490 222 110 126 159 211 HWE exact P 0.027 n.s. 0.003 0.001 n.s. 0.001 Frequency C 0.661 0.646 0.673 0.683 0.557* 0.647* 237indelG 2g2g 367 (71.1%) 181 (73%) 70 (61.9%) 126 (71.6%) 92 (57.5%) 115 (49.8%) 2g3g 133 (25.8%) 57 (23%) 40 (35.4%) 44 (25%) 51 (31.9%) 93 (40.3%) 3g3g 16 (3.1%) 10 (4%) 3 (2.7%) 6 (3.4%) 17 (10.6%) 23 (10%) n 516 248 113 176 160 231 HWE exact P n.s. n.s. n.s. n.s. n.s. n.s. Frequency 2g 0.840 0.845 0.796 0.841 0.734 0.699 V825I (GTC>ATC) GG 92 (31.3%) 34 (31.5%) 37 (48.1%) 62 (50.4%) 71 (85.5%) 97 (89%) GA 142 (48.3%) 58 (53.7%) 31 (40.3%) 52 (42.3%) 10 (12%) 12 (11%) AA 60 (20.4%) 16 (14.8%) 9 (11.7%) 9 (7.3%) 2 (2.4%) 0 (0%) n 294 108 77 123 83 109 HWE exact P n.s. n.s. n.s. n.s. n.s. n.s. Frequency G 0.554 0.583 0.682 0.715 0.916 0.945 M883I (ATG>ATA) GG 168 (46.2%) 97 (38.8%) 26 (26%) 22 (13.2%) 6 (3.9%) 3 (1.3%) GA 169 (46.4%) 134 (53.6%) 45 (45%) 87 (52.1%) 20 (13.2%) 34 (15.2%) AA 27 (7.4%) 19 (7.6%) 29 (29%) 58 (34.7%) 126 (82.9%) 186 (83.4%) n 364 250 100 167 152 223 HWE exact P n.s. 0.002 n.s. n.s. n.s. n.s. Frequency G 0.694 0.656 0.485* 0.392* 0.105 0.090 8994A>G AA 342 (66.4%) 193 (71%) 84 (75%) 130 (72.6%) 117 (70.5%) 162 (69.5%) AG 152 (29.5%) 75 (27.6%) 22 (19.6%) 39 (21.8%) 45 (27.1%) 66 (28.3%) GG 21 (4.1%) 4 (1.5%) 6 (5.4%) 10 (5.6%) 4 (2.4%) 5 (2.1%) n 515 272 112 179 166 233 HWE exact P n.s. n.s. n.s. n.s. n.s. n.s. Frequency A 0.812* 0.847* 0.848 0.835 0.840 0.837 *P<0.05, allele frequencies that are statistically different between cases and controls by Fisher`s exact test (one-sided) significant LD was detected between V825I and M883I in both Chinese and Indian case-control samples, as well as in Malay cases, but not in Malay controls (data not shown). Login to comment
118 All configurations that omitted both V825I and M883I, or included the former but not the latter, gave insignificant test results, whereas those that included both produced consistently significant outcomes. Login to comment
119 Furthermore there may be a stronger association with M883I compared with V825I because some haplotype configurations involving M883I, but not V825I, were sufficient to detect a positive association. Login to comment
120 Hence, based on the results of the haplotype analysis, both V825I and M883I were necessary to be strongly associated with the CAD phenotype in the Malay population, and studying the effect of either SNP alone, in particular V825I, might weaken the association. Login to comment
121 The reason is that V825I and M883I were not in perfect LD. Login to comment
127 In Malay cases, for all the eight locus combinations that involved both V825I and M883I, all of them tested positive for disequilibria, whereas in the corresponding controls, every locus combination remained in HWE (Table 6). Login to comment
133 Notably, the seven significant disequilibria (out of a possible eight) in the Chinese CAD group involved both V825I and I883M; however, two of these disequilibria were also found in the Chinese control group and therefore it was hard to deduce the effects of V825I and I883M on the CAD status in Chinese. Login to comment
146 V825I Significant trends in lipids between V825I genotypes were not observed in any population. Login to comment
151 Codes for loci: 1 -14C>T, 2 237indelG, 3 V825I, 4 M883I, 5 8994A>G. Login to comment
160 The case-control analysis in the Malay population revealed that V825I and M883I are potential markers for the CAD phenotype, but this positive association was not accompanied by changes in plasma HDL-C or apoA1 concentrations in Malay controls. Login to comment
167 In our study, several lines of evidence implicate V825I and M883I in CAD susceptibility for the Malay population. Login to comment
169 However, the case-control analysis for V825I did not detect a significant difference, a result that could partly be explained by the smaller number of individuals genotyped for V825I, in which case there would be a higher chance of making a false negative inference or type II error. Login to comment
170 Also, the LD between V825I and M883I might have partially dissipated. Login to comment
171 While single-locus frequency comparison was ambiguous in assigning an effect to V825I, analyses using multiple SNPs clearly indicate that both V825I and M883I were associated with CAD status in Malays. Login to comment
173 Specifically, V825I and M883I were in strong LD in Malay cases but not in Malay controls. Login to comment
178 The association of both V825I and M883I in CAD susceptibility in Malays was revealed definitively in haplotype frequency and multi-locus disequilibria tests. Login to comment
180 Based on these observations, it seems that 8994A>G is inconsequential to the CAD phenotype, while the effects of -14C>T and 237indelG are inconclusive; but there is an obvious association of V825I and M883I with CAD status. Moreover, multi-locus HWE tests showed that any combinations that involved both V825I and M883I were always in disequilibria in Malay cases but not in the corresponding controls, thus reinforcing the haplotype association result. Login to comment
181 Since V825I and M883I code for missense SNPs and are sited near the critical nucleotide-binding domain of the ABCA1 protein, these allelic variants may potentially modulate the biological function of the transporter. Login to comment
186 In any case, it may be premature at this stage to do a functional analysis of V825I and M883I. Login to comment
189 Although the data in Malay case-control samples indicated a combined association of V825I and M883I with the CAD phenotype, genotypes of either SNP did not show changes in HDL-C or apoA1 in the controls. Login to comment
192 Genotypes of V825I showed no association with any lipids in the Malay controls. Login to comment
197 Existing literature on the associations of V825I and M883I with CAD agree with our findings in the Malay case-control study. Login to comment
199 Among male CAD participants in a Dutch cohort prospective study, obvious differences in CAD event rate were also detected for V825I or M883I, again without any change in HDL-C (Clee et al. 2001). Login to comment
221 In summary, our data showed a strong association of V825I and M883I with CAD susceptibility that was specific to the Malay population. Login to comment

[hide] Genetics of HDL regulation in humans. Curr Opin Lipidol. 2003 Jun;14(3):273-9. Miller M, Rhyne J, Hamlette S, Birnbaum J, Rodriguez A
Genetics of HDL regulation in humans.
Curr Opin Lipidol. 2003 Jun;14(3):273-9., [PMID:12840658]

Abstract [show]
PURPOSE OF REVIEW: To review gene regulation of HDL-cholesterol and discuss molecular abnormalities in HDL candidate genes that may lead to human pathologic states. RECENT FINDINGS: The inverse association between HDL-cholesterol and vascular disease, especially coronary heart disease, has long been recognized, but understanding gene regulation of HDL in humans gained considerable momentum following the identification of ABCA1 as playing a pivotal role in reverse cholesterol transport. Recent data suggest that potentially important targets for upregulating HDL in humans include upregulators of ABCA1 and APOA1 (e.g. peroxisome proliferator activated receptor and liver X receptor agonists) and downregulators of CETP (e.g. JTT-705). A host of other nuclear receptors under investigation in animal models may advance to human testing in the near future. SUMMARY: Disorders affecting HDL metabolism are complex because monogenic disorders causing low HDL do not necessarily correlate with premature vascular disease. To date, pathologic phenotypes have only been deduced among several HDL candidate genes. Understanding the genetic underpinnings associated with variant HDL and reverse cholesterol transport provides an exceptional opportunity to identify novel agents that may optimize this process and reduce vascular event rates beyond currently available LDL lowering therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 TD 1591 T/C 11 V399A extracellular [68] TD 1979 (110bpAlu Ins) 12 truncated truncation [60] TD/FHA 2154 C/T 14 R587W extracellular [67,69] TD 2164 G/C 14 W590S extracellular [61] TD 2185 A/G 14 Q597R extracellular [59,67] TD 2219 G/del 14 truncated, 635X truncated [60,61] FHA 2472-2474 3bp del 15 Del L693 TM domain #3 [59] phosphorylation 2706 G/A 16 V771M extracellular [68] 2715 A/C 16 T774P extracellular [68] 2723 G/C 16 K776N extracellular [68] 2868 G/A 17 V825I TM domain #6 [67,68] TD/FHA 3044 A/G 18 I883M cytoplasmic [68] phosphorylat site FHA 3120 C/T 19 R909X truncation [63,71] TD 3181 C/T 19 T929I cytoplasmic [62] TD 3199 A/G 19 N935S Walker A [61] TD 3205 C/T 19 A937V Walker A [61] TD 3532 C/A 22 A1046D cytoplasmic, Walker A/B [70] FHA 3667 T/C 23 M1091T cytoplasmic [63] 3690 G/T 23 D1099Y cytoplasmic [9] TD 3738 2bp del 23 1145X truncation [66] FHA 3911 G/C 24 E1172D linker/cytoplasmic [68] FHA 4242 4bp del 27 1297X truncated [64] TD 4260 G/A 27 D1289N linker cytoplasm [64,65] TD 4824 T/C 31 C1477R extracellular [59] TD 4912 C/T 32 S1506L extracellular loop #2 [71] TD 5025 ins A 34 A1544S?1552X truncation [70] 5059 T/C 34 I1555T extracellular loop #2 [67] 5155 G/A 35 R1587K extracellular loop #2 [68] FHA 5226 A/G 36 N1611D extracellular loop #2 [75..] 5338 T/C 36 L1648P extracellular loop #2 [67] TD 5443 C/T 37 R1680W cytoplasmic [74.] Login to comment

[hide] Common genetic variation in ABCA1 is associated wi... Circulation. 2001 Mar 6;103(9):1198-205. Clee SM, Zwinderman AH, Engert JC, Zwarts KY, Molhuizen HO, Roomp K, Jukema JW, van Wijland M, van Dam M, Hudson TJ, Brooks-Wilson A, Genest J Jr, Kastelein JJ, Hayden MR
Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease.
Circulation. 2001 Mar 6;103(9):1198-205., [PMID:11238261]

