ABCMdb

ABCA3 p.Glu292Val

None has been submitted yet.

Publications

PMID: 16540294 [PubMed] Kaminski WE et al: "ABC A-subfamily transporters: structure, function and disease."

No. Sentence Comment

162 Intriguingly, in three out of four patients with the histological diagnosis of desquamative interstitial peumonitis, who were older than 10 years at the time of enrollment, heterozygosity for a novel missense mutation (E292V) was found. Login to comment
163 Heterozygosity for the E292V mutation was detected in seven additional patients and in eight of the ten patients a second, distinct mutation was identified on the other ABCA3 allele. Login to comment

PMID: 22866751 [PubMed] Baekvad-Hansen M et al: "Heterozygosity for E292V in ABCA3, lung function and COPD in 64,000 individuals."

No. Sentence Comment

2 Heterozygosity for E292V in ABCA3, lung function and COPD in 64,000 individuals Respiratory Research 2012, 13:67 doi:10.1186/1465-9921-13-67 Marie Bækvad-Hansen (baekvad@gmail.com}) Børge G Nordestgaard (brno@heh.regionh.dk}) Morten Dahl (dahlos2003@yahoo.dk}) ISSN 1465-9921 Article type Research Submission date 23 March 2012 Acceptance date 27 July 2012 Publication date 6 August 2012 Article URL http://respiratory-research.com/content/13/1/67 This peer-reviewed article was published immediately upon acceptance. Login to comment
7 Heterozygosity for E292V in ABCA3, lung function and COPD in 64,000 individuals Marie Bækvad-Hansen1,4 Email: baekvad@gmail.com Børge G Nordestgaard1,2,4 Email: brno@heh.regionh.dk Morten Dahl1,3,4,* Email: morten.dahl@rh.regionh.dk 1 Department of Clinical Biochemistry, Herlev Hospital, Copenhagen University Hospital, Copenhagen, Denmark 2 Copenhagen City Heart Study, Bispebjerg Hospital, Copenhagen University Hospital, Copenhagen, Denmark 3 Department of Clinical Biochemistry, Rigshospitalet, Copenhagen University Hospital, Blegdamsvej 9, Copenhagen DK-2100, Denmark 4 Faculty of Health Sciences, University of Copenhagen, Copenhagen, Denmark * Corresponding author. Login to comment
10 Methods We screened 760 individuals with extreme pulmonary phenotypes and identified three novel (H86Y, A320T, A1086D) and four previously described mutations (E292V, P766S, S1262G, R1474W) in the ABCA3 gene. Login to comment
13 Results In the Copenhagen City Heart Study individuals heterozygous for E292V had 5 % reduced FEV1 % predicted compared with noncarriers (t-test: p = 0.008), and an increased odds ratio for COPD of 1.9 (95 % CI: 1.1-3.1). Login to comment
16 In the larger Copenhagen General Population Study, and in the two studies combined, E292V heterozygotes did not have reduced lung function or increased risk of COPD (p = 0.11-0.98), while this was the case for the positive controls, surfactant protein-B 121ins2 heterozygotes and α1-antitrypsin ZZ homozygotes. Login to comment
17 Conclusion Our results indicate that partially reduced ABCA3 activity due to E292V is not a major risk factor for reduced lung function and COPD in the general population. Login to comment
18 This is an important finding as 1.3 % in the Danish population has partially reduced ABCA3 function due to E292V. Login to comment
27 A relatively common mutation in ABCA3, E292V, is associated with partially impaired ABCA3 function [6] and with milder chronic lung disease in childhood [3,6]. Login to comment
29 The E292V mutation has been found in about 0.3-0.4 % of individuals in a heterogeneous US population [7] and may affect both heterozygous [8,9] and compound heterozygous carriers [8,10]. Login to comment
31 Given this, ABCA3 variants, and in particular E292V, could play an important role on development of common pulmonary disorders in the general population. Login to comment
77 H86Y, A320T and A1086D were novel variants, whereas E292V, P766S, S1262G and R1474W have been described previously. Login to comment
82 SIFT and Polyphen both predicted E292V to be damaging, but none of the other six mutations. Login to comment
87 Individuals heterozygous for E292V had 5 % reduced FEV1%predicted (t-test:p = 0.008), 3 % reduced FVC%predicted (p = 0.04) and 0.02 reduced FEV1/FVC (p = 0.03), compared with wildtypes (figure 1). Login to comment
88 The observed reductions in pulmonary function were almost similar in absolute numbers to those observed for surfactant protein-B 121ins2, a mutation which in the homozygous state associates with a phenotype somewhat similar to that for E292V compound heterozygosity. Login to comment
101 COPD by ABCA3 genotype in the Copenhagen City Heart Study Individuals heterozygous for E292V had a multivariate adjusted odds ratio for COPD of 1.9 (95 % CI 1.1-3.1) compared with wildtypes in the Copenhagen City Heart Study (figure 2). Login to comment
110 Risk of COPD according to surfactant protein-B 121ins2 heterozygosity and α1-antitrysin ZZ homozygosity serve as positive controls. Numbers of individuals with surfactant protein-B 121ins2 heterozygosity and α1-antitrypsin ZZ homozygosity differ slightly from the number of individuals with ABCA3 genotypes due to different number of study subjects available for analysis within the study period Pulmonary function and COPD by ABCA3 E292V in the Copenhagen General Population Study To further validate the findings for E292V, we genotyped the Copenhagen General Population Study (n = 54,395) for the E292V variant. Login to comment
113 Characteristics did not differ between E292V heterozygotes and wildtypes in any of the two study cohorts. Login to comment
116 Table 1 Characteristics of participants in the Copenhagen City Heart Study and the Copenhagen General Population Study according to E292V genotype Copenhagen City Heart Study Copenhagen General Population Study Wildtypes E292V heterozygotes p-value Wildtypes E292V heterozygotes p-value N 9,706 110 53,685 710 Women, % 5,374 (55) 60 (55) 0.86 29,756 (55) 394 (55) 0.97 Age, yrs 58 (44- 69) 57 (45-67) 0.57 60(50-70) 59(49-69) 0.20 Eversmokers, % 76 77 0.72 60 59 0.40 Packyears of tobacco smoked 25(11-40) 25(13-40) 0.72 17(6-31) 15(6-30) 0.44 Values represent number, median (interquartile range), or percent. Login to comment
119 We found that FEV1%predicted, FVC%predicted, and FEV1/FVC did not differ in E292V heterozygotes vs wildtypes (p≥0.67), whereas FEV1%predicted was reduced in the positive controls, surfactant protein-B 121ins2 heterozygotes and α1-antitrypsin ZZ homozygotes. Login to comment
120 In accordance with the results on pulmonary function, the multivariate adjusted odds ratio for COPD was not increased in E292V heterozygotes compared with wildtypes (odds ratio 1.10 (0.83-1.46)), while surfactant protein-B 121ins2 heterozygotes and α1-antitrypsin ZZ homozygotes had increased odds ratios for COPD of 2.8 (1.0-8.1) and 6.6 (1.7-26) (Additional file 9) Pulmonary function and COPD by ABCA3 E292V in the Copenhagen City Heart Study and Copenhagen General Population Study combined Finally, to maximize our statistical power, we combined the Copenhagen City Heart Study and Copenhagen General Population Study. Login to comment
121 In this analysis, we found that FEV1%predicted, FVC%predicted, and FEV1/FVC did not differ in E292V heterozygotes vs wildtypes (p≥0.28), whereas FEV1%predicted was reduced in the positive controls, surfactant protein-B 121ins2 heterozygotes and α1-antitrysin ZZ homozygotes (figure 3). Login to comment