Abstract [show]
BACKGROUND: Low plasma HDL cholesterol (HDL-C) is associated with an increased risk of coronary artery disease (CAD). We recently identified the ATP-binding cassette transporter 1 (ABCA1) as the major gene underlying the HDL deficiency associated with reduced cholesterol efflux. Mutations within the ABCA1 gene are associated with decreased HDL-C, increased triglycerides, and an increased risk of CAD. However, the extent to which common variation within this gene influences plasma lipid levels and CAD in the general population is unknown. METHODS AND RESULTS: We examined the phenotypic effects of single nucleotide polymorphisms in the coding region of ABCA1. The R219K variant has a carrier frequency of 46% in Europeans. Carriers have a reduced severity of CAD, decreased focal (minimum obstruction diameter 1.81+/-0.35 versus 1.73+/-0.35 mm in noncarriers, P:=0.001) and diffuse atherosclerosis (mean segment diameter 2.77+/-0.37 versus 2.70+/-0.37 mm, P:=0.005), and fewer coronary events (50% versus 59%, P:=0.02). Atherosclerosis progresses more slowly in carriers of R219K than in noncarriers. Carriers have decreased triglyceride levels (1.42+/-0.49 versus 1.84+/-0.77 mmol/L, P:=0.001) and a trend toward increased HDL-C (0.91+/-0.22 versus 0.88+/-0.20 mmol/L, P:=0.12). Other single nucleotide polymorphisms in the coding region had milder effects on plasma lipids and atherosclerosis. CONCLUSIONS: These data suggest that common variation in ABCA1 significantly influences plasma lipid levels and the severity of CAD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5Ј33Ј)* Reverse Oligo (5Ј33Ј)* Annealing Temperature, °C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
85 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587G† S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
111 Other ABCA1 cSNPs Influence Plasma Lipid Levels and Risk of CAD Carriers of the V825I cSNP (nϭ103 VI ϩ 4 II) had no obvious differences in lipid levels or baseline MSD or MOD (Table 6), but they did have a significantly increased number of events during the trial (44% versus 33% in noncarriers, Pϭ0.0008; odds ratio, 2.31; 95% CI, 1.41 to 3.83). Login to comment
145 If all V771M and K776N carriers are excluded, the results are unaltered, with increased MOD (1.80Ϯ0.35 versus 1.73Ϯ0.35 mm, Pϭ0.006) and MSD (2.76Ϯ0.36 versus 2.70Ϯ0.37 mm, Pϭ0.02) and lower mean TG levels (1.71Ϯ0.75 versus 1.84Ϯ0.77 mmol/L, Pϭ0.02) in carriers of R219K (nϭ329) compared with noncarriers (nϭ422). Login to comment
146 The I883M and R1587K cSNPs are also often seen in carriers of R219K. Login to comment
147 We identified R219K carriers who do not also carry either the I883M or R1587K genotype (nϭ62) and compared them with the group of individuals who do not carry any of the 3 variants (nϭ116). Login to comment
150 The V825I cSNP was found to be in linkage disequilibrium with I883M. Login to comment
151 The relative risk of the V825I carriers adjusted for I883M genotype was 2.31 (95% CI, 0.78 to 6.85). Login to comment
152 Because the effects of the I883M variant were only evident in homozygous carriers, the number of individuals was too few to correct for V825I genotype. Login to comment
156 No significant differences in lipid levels or CAD were observed for E1172D carriers compared with R1587K heterozygotes without E1172D. Login to comment
161 ABCA cSNPs in REGRESS MOD, mm MSD, mm HDL-C, mmol/L TG, mmol/L Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P V825I 1.74Ϯ0.37 (107) 1.77Ϯ0.35 (575) 0.39 2.70Ϯ0.38 2.75Ϯ0.38 0.21 0.91Ϯ0.23 0.93Ϯ0.22 0.42 1.86Ϯ0.84 1.80Ϯ0.76 0.49 I883M 1.74Ϯ0.38 (100) 1.75Ϯ0.36 (320) 0.71 2.69Ϯ0.38 2.73Ϯ0.36 0.41 0.91Ϯ0.22 0.91Ϯ0.21 0.97 1.75Ϯ0.77 1.82Ϯ0.75 0.42 R1587K 1.77Ϯ0.34 (346) 1.76Ϯ0.37 (433) 0.75 2.73Ϯ0.39 2.74Ϯ0.36 0.64 0.90Ϯ0.22 0.94Ϯ0.23 0.03 1.79Ϯ0.76 1.81Ϯ0.78 0.77 V399A 1.92Ϯ0.32 (9) 1.73Ϯ0.35 (540) 0.13 2.73Ϯ0.40 2.71Ϯ0.37 0.89 1.03Ϯ0.28 0.92Ϯ0.23 0.15 1.71Ϯ0.63 1.82Ϯ0.78 0.68 V771M 1.89Ϯ0.38 (37) 1.76Ϯ0.35 (598) 0.045 2.83Ϯ0.49 2.73Ϯ0.37 0.13 0.91Ϯ0.20 0.92Ϯ0.22 0.58 1.98Ϯ0.79 1.78Ϯ0.76 0.11 T774P 1.63Ϯ0.31 (4) 1.76Ϯ0.36 (621) 0.47 2.85Ϯ0.34 2.73Ϯ0.37 0.52 0.85Ϯ0.07 0.93Ϯ0.22 0.50 1.90Ϯ1.04 1.82Ϯ0.77 0.84 K776N 1.92Ϯ0.33 (3) 1.78Ϯ0.34 (546) 0.48 2.95Ϯ0.48 2.76Ϯ0.37 0.36 0.94Ϯ0.28 0.93Ϯ0.22 0.93 2.25Ϯ0.94 1.76Ϯ0.76 0.26 E117SD 1.80Ϯ0.39 (34) 1.77Ϯ0.36 (610) 0.67 2.78Ϯ0.35 2.74Ϯ0.37 0.42 0.93Ϯ0.23 0.94Ϯ0.23 0.89 1.80Ϯ0.90 1.77Ϯ0.76 0.80 Values are meanϮSD (n). Login to comment
43 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5b18;33b18;)* Reverse Oligo (5b18;33b18;)* Annealing Temperature, &#b0;C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
80 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587Gߤ S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
106 Other ABCA1 cSNPs Influence Plasma Lipid Levels and Risk of CAD Carriers of the V825I cSNP (nafd;103 VI af9; 4 II) had no obvious differences in lipid levels or baseline MSD or MOD (Table 6), but they did have a significantly increased number of events during the trial (44% versus 33% in noncarriers, Pafd;0.0008; odds ratio, 2.31; 95% CI, 1.41 to 3.83). Login to comment

[hide] High-density single-nucleotide polymorphism (SNP) ... J Hum Genet. 2001;46(9):522-8. Iida A, Saito S, Sekine A, Kitamura Y, Kondo K, Mishima C, Osawa S, Harigae S, Nakamura Y
High-density single-nucleotide polymorphism (SNP) map of the 150-kb region corresponding to the human ATP-binding cassette transporter A1 (ABCA1) gene.
J Hum Genet. 2001;46(9):522-8., [PMID:11558901]

Abstract [show]
Highly dense catalogs of human genetic variations, in combination with high-throughput genotyping technologies, are expected to clarify individual genetic differences in pharmacological responsiveness and predispositions to common diseases. Here we report single-nucleotide polymorphisms (SNPs) present among 48 Japanese individuals at the locus for the human ATP-binding cassette transporter A1 (ABCA1) gene. ABCA1 plays a key role in apolipoprotein-mediated cholesterol transport, and mutations in this gene are responsible for Tangier disease and familial high-density lipoprotein deficiency associated with reduced cholesterol efflux. We identified a total of 162 SNPs, 149 of which were novel, within the 150-kb region encompassing the entire ABCA1 gene. Eight of the SNPs lie within coding elements, two in 5' flanking regions, 147 in introns, and five in 3' untranslated regions, but none were found in 5' untranslated or 3' flanking regions. The ratio of transitions to transversions was approximately 2.37 to 1. Our dense SNP map of this region could serve as a powerful resource for studies of complex genetic diseases that may be associated with ABCA1 and of individual responses to drug therapy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Therefore, information concerning naturally occurring genetic variants in human transporter genes such as ABCA1 Fig.1.Single-nucleotidepolymorphism(SNP)mapspanningthe150-kbregioncontainingtheABCA1gene.Exonsarerepresentedbyopenrectanglesandintronsbyhorizontallines.SNPs areindicatedabovethelinesaccordingtonumber(correspondingtothenumbersinthefar-leftcolumnofTable1);thepositionsofeightinsertion-deletionpolymorphismsareindicatedbelow thelines(seeTable2).Microsatellitesequencesarealsoshown Table 1. Characterization of 162 single-nucleotide polymorphisms (SNPs) within the ABCA1 locus Repetitive Identity Number Location Exon SNP (5Ј to 3Ј) Substituion sequence to dbSNP Reference 1 -278 G Ͼ C 5Ј flanking region gggcccgggcgggggaaggg G/C acgcagaccgcggaccctaa rs1800976 2 -99 G Ͼ C 5Ј flanking region acataaacagaggccgggaa G/C ggggcggggaggagggagag 3 159 G Ͼ T intron 1 gcggtgttaaatggggagac G/T atgtcctagtacgagctctg 4 506 G Ͼ C intron 1 gaattggctatatgctcccc G/C ggactggagcggcacagtcc 5 5897 T Ͼ G intron 1 gtacaaaaccctttagcttt T/G gcaaacctcctttaagaccc 6 5929 C Ͼ T intron 1 ttaagacccgatttaaatgc C/T tccctcctcatgaagctctt 7 5962 T Ͼ C intron 1 aagctcttctggatccactc T/C ttcccatcactaagttgaaa 8 5985 A Ͼ C intron 1 cccatcactaagttgaaagt A/C agatccccttctctttactt 9 11416 G Ͼ A intron 1 ttacagtgccctttatagga G/A agaaagaagaaattgtgtct 10 11935 G Ͼ A intron 1 tctctgtggagcaaatagag G/A gctgtctgacacttggttcc 11 12281 T Ͼ A intron 1 gaatgtttgatttgtgaaaa T/A cttaataacagtagtttttt 12 12924 T Ͼ C intron 1 gtgctgacaatcttatactc T/C aggttgaacctccggggaag 13 13002 C Ͼ G intron 1 gagcctcaatcacagattct C/G tctagctcacatgaagttaa 14 17715 C Ͼ T intron 1 ggagcatgactttgtggaag C/T ctctcctcttccacccagag 15 17848 T Ͼ C intron 1 gagggctgactgtcaccctt T/C gataggagcccagcactaaa 16 21384 G Ͼ C intron 1 gtgggtgggaggaattggag G/C aggaagcttgcctaagtgtg 17 22145 C Ͼ G intron 1 gtagcttctaaatcaacgaa C/G tgattcctggagagcagctt rs1340361 18 23063 G Ͼ A intron 1 ggaggcacctgtgacaccca G/A cggagtaggggggcggtgtg 19 23131 G Ͼ A intron 1 agtgtgcatatgtgctgacc G/A tgggagcttgtttgtcggtt 20 156 T Ͼ C intron 2 ggacacaggactgtgtggtc T/C ggatatggcatgtggcttat rs1078143 21 384 A Ͼ G intron 2 gctgtgggtgaagtgagtta A/G tggccccactcttagagatc rs1078144 22 1081 G Ͼ A intron 2 agtgcagccaaaattgcaaa G/A tcataccattcaaattaata rs752187 23 2801 A Ͼ G intron 2 aagaaaagtgatttatttca A/G gttgctgatgcttagattgt 24 2830 C Ͼ G intron 2 tgcttagattgttagagttg C/G aaagatctggcttgcatctt 25 2856 A Ͼ G intron 2 tctggcttgcatcttgtaca A/G ctgacagaactggggctcag 26 3187 A Ͼ G intron 2 tgatagctgttgcctgcagc A/G tacggacgttcattgcgcag 27 3190 C Ͼ T intron 2 tagctgttgcctgcagcata C/T ggacgttcattgcgcagttc 28 3194 C Ͼ T intron 2 tgttgcctgcagcatacgga C/T gttcattgcgcagttcctgt 29 3204 G Ͼ A intron 2 agcatacggacgttcattgc G/A cagttcctgtctcctgagat 30 3401 T Ͼ C intron 2 acataaagcctgtgtgctgc T/C gccaggaagactagaaacgc 31 13927 A Ͼ G intron 2 gtcaccacatacctggcact A/G tgctaaggctgggaatgcag L2 32 4163 G Ͼ A intron 3 ccagcccacttcatcttacc G/A tagttacctccttagagtat 33 4262 T Ͼ C intron 3 tgtcaaagaggaactaagga T/C gccagggactttctgcttag 34 4306 C Ͼ T intron 3 ccctctcatcacttctccaa C/T gctggtatcatgaaccccat 35 240 G Ͼ A intron 5 gacagaagaaaagtccccag G/A gaagaatactacagacttgg rs1107281 36 490 G Ͼ A intron 5 gatgggcatttgaacttgtt G/A tctttaaaaagtgaaatctt 37 583 T Ͼ G intron 5 tatctggggagtgggcattt T/G ctgactgaggcattggctgc 38 1051 C Ͼ T inton 5 ggctacaaaactgtgctttc C/T ttgggcagtaaaagaggcaa 39 3051 G Ͼ A intron 5 tagagaacaagtctaattct G/A ttttccttgaaatagtcgaa 40 3127 A Ͼ G intron 5 aagtccatgattttttaggc A/G aaatggcctcctttcctctt 41 5924 C Ͼ T intron 5 ctttctttcacaaaattgcc C/T cccagagctttctggaaggg 42 6831 T Ͼ C intron 5 ccagtccctcagccttgcca T/C tgcttatgctggtctggaaa 43 12678 G Ͼ C intron 5 gctcaccgctctgctcaccc G/C accctctggccatctcctct 44 14214 G Ͼ A intron 5 cagcttggtcccagaggcct G/A gacctgggtcccagaggtcc 45 14257 C Ͼ T intron 5 gctggttccccggcttggtc C/T cagaggcctggatgtgtggc 46 18078 C Ͼ T intron 5 cctaccacaccatgcacgtg C/T acagccaagggttgttgact 47 18795 G Ͼ A intron 5 ctgggctcttcctggacctg G/A ccagctaaaaggaaatctcc 48 18948 G Ͼ A intron 5 gcattggtggtactaagaac G/A catattccctatcctatagg L2 49 19053 T Ͼ C intron 5 ctcccccaacattaaaagtg T/C aagggatgcttattcaaatg MER5A 50 19148 C Ͼ A intron 5 ggcccaagaaactgcatttt C/A gcatgctccctaaatgaagc MER5A 51 19229 C Ͼ T intron 5 atgctaacagtgtagagtca C/T atgtgatgggaagcatcagg 52 19405 T Ͼ C intron 5 cttgctcaatttattctgtc T/C atataactcaatattactga 53 19534 G Ͼ A intron 5 catgtgaccctcttagctcc G/A cggattaactcctgtcctca 54 474 G Ͼ A coding region 6 gaaaccttctctgggttcct G/A tatcacaacctctctctccc Leu 158 Leu 55 210 A Ͼ C intron 6 gcaacctggcgtcatgggcc A/C gctggttaaaataaaattga 56 334 G Ͼ A intron 6 acagttctgaggcaataacc G/A tggttaagggttattgatct 57 2288 C Ͼ T intron 6 cttctttcaaagcttgtggt C/T cactggaccacgtatgaagt 58 2322 T Ͼ C intron 6 atgaagtagaatagtttagg T/C ccagaaaggcaattaagtaa 59 2820 T Ͼ G intron 6 gtgctttgatacattctgag T/G ttcagtaaagagacctgatg 60 656 G Ͼ A coding region 7 tgagctttgtggcctaccaa G/A ggagaaactggctgcagcag Arg 219 Lys Clee et al. 2001 61 416 G Ͼ A intron 7 catcataaagatgacattgt G/A ggctgtcacagttggaaggc 62 471 C Ͼ T intron 7 agaccacactatttagctta C/T ttagtaataacattgcaaag 63 504 G Ͼ A intron 7 ttgcaaagaaaaattccgac G/A aagttttttcagcctaggaa 64 679 G Ͼ C intron 7 gctctggtgaaattcctctc G/C ctaccccaaacatcatcatt 65 1740 C Ͼ T intron 7 acaaatgctcaccctttcag C/T tggaatgattgaaattttgg 66 2122 A Ͼ G intron 7 tgattaaggtggctactacc A/G ggtgctttctgcatatctcg 67 7753 T Ͼ C intrion 7 taggaattccaagctgtgaa T/C tttttactgaagctctttgg 68 8973 A Ͼ T intron 7 atggaaatttgtttatattg A/T ctacagattgccaatattat 69 8976 A Ͼ G intron 7 gaaatttgtttatattgact A/G cagattgccaatattattag Table 1. Continued Repetitive Identity Number Location Exon SNP (5Ј to 3Ј) Substituion sequence to dbSNP Reference 70 11327 G Ͼ C intron 7 ctaacaatcttatttccatt G/C agtccttataaaagaagtgg 71 11738 C Ͼ T intron 7 ctgacgtttaagggagaccg C/T gtaggtccctttgaggactg 72 12295 T Ͼ A intron 7 agtctgtaaattattgttct T/A ttttttctttagcttatgct 73 387 C Ͼ G intron 8 tagcaaggccaatcatttta C/G caacacacatgcttgctaac 74 697 A Ͼ T intron 8 ggaactgtctggtgtccccc A/T gcataggaagctgagccagg 75 1312 G Ͼ A intron 8 attgctctgcagatcccctc G/A cagccctctgtcccttgttc rs1175929 76 3036 T Ͼ G intron 8 ctttatgtgggaagaaattt T/G tttttttgattggggagtgg 77 3176 C Ͼ A intron 8 aaatggcctggttctctgtc C/A cctttctgtctgtatgcctc 78 3364 A Ͼ T intron 8 ggcagaaggcaaagcttagg A/T cctagagagtgctggaccac 79 3373 G Ͼ A intron 8 caaagcttaggacctagaga G/A tgctggaccacgccactcac 80 3561 C Ͼ A intron 8 cagggatttattaatgattt C/A ttgtgaaatgtttggaaata 81 3654 T Ͼ C intron 8 agtgccggaatacatttgca T/C gtaagacagaacgctgcctg 82 4715 C Ͼ T intron 8 ggcagaggggtctcagaatc C/T gcatttccaacaatgtctcc 83 936 C Ͼ T coding region 9 cgtattgtctgcgggcatcc C/T gagggaggggggctgaagat Pro 312 Pro 84 2309 A Ͼ G intron 9 cccctcaagagtcagtttaa A/G tgttggtcatgttagttgtc 85 2392 T Ͼ C intron 9 atgggagggcttgtgcttca T/C gaaaacatttttccagatca 86 228 A Ͼ G intron 10 tggggatggggaggactggc A/G cagggctgctgtgatggggt 87 319 C Ͼ T intron 10 ttctgcggtccctggctccc C/T acctgactccaggtgaacaa 88 377 A Ͼ C intron 11 gaaagaagtgtgggagcaaa A/C gcatgatgttacatgtagac 89 521 G Ͼ A intron 11 agtgctctagagacaattgg G/A ttcaaatgtggagcaggctg 90 2850 G Ͼ C intron 11 ctctatacaatcattatgct G/C ccattgaaataataaataca 91 2976 A Ͼ G intron 11 ctccaattcggtagaaccag A/G gcttcatcttctctgtcgaa 92 3056 C Ͼ T intron 11 gtttgcagctgctgtttttc C/T ggcagcacatctgtgcaggc 93 340 T Ͼ C intron 12 ggcattatttgtgaaactta T/C ctaaaatcgaattcgggtcc 94 381 A Ͼ G intron 12 aattaaatttttgaaatttt A/G tattaaaaattatattagta 95 1728 C Ͼ T intron 14 caggctcagaggccttggcc C/T atcaccctggctcacgtgtg 96 2040 C Ͼ A coding region 15 atgggcctggacaacagcat C/A ctctggtttagctggttcat Ile 680 Ile 97 1382 G Ͼ A intron 15 cttttagacagaaaagttac G/A tgggatattatctcccacag 98 1453 G Ͼ A intron 15 tatataaggagaaaccagtt G/A aaattacctattgaagaaac 99 1567 G Ͼ A intron 15 ttctgcgtagttttgggtaa G/A tcacttatcttctttaggat MIR 100 1617 T Ͼ A intron 15 cagttgcctcatcagaaaga T/A gaacagcattacgcctctgc MIR 101 95 T Ͼ A intron 16 agttgagaacagaagatgat T/A gtcttttccaatgggacatg 102 452 G Ͼ A intron 16 tggtgttttgcttgagtaat G/A ttttctgaactaagcacaac 103 657 T Ͼ C intron 16 ctgttgcctcagtctgggct T/C cataggcatcagcagcccca 104 2473 G Ͼ A coding region 17 gcttcaatctcaccacttcg G/A tctccatgatgctgtttgac Val 825 Ile Clee et al. 2001 105 2649 A Ͼ G coding region 18 ggttccaaccagaagagaat A/G tcagaaagtaagtgctgttg Ile 883 Met Clee et al. 2001 106 1730 C Ͼ G intron 18 tgaaagttcaagcgcagtgc C/G ctgtgtccttacactccact 107 426 A Ͼ G intron 19 aggaccttacagtgggtagt A/G tcaggaggggtcaggggctg 108 468 A Ͼ G intron 19 aaagcaccagcgttagcctc A/G gtggcttccagcacgattcc 109 876 C Ͼ T intron 20 ccctcctcatctaaagtgaa C/T acatggggctcatgtgcagg 110 118 T Ͼ G intron 22 catgggatactcttctgtta T/G cacagaagagataaagggca 111 560 G Ͼ A intron 22 aaagctttgccattctaggg G/A tcatagccatacagggtgaa 112 102 A Ͼ G intron 23 accccttttgccatgttgaa A/G ccaccatctccctgctctgt 113 287 C Ͼ T intron 23 gtcaaagaaaagagacttgt C/T aagaggtaagagccttggct 114 1063 G Ͼ A intron 23 acctttcaccctcaggaagc G/A aggctgttcacacggcacac 115 321 T Ͼ G intron 25 ctctttacttaagtacagtg T/G gaggaacagcggcatcagga MER5A 116 376 G Ͼ C intron 25 gttagaaattcagcaacttg G/C gcccagctcagacctactga MER5A 117 478 C Ͼ T intron 25 catacataggaaatgacaaa C/T gtttatggatggatagtcta 118 579 G Ͼ T intron 25 tcatttaattctcaaaaaaa G/T atgaaaaaatgaacactcag 119 153 C Ͼ T intron 27 aatggtaaaagccacttgtt C/T tttgcagcatcgtgcatgtg 120 1058 C Ͼ T intron 28 actatcatgggagataatga C/T tatggttgtccatgattgga 121 1317 C Ͼ T intron 28 caggacccagtgttctgagt C/T accctgaatgtgagcactat 122 372 T Ͼ C intron 30 tatatgatttttaggttttg T/C ttatcagcttcttcgctttt 123 506 A Ͼ G intron 30 ccttttaaaaagtaagcagt A/G gataaataaattcagtgaag 124 1033 G Ͼ C intron 30 ctggatttcatggtgccttt G/C attttccacatgaaggttgt 125 4281 G Ͼ A coding region 31 tcttccctttgcagagacac G/A ccctgccaggcaggggagga Thr 1427 Thr 126 626 C Ͼ T intron 33 ggctccttgttactgatttc C/T gtcttttctctctgcctttt 127 719 G Ͼ A intron 33 taatagccctcatgctagaa G/A ggagccggagcctgtgtata 128 726 G Ͼ A intron 33 cctcatgctagaagggagcc G/A gagcctgtgtataaggccag 129 889 A Ͼ G intron 33 ctttcctcaatgtctcagct A/G tctaactgtgtgtgtaatca 130 1097 G Ͼ C intron 33 ctgtgcaccccactgtctgg G/C ttttaatgtcaggctgttct 131 4760 G Ͼ A coding region 35 tatgacaggactggacacca G/A aaataatgtcaaggtaaacc Arg 1587 Lys Clee et al. 2001 132 234 T Ͼ C intron 35 aacctatctaaacctcagtt T/C cctcatctgtgaaatggaga MIR 133 411 C Ͼ T intron 37 aactctgtacattttatcag C/T agcttatccatccattgcaa 134 1224 A Ͼ G intron 37 caggcataggtgattcagag A/G tgaaaggtcaagtccctgaa L2 135 1720 G Ͼ T intron 37 aaattaaaattactctgact G/T ggaatccatcgttcagtaag 136 251 T Ͼ G intron 40 tgaaggtaaggaaaatagtg T/G tatttgcttggatccactgg 137 252 T Ͼ C intron 40 gaaggtaaggaaaatagtgt T/C atttgcttggatccactggc 138 319 A Ͼ G intron 40 agcactggaaaagtcaaacc A/G taactttgagaattaggtga Table 2. Characterization of insertion/deletion polymorphisms at the ABCA1 locus Number Location Variations (5Ј to 3Ј) 1 (-1033)-(-1032) ins AT 5Ј flanking region tgacttaaatatttagacat (AT/ϩ) ggtgtgtaggcctgcattcc 2 6368 del C intron 5 ttctgatggggttgttgctg (C/-) tgagaatcatgactgggtgg 3 9709 del T intron 5 cattttctgtctgaaccccc (T/-) cacccattcaggcagctgct 4 13816 del T intron 5 tccctacttctccttttttt (T/-) catttgcctcctccacccac 5 270-271 ins G intron 10 cttttcagggaggagccaaa (G/ϩ) cgctcattgtctgtgcttct 6 611-612 ins C intron 20 tttagcccatcctctccccc (C/ϩ) gccaccctccttattgaggc 7 391-392 ins T intron 32 gagtgccttgggtactctct (T/ϩ) gatgggggactccatgataa 8 847 del C intron 37 gctgtatattgtgaatgtcc (C/-) gttttcaaaagcaaagccaa Nucleotide numbering is according to the mutation nomenclature (den Dunnen and Antonarakis, 2000) (ϩ), insertion polymorphism; (-), deletion polymorphism Table 1. Continued Repetitive Identity Number Location Exon SNP (5Ј to 3Ј) Substituion sequence to dbSNP Reference 139 957 G Ͼ C intron 40 cttgttactcttttttcctt G/C tcatgggtgatagccatttg 140 146 C Ͼ T intron 41 tgatgtgggcatcccgcagc C/T ccctccctgcccatcctgga 141 239 A Ͼ C intron 42 cattggttttatatgcttac A/C tttatgtgttagttattaaa 142 321 T Ͼ A intron 42 aataaatggttgattttgag T/A ttgagtttcatagtccaaaa 143 322 T Ͼ C intron 42 ataaatggttgattttgagt T/C tgagtttcatagtccaaaaa 144 533 G Ͼ A intron 42 agatgaaaaattatgtagat G/A ataatgaatgatacggttct 145 546 A Ͼ G intron 42 tgtagatgataatgaatgat A/G cggttctaaaaagacaggtt 146 739 T Ͼ A intron 43 tacagccacacttaaaatgg T/A cccattatgaaatacatatt 147 18 T Ͼ C intron 44 taggtgagaaaagaagtggc T/C tgtattttgctgcaaagact 148 264 T Ͼ C intron 44 acaatataatttgcttgttt T/C ttaagagtataatttagtga L1MB8 149 279 T Ͼ C intron 44 tgttttttaagagtataatt T/C agtgatttttggtaaattga L1MB8 150 508 C Ͼ T intron 44 tttacattgctacataaaat C/T cccctatgtacatgtaccta 151 1477 A Ͼ T intron 44 gatctcctctcctgtctctt A/T catttttgcagtagcaatgt 152 1665 G Ͼ A intron 44 tggttgtaagaactgatttg G/A ttggtatagctgtgagggcc 153 1956 T Ͼ G intron 44 gtgttgctcacactcaaaat T/G tctgggccttctcatttggt 154 68 T Ͼ C intron 45 aatatataccttatggcttt T/C ccacacgcattgacttcagg 155 608 G Ͼ C intron 46 ttatactgacttcaatagag G/C tttcagacaaaaagttgttt 156 336 T Ͼ C intron 47 ttcacaattgtaaacaccac T/C acactgaacagcatcatccc L1MD2 157 55 G Ͼ C intron 49 agggtgtggattcctgcccc G/C acactcccgcccataggtcc rs1331924 158 7479 C Ͼ T 3Ј untranslated region 50 aacaaaaatgtgggtgtctc C/T aggcacgggaaacttggttc 159 8226 C Ͼ T 3Ј untranslated region 50 aggagcccactgtaacaata C/T tgggcagccttttttttttt 160 8682 G Ͼ A 3Ј untranslated region 50 aacttcttccactttttcca G/A aatttgaatattaacgctaa rs363717 161 8697 C Ͼ T 3Ј untranslated region 50 ttccagaatttgaatattaa C/T gctaaaggtgtaagacttca 162 9097 A Ͼ G 3Ј untranslated region 50 aactattttgaagaaaacac A/G acattttaatacagattgaa Nucleotide numbering is according to the mutation nomenclature (den Dunnen and Antonarakis, 2000) is an important resource for understanding not only the etiology and risk of some diseases, but also the pharmacokinetics or pharmacodyamics of drugs used to treat them. Login to comment