122 We also stratified our data for smoking status, as did our previous study of surfactant protein-B 121ins2 as a risk factor in COPD [12], but found no significant differences in lung function for E292V. Login to comment
126 Figure 3 Lung function according to ATP binding cassette member 3 (ABCA3) E292V, surfactant protein-B 121ins2, and α1-antitrypsin ZZ genotypes in the Copenhagen City Heart Study and Copenhagen General Population Study combined, stratified for smoking status. Login to comment
128 P-values are by Student`s t-test. Lung function according to surfactant protein-B 121ins2 heterozygosity and α1-antitrysin ZZ homozygosity serve as positive controls. Numbers of individuals with surfactant protein-B 121ins2 heterozygosity and α1-antitrypsin ZZ homozygosity differ slightly from the number of individuals with an ABCA3 E292V genotype due to different number of study subjects available for analysis within the study period Individuals heterozygous for E292V had multivariate adjusted odds ratios for COPD of 1.2 (0.96-1.57) among all subjects, of 1.1 (0.6-2.1) among nonsmokers, and of 1.2 (0.95-1.63) among smokers, respectively, compared with wildtypes (figure 4). Login to comment
131 We had 80 % power to exclude odds ratios for COPD for E292V heterozygotes of 1.3, for surfactant protein-B 121ins2 heterozygotes of 2.1, and for α1-antitrypsin ZZ homozygotes of 4.0. Login to comment
132 Figure 4 Risk of COPD according to ATP binding cassette member 3 (ABCA3) E292V, surfactant protein-B 121ins2, and α1-antitrypsin ZZ genotypes in the Copenhagen City Heart Study and Copenhagen General Population Study combined, stratified for smoking status. Login to comment
135 Numbers of individuals with surfactant protein-B 121ins2 heterozygosity and α1-antitrypsin ZZ homozygosity differ slightly from the number of individuals with an ABCA3 E292V genotype due to different number of study subjects available for analysis within the study period Discussion To test whether individuals heterozygous for ABCA3 variants have reduced lung function and increased risk of COPD in the general population, we screened 760 individuals with extreme lung phenotypes for genetic variations in the ABCA3 gene and identified three novel (H86Y, A320T, A1086D) and four previously described variations (E292V, P766S, S1262G, R1474W). Login to comment
137 We found that E292V heterozygotes had reduced lung function and increased risk of COPD, whereas the novel A1086 mutation was associated with increased lung function. Login to comment
138 To validate the findings for E292V we genotyped an additional 54,395 individuals from the Copenhagen General Population Study. Login to comment
139 In this larger cohort, and in the two study cohorts combined, we found that E292V heterozygotes did not have reduced lung function or increased risk of COPD. Login to comment
140 Supporting this overall negative result, the estimates for the positive controls, surfactant protein-B 121ins2 heterozygotes and α1-antitrypsin ZZ homozygotes, were relatively stable throughout the studies and there was no evidence of selection bias against E292V in any of the two cohorts. Login to comment
141 The phenotype in E292V carriers was previously reported to range from minimal changes on lung biopsy and no symptoms to severe fatal lung disease [8,9]. Login to comment
142 It is thus possible that E292V may cause lung disease in certain contexts or subgroups of individuals, e.g. when additional impairments of surfactant function are present, leaving the average carrier unaffected. Login to comment
143 Tobacco smoking [23] and unidentified mutations in surfactant protein-C [24,25], ABCA3 [26], and surfactant protein-B could be risk factors of additionally impaired surfactant function in E292V heterozygotes; although the latter risk factors are probably less prevalent in the general population as compared with tobacco smoking. Login to comment
144 Because participants in the Copenhagen City Heart Study smoked more tobacco than participants from the Copenhagen General Population Study we speculate that the difference in smoking habits between the two cohorts could partly contribute to the different results observed for E292V in the two cohorts. Login to comment
145 When statistical power, however, was maximised using the Copenhagen General Population Study or the two studies combined, E292V heterozygotes did not differ from wildtypes in lung function or COPD risk. Login to comment
146 This is an important finding as 1.3 % in the Danish general population has partially reduced ABCA3 function due to E292V, and since this variant has been linked previously with severe chronic lung disease in heterozygous and compound heterozygous E292V carriers [8-10]. Login to comment
147 Besides E292V, we identified six other variants of potential relevance to ABCA3 function. Login to comment
151 In addition, if correction for multiple comparisons was performed none of the results for E292V in the Copenhagen City Heart Study would be of statistical significance. Login to comment
152 The second novel mutation, H86Y, is situated in the first extracellular loop of ABCA3. Login to comment
169 Conclusions We found with significant statistical power that ABCA3 E292V heterozygotes do not have reduced lung function or increased risk of COPD in the general population. Login to comment
170 This is an important finding as 1.3 % in the Danish general population has partially reduced ABCA3 function due to E292V and since this variant has been linked previously with severe chronic lung disease in E292V heterozygotes and compound heterozygotes. Login to comment
171 Abbreviations ABCA3, ATP-binding cassette member A3; COPD, Chronic obstructive pulmonary disease; E292V, Substitution of valine for glutamic acid at aminoacid-position 292; FEV1, Forced expiratory volume in one second; FVC, Forced vital capacity. Login to comment
0 RESEARCH Open Access Heterozygosity for E292V in ABCA3, lung function and COPD in 64,000 individuals Marie B&#e6;kvad-Hansen1,4 , B&#f8;rge G Nordestgaard1,2,4 and Morten Dahl1,3,4* Abstract Background: Mutations in ATP-binding-cassette-member A3 (ABCA3) are related to severe chronic lung disease in neonates and children, but frequency of chronic lung disease due to ABCA3 mutations in the general population is unknown. Login to comment
5 Results: In the Copenhagen City Heart Study individuals heterozygous for E292V had 5% reduced FEV1 % predicted compared with noncarriers (t-test: p = 0.008), and an increased odds ratio for COPD of 1.9 (95% CI: 1.1-3.1). Login to comment
8 In the larger Copenhagen General Population Study, and in the two studies combined, E292V heterozygotes did not have reduced lung function or increased risk of COPD (p = 0.11-0.98), while this was the case for the positive controls, surfactant protein-B 121ins2 heterozygotes and b1;1-antitrypsin ZZ homozygotes. Login to comment
9 Conclusion: Our results indicate that partially reduced ABCA3 activity due to E292V is not a major risk factor for reduced lung function and COPD in the general population. Login to comment
20 The E292V mutation * Correspondence: morten.dahl@rh.regionh.dk 1 Department of Clinical Biochemistry, Herlev Hospital, Copenhagen University Hospital, Copenhagen, Denmark 3 Department of Clinical Biochemistry, Rigshospitalet, Copenhagen University Hospital, Blegdamsvej 9, Copenhagen DK-2100, Denmark Full list of author information is available at the end of the article (c) 2012 B&#e6;kvad-Hansen et al. Login to comment
25 Given this, ABCA3 variants, and in particular E292V, could play an important role on development of common pulmonary disorders in the general population. Login to comment
71 H86Y, A320T and A1086D were novel variants, whereas E292V, P766S, S1262G and R1474W have been described previously. Login to comment
76 SIFT and Polyphen both predicted E292V to be damaging, but none of the other six mutations. Login to comment
81 Individuals heterozygous for E292V had 5% reduced FEV1 % predicted (t-test:p = 0.008), 3% reduced FVC % predicted (p = 0.04) and 0.02 reduced FEV1/FVC (p = 0.03), compared with wildtypes (Figure 1). Login to comment
93 COPD by ABCA3 genotype in the Copenhagen City Heart Study Individuals heterozygous for E292V had a multivariate adjusted odds ratio for COPD of 1.9 (95% CI 1.1-3.1) compared with wildtypes in the Copenhagen City Heart Study (Figure 2). Login to comment
99 Pulmonary function and COPD by ABCA3 E292V in the Copenhagen General Population Study To further validate the findings for E292V, we genotyped the Copenhagen General Population Study (n = 54,395) for the E292V variant. Login to comment
102 Characteristics did not differ between E292V heterozygotes 60 80 100 120 60 80 100 120 0.6 0.8 Genotype N FEV1 % predicted p FVC % predicted p FEV1/FVC p H86Y Wt 9801 Het 15 0.76 0.91 0.39 E292V Wt 9706 Het 110 0.008 0.04 0.03 A320T Wt 9803 Het 13 0.19 0.27 0.74 P766S Wt 9695 Het 121 0.65 0.42 0.55 A1086D Wt 9802 Het 4 0.03 0.008 0.51 S1262G Wt 9802 Het 14 0.47 0.77 0.53 R1474W Wt 9636 Het 180 0.49 0.20 0.48 SP-B121ins2 Wt 10425 Het 21 0.67 0.68 0.10 b1;1-antitrypsin MM 8082 ZZ 6 0.01 0.55 0.0008 Figure 1 Lung function according to ATP binding cassette member 3 (ABCA3) genotype in the Copenhagen City Heart Study. Login to comment
108 We found that FEV1 % predicted, FVC % predicted, and FEV1/FVC did not differ in E292V heterozygotes vs wildtypes (pࣙ0.67), whereas FEV1 % predicted was reduced in the positive controls, surfactant protein-B 121ins2 heterozygotes and b1;1-antitrypsin ZZ homozygotes. Login to comment
109 In accordance with the results on pulmonary function, the multivariate adjusted odds ratio for COPD was not increased in E292V heterozygotes compared with wildtypes (odds ratio 1.10 (0.83-1.46)), while surfactant protein-B 121ins2 heterozygotes and b1;1-antitrypsin ZZ homozygotes had increased odds ratios for COPD of 2.8 (1.0-8.1) and 6.6 (1.7-26) (Additional file 9). Login to comment
111 In this analysis, we found that FEV1 % predicted, FVC % predicted, and FEV1/FVC did not differ in E292V heterozygotes vs wildtypes (pࣙ0.28), whereas FEV1 % predicted was reduced in the positive controls, surfactant protein-B 121ins2 heterozygotes and b1;1-antitrysin ZZ homozygotes (figure 3). Login to comment
112 We also stratified our data for smoking status, as did our previous study of surfactant protein-B 121ins2 as a risk factor in COPD [12], but found no significant differences in lung Age adjusted Odds ratio (95% confidence interval) 0.1 1 10 Genotype Participants Events H86Y Wt 9801 1080 Het 15 2 E292V Wt 9706 1063 Het 110 19 P766S Wt 9695 1067 Het 121 15 R1474W Wt 9636 1064 Het 180 18 SP-B121ins2 Wt 10427 1209 Het 21 5 b1;1-antitrypsin MM 8082 927 ZZ 6 3 Multi variate adjusted 0.1 1 10 Figure 2 Risk of COPD according to ATP binding cassette member 3 (ABCA3) genotype in the Copenhagen City Heart Study. Login to comment
118 function for E292V. Login to comment
125 We had 80% power to exclude odds ratios for COPD for E292V heterozygotes of 1.3, for surfactant protein-B 121ins2 heterozygotes of 2.1, and for b1;1-antitrypsin ZZ homozygotes of 4.0. Login to comment
129 To validate the findings for 60 80 100 Genotype N FEV1 % predicted P FVC% predicted P FEV1/FVC P All E292V Wt 63391 Het 820 0.28 0.40 0.60 SPB121ins2 Wt 46409 Het 83 0.02 0.07 0.11 b1;1 antitrypsin MM 40066 ZZ 19 0.0008 0.1 9 0.0009 Never smoker E292V Wt 23738 Het 319 0.81 0.99 0.53 SPB121ins2 Wt 16248 Het 36 0.60 0.50 0.70 b1;1 antitrypsin MM 14022 ZZ 9 0.43 0.82 0.67 Smoker E292V Wt 39653 Het 501 0.11 0.26 0.19 SPB121ins2 Wt 30175 Het 47 0.0008 0.01 0.00007 b1;1 antitrypsin MM 26044 ZZ 10 0.0001 0.10 0.0001 60 80 100 0.6 0.8 Figure 3 Lung function according to ATP binding cassette member 3 (ABCA3) E292V, surfactant protein-B 121ins2, and b1;1-antitrypsin ZZ genotypes in the Copenhagen City Heart Study and Copenhagen General Population Study combined, stratified for smoking status. Login to comment
130 Values are mean and standard error. P-values are by Student`s t-test. Lung function according to surfactant protein-B 121ins2 heterozygosity and b1;1-antitrysin ZZ homozygosity serve as positive controls. Numbers of individuals with surfactant protein-B 121ins2 heterozygosity and b1;1-antitrypsin ZZ homozygosity differ slightly from the number of individuals with an ABCA3 E292V genotype due to different number of study subjects available for analysis within the study period. Login to comment
133 Supporting this overall negative result, the estimates for the positive controls, surfactant protein-B 121ins2 heterozygotes and b1;1-antitrypsin ZZ homozygotes, were relatively stable throughout the studies and there was no evidence of selection bias against E292V in any of the two cohorts. Login to comment
134 The phenotype in E292V carriers was previously reported to range from minimal changes on lung biopsy and no symptoms to severe fatal lung disease [8,9]. Login to comment
136 Tobacco smoking [23] and unidentified mutations in surfactant protein-C [24,25], ABCA3 [26], and surfactant protein-B could be risk factors of additionally impaired surfactant function in E292V heterozygotes; although the latter risk factors are probably less prevalent in the general population as compared with tobacco smoking. Login to comment
149 However, no association with N Events N Events N Events E292V Wt 63391 5168 23738 726 39653 4442 Het 820 75 319 10 501 65 SP-B 121ins2 Wt 46423 4735 16248 660 30175 4075 Het 83 15 36 2 47 13 b1;1-antitrypsin MM 40066 3588 14022 454 26044 3134 ZZ 19 6 9 1 10 5 All 0.1 1 10 Never smoker Odds ratio (95% confidence interval) 0.1 1 10 Smoker 0.1 1 10 Figure 4 Risk of COPD according to ATP binding cassette member 3 (ABCA3) E292V, surfactant protein-B 121ins2, and b1;1-antitrypsin ZZ genotypes in the Copenhagen City Heart Study and Copenhagen General Population Study combined, stratified for smoking status. Login to comment
166 Conclusions We found with significant statistical power that ABCA3 E292V heterozygotes do not have reduced lung function or increased risk of COPD in the general population. Login to comment
167 This is an important finding as 1.3% in the Danish general population has partially reduced ABCA3 function due to E292V and since this variant has been linked previously with severe chronic lung disease in E292V heterozygotes and compound heterozygotes. Login to comment
172 Abbreviations ABCA3: ATP-binding cassette member A3; COPD: Chronic obstructive pulmonary disease; E292V: Substitution of valine for glutamic acid at aminoacid-position 292; FEV1: Forced expiratory volume in one second; FVC: Forced vital capacity. Login to comment
295 : Heterozygosity for E292V in ABCA3, lung function and COPD in 64,000 individuals. Login to comment