19 Microsatellite sequences are also shown Table 1. Characterization of 162 single-nucleotide polymorphisms (SNPs) within the ABCA1 locus Repetitive Identity Number Location Exon SNP (5b18; to 3b18;) Substituion sequence to dbSNP Reference 1 afa;278 G b0e; C 5b18; flanking region gggcccgggcgggggaaggg G/C acgcagaccgcggaccctaa rs1800976 2 afa;99 G b0e; C 5b18; flanking region acataaacagaggccgggaa G/C ggggcggggaggagggagag 3 159 G b0e; T intron 1 gcggtgttaaatggggagac G/T atgtcctagtacgagctctg 4 506 G b0e; C intron 1 gaattggctatatgctcccc G/C ggactggagcggcacagtcc 5 5897 T b0e; G intron 1 gtacaaaaccctttagcttt T/G gcaaacctcctttaagaccc 6 5929 C b0e; T intron 1 ttaagacccgatttaaatgc C/T tccctcctcatgaagctctt 7 5962 T b0e; C intron 1 aagctcttctggatccactc T/C ttcccatcactaagttgaaa 8 5985 A b0e; C intron 1 cccatcactaagttgaaagt A/C agatccccttctctttactt 9 11416 G b0e; A intron 1 ttacagtgccctttatagga G/A agaaagaagaaattgtgtct 10 11935 G b0e; A intron 1 tctctgtggagcaaatagag G/A gctgtctgacacttggttcc 11 12281 T b0e; A intron 1 gaatgtttgatttgtgaaaa T/A cttaataacagtagtttttt 12 12924 T b0e; C intron 1 gtgctgacaatcttatactc T/C aggttgaacctccggggaag 13 13002 C b0e; G intron 1 gagcctcaatcacagattct C/G tctagctcacatgaagttaa 14 17715 C b0e; T intron 1 ggagcatgactttgtggaag C/T ctctcctcttccacccagag 15 17848 T b0e; C intron 1 gagggctgactgtcaccctt T/C gataggagcccagcactaaa 16 21384 G b0e; C intron 1 gtgggtgggaggaattggag G/C aggaagcttgcctaagtgtg 17 22145 C b0e; G intron 1 gtagcttctaaatcaacgaa C/G tgattcctggagagcagctt rs1340361 18 23063 G b0e; A intron 1 ggaggcacctgtgacaccca G/A cggagtaggggggcggtgtg 19 23131 G b0e; A intron 1 agtgtgcatatgtgctgacc G/A tgggagcttgtttgtcggtt 20 156 T b0e; C intron 2 ggacacaggactgtgtggtc T/C ggatatggcatgtggcttat rs1078143 21 384 A b0e; G intron 2 gctgtgggtgaagtgagtta A/G tggccccactcttagagatc rs1078144 22 1081 G b0e; A intron 2 agtgcagccaaaattgcaaa G/A tcataccattcaaattaata rs752187 23 2801 A b0e; G intron 2 aagaaaagtgatttatttca A/G gttgctgatgcttagattgt 24 2830 C b0e; G intron 2 tgcttagattgttagagttg C/G aaagatctggcttgcatctt 25 2856 A b0e; G intron 2 tctggcttgcatcttgtaca A/G ctgacagaactggggctcag 26 3187 A b0e; G intron 2 tgatagctgttgcctgcagc A/G tacggacgttcattgcgcag 27 3190 C b0e; T intron 2 tagctgttgcctgcagcata C/T ggacgttcattgcgcagttc 28 3194 C b0e; T intron 2 tgttgcctgcagcatacgga C/T gttcattgcgcagttcctgt 29 3204 G b0e; A intron 2 agcatacggacgttcattgc G/A cagttcctgtctcctgagat 30 3401 T b0e; C intron 2 acataaagcctgtgtgctgc T/C gccaggaagactagaaacgc 31 13927 A b0e; G intron 2 gtcaccacatacctggcact A/G tgctaaggctgggaatgcag L2 32 4163 G b0e; A intron 3 ccagcccacttcatcttacc G/A tagttacctccttagagtat 33 4262 T b0e; C intron 3 tgtcaaagaggaactaagga T/C gccagggactttctgcttag 34 4306 C b0e; T intron 3 ccctctcatcacttctccaa C/T gctggtatcatgaaccccat 35 240 G b0e; A intron 5 gacagaagaaaagtccccag G/A gaagaatactacagacttgg rs1107281 36 490 G b0e; A intron 5 gatgggcatttgaacttgtt G/A tctttaaaaagtgaaatctt 37 583 T b0e; G intron 5 tatctggggagtgggcattt T/G ctgactgaggcattggctgc 38 1051 C b0e; T inton 5 ggctacaaaactgtgctttc C/T ttgggcagtaaaagaggcaa 39 3051 G b0e; A intron 5 tagagaacaagtctaattct G/A ttttccttgaaatagtcgaa 40 3127 A b0e; G intron 5 aagtccatgattttttaggc A/G aaatggcctcctttcctctt 41 5924 C b0e; T intron 5 ctttctttcacaaaattgcc C/T cccagagctttctggaaggg 42 6831 T b0e; C intron 5 ccagtccctcagccttgcca T/C tgcttatgctggtctggaaa 43 12678 G b0e; C intron 5 gctcaccgctctgctcaccc G/C accctctggccatctcctct 44 14214 G b0e; A intron 5 cagcttggtcccagaggcct G/A gacctgggtcccagaggtcc 45 14257 C b0e; T intron 5 gctggttccccggcttggtc C/T cagaggcctggatgtgtggc 46 18078 C b0e; T intron 5 cctaccacaccatgcacgtg C/T acagccaagggttgttgact 47 18795 G b0e; A intron 5 ctgggctcttcctggacctg G/A ccagctaaaaggaaatctcc 48 18948 G b0e; A intron 5 gcattggtggtactaagaac G/A catattccctatcctatagg L2 49 19053 T b0e; C intron 5 ctcccccaacattaaaagtg T/C aagggatgcttattcaaatg MER5A 50 19148 C b0e; A intron 5 ggcccaagaaactgcatttt C/A gcatgctccctaaatgaagc MER5A 51 19229 C b0e; T intron 5 atgctaacagtgtagagtca C/T atgtgatgggaagcatcagg 52 19405 T b0e; C intron 5 cttgctcaatttattctgtc T/C atataactcaatattactga 53 19534 G b0e; A intron 5 catgtgaccctcttagctcc G/A cggattaactcctgtcctca 54 474 G b0e; A coding region 6 gaaaccttctctgggttcct G/A tatcacaacctctctctccc Leu 158 Leu 55 210 A b0e; C intron 6 gcaacctggcgtcatgggcc A/C gctggttaaaataaaattga 56 334 G b0e; A intron 6 acagttctgaggcaataacc G/A tggttaagggttattgatct 57 2288 C b0e; T intron 6 cttctttcaaagcttgtggt C/T cactggaccacgtatgaagt 58 2322 T b0e; C intron 6 atgaagtagaatagtttagg T/C ccagaaaggcaattaagtaa 59 2820 T b0e; G intron 6 gtgctttgatacattctgag T/G ttcagtaaagagacctgatg 60 656 G b0e; A coding region 7 tgagctttgtggcctaccaa G/A ggagaaactggctgcagcag Arg 219 Lys Clee et al. 2001 61 416 G b0e; A intron 7 catcataaagatgacattgt G/A ggctgtcacagttggaaggc 62 471 C b0e; T intron 7 agaccacactatttagctta C/T ttagtaataacattgcaaag 63 504 G b0e; A intron 7 ttgcaaagaaaaattccgac G/A aagttttttcagcctaggaa 64 679 G b0e; C intron 7 gctctggtgaaattcctctc G/C ctaccccaaacatcatcatt 65 1740 C b0e; T intron 7 acaaatgctcaccctttcag C/T tggaatgattgaaattttgg 66 2122 A b0e; G intron 7 tgattaaggtggctactacc A/G ggtgctttctgcatatctcg 67 7753 T b0e; C intrion 7 taggaattccaagctgtgaa T/C tttttactgaagctctttgg 68 8973 A b0e; T intron 7 atggaaatttgtttatattg A/T ctacagattgccaatattat 69 8976 A b0e; G intron 7 gaaatttgtttatattgact A/G cagattgccaatattattag Table 1. Continued Repetitive Identity Number Location Exon SNP (5b18; to 3b18;) Substituion sequence to dbSNP Reference 70 11327 G b0e; C intron 7 ctaacaatcttatttccatt G/C agtccttataaaagaagtgg 71 11738 C b0e; T intron 7 ctgacgtttaagggagaccg C/T gtaggtccctttgaggactg 72 12295 T b0e; A intron 7 agtctgtaaattattgttct T/A ttttttctttagcttatgct 73 387 C b0e; G intron 8 tagcaaggccaatcatttta C/G caacacacatgcttgctaac 74 697 A b0e; T intron 8 ggaactgtctggtgtccccc A/T gcataggaagctgagccagg 75 1312 G b0e; A intron 8 attgctctgcagatcccctc G/A cagccctctgtcccttgttc rs1175929 76 3036 T b0e; G intron 8 ctttatgtgggaagaaattt T/G tttttttgattggggagtgg 77 3176 C b0e; A intron 8 aaatggcctggttctctgtc C/A cctttctgtctgtatgcctc 78 3364 A b0e; T intron 8 ggcagaaggcaaagcttagg A/T cctagagagtgctggaccac 79 3373 G b0e; A intron 8 caaagcttaggacctagaga G/A tgctggaccacgccactcac 80 3561 C b0e; A intron 8 cagggatttattaatgattt C/A ttgtgaaatgtttggaaata 81 3654 T b0e; C intron 8 agtgccggaatacatttgca T/C gtaagacagaacgctgcctg 82 4715 C b0e; T intron 8 ggcagaggggtctcagaatc C/T gcatttccaacaatgtctcc 83 936 C b0e; T coding region 9 cgtattgtctgcgggcatcc C/T gagggaggggggctgaagat Pro 312 Pro 84 2309 A b0e; G intron 9 cccctcaagagtcagtttaa A/G tgttggtcatgttagttgtc 85 2392 T b0e; C intron 9 atgggagggcttgtgcttca T/C gaaaacatttttccagatca 86 228 A b0e; G intron 10 tggggatggggaggactggc A/G cagggctgctgtgatggggt 87 319 C b0e; T intron 10 ttctgcggtccctggctccc C/T acctgactccaggtgaacaa 88 377 A b0e; C intron 11 gaaagaagtgtgggagcaaa A/C gcatgatgttacatgtagac 89 521 G b0e; A intron 11 agtgctctagagacaattgg G/A ttcaaatgtggagcaggctg 90 2850 G b0e; C intron 11 ctctatacaatcattatgct G/C ccattgaaataataaataca 91 2976 A b0e; G intron 11 ctccaattcggtagaaccag A/G gcttcatcttctctgtcgaa 92 3056 C b0e; T intron 11 gtttgcagctgctgtttttc C/T ggcagcacatctgtgcaggc 93 340 T b0e; C intron 12 ggcattatttgtgaaactta T/C ctaaaatcgaattcgggtcc 94 381 A b0e; G intron 12 aattaaatttttgaaatttt A/G tattaaaaattatattagta 95 1728 C b0e; T intron 14 caggctcagaggccttggcc C/T atcaccctggctcacgtgtg 96 2040 C b0e; A coding region 15 atgggcctggacaacagcat C/A ctctggtttagctggttcat Ile 680 Ile 97 1382 G b0e; A intron 15 cttttagacagaaaagttac G/A tgggatattatctcccacag 98 1453 G b0e; A intron 15 tatataaggagaaaccagtt G/A aaattacctattgaagaaac 99 1567 G b0e; A intron 15 ttctgcgtagttttgggtaa G/A tcacttatcttctttaggat MIR 100 1617 T b0e; A intron 15 cagttgcctcatcagaaaga T/A gaacagcattacgcctctgc MIR 101 95 T b0e; A intron 16 agttgagaacagaagatgat T/A gtcttttccaatgggacatg 102 452 G b0e; A intron 16 tggtgttttgcttgagtaat G/A ttttctgaactaagcacaac 103 657 T b0e; C intron 16 ctgttgcctcagtctgggct T/C cataggcatcagcagcccca 104 2473 G b0e; A coding region 17 gcttcaatctcaccacttcg G/A tctccatgatgctgtttgac Val 825 Ile Clee et al. 2001 105 2649 A b0e; G coding region 18 ggttccaaccagaagagaat A/G tcagaaagtaagtgctgttg Ile 883 Met Clee et al. 2001 106 1730 C b0e; G intron 18 tgaaagttcaagcgcagtgc C/G ctgtgtccttacactccact 107 426 A b0e; G intron 19 aggaccttacagtgggtagt A/G tcaggaggggtcaggggctg 108 468 A b0e; G intron 19 aaagcaccagcgttagcctc A/G gtggcttccagcacgattcc 109 876 C b0e; T intron 20 ccctcctcatctaaagtgaa C/T acatggggctcatgtgcagg 110 118 T b0e; G intron 22 catgggatactcttctgtta T/G cacagaagagataaagggca 111 560 G b0e; A intron 22 aaagctttgccattctaggg G/A tcatagccatacagggtgaa 112 102 A b0e; G intron 23 accccttttgccatgttgaa A/G ccaccatctccctgctctgt 113 287 C b0e; T intron 23 gtcaaagaaaagagacttgt C/T aagaggtaagagccttggct 114 1063 G b0e; A intron 23 acctttcaccctcaggaagc G/A aggctgttcacacggcacac 115 321 T b0e; G intron 25 ctctttacttaagtacagtg T/G gaggaacagcggcatcagga MER5A 116 376 G b0e; C intron 25 gttagaaattcagcaacttg G/C gcccagctcagacctactga MER5A 117 478 C b0e; T intron 25 catacataggaaatgacaaa C/T gtttatggatggatagtcta 118 579 G b0e; T intron 25 tcatttaattctcaaaaaaa G/T atgaaaaaatgaacactcag 119 153 C b0e; T intron 27 aatggtaaaagccacttgtt C/T tttgcagcatcgtgcatgtg 120 1058 C b0e; T intron 28 actatcatgggagataatga C/T tatggttgtccatgattgga 121 1317 C b0e; T intron 28 caggacccagtgttctgagt C/T accctgaatgtgagcactat 122 372 T b0e; C intron 30 tatatgatttttaggttttg T/C ttatcagcttcttcgctttt 123 506 A b0e; G intron 30 ccttttaaaaagtaagcagt A/G gataaataaattcagtgaag 124 1033 G b0e; C intron 30 ctggatttcatggtgccttt G/C attttccacatgaaggttgt 125 4281 G b0e; A coding region 31 tcttccctttgcagagacac G/A ccctgccaggcaggggagga Thr 1427 Thr 126 626 C b0e; T intron 33 ggctccttgttactgatttc C/T gtcttttctctctgcctttt 127 719 G b0e; A intron 33 taatagccctcatgctagaa G/A ggagccggagcctgtgtata 128 726 G b0e; A intron 33 cctcatgctagaagggagcc G/A gagcctgtgtataaggccag 129 889 A b0e; G intron 33 ctttcctcaatgtctcagct A/G tctaactgtgtgtgtaatca 130 1097 G b0e; C intron 33 ctgtgcaccccactgtctgg G/C ttttaatgtcaggctgttct 131 4760 G b0e; A coding region 35 tatgacaggactggacacca G/A aaataatgtcaaggtaaacc Arg 1587 Lys Clee et al. 2001 132 234 T b0e; C intron 35 aacctatctaaacctcagtt T/C cctcatctgtgaaatggaga MIR 133 411 C b0e; T intron 37 aactctgtacattttatcag C/T agcttatccatccattgcaa 134 1224 A b0e; G intron 37 caggcataggtgattcagag A/G tgaaaggtcaagtccctgaa L2 135 1720 G b0e; T intron 37 aaattaaaattactctgact G/T ggaatccatcgttcagtaag 136 251 T b0e; G intron 40 tgaaggtaaggaaaatagtg T/G tatttgcttggatccactgg 137 252 T b0e; C intron 40 gaaggtaaggaaaatagtgt T/C atttgcttggatccactggc 138 319 A b0e; G intron 40 agcactggaaaagtcaaacc A/G taactttgagaattaggtga Table 2. Characterization of insertion/deletion polymorphisms at the ABCA1 locus Number Location Variations (5b18; to 3b18;) 1 (afa;1033)-(afa;1032) ins AT 5b18; flanking region tgacttaaatatttagacat (AT/af9;) ggtgtgtaggcctgcattcc 2 6368 del C intron 5 ttctgatggggttgttgctg (C/afa;) tgagaatcatgactgggtgg 3 9709 del T intron 5 cattttctgtctgaaccccc (T/afa;) cacccattcaggcagctgct 4 13816 del T intron 5 tccctacttctccttttttt (T/afa;) catttgcctcctccacccac 5 270-271 ins G intron 10 cttttcagggaggagccaaa (G/af9;) cgctcattgtctgtgcttct 6 611-612 ins C intron 20 tttagcccatcctctccccc (C/af9;) gccaccctccttattgaggc 7 391-392 ins T intron 32 gagtgccttgggtactctct (T/af9;) gatgggggactccatgataa 8 847 del C intron 37 gctgtatattgtgaatgtcc (C/afa;) gttttcaaaagcaaagccaa Nucleotide numbering is according to the mutation nomenclature (den Dunnen and Antonarakis, 2000) (af9;), insertion polymorphism; (afa;), deletion polymorphism Table 1. Continued Repetitive Identity Number Location Exon SNP (5b18; to 3b18;) Substituion sequence to dbSNP Reference 139 957 G b0e; C intron 40 cttgttactcttttttcctt G/C tcatgggtgatagccatttg 140 146 C b0e; T intron 41 tgatgtgggcatcccgcagc C/T ccctccctgcccatcctgga 141 239 A b0e; C intron 42 cattggttttatatgcttac A/C tttatgtgttagttattaaa 142 321 T b0e; A intron 42 aataaatggttgattttgag T/A ttgagtttcatagtccaaaa 143 322 T b0e; C intron 42 ataaatggttgattttgagt T/C tgagtttcatagtccaaaaa 144 533 G b0e; A intron 42 agatgaaaaattatgtagat G/A ataatgaatgatacggttct 145 546 A b0e; G intron 42 tgtagatgataatgaatgat A/G cggttctaaaaagacaggtt 146 739 T b0e; A intron 43 tacagccacacttaaaatgg T/A cccattatgaaatacatatt 147 18 T b0e; C intron 44 taggtgagaaaagaagtggc T/C tgtattttgctgcaaagact 148 264 T b0e; C intron 44 acaatataatttgcttgttt T/C ttaagagtataatttagtga L1MB8 149 279 T b0e; C intron 44 tgttttttaagagtataatt T/C agtgatttttggtaaattga L1MB8 150 508 C b0e; T intron 44 tttacattgctacataaaat C/T cccctatgtacatgtaccta 151 1477 A b0e; T intron 44 gatctcctctcctgtctctt A/T catttttgcagtagcaatgt 152 1665 G b0e; A intron 44 tggttgtaagaactgatttg G/A ttggtatagctgtgagggcc 153 1956 T b0e; G intron 44 gtgttgctcacactcaaaat T/G tctgggccttctcatttggt 154 68 T b0e; C intron 45 aatatataccttatggcttt T/C ccacacgcattgacttcagg 155 608 G b0e; C intron 46 ttatactgacttcaatagag G/C tttcagacaaaaagttgttt 156 336 T b0e; C intron 47 ttcacaattgtaaacaccac T/C acactgaacagcatcatccc L1MD2 157 55 G b0e; C intron 49 agggtgtggattcctgcccc G/C acactcccgcccataggtcc rs1331924 158 7479 C b0e; T 3b18; untranslated region 50 aacaaaaatgtgggtgtctc C/T aggcacgggaaacttggttc 159 8226 C b0e; T 3b18; untranslated region 50 aggagcccactgtaacaata C/T tgggcagccttttttttttt 160 8682 G b0e; A 3b18; untranslated region 50 aacttcttccactttttcca G/A aatttgaatattaacgctaa rs363717 161 8697 C b0e; T 3b18; untranslated region 50 ttccagaatttgaatattaa C/T gctaaaggtgtaagacttca 162 9097 A b0e; G 3b18; untranslated region 50 aactattttgaagaaaacac A/G acattttaatacagattgaa Nucleotide numbering is according to the mutation nomenclature (den Dunnen and Antonarakis, 2000) is an important resource for understanding not only the etiology and risk of some diseases, but also the pharmacokinetics or pharmacodyamics of drugs used to treat them. Login to comment