PMID: 22434821 [PubMed] Kaltenborn E et al: "Respiratory syncytial virus potentiates ABCA3 mutation-induced loss of lung epithelial cell differentiation."

No. Sentence Comment

4 Here, we investigated the impact of the clinically relevant ABCA3 mutations, p.Q215K and p.E292V, by stable transfection of A549 lung epithelial cells. Login to comment
38 For our study, we chose two clinically relevant ABCA3 mutations, namely p.Q215K and p.E292V. Login to comment
39 The p.E292V mutation has a prevalence of 1:277 in the USA, and therefore it is the most common ABCA3 mutation observed in children so far (19). Login to comment
40 In vitro studies reported that ABCA3 p.E292V is properly localized to the LB but only has residual ATPase activity, therefore belonging to the class of functional mutations (20). Login to comment
41 The ABCA3 mutation p.Q215K has been observed in a neonate that died of respiratory distress. Login to comment
42 Immunohistochemical analysis of the lung tissue of this patient who was the compound heterozygote for ABCA3 p.Q215K and p.R288K showed no ABCA3 staining in ATII cells, and electron microscopy revealed the presence of many electron-dense bodies in the absence of LBs (9). Login to comment
45 RESULTS Stable expression of HA-tagged ABCA3 in A549 cells To study the effect of the two clinically relevant ABCA3 mutations p.Q215K and p.E292V on cellular homeostasis, A549 lung epithelial cells were stably transfected with HA-tagged ABCA3. Login to comment
47 While ABCA3 harboring the p.E292V mutation is properly localized to LBs (Fig. 1C), it is functionally impaired (20). Login to comment
51 E-cadherin, a cellular adhesion protein found in adherens junctions and desmosomes, was decreased up to 4-fold in p.Q215K and p.E292V cells when compared with untransfected A549 and cells expressing wild-type (WT) ABCA3 (Fig. 1B, right). Login to comment
53 A549 cells expressing p.Q215K had approximately 2.5-fold decreased amounts of ZO-1. Login to comment
57 In p.Q215K and p.E292V cells, E-cadherin overall appeared to be less abundant, thus confirming the results obtained by western blotting. Login to comment
67 MMP-2 mRNA levels in p.E292V cells were slightly, but not significantly, 2794 increased when compared with WT cells. Login to comment
69 Into supernatants of cells expressing ABCA3-E292V, about one-tenth of this amount was secreted, which was about in the range of non-transfected A549 cells. Login to comment
71 Cells expressing the ABCA3 p.Q215K mutation produce increased amounts of TGF-b1 TGF-b1 is a protein controlling cellular proliferation and differentiation. Login to comment
75 TGF-b1 secretion was not increased in E292V cells. Login to comment
77 Src kinase activation is increased in cells with ABCA3-Q215K mutation Next, we wanted to investigate whether phosphorylation of the tyrosine kinase Src, which has important signaling functions in cell proliferation, motility and cytoskeleton assembly (26), was upregulated in cells with ABCA3 mutations as well. Login to comment
105 The cell morphology of A549 and ABCA3 WT and p.E292V transfected cells also changed slightly after RSV infection. Login to comment
134 After infection with RSV, MMP-2 mRNA levels in p.Q215K and p.E292V cells increased even further when compared with ABCA3-WT, the change being more than 15-fold between p.Q215K and WT and more than 7-fold between p.E292V and WT (Fig. 6A, left and B). Login to comment
150 When MMP-2 protein levels in UV-inactivated samples from non-infected cells were analyzed, the MMP-2 protein amount in untransfected A549 cells and A549 cells transfected with ABCA3 WT and p.E292V decreased below the detection limit. Login to comment
171 Significant changes compared with the corresponding non-infected cells were observed in p.E292V cells for both markers. Login to comment
179 Thus, ER stress does not seem to account for the changes in p.Q215K cell morphology and protein expression as observed after RSV infection when compared with A549 cells expressing ABCA3 WT or p.E292V. Login to comment
229 Interestingly, we and others found decreased levels of mature SP-C protein in immunohistochemistry staining of lung tissue and in lavage samples from patients (compound) heterozygote for the ABCA3 mutations Q215K and E292V (data not shown), respectively (9). Login to comment
275 A549 cells were transfected with the pUB6-ABCA3-WT/Q215K/E292V vectors using ExGene 500 (Fermentas) according to the manufacturer`s protocol. Login to comment
49 While ABCA3 harboring the p.E292V mutation is properly localized to LBs (Fig. 1C), it is functionally impaired (20). Login to comment
59 In p.Q215K and p.E292V cells, E-cadherin overall appeared to be less abundant, thus confirming the results obtained by western blotting. Login to comment
108 The cell morphology of A549 and ABCA3 WT and p.E292V transfected cells also changed slightly after RSV infection. Login to comment
137 After infection with RSV, MMP-2 mRNA levels in p.Q215K and p.E292V cells increased even further when compared with ABCA3-WT, the change being more than 15-fold between p.Q215K and WT and more than 7-fold between p.E292V and WT (Fig. 6A, left and B). Login to comment
153 When MMP-2 protein levels in UV-inactivated samples from non-infected cells were analyzed, the MMP-2 protein amount in untransfected A549 cells and A549 cells transfected with ABCA3 WT and p.E292V decreased below the detection limit. Login to comment
174 Significant changes compared with the corresponding non-infected cells were observed in p.E292V cells for both markers. Login to comment
182 Thus, ER stress does not seem to account for the changes in p.Q215K cell morphology and protein expression as observed after RSV infection when compared with A549 cells expressing ABCA3 WT or p.E292V. Login to comment
232 Interestingly, we and others found decreased levels of mature SP-C protein in immunohistochemistry staining of lung tissue and in lavage samples from patients (compound) heterozygote for the ABCA3 mutations Q215K and E292V (data not shown), respectively (9). Login to comment
278 A549 cells were transfected with the pUB6-ABCA3-WT/Q215K/E292V vectors using ExGene 500 (Fermentas) according to the manufacturer`s protocol. Login to comment