[hide] Is dyslipidemia sustained during remission of neph... Pol Arch Med Wewn. 2009 Jan-Feb;119(1-2):11-6. Ksiazek J, Ciechanowicz A, Wierzbicka A, Syczewska M, Grenda R
Is dyslipidemia sustained during remission of nephrotic syndrome genetically determined? Evaluation of genetic polymorphisms of proteins involved in lipoprotein metabolism in children and adolescents with nephrotic syndrome.
Pol Arch Med Wewn. 2009 Jan-Feb;119(1-2):11-6., [PMID:19341173]

Abstract [show]
INTRODUCTION: In same patients lipid profile disturbances persist during nephrotic syndrome remission. OBJECTIVES: The aim of the study was to evaluate the impact of the genetic polymorphisms of proteins involved in lipoprotein metabolism on persistent abnormal lipid profile in patients with nephrotic syndrome during remission. PATIENTS AND METHODS: 50 patients aged between 5.8 and 16.6 years (mean age 10.45 +/- 3.04) with nephrotic syndrome in remission of at least 8 weeks' duration, including 12 steroid-resistant and 38 steroid-dependent cases, participated in the study. We evalauated associations between lipid profile and genetic polymorphisms, V771M, V8251, and R1587K of the gene encoding the cassette ABCA1 (adenosine triphosphate binding cassette transporter A1) protein synthesis, a E3 polymorphism of the gene encoding the type upsilon of apolipoprotein E (apoE) synthesis and that of the gene encoding the cholesterol ester transfer protein (CETP) synthesis. RESULTS: Dyslipidemia was observed in 10/13 (76.9%) patients with V8251 polymorphism vs. 27/37 (73%) of non-carriers, and in 16/21 (76.2%) patients with R1587K polymorphism vs. 21/29 (72.4%) in the remaining subjects. V771M polymorphism was found only in 2 (4%) patients and one subject had abnormal lipid profile. In the presence of CETP gene polymorphism, hiperlipoproteinemia was detected in 22/31 (71%) vs. 15/19 (78.9%) in the remaining cases. The epsilon3epsilon3 apoE genotype (observed most commonly in the healthy population) was found in the majority (n=35; 70%) of patients. This genotype was also seen in most patients with abnormal serum lipid profile (in 26/37; 70.3%). Analysis of the whole population (ANOVA) did not show significant correlations between parameters of lipid profile and any of the polymorphisms studied. CONCLUSIONS: The study did not confirm associations between genetic polymorphisms of ABCA1 transporter, CETP and apoE and abnormal serum lipid profile during remission of nephrotic syndrome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
8 We evalauated associations between lipid profile and genetic polymorphisms, V771M, V825I, and R1587K of the gene encoding the cassette ABCA1 (adenosine triphosphate binding cassette transporter A1) protein synthesis, a b5;3 polymorphism of the gene encoding the type b5; of apolipoprotein E (apoE) synthesis and that of the gene encoding the cholesterol ester transfer protein (CETP) synthesis. Login to comment
9 Resultsߓ Dyslipidemia was observed in 10/13 (76.9%) patients with V825I polymorphism vs. 27/37 (73%) of nonߛcarriers, and in 16/21 (76.2%) patients with R1587K polymorphism vs. 21/29 (72.4%) in the remaining subjects. Login to comment
36 Some investigators have suggestߛ ed higher incidence of specific genotypes in paߛ tients with nephritic syndrome and endߛstage Table 1ߓ Characteristics of patients Patients Total Males Females Steroidߛresistant Number (n) % ߗ 50 100 35 70 15 30 12 24 Mean age (years) SD ߗ 10.45 ߗߗ 3.04 10.5 ߗ 3.13 10.35 ߗ 2.82 Duration of treatment (years) SD ߗߗ 7.09 ߗߗ 2.88 ߗ 6.88 ߗ 3.14 ߗ 7.55 ߗ 2.19 Histological diagnosis MCNS ߗ 21 14 ߗ 7 ߗ 1 MPGN ߗ 26 19 ߗ 7 ߗ 9 FSGS ߗߗ 3 ߗ 1 ߗ 2 ߗ 2 Abbreviations: FSGS - focal segmental glomerulosclerosis, MCNS - minimal change nephrotic syndrome, MPGN - mesangial proliferative glomerulonephritis, SD - standard deviation of the ABCA1 gene (V771M, V825I and R1587K), a polymorphism of the CETP gene and polymorߛ phisms of the apoE gene. Login to comment
39 Three single nuߛ cleotide variants of guanine (G) > adenine (A) transition of the ABCA1 gene such as V771M, V825I i R1587K that determine the HDLߛC plasma level were genotyped by the selfߛdevelߛ oped method, using the restriction enzyme Tail for determining polymorphism V771M, the reߛ striction enzyme MboI for polymorphism V825I and the restriction enzyme Bgl II for R1587K polymorphism. Login to comment
41 Transition G to A in posiߛ tion 2472 cDNA caused substitution of valine to isoleucine in position 825 of the polypepߛ tide chain of ABCA1 protein (polymorphism V825IߛG2472A). Login to comment
56 The results were assessed in comparison with normal reference values coming from the evaluߛ ation of the healthy Warszawa population aged between 6 and 20, published previously by inߛ vestigators from the Children`s Memorial Health Institute.14 In all subjects the following genetic polyߛ morphisms were evaluated: - three nonߛsynonߛ ymous single nucleotide polymorphisms variants Table 2ߓ Median values of lipid profile parameters in patients with dyslipidemia (nߙ=ߙ37) and normolipidemia (nߙ=ߙ13) during remission of nephrotic syndrome Parameter mg/dl nߙ=ߙ13 nߙ=ߙ37 pa TC (mg/dl) 175.8 232 <0.0001 HDLߛC (mg/dl) ߗ 55 ߗ 49 NS LDLߛC (mg/dl) 100.66 163.29 <0.0001 VLDLߛC (mg/dl) ߗ 14.2308 ߗ 21.6 0.0015 TG (mg/dl) ߗ 77.2222 156.25 0.00007 ApoB (g/dl) ߗߗ 0.8067 ߗߗ 1.22 0.000004 ApoA1 (g/dl) ߗߗ 1.52 ߗߗ 1.51 NS OxyߛLDL (mU/ml) 278.28 504.9 0.0022 GPX (u/gHb) ߗ 32.30 ߗ 30.71 0.0016 Lp(a) (mg/dl) ߗ 10.20 ߗ 15.62 0.0184 Albumin (g/l) ߗ 40.73 ߗ 37.52 0.0014 aߓ MannߛWhitney`s test Abbreviations: apoA1 - apolipoprotein A1, apoB - apolipoprotein B, GPX - glutathione peroxidase, HDLߛC - highߛdensity lipoprotein cholesterol, LDLߛC - lowߛdensity lipoprotein cholesterol, Lp (a) - lipoprotein (a), NS - not significant, oxyߛLDLߛC - oxidized LDLߛcholesterol, TC - total cholesterol, TG - triglycerides, VLDLߛC - very lowߛdensity lipoprotein cholesterol Table 3ߓ Number of patients with ABCA1 genetic polymorphisms Patients Polymorphic variants V771M V825I R1587K V825 Iߙ+ߙR1587K GA GA AA GA AA GAߛGA GAߛAA s - d. ns nߙ=ߙ38 2 ߗ 9 1 11 2 5 1 s - r. ns nߙ=ߙ12 - ߗ 3 - ߗ 6 2 2 1 Overall nߙ=ߙ50 2 (4%) 13 (26%) 21 (42%) 9 (18%) Abbreviations: AA, GA, GG - variants of polymorphism of ABCA1 gene, sߛd ns - steroidߛdependent nephrotic syndrome, sߛr ns - steroidߛresistant nephrotic syndrome, in TABLE 3. Login to comment
58 The V825I polymorphism of ABCA1 gene of GA variant was confirmed in 12 of 50 (24%) cases. Login to comment
59 The V825I polymorphism of AA variant was confirmed in 1/50 (2%) case with the low HDLߛC serum level. Login to comment
60 Overall, the V825I polyߛ morphism was demonstrated in 13 of 50 (26%) patients. Login to comment
65 The presence of 2 gene polymorphisms (V825I and R1587K) was detected in 9 of 50 (18%) patients. Login to comment
70 Among 13 subjects with confirmed V825I polyߛ morphisms, abnormal lipid profile was shown in the majority of cases (10; 76.9%). Login to comment
81 The number and distribution of specific gene polymorphisms of ABCA1 are presented Table 4ߓ Distribution of significant (compared to reference data) lipid abnormalities in subgroups of patients divided with regard to ABCA1 genetic polymorphisms Polymorphism Disturbances V771M nߙ=ߙ2 (4%) V825I nߙ=ߙ13 (26%) R1587K nߙ=ߙ21 (42%) V8251ߙ+ߙR1587K nߙ=ߙ9 (18%) GA nߙ=ߙ2 AA GA nߙ=ߙ12 AA nߙ=ߙ1 GA nߙ=ߙ17 AA nߙ=ߙ4 GAߛGA nߙ=ߙ7 GAߛAA nߙ=ߙ2 ࢏ TC - - 1 - 2 - 1 - ࢏ TCߙ+ߙ࢏ TG 1 - 2 - 3 1 2 2 ࢏TCߙ+ߙ࢏ TGߙ+ߙ࢑ HDLߛC - - 2 - 4 1 1 - ࢏TCߙ+ߙ࢑ HDLߛC - - 1 - - 1 - - ࢏ TGߙ+ߙ࢑ HDLߛC - - 1 - 1 1 - ߙ+ߙ࢑ HDLߛC - - 2 1 2 1 1 - Overall 1 50% - 10 76.9% 16 76.2% 7 77.8% No disturbances 1 50% - 3 23.1% 5 33.8% 2 22.2% Abbreviations: AA, GA, GG - variants of polymorphism of ABCA1 gene, HDLߛC - fraction HDL of cholesterol, TC - total cholesterol, ߓ TG - triglycerides, V771M, V825I, R587K - nonߛsynonymous single nucleotide polymorphisms of ABCA1 cassette gene Table 5ߓ Distribution of significant (compared to reference data) lipid abnormalities in subgroups of patients divided with regard to CETP gene polymorphisms Polymorphism Disturbances GA variant nߙ=ߙ25 (50%) AA variant nߙ=ߙ6 (12%) ࢏ TCߙ+ߙTG 3 2 ࢏TCߙ+ߙTGߙ+ߙ࢑ HDLߛC 3 2 ࢏ TGߙ+ߙ࢑ HDLߛC 1 - ࢏ TCߙ+ߙ࢑ HDLߛC 1 - ࢏ TC 4 1 - ࢑ HDLߛC 4 1 Overall 22/31 71% No lipid disturbances 9/31 29% Abbreviations: AA, GA, GG - variants of polymorphism of the gene, HDLߛC - fraction HDL of cholesterol, TC - total cholesterol, TG - triglycerides was a nonߛsignificant trend (pߙ=ߙ0.067) in terms of association between the triglyceride level and R1587K genotype. Login to comment
100 There Table 6ߓ Distribution of significant (compared to reference data) lipid abnormalities in subgroups of patients divided with regard to apoE gene polymorphisms Lipid disturbances ApoE subtype b5;3b5;3 nߙ=ߙ35 (70%) b5;3b5;4 nߙ=ߙ6 b5;2b5;3 nߙ=ߙ5 b5;2b5;4 nߙ=ߙ1 b5;4b5;4 nߙ=ߙ2 b5;2b5;2 nߙ=ߙ1 ࢏TCߙ+ߙ࢏TGߙ+ߙ࢑ HDLߛC ߗ 4 2 2 1 - - ࢏TGߙ+ߙ࢑HDLߛC ߗ 1 - - - 1 - ࢑ HDLߛC ߗ 5 1 1 - - 1 ࢏TC ߗ 7 1 - - - - ࢏TCߙ+ߙ࢏TG ߗ 7 1 - - - - ࢏TCߙ+ߙ࢑ HDLߛC ߗ 2 - - - - - Overall 26 (74.3%) 5 3 1 1 1 No disturbances ߗ 9 (25.7%) 1 2 - 1 - Abbreviations: apoE - apolipoprotein E, HDLߛC - fraction HDL of cholesterol, TC - total cholesterol, TG - triglycerides Table 7ߓ Distribution of lipid disturbances prevalence in children with and without specific genetic polymorphisms(summary) Polymorphism Number of patients (n) with polymorphisms and lipid abnormalities with no polymorphisms and lipid abnormalities V771M nߙ=ߙ2/50 1/2 (50%) 36/48 (76.6%) V825I nߙ=ߙ13/50 10/13 (76.9%) 27/37 (73%) R1587K nߙ=ߙ21/50 16/21 (76.2%) 21/29 (72.4%) CETP nߙ=ߙ31/50 22/31 (71%) 15/19 (78.9%) apo b5;3b5;3 nߙ=ߙ35/50 26/35 (74.35) - Other types apoE nߙ=ߙ15/50 12/15 (73.3%) - Abbreviations: apoE- polymorphism of apoE gene, CETP - polymorphism of CETP gene, 14ߓ Litwin M, a;ladowska J, Antoniewicz J, et al.: Metabolic abnormalities, insulin resistance and metabolic syndrome in children with primary hyperߛ tension. Login to comment

[hide] The ABCA1 gene R230C variant is associated with de... PLoS One. 2012;7(11):e49285. doi: 10.1371/journal.pone.0049285. Epub 2012 Nov 9. Villarreal-Molina T, Posadas-Romero C, Romero-Hidalgo S, Antunez-Arguelles E, Bautista-Grande A, Vargas-Alarcon G, Kimura-Hayama E, Canizales-Quinteros S, Juarez-Rojas JG, Posadas-Sanchez R, Cardoso-Saldana G, Medina-Urrutia A, Gonzalez-Salazar Mdel C, Martinez-Alvarado R, Jorge-Galarza E, Carnevale A
The ABCA1 gene R230C variant is associated with decreased risk of premature coronary artery disease: the genetics of atherosclerotic disease (GEA) study.
PLoS One. 2012;7(11):e49285. doi: 10.1371/journal.pone.0049285. Epub 2012 Nov 9., [PMID:23152888]

Abstract [show]
BACKGROUND: ABCA1 genetic variation is known to play a role in HDL-C levels and various studies have also implicated ABCA1 variation in cardiovascular risk. The functional ABCA1/R230C variant is frequent in the Mexican population and has been consistently associated with low HDL-C concentrations. Although it has been associated with other cardiovascular risk factors such as obesity and type 2 diabetes mellitus, it is not known whether it is associated with coronary artery disease (CAD). AIM: The purpose of the study was to analyze whether the ABCA1/R230C variant is associated with premature CAD in a case-control association study (GEA or Genetics of Atherosclerotic Disease), and to explore whether BMI modulates the effect of the C230 allele on other metabolic traits using a population-based design. RESULTS: The C230 allele was significantly associated with both lower HDL-C levels and a lower risk of premature CAD as compared to controls (OR = 0.566; P(add) = 1.499x10(-5)). In addition, BMI modulated the effect of R230C on body fat distribution, as the correlation between BMI and visceral to subcutaneous adipose tissue (a metric of the propensity to store fat viscerally as compared to subcutaneously) was negative in RR homozygous individuals, but positive in premenopausal women bearing the C230 allele, with a statistically significant interaction (P = 0.005). BMI-R230C interaction was also significant for triglyceride levels in women regardless of their menopausal status (P = 0.036). CONCLUSION: This is the first study assessing the effect of the R230C/ABCA1 variant in remature CAD. C230 was associated with both decreased HDL-C levels and a lower risk of premature CAD, and gender-specific BMI-R230C interactions were observed for different metabolic traits. These interactions may help explain inconsistencies in associations, and underscore the need to further analyze interactions of this functional and frequent variant with diet, exercise and other environmental factors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
132 In this regard, heterozygosity for loss of function ABCA1 mutations were associated with lower plasma HDL-cholesterol levels, but not with an increased risk of ischemic heart disease after adjusting for known cardiovascular risk factors [10]; ABCA1 variants V772M and V825I were both associated with increased HDL-C levels and increased IHD risk [12], and the ABCA1 promoter variant rs2422498 was associated with a decreased risk of 10-year vascular death in CAD patients with no apparent effect on HDL-C levels [33]. Login to comment

[hide] Trans-ethnic fine-mapping of lipid loci identifies... PLoS Genet. 2013 Mar;9(3):e1003379. doi: 10.1371/journal.pgen.1003379. Epub 2013 Mar 21. Wu Y, Waite LL, Jackson AU, Sheu WH, Buyske S, Absher D, Arnett DK, Boerwinkle E, Bonnycastle LL, Carty CL, Cheng I, Cochran B, Croteau-Chonka DC, Dumitrescu L, Eaton CB, Franceschini N, Guo X, Henderson BE, Hindorff LA, Kim E, Kinnunen L, Komulainen P, Lee WJ, Le Marchand L, Lin Y, Lindstrom J, Lingaas-Holmen O, Mitchell SL, Narisu N, Robinson JG, Schumacher F, Stancakova A, Sundvall J, Sung YJ, Swift AJ, Wang WC, Wilkens L, Wilsgaard T, Young AM, Adair LS, Ballantyne CM, Buzkova P, Chakravarti A, Collins
Trans-ethnic fine-mapping of lipid loci identifies population-specific signals and allelic heterogeneity that increases the trait variance explained.
PLoS Genet. 2013 Mar;9(3):e1003379. doi: 10.1371/journal.pgen.1003379. Epub 2013 Mar 21., [PMID:23555291]