PMID: 22145626 [PubMed] Hartel C et al: "ATP-binding cassette member A3 (E292V) gene mutation and pulmonary morbidity in very-low-birth-weight infants."

No. Sentence Comment

5 Term infants carrying the E292V missense mutation of the gene encoding ABCA3 are likely to develop respiratory distress syndrome, and the mutation has also been linked to interstitial lung disease in paediatric patients. Login to comment
6 The aim of this study was to investigate the association of the E292V genotype with pulmonary morbidity in a large cohort of very-low-birth-weight (VLBW) infants. Methods: We performed a genetic association study with a prospective, population-based multi-centre cohort of 3177 VLBW infants born in 16 German study centres between 2003 and 2009 (German Neonatal Network). Login to comment
8 Results: In a large cohort of 3177 VLBW infants, 11 individuals were found to be heterozygote for the E292V mutation (0.34%). Login to comment
10 Conclusions: Within the size limits of our study cohort, the ABCA3 missense mutation E292V had no remarkable effect on pulmonary outcome in VLBW infants. Login to comment
11 Present results do not rule out the possibility that E292V phenotype is associated with minor difference in the morbidity. Login to comment
16 Recently, several studies have linked ABCA3 gene mutations with lung disease in neonates and 1 Key notes • ATP-binding cassette member A 3 (ABCA3) plays a critical role for the transport of surfactant phospholipids, and the E292V missense mutation of the ABCA3 gene has been linked to pulmonary morbidity. Login to comment
18 • 11 individuals were found to be heterozygote for the E292V mutation (0.34%); however, no remarkable effect on pulmonary outcome was noted. Login to comment
20 The E292V missense mutation was found to be over-represented in a cohort of term infants with RDS (7). Login to comment
21 This particular mutation consists of a thymine for adenine substitution at cDNA position 875 (first codon of exon 9) and causes substitution of valine (mutation) for glutamic acid (wildtype) in codon 292 (E292V, new recognition site for the restriction endonuclease BsrG1; 8). Login to comment
22 Bullard et al. (8) also noted an association between the E292V mutation and interstitial lung disease in children. Login to comment
26 In this study, we hypothesized that the ABCA3 E292V is a potential candidate mutation to influence short-term pulmonary outcome in a multi-centre cohort of 3177 VLBW infants. METHODS Genetic association study We prospectively studied the influence of the ABCA3 E292 V on pulmonary outcome in 3177 VLBW infants enrolled in a multi-centre trial involving 16 neonatal intensive care units in Germany from April 2003 until December 2009. Login to comment
33 BsrG1 restriction enzyme analysis was used to detect the E292V mutation according to previously published reports by means of restriction fragment length polymorphism-PCR (7,8). Login to comment
37 Table 1 Clinical characteristics of the very-low-birth-weight cohort stratified to ABCA3 genotype ABCA3 E292E (total) ABCA3 E292V (total) p ABCA3 E292E (<30 weeks) ABCA3 E292V (<30 weeks) p Number of infants 3166 11 2048 6 Gestational age (mean / median / range weeks) 28.8 / 28.8 / 22.0-36.4 28.9 / 28.6 / 24.1-33.1 0.52 27.2 / 27.4 / 22.0-29.8 26.6 / 26.6 / 24.1-28.6 0.32 Birth weight (mean / median, g) 1073 / 1100 / 295-1495 1042 / 1020 / 615-1490 0.71 951 / 940 / 295-1495 866 / 825 / 615-1170 0.42 Gender (male, %) 51.0 54.5 1.0 52.4 66.7 0.7 Multiples (%) 27.3 32.6 1.0 29.8 33.3 1.0 Inborn (%) 92.7 88.8 0.49 92.4 80.0 0.33 Antenatal steroids (%) 86.4 100 0.38 88.7 100 1.0 Death (%) 2.4 9.1 0.24 3.4 16.7 0.18 IVH (%) 17.7 36.3 0.08 23.8 66.7 0.03 Grade I 7.2 10.0 8.8 16.7 Grade II 4.1 10.0 6.0 16.7 Grade III 2.8 10.0 4.0 16.7 Grade IV 3.6 10.0 5.0 16.7 Sepsis (%) 16.5 18.2 0.7 22.1 33.3 0.62 OP (%) 13.4 9.1 1.0 19.2 16.7 1.0 Duration hospital stay (mean / median / range, days) 71.8 / 66 / 1-387 67.3 / 64 / 3-125 0.74 84.4 / 80 / 1-387 85.2 / 103 / 3-125 0.46 Maternal descendence Germany (%) 74.5 90.9 0.84 71.6 83.3 0.9 Europe / Russia (%) 10.7 9.1 11.5 16.7 Middle East / Turkey (%) 10.0 0 11.1 0 IVH intraventricular haemorrhage; sepsis: clinical sepsis with positive blood culture; OP: any surgical intervention for necrotizing enterocolitis or focal intestinal perforation, retinopathy of prematurity, persistent Ductus arteriosus, hydrocephalus. Login to comment
38 RESULTS In a large cohort of 3177 VLBW infants, 11 individuals carried the E292V mutation (0.34%). Login to comment
42 When we analysed a subgroup of infants <30 weeks of gestation, infants carrying the E292V mutation had a higher risk for development of IVH and tended to be more frequently and longer ventilated than infants without the mutation. Login to comment
45 DISCUSSION This is the first large-scale cohort of VLBW infants studied for the influence of the ABCA3 E292V mutation on pulmonary morbidity. Login to comment
53 ABCA3 (E292V) and pulmonary morbidity in VLBW infants Ha¨rtel et al. ª2011 The Author(s)/Acta Pædiatrica ª2011 Foundation Acta Pædiatrica 2012 101, pp. 380-383 infants were born after Caesarean section. Login to comment
57 We would like to illustrate this by a post hoc power analysis: If the rate of 'death or BPD`, which was 15% in infants not carrying the ABCA3-E292V, would have been 50% in carriers of the mutation, 3000 infants would have been sufficient to test the difference. Login to comment
59 Therefore present results do not rule out the possibility that E292V phenotype is associated with some difference in the morbidity. Login to comment
60 Besides statistical limitations of our study, there may be ethnic differences relating to other interactive genes expressed in alveolar epithelium or to haplotypes associated with E292V genotype that influence the risk. Login to comment
65 Garmany et al. (7) noted a high incidence of respiratory dysfunction (BPD, mechanical ventilation >1 year) in the two most immature infants (26 and 29 gestational weeks) with E292V; however, this was not confirmed in our cohort (Tables 2 and 3). Login to comment
70 In conclusion, we were not able to confirm an attributable risk of the genetically disruptive ABCA3 mutation E292V on pulmonary outcome in VLBW infants. Login to comment