Abstract [show]
Genome-wide association studies (GWAS) have identified ~100 loci associated with blood lipid levels, but much of the trait heritability remains unexplained, and at most loci the identities of the trait-influencing variants remain unknown. We conducted a trans-ethnic fine-mapping study at 18, 22, and 18 GWAS loci on the Metabochip for their association with triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C), respectively, in individuals of African American (n = 6,832), East Asian (n = 9,449), and European (n = 10,829) ancestry. We aimed to identify the variants with strongest association at each locus, identify additional and population-specific signals, refine association signals, and assess the relative significance of previously described functional variants. Among the 58 loci, 33 exhibited evidence of association at P<1 x 10(-4) in at least one ancestry group. Sequential conditional analyses revealed that ten, nine, and four loci in African Americans, Europeans, and East Asians, respectively, exhibited two or more signals. At these loci, accounting for all signals led to a 1.3- to 1.8-fold increase in the explained phenotypic variance compared to the strongest signals. Distinct signals across ancestry groups were identified at PCSK9 and APOA5. Trans-ethnic analyses narrowed the signals to smaller sets of variants at GCKR, PPP1R3B, ABO, LCAT, and ABCA1. Of 27 variants reported previously to have functional effects, 74% exhibited the strongest association at the respective signal. In conclusion, trans-ethnic high-density genotyping and analysis confirm the presence of allelic heterogeneity, allow the identification of population-specific variants, and limit the number of candidate SNPs for functional studies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
234 Reported functional variants [ref] Reported functional variants on Metabochip Variants with strongest association at a signal Signal Ethnic group* MAF Notes PCSK9: rs28362286 (C679X) [22] Yes rs28362286 1st AA 0.009 Same variant PCSK9: rs28362263 (A443T) [29] Yes rs28362263 2nd AA 0.097 Same variant PCSK9: rs28362261 (N425S) [30] Yes rs28362261 3rd AA 0.017 Same variant PCSK9: rs67608943 (Y142X) [22] Yes rs67608943 4th AA 0.004 Same variant PCSK9: rs72646508 (L253F) [22] Yes rs72646508 5th AA 0.003 Same variant APOE: rs7412 (R176C) [23] Yes rs7412 1st AA, ASN, EUR 0.056-0.110 Same variant APOE: rs769455 (R163C) [31] Yes rs769455 2nd AA 0.020 Same variant APOA5: rs3135506 (S19W) [26] Yes rs3135506 1st AA 0.058 Same variant APOA5: rs651821(-3A.G) [32] Yes rs651821 1st ASN 0.275 Same variant APOA5: rs2075291 (G185C) [25] Yes rs2075291 2nd ASN 0.064 Same variant GCKR: rs1260326 (L446P) [28] Yes rs1260326 1st AA, EUR 0.149-0.350 Same variant SORT1: rs12740374 [18] Yes rs12740374 1st AA 0.247 Same variant CETP: rs17231520 [33] Yes rs17231520 3rd AA 0.069 Same variant LIPC: rs2070895 [34] Proxy: rs1077834 (LD r2 = 1.00) rs1077834 1st, 2nd AA, EUR 0.481 LD r2 = 1.00 APOB: rs7575840 [35] Yes rs934198 1st EUR 0.298 LD r2 = 0.98 LPL: rs328 (S447X) [36] Yes rs1803924 1st ASN 0.095 LD r2 = 0.96 LDLR: rs688 (N591N) [37] Yes rs73015011, rs112898275 1st AA, EUR ---- LD r2 ,0.01 LPL: rs1801177 (D9N) [38] Yes rs75551077, rs15285 1st AA, EUR ---- LD r2 ,0.02 HMGCR: rs3761740 (-911C.A) [39] Proxy: rs17238330 (LD r2 = 1.00) rs12916 1st EUR ---- LD r2 ,0.20 LDLR: -139C.G [40] No ---- ---- ---- ---- ---- LPL: rs268 (N291S) [41] No ---- ---- ---- ---- ---- ABCA1: rs9282541 (R230C) [42] No ---- ---- ---- ---- ---- ABCA1: rs2066715 (V825I) [43] No ---- ---- ---- ---- ---- LCAT: rs28940887(R159W) [44] No ---- ---- ---- ---- ---- PLTP: R235W [45] No ---- ---- ---- ---- ---- LIPG: rs77960347 (A396S) [46] No ---- ---- ---- ---- ---- LIPG: rs34474737 [47] No ---- ---- ---- ---- ---- *AA, African American; EUR, European; ASN, East Asian. Login to comment

[hide] Gene-gene combination effect and interactions amon... PLoS One. 2013 Dec 20;8(12):e82046. doi: 10.1371/journal.pone.0082046. eCollection 2013. Nakamura A, Niimura H, Kuwabara K, Takezaki T, Morita E, Wakai K, Hamajima N, Nishida Y, Turin TC, Suzuki S, Ohnaka K, Uemura H, Ozaki E, Hosono S, Mikami H, Kubo M, Tanaka H
Gene-gene combination effect and interactions among ABCA1, APOA1, SR-B1, and CETP polymorphisms for serum high-density lipoprotein-cholesterol in the Japanese population.
PLoS One. 2013 Dec 20;8(12):e82046. doi: 10.1371/journal.pone.0082046. eCollection 2013., [PMID:24376512]

Abstract [show]
BACKGROUND/OBJECTIVE: Gene-gene interactions in the reverse cholesterol transport system for high-density lipoprotein-cholesterol (HDL-C) are poorly understood. The present study observed gene-gene combination effect and interactions between single nucleotide polymorphisms (SNPs) in ABCA1, APOA1, SR-B1, and CETP in serum HDL-C from a cross-sectional study in the Japanese population. METHODS: The study population comprised 1,535 men and 1,515 women aged 35-69 years who were enrolled in the Japan Multi-Institutional Collaborative Cohort (J-MICC) Study. We selected 13 SNPs in the ABCA1, APOA1, CETP, and SR-B1 genes in the reverse cholesterol transport system. The effects of genetic and environmental factors were assessed using general linear and logistic regression models after adjusting for age, sex, and region. PRINCIPAL FINDINGS: Alcohol consumption and daily activity were positively associated with HDL-C levels, whereas smoking had a negative relationship. The T allele of CETP, rs3764261, was correlated with higher HDL-C levels and had the highest coefficient (2.93 mg/dL/allele) among the 13 SNPs, which was statistically significant after applying the Bonferroni correction (p<0.001). Gene-gene combination analysis revealed that CETP rs3764261 was associated with high HDL-C levels with any combination of SNPs from ABCA1, APOA1, and SR-B1, although no gene-gene interaction was apparent. An increasing trend for serum HDL-C was also observed with an increasing number of alleles (p<0.001). CONCLUSIONS: The present study identified a multiplier effect from a polymorphism in CETP with ABCA1, APOA1, and SR-B1, as well as a dose-dependence according to the number of alleles present.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 doi:10.1371/journal.pone.0082046.g001 polymorphisms (SNPs) that have been reported to be associated with HDL-C levels in previous studies [11-17]: ABCA1-565C.T (rs2422493), R1587K (rs2230808), -273G.C (rs1800976), V771M (rs2066718), -17C.G (rs2740483), and V825I (rs2066715); APOA1 A61T (rs12718465); LCAT (rs4986970); CETP Taq1B (rs708272), G/T (rs3764261), I405V (rs5882), and -629C.A (rs1800775); SR-B1 A.G (rs3782287), A350A (rs5888), and V135I (rs5891). Login to comment
146 Gene rs Number Alias Allele MAF ABCA1 rs2422493 2565C.T C.T 0.408 rs2230808 R1587K G.A 0.399 rs1800976 2273G.C G.C 0.409 rs2066718 V771M G.A 0.075 rs2740483 217C.G C.G 0.295 rs2066715 V825I G.A 0.361 APOA1 rs12718465 A61T C.T 0.068 CETP rs708272 Taq1B C.T 0.398 rs3764261 G/T G.T 0.272 rs5882 Ile405Val A.G 0.495 rs1800775 2629C.A A.C 0.445 SR-B1 rs3782287 A.G G.A 0.244 rs5888 A350A C.T 0.220 MAF, minor allele frequency. Login to comment

[hide] ATP-binding cassette transporters, atherosclerosis... Circ Res. 2014 Jan 3;114(1):157-70. doi: 10.1161/CIRCRESAHA.114.300738. Westerterp M, Bochem AE, Yvan-Charvet L, Murphy AJ, Wang N, Tall AR
ATP-binding cassette transporters, atherosclerosis, and inflammation.
Circ Res. 2014 Jan 3;114(1):157-70. doi: 10.1161/CIRCRESAHA.114.300738., [PMID:24385509]

Abstract [show]
Although recent genome-wide association studies have called into question the causal relationship between high-density lipoprotein (HDL) cholesterol levels and cardiovascular disease, ongoing research in animals and cells has produced increasing evidence that cholesterol efflux pathways mediated by ATP-binding cassette (ABC) transporters and HDL suppress atherosclerosis. These differing perspectives may be reconciled by a modified HDL theory that emphasizes the antiatherogenic role of cholesterol flux pathways, initiated in cells by ABC transporters. ABCA1 and ABCG1 control the proliferation of hematopoietic stem and multipotential progenitor cells in the bone marrow and hematopoietic stem and multipotential progenitor cell mobilization and extramedullary hematopoiesis in the spleen. Thus, activation of cholesterol efflux pathways by HDL infusions or liver X receptor activation results in suppression of hematopoietic stem and multipotential progenitor cell mobilization and extramedullary hematopoiesis, leading to decreased production of monocytes and neutrophils and suppression of atherosclerosis. In addition, macrophage-specific knockout of transporters has confirmed their role in suppression of inflammatory responses in the arterial wall. Recent studies have also shown that ABCG4, a close relative of ABCG1, controls platelet production, atherosclerosis, and thrombosis. ABCG4 is highly expressed in megakaryocyte progenitors, where it promotes cholesterol efflux to HDL and controls the proliferative responses to thrombopoietin. Reconstituted HDL infusions act in an ABCG4-dependent fashion to limit hypercholesterolemia-driven excessive platelet production, thrombosis, and atherogenesis, as occurs in human myeloproliferative syndromes. Activation of ABC transporter-dependent cholesterol efflux pathways in macrophages, hematopoietic stem and multipotential progenitor cells, or platelet progenitors by reconstituted HDL infusion or liver X receptor activation remain promising approaches to the treatment of human atherothrombotic diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 In a Mendelian randomization approach in a prospective cohort comprising ࣈ9000 individuals, heterozygosity for the ABCA1 mutation K776N led to a 2-to-3 times higher risk of ischemic heart disease.105 Furthermore, 5 single-nucleotide polymorphisms (SNPs) inABCA1 (V771M,V825I, I883M, E1172D, R1587K) were shown to predict risk of ischemic heart disease in a cohort of 9259 individuals.106 However, the same group reported more recently that heterozygosity for 4 loss-of-function mutations (P1065S, G1216V, N1800H, R2144X) was not associated with a higher risk of ischemic heart disease in 3 prospective cohorts comprising 56ߙ886 individuals.107 It must be noted, however, that only small decreases in HDL, of ࣈ28% as opposed to ࣈ50% in previously reported ABCA1 heterozygotes, were observed.94,101-103,107 Also, the residual cholesterol efflux was substantial (74%-79% for P1065S and G1216V and 48%-49% for N1800H and R2144X for homozygous mutations compared with controls),107 whereas in patients with TD there was only 20% to 30% residual cholesterol efflux.108 In addition, LDL levels were reduced by ࣈ25%, probably offsetting the effects of reduced HDL on CVD.107 Thus, the conflicting results in these studies could be related to inclusion of relatively mild ABCA1 mutations as well as offsetting effects of reduced LDL cholesterol levels.109 In a meta-analysis of genome-wide association studies, SNPs near the ABCA1 gene have been associated with HDL and total cholesterol levels,110,111 but not with cardiovascular risk.112 Although these studies have the benefit of huge statistical power, some caution is merited in the interpretation of findings. Login to comment

[hide] Influence of ATP-binding cassette transporter 1 R2... PLoS One. 2014 Jan 23;9(1):e86480. doi: 10.1371/journal.pone.0086480. eCollection 2014. Yin YW, Li JC, Gao D, Chen YX, Li BH, Wang JZ, Liu Y, Liao SQ, Zhang MJ, Gao CY, Zhang LL
Influence of ATP-binding cassette transporter 1 R219K and M883I polymorphisms on development of atherosclerosis: a meta-analysis of 58 studies.
PLoS One. 2014 Jan 23;9(1):e86480. doi: 10.1371/journal.pone.0086480. eCollection 2014., [PMID:24466114]

Abstract [show]
BACKGROUND: Numerous epidemiological studies have evaluated the associations between ATP-binding cassette transporter 1 (ABCA1) R219K (rs2230806) and M883I (rs4149313) polymorphisms and atherosclerosis (AS), but results remain controversial. The purpose of the present study is to investigate whether these two polymorphisms facilitate the susceptibility to AS using a meta-analysis. METHODS: PubMed, Embase, Web of Science, Medline, Cochrane database, Clinicaltrials.gov, Current Controlled Trials, Chinese Clinical Trial Registry, CBMdisc, CNKI, Google Scholar and Baidu Library were searched to get the genetic association studies. All statistical analyses were done with Stata 11.0. RESULTS: Forty-seven articles involving 58 studies were included in the final meta-analysis. For the ABCA1 R219K polymorphism, 42 studies involving 12,551 AS cases and 19,548 controls were combined showing significant association between this variant and AS risk (for K allele vs. R allele: OR = 0.77, 95% CI = 0.71-0.84, P<0.01; for K/K vs. R/R: OR = 0.60, 95% CI = 0.51-0.71, P<0.01; for K/K vs. R/K+R/R: OR = 0.69, 95% CI = 0.60-0.80, P<0.01; for K/K+R/K vs. R/R: OR = 0.74, 95% CI = 0.66-0.83, P<0.01). For the ABCA1 M883I polymorphism, 16 studies involving 4,224 AS cases and 3,462 controls were combined. There was also significant association between the variant and AS risk (for I allele vs. M allele: OR = 0.85, 95% CI = 0.77-0.95, P<0.01). CONCLUSIONS: The present meta-analysis suggested that the ABCA1 R219K and M883I polymorphisms were associated with the susceptibility to AS. However, due to the high heterogeneity in the meta-analysis, the results should be interpreted with caution.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 Recently, a number of molecular epidemiological studies have been done to evaluate the associations between the ABCA1 gene polymorphisms (such as R219K, M883I, C69T, V825I, R1587K, V771M and 2565C/T) and the risk of atherosclerotic diseases [248]. Login to comment