PMID: 22068586 [PubMed] Flamein F et al: "Molecular and cellular characteristics of ABCA3 mutations associated with diffuse parenchymal lung diseases in children."

No. Sentence Comment

27 For instance, the heterozygous c.875A.T (p.Glu292Val, p.E292V) ABCA3 mutation was identified in several older children and young adults with desquamative interstitial pneumonitis (1). Login to comment
29 For instance, the heterozygous c.875A.T (p.Glu292Val, p.E292V) ABCA3 mutation was identified in several older children and young adults with desquamative interstitial pneumonitis (1). Login to comment

PMID: 22236549 [PubMed] Epaud R et al: "[Genetic disorders of surfactant]."

No. Sentence Comment

145 Le séquenc ¸age d`ABCA3 est plus complexe du fait de la longueur du gène (30 exons à séquencer) mais devrait se développer avec la généralisation du séquenc ¸age haut débit. Le diagnostic est simple et sans ambiguïté pour les mutations fréquentes (121ins2 pour SFTPB, I73T pour SFTPC et E292V pour ABCA3). Login to comment
146 Le s&#e9;quenc &#b8;age d`ABCA3 est plus complexe du fait de la longueur du g&#e8;ne (30 exons &#e0; s&#e9;quencer) mais devrait se d&#e9;velopper avec la g&#e9;n&#e9;ralisation du s&#e9;quenc &#b8;age haut d&#e9;bit. Le diagnostic est simple et sans ambigu&#ef;t&#e9; pour les mutations fr&#e9;quentes (121ins2 pour SFTPB, I73T pour SFTPC et E292V pour ABCA3). Login to comment

PMID: 20863830 [PubMed] Engelbrecht S et al: "The surfactant lipid transporter ABCA3 is N-terminally cleaved inside LAMP3-positive vesicles."

No. Sentence Comment

34 Two ABCA3 point mutations Q215K and E292V were introduced into WT hABCA3 by site-directed mutagenesis (Stratagene). Login to comment
90 We used two ILD-related ABCA3 mutations (Supplementary Fig. 1): Q215K, a misfolding defect studied here for the first time, and E292V, a functional mutation [10], to prove that the ER retention in general, regardless of the cause (mutation as intrinsic cause or enforced processing impairment, Fig. 2) hinders the ABCA3 maturation. Login to comment
91 Localization studies in A549 cells stably expressing WT, Q215K or E292V proteins with C-terminal HA-tag showed that the E292V mutant colocalized properly with the MVB/LB protein LAMP3 (Fig. 4A) but not with the ER protein calnexin (Fig. 4B). Login to comment
93 Immunodetection of WT, Q215K and E292V proteins via HA-tag demonstrated that the ER retained Q215K protein completely lacked the 150 kDa band, which was strongly present in the MVB/LB-localized WT Fig. 2. Login to comment
98 Results of three independent experiments are presented; *P < 0.05, **P < 0.01, ***P < 0.001. and E292V proteins (Fig. 4C). Login to comment
125 WT ABCA3 and two mutants E292V and Q215K (all C-terminal HA-tag) were stably expressed in A549 cells. Login to comment
126 HA-tag immunofluorescence of WT and E292V (green) showed their correct LAMP3-colocalization (A, red) while Q215K mutant (green) remained in the ER colocalizing with calnexin (B, red). Login to comment
137 The ER retained mutation Q215K, which completely lacks the 150 kDa band, does not support the biogenesis of LAMP3-positive vesicles (Fig. 4, red signal) in A549 cells, while WT protein and even E292V mutant that has reduced ATP hydrolysis capacity [10] both do. Login to comment
139 Instead accumulation of the lower 150 kDa band, a process that includes N-terminal cleavage, is necessary for at least partial ABCA3 function (Fig. 4, E292V mutation). Login to comment

PMID: 20371530 [PubMed] Crossno PF et al: "Identification of early interstitial lung disease in an individual with genetic variations in ABCA3 and SFTPC."

No. Sentence Comment

88 Previously, Bullard and Nogee7 analyzed children with I73T SFTPC mutation-associated ILD and found heterozygous ABCA3 mutations in three of four individuals-two with E292V (glutamic acid-to-valine) and one with L212M (leucine-to-methionine). Login to comment

PMID: 22087432 [PubMed] Nogee LM et al: "Genetic Basis of Children's Interstitial Lung Disease."

No. Sentence Comment

38 Ablation of the β chain in mice resulted in the phenotype of PAP in either preclude ABCA3 production or intracellular transport (type I), or impair the ability of protein to bind and/or hydrolyze ATP or transport phospholipids across membranes (type II).69-72 One specific mutation, the substitution of valine for glutamic acid in codon 292 (p.E292V or c.875A>T) has been identified in multiple unrelated children with generally milder disease and the phenotype of chILD. Login to comment

PMID: 19861431 [PubMed] Park SK et al: "Identification and characterization of a novel ABCA3 mutation."