[hide] ATP-binding cassette transporter 1 C69T and V825I ... Thromb Res. 2015 Jan;135(1):130-6. doi: 10.1016/j.thromres.2014.10.022. Epub 2014 Nov 4. Yin YW, Wang Q, Sun QQ, Hu AM, Liu HL
ATP-binding cassette transporter 1 C69T and V825I polymorphisms in the development of atherosclerosis: a meta-analysis of 18,320 subjects.
Thromb Res. 2015 Jan;135(1):130-6. doi: 10.1016/j.thromres.2014.10.022. Epub 2014 Nov 4., [PMID:25527331]

Abstract [show]
INTRODUCTION: ATP-binding cassette transporter 1 (ABCA1), a member of the ATP-binding cassette family, plays a critical role in the development of atherosclerosis (AS). This meta-analysis was performed to assess the associations of ABCA1 C69T and V825I polymorphisms with AS susceptibility. MATERIALS AND METHODS: A comprehensive search was conducted to identify all eligible studies from PubMed, Embase, Web of Science, Cochrane database, CBMdisc, CNKI and Google Scholar. Additionally, hand searching of the references of identified articles was performed. All statistical analyses were done with Review Manager 5.1.4 and Stata 11.0. RESULTS: Eleven articles involving 14 studies were included in the final meta-analysis. For the ABCA1 C69T polymorphism, six studies involving 1854 AS cases and 5744 controls were combined showing significant association between this variant and AS risk (for T allele vs. C allele: OR =1.44, 95% CI =1.04-1.24, p =0.005; for T/T vs. C/C: OR =1.39, 95% CI =1.12-1.73, p =0.003; for T/T vs. C/T+C/C: OR =1.34, 95% CI =1.09-1.65, p =0.006; for T/T+C/T vs. C/C: OR =1.13, 95% CI =1.01-1.27, p =0.040). For the ABCA1 V825I polymorphism, eight studies involving 2026 AS cases and 8696 controls were combined. There was no significant association between the variant and AS risk (for I allele vs. V allele: OR =1.18, 95% CI =0.90-1.53, p =0.230; for I/I vs. V/V: OR =1.29, 95% CI =0.75-2.23, p =0.360; for I/I vs. V/I+V/V: OR =1.40, 95% CI =0.87-2.26, p =0.160; for I/I+V/I vs. V/V: OR =1.15, 95% CI =1.00-1.33, p =0.060). CONCLUSIONS: This meta-analysis suggested that the ABCA1 C69T polymorphism was associated with an increased AS risk. Furthermore, there was no significant association between the ABCA1 V825I polymorphism and AS risk.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 This meta-analysis was performed to assess the associations of ABCA1 C69T and V825I polymorphisms with AS susceptibility. Login to comment
7 For the ABCA1 V825I polymorphism, eight studies involving 2026 AS cases and 8696 controls were combined. Login to comment
10 Furthermore, there was no significant association between the ABCA1 V825I polymorphism and AS risk. Login to comment
21 In 2003, Tan et al. found that the ABCA1 V825I polymorphism was associated with the susceptibility of coronary artery disease (CAD) among Malay population [3]. Login to comment
22 In 2004, Wang et al. also found significant association between the ABCA1 V825I polymorphism and ischemic stroke (IS) risk in kazakh ethnic [4]. Login to comment
33 In 2012, Qin et al. demonstrated no significant association between the ABCA1 V825I polymorphism and IS risk among Chinese [15]. Login to comment
34 In the same year, Xue et al. showed that the I/I genotype of the ABCA1 V825I polymorphism was a protective factor for IS among Chinese [7]. Login to comment
35 It is unclear yet whether there are significant associations between the ABCA1 C69T and V825I polymorphisms and AS risk. Login to comment
37 Here, we focused on the associations between the ABCA1 C69T and V825I polymorphisms and AS risk. Login to comment
38 We therefore designed this meta-analysis synthesizing the data from single studies to evaluate the genetic risk of the C69T and V825I polymorphisms in ABCA1 gene for AS. Login to comment
46 Inclusion Criteria All studies that aimed to investigate the associations between the ABCA1 C69T and V825I polymorphisms and AS risk were considered. Login to comment
47 Any study which fulfilled the following criteria was included: (1) original (case-control or cohort studies) research evaluating the associations between the ABCA1 C69T and V825I polymorphisms and AS risk; (2) studied on human beings; (3) sufficient data to estimate an odds ratios (ORs) with their 95% confidence intervals (CIs); (4) not republished data. Login to comment
57 ORs with 95% CIs were used to measure the associations strength between the ABCA1 C69T and V825I polymorphisms and AS risk. Login to comment
58 In the present meta-analysis, we evaluated the overall AS risk in four comparison models: allelic model (T allele vs. C allele for C69T; I allele vs. V allele for V825I), additive model (T/T vs. C/C for C69T; I/I vs. V/V for V825I), recessive model (T/T vs. C/T + C/C for C69T; I/I vs. V/I + V/V for V825I), and dominant model (T/T + C/T vs. C/C for C69T; I/I + V/I vs. V/V for V825I). Login to comment
68 After careful review, a total of 11 articles involving 14 studies (six studies for C69T polymorphism and eight studies for V825I polymorphism), comprising 3880 patients and 14440 controls, fulfilled the criteria for inclusion in this study [3-7,11-16]. Login to comment
83 For the ABCA1 V825I polymorphism, eight studies were combined. Login to comment
85 However, significant association was found between the ABCA1 V825I polymorphism and AS risk in the IS group (for I/I + V/I vs. V/V: OR =1.19, 95% CI =1.01-1.40, p =0.040). Login to comment
88 The included studies were limited to those conforming to HWE. Overall, the corresponding pooled ORs were not materially altered, either for the ABCA1 C69T polymorphism or for V825I polymorphism. Login to comment
92 Furthermore, the results of Egger`s regression test also revealed no publication bias, either for the ABCA1 C69T polymorphism (p =0.469 for allelic model, p =0.464 for additive model, p =0.586 for recessive model, and p =0.297 for dominant model, respectively) or for V825I polymorphism(p =0.459 for allelic model, p =0.921 for additive model, p =0.943 for recessive model, Fig. 1. Login to comment
97 Therefore, to clarify the earlier inconclusive results involving the associations between the ABCA1 C69T and V825I polymorphisms and AS risk, we performed the present meta-analysis. Login to comment
98 The present meta-analysis of 14 studies, including 3880 AS cases and 14440 controls, provided the most comprehensive analysis on the associations of the ABCA1 C69T and V825I polymorphisms with AS risk. Login to comment
102 For the ABCA1 V825I polymorphism, no significant association was found between this variant and AS risk. Login to comment
109 As for the ABCA1 V825I polymorphism, we did not find any evidence of association between this variant and AS risk in the Asians group and IS group. Login to comment
110 In contrast, significant association was found between the ABCA1 V825I polymorphism and AS risk in the CAD group suggesting the I allele carriers had a higher risk for developing AS (for OR = 1.19) compared to those with V allele. Login to comment
112 Position First author Year Country Ethnicity Disease Source of controls Sample size (case/control) Genotypes distribution (case/control) HWE Y/N(P) Score C69T C/C C/T T/T C T Wang [11] 2006 China Asian CAD PB 264/278 164/183 91/87 9/8 419/453 109/103 Y(0.540) 9 Ergen [12] 2008 Turkey Caucasian CAD PB 77/50 32/23 27/20 18/7 91/66 63/34 Y(0.442) 8 Yamada [5] 2008 Japan Asian IS PB 822/2070 445/1221 305/743 72/106 1195/3185 449/955 Y(0.607) 6 Porchay-Bald&#e9;relli [6] 2009 France Caucasian CAD HB 223/2906 91/1206 106/1331 26/369 288/3743 158/2069 Y(0.953) 6 Cheng [13] 2011 China Asian CAD HB 228/200 101/83 114/107 13/10 316/273 140/127 N(0.001) 6 Yi [14] 2011 China Asian IS PB 240/240 110/115 107/104 23/21 327/334 153/146 Y(0.713) 7 V825I V/V V/I I/I V I Tan-a [3] 2003 Singapore Asian CAD PB 294/108 92/34 142/58 60/16 326/126 262/90 Y(0.276) 7 Tan-b [3] 2003 Singapore Asian CAD PB 77/123 37/62 31/52 9/9 105/176 49/70 Y(0.671) 7 Tan-c [3] 2003 Singapore Asian CAD PB 83/109 71/97 10/12 2/0 152/206 14/12 Y(0.543) 7 Wang-a [4] 2004 China Asian IS PB 58/60 3/4 13/28 42/28 19/36 97/84 Y(0.389) 7 Wang-b [4] 2004 China Asian IS PB 58/60 7/12 32/34 19/14 46/58 70/62 Y(0.297) 7 Qin [15] 2012 China Asian IS PB 252/249 74/84 120/120 58/45 268/288 236/210 Y(0.851) 8 Xue [7] 2012 China Asian IS PB 97/129 36/33 50/65 11/31 122/131 72/127 Y(0.928) 7 V/V V/I + I/I Frikke-Schmidt [16] 2008 Denmark Caucasian CAD PB 1107/7858 962/6997 145/861 - 7 PB: population-based, HB: hospital-based. Login to comment
114 Table 2 Meta-analyses of ABCA1 C69T and V825I polymorphisms and risk of AS in each subgroup. Login to comment
115 Position Sample size (case/control) Allelic model Additive model Recessive model Dominant model OR(95% CI) P OR(95% CI) P OR(95% CI) P OR(95%CI) P Overall analysis C69T 1854/5744 1.14[1.04,1.24] 0.005 1.39[1.12,1.73] 0.003 1.34[1.09,1.65] 0.006 1.13[1.01,1.27] 0.040 V825I 2026/8696 1.18[0.90,1.53]a 0.230 1.29[0.75,2.23]a 0.360 1.40[0.87,2.26]a 0.160 1.15[1.00,1.33] 0.060 Subgroup analysis based on ethnicity C69T (E) 300/2956 1.03[0.86,1.25] 0.740 1.05 [0.70,1.57] 0.820 1.03[0.70,1.50] 0.160 1.05[0.81,1.36] 0.710 C69T (A) 1554/2788 1.17[1.06,1.30] 0.003 1.58[1.21,2.05] b0.001 1.52[1.18,1.97] 0.001 1.15[1.01,1.31] 0.030 V825I (A) 919/838 1.18[0.90,1.53]a 0.230 1.29[0.75,2.23]a 0.360 1.40[0.87,2.26]a 0.160 1.06[0.85,1.32] 0.590 Subgroup analysis based on atherosclerotic diseases C69T (CAD) 792/3434 1.04[0.90,1.19] 0.620 1.07[0.76,1.51] 0.680 1.06[0.77,1.47] 0.720 1.04[0.87,1.25] 0.650 C69T (IS) 1062/2310 1.22[1.08,1.37] 0.001 1.68[1.26,2.24] b0.001 1.61[1.21,2.12] b0.001 1.19[1.03,1.39] 0.020 V825I (CAD) 1561/8198 1.18[0.92,1.50] 0.190 1.57[0.91,2.73] 0.110 1.61[0.97,2.67] 0.060 1.19[1.01,1.40] 0.040 V825I (IS) 465/498 1.18[0.74,1.89]a 0.490 1.13[0.46,2.81]a 0.790 1.27[0.61,2.64]a 0.520 1.04[0.78,1.40] 0.780 Sensitivity analysis C69T (BH) 1626/5544 1.16[1.05,1.27] 0.002 1.42[1.13,1.78] 0.002 1.35[1.09,1.68] 0.006 1.16[1.03,1.31] 0.020 V825I (BH) 919/838 1.18[0.90,1.53]a 0.230 1.29[0.75,2.23]a 0.360 1.40[0.87,2.26]a 0.160 1.06[0.85,1.32] 0.590 A: Asians, E: Europeans, PB: population-based, HB: hospital-based, BH: based on HWE (Studies with HWE were included), CAD: coronary artery disease, IS: ischemic stroke, a Significant heterogeneity: the random-effects model was chosen to summarize the result. Login to comment
117 In addition, considering the results produced from genetic association case-control studies may be spurious when the genotype distribution of controls deviates from HWE [28], we also performed sensitivity analyses by limiting studies to those conforming to HWE. Overall, the corresponding pooled ORs were not materially altered, either for the ABCA1 C69T polymorphism or for V825I polymorphism. Login to comment
119 Simultaneously, the results of sensitivity analyses further strengthened the overall conclusion involving the ABCA1 C69T and V825I polymorphisms and AS risk. Login to comment
122 So far, at least seven single-nucleotide polymorphisms at the ABCA1 gene promoter have been studied to investigate the associations between these variants and the susceptibility of atherosclerotic diseases, such as R219K, M883I, C69T, V825I, R1587K, V771M and -565C/T. Login to comment
127 For the ABCA1 V825I polymorphism, significant between-study heterogeneity existed in the allelic model, additive model and recessive model. Login to comment
140 Fig. 3. Forest plots for the ABCA1 V825I polymorphism and AS risk. A (I allele vs. V allele); B (I/I vs. V/V). Login to comment
148 Funnel plots for the ABCA1 V825I polymorphism and AS risk. A (I allele vs. V allele); B (I/I vs. V/V). Login to comment
154 In addition, no significant association was found between the ABCA1 V825I polymorphism and AS risk. Login to comment
155 To the best of our knowledge, this is the first comprehensive meta-analysis to date investigating the associations between the ABCA1 C69T and V825I polymorphisms and AS risk. Login to comment