No. Sentence Comment

87 The R295C mutation is located in the first ICL (ICL-1) of the protein (Fig. 2A) and is adjacent to the previously reported mutant E292V (2). Login to comment
99 Type I mutations include L101P, L982P, L1553P, and Q1591P; type II mutations include E292V, N568D, E690K, T1114, G1221S, and L1580P (13, 14). Login to comment
110 The level of the ABCA3-R295C-GFP mutant protein was comparable to that of wild-type ABCA3-GFP as demonstrated in the anti-GFP immunoblot. Login to comment
111 Vanadate-induced nucleotide trapping was also decreased in the N568D mutant as reported previously (14). Login to comment
115 Other mutations in the ABCA3 protein also result in impaired ATP hydrolysis, including E292V, N568D, G1221S, L1580P, and T1114M (13, 14). Login to comment
116 The E292V mutation is in ICL-1 only three amino acids from the R295C mutation. Login to comment
146 Interestingly, the frequency of individuals heterozygous for the E292V mutation is elevated in a cohort of children with RDS, suggesting that a mutation in this region might impart increased genetic risk for respiratory insufficiency, even in heterozygotes (9). Login to comment
82 The R295C mutation is located in the first ICL (ICL-1) of the protein (Fig. 2A) and is adjacent to the previously reported mutant E292V (2). Login to comment
94 Type I mutations include L101P, L982P, L1553P, and Q1591P; type II mutations include E292V, N568D, E690K, T1114, G1221S, and L1580P (13, 14). Login to comment
142 Interestingly, the frequency of individuals heterozygous for the E292V mutation is elevated in a cohort of children with RDS, suggesting that a mutation in this region might impart increased genetic risk for respiratory insufficiency, even in heterozygotes (9). Login to comment

PMID: 19824815 [PubMed] Whitsett JA et al: "Alveolar surfactant homeostasis and the pathogenesis of pulmonary disease."

No. Sentence Comment

87 Less frequently, milder ABCA3 mutations (for example, E292V) are associated with chronic lung disease with features of ILD, desquamative interstitial pneumonitis, and nonspecific interstitial pneumonitis presenting in childhood (26, 27). Login to comment
92 Less frequently, milder ABCA3 mutations (for example, E292V) are associated with chronic lung disease with features of ILD, desquamative interstitial pneumonitis, and nonspecific interstitial pneumonitis presenting in childhood (26, 27). Login to comment

PMID: 20461691 [PubMed] Szczawinska-Poplonyk A et al: "[Interstitial lung disease associated with surfactant protein B and C deficiencies]."

No. Sentence Comment

70 Mutacje ABCA3, dziedziczone autosomalnie recesyw- nie i identyczne u wszystkich opisanych pacjentów - w allelu E292V, cechują się zróżnicowaną manifestacją kliniczną - od fatalnego przebiegu w okresie noworodkowym, po rozwój ILD w dzieciństwie [23]. Login to comment

PMID: 19148933 [PubMed] Abou Taam R et al: "Familial interstitial disease with I73T mutation: A mid- and long-term study."

No. Sentence Comment

39 The SFTPC gene screening and ABCA3 E292V research were performed routinely. Login to comment
51 The ABCA3 E292V mutation was negative for all tested cases: II:4, III:4, III:8, III:9, III:10, and IV:1. Login to comment
119 The E292V mutation has not been found in our patients. Login to comment

PMID: 18676873 [PubMed] Matsumura Y et al: "Aberrant catalytic cycle and impaired lipid transport into intracellular vesicles in ABCA3 mutants associated with nonfatal pediatric interstitial lung disease."

No. Sentence Comment

12 E292V (intracellular loop 1), E690K (adjacent to Walker B motif in nucleotide binding domain 1), and T1114M (8th putative transmembrane segment) mutant proteins are localized mainly in intracellular vesicle membranes as wild-type protein. Login to comment
13 Lipid analysis and sucrose gradient fractionation revealed that the transport function of E292V mutant protein is moderately preserved, whereas those of E690K and T1114M mutant proteins are severely impaired. Login to comment
24 On the other hand, patients with the common missense mutation E292V and a second, specific mutation such as E690K or T1114M develop pediatric interstitial lung disease (pILD), the phenotype of which is milder than that of fatal surfactant deficiency, suggesting that the E292V ABCA3 mutation is responsible for the development of pILD (4). Login to comment
26 In this study, we characterized E292V, E690K, and T1114M mutant ABCA3 proteins identified in pILD. Login to comment
29 The plasmid pEGFPN1-ABCA3 (17), which encodes ABCA3 protein fused with enhanced green fluorescent protein (GFP) at the COOH terminus (ABCA3-GFP), and its mutants containing pILD mutations (E292V, E690K, and T1114M) and other site-directed mutations (E292D, E292K, T1114S, E690D, and E690R) were generated as described previously and used for transient transfection experiment. Login to comment
90 The E292V, E690K, and T1114M mutations identified in pILD (4) are located at intracellular loop 1 (ICL-1), adjacent to the Walker B motif in NBD-1 and the 8th putative transmembrane segment (TM-8), respectively (Fig. 1A). Login to comment
91 When E292V, E690K, and T1114M mutant ABCA3-GFP proteins were transiently expressed in HEK-293 cells, most of the GFP fluorescence was located at intracellular vesicles, as with the wild-type protein (Fig. 1B). Login to comment
97 In the E292V, E690K, and T1114M mutant proteins, 50-60% of the 220-kDa protein remained as Endo H-insensitive complex-type protein (Fig. 1E), indicating that intracellular trafficking and processing of oligosaccharide of these mutant proteins are largely preserved and that these mutations are not type I mutations. Login to comment
107 B: intracellular localization of GFP, wild-type ABCA3-GFP protein (WT), and its mutants (E292V, E690K, and T1114M) transiently expressed in human embryonic kidney HEK-293 cells were determined by confocal microscopy. Login to comment
117 The level of LAMP3 in E292V transfectant was comparable to that in wild-type transfectant, whereas those in E690K and T1114M transfectants were lower than in wild-type transfectant (Fig. 2A and Supplemental Fig. 1A). Login to comment
123 The levels of choline-phospholipids were significantly increased 1.38- and 1.13-fold in wild-type and E292V transfectants, respectively, compared with the level in HEK-293 cells, whereas levels in E690K and T1114M transfectants were similar to that in HEK-293 cells (Fig. 2B). Login to comment
130 In E292V transfectant, choline-phospholipid content in fractions 2-4 was higher than that in HEK-293 cells and lower than that in wild-type transfectant. Login to comment
132 In T1114M transfectant, choline-phospholipid content in fractions 2-4 was somewhat higher than that in HEK-293 cells, but the difference was not statistically significant (n ϭ 4, Supplemental Fig. 1C). Login to comment
133 Considered together, these results suggest that although the lipid transport function of the E292V mutant protein is moderate, those of the E690K and T1114M mutant proteins are severely impaired. Login to comment
136 Lipids transport function of wild-type ABCA3-GFP and pILD mutant proteins. A: Immunoblot analysis of the level of ABCA3-GFP, LAMP3, and GRP78 in HEK-293 cells stably expressing WT ABCA3-GFP, E292V, E690K, T1114M, or untransfected HEK-293 cells. Login to comment
151 In vanadate-induced nucleotide trapping by the E292V and T1114M mutant proteins, ATP hydrolysis with production of a photoaffinity-labeled intermediate was decreased to 40 and 52% of that of wild-type protein, respectively (Fig. 3A, lanes 5, 6, 9, and 10, and B). Login to comment
152 On the other hand, in the E690K mutant protein, it was increased to 200% of that of wild-type protein (Fig. 3A, lanes 7 and 8, and B). Login to comment
156 ATP binding of the E292V and T1114M mutant proteins determined by photoaffinity labeling with 8-azido-[␥-32 P]ATP was similar to that of wild-type ABCA3-GFP protein (Fig. 3, C and D). Login to comment
157 However, in E690K mutant protein, photoaffinity labeling of the 220-kDa protein was similar to that of wild type protein regardless of decreased noncleaved form protein, and photoaffinity labeling of the 180-kDa protein was dramatically enhanced even when the increased levels of the cleaved form of the protein were taken into consideration. Login to comment
161 To investigate the mechanism of loss of ATP hydrolysis with production of a photoaffinity-labeled intermediate in E292V and T1114M mutant proteins, we performed mutational analyses of Glu292 residue in ICL-1 and Thr1114 in putative TM-8. Login to comment
166 A: 20,000-g membrane fraction prepared from HEK-293 cells stably expressing the WT ABCA3-GFP (lanes 3 and 4), E292V (lanes 5 and 6), E690K (lanes 7 and 8), T1114M (lanes 9 and 10), or untransfected HEK-293 cells (lanes 1 and 2) was incubated with 10 ␮M 8-azido-[␣-32 P]ATP in the absence (-) or presence (ϩ) of 0.4 mM orthovanadate (Vi) and 3 mM MgCl2 for 10 min at 37°C. Protein was photoaffinity labeled with UV irradiation after removal of unbound ATP, electrophoresed on SDS-PAGE, and transferred to a PVDF membrane. Login to comment
171 C: 20,000-g membrane fraction prepared from HEK-293 cells stably expressing the WT ABCA3-GFP, E292V, E690K, T1114M, or untransfected HEK-293 cells was incubated with 40 ␮M 8-azido-[␥-32 P] and 3 mM MgCl2 for 10 min at 0°C. Protein was photoaffinity labeled with UV irradiation, immunoprecipitated with anti-human ABCA3 antibody, electrophoresed on SDS-PAGE, and transferred to a PVDF membrane. Membrane was analyzed by FLA-5000 (top) and IB using anti-GFP antibody (bottom). Login to comment
175 L702 CHARACTERIZATION OF ABCA3 MUTANTS ASSOCIATED WITH pILD AJP-Lung Cell Mol Physiol • VOL 295 • OCTOBER 2008 • www.ajplung.org intermediate during ATP hydrolysis was decreased to 37% of that of wild-type protein, as also was the case in E292V mutant protein (Fig. 4B, lanes 5-8, and C). Login to comment
184 Interaction of E690K mutant ABCA3-GFP protein with nucleotides. Login to comment
188 The amino acid residues that are conserved in 6 transporters and in 4 or 5 transporters are indicated by asterisks and dots, respectively. B: 20,000-g membrane fraction prepared from HEK-293 cells stably expressing the WT ABCA3-GFP (lanes 3 and 4), E292V (lanes 5 and 6), E292D (lanes 7 and 8), E292K (lanes 9 and 10), or untransfected HEK-293 cells (lanes 1 and 2) was incubated with 10 ␮M 8-azido-[␣-32 P]ATP in the absence or presence of 0.4 mM Vi and 3 mM MgCl2 for 10 min at 37°C. Protein was photoaffinity labeled with UV irradiation after removal of unbound ATP, electrophoresed on SDS-PAGE, and transferred to a PVDF membrane. Membrane was analyzed by autoradiography (top) and IB using anti-GFP antibody (bottom). Login to comment
230 Although E292V, E690K, and T1114M mutant proteins were found to traffic to intracellular vesicles, the lipid transport function of E292V mutant protein was partially impaired, and those of E690K and T1114M mutant protein were severely impaired, accompanied by an aberrant catalytic cycle. Login to comment
232 Accordingly, E292V, E690K, and T1114M are type II mutations. Login to comment
234 On the other hand, patients carrying a type II/type II ABCA3 mutation (E292V/T1114M or E292V/E690K) exhibit pILD (4), suggesting that the type II/type II ABCA3 mutation produces a milder phenotype. Login to comment
235 Although an exception has been identified in a Japanese patient with a type I/type II ABCA3 mutation (W1148X/T1114A) (37), the moderately preserved lipid transport function of the E292V mutant protein may underlie the generally milder phenotype of pILD patients. Login to comment
237 The E292V mutant protein exhibits moderately preserved lipid transport function and vanadate-induced nucleotide trapping, and mutational analysis of Glu292 in ICL-1 indicates the significance of both negative charge and side chain length of Glu292 for ATP hydrolysis with production of a photoaffinity-labeled intermediate in ABCA3 protein. Login to comment
239 Thus the E292V mutation might impede the transmission of conformational changes, resulting in moderate impairment of lipid transport in ABCA3 protein. Login to comment
252 Genotype-phenotype correlation for ABCA3 mutation ABCA3 Mutation Age of Symptoms Phenotype Ref. W1142X W1142X Neonate FSD 27 L101P L101P Neonate FSD 27 L1553P L1553P Neonate FSD 27 Ins1518 L1580P Neonate FSD 27 L982P G1221S Neonate FSD 27 E292V T1114M Neonate pILD 4 E292V E690K 5 or 7 yr pILD 4 W1148X T1114A 12 mo pILD 37 Type I and type II ATP binding cassette A3 (ABCA3) mutations are shown in italics and roman, respectively. Login to comment
265 Interestingly, in E690K mutant protein, the amount of 180-kDa cleaved form was increased compared with that of wild-type protein. Login to comment
268 In summary, the moderately preserved lipid transport function of E292V mutant protein may be responsible for the milder phenotype in pILD caused by ABCA3 mutation compared with that in fatal surfactant deficiency. Login to comment
7 E292V (intracellular loop 1), E690K (adjacent to Walker B motif in nucleotide binding domain 1), and T1114M (8th putative transmembrane segment) mutant proteins are localized mainly in intracellular vesicle membranes as wild-type protein. Login to comment
8 Lipid analysis and sucrose gradient fractionation revealed that the transport function of E292V mutant protein is moderately preserved, whereas those of E690K and T1114M mutant proteins are severely impaired. Login to comment
19 On the other hand, patients with the common missense mutation E292V and a second, specific mutation such as E690K or T1114M develop pediatric interstitial lung disease (pILD), the phenotype of which is milder than that of fatal surfactant deficiency, suggesting that the E292V ABCA3 mutation is responsible for the development of pILD (4). Login to comment
21 In this study, we characterized E292V, E690K, and T1114M mutant ABCA3 proteins identified in pILD. Login to comment
86 The E292V, E690K, and T1114M mutations identified in pILD (4) are located at intracellular loop 1 (ICL-1), adjacent to the Walker B motif in NBD-1 and the 8th putative transmembrane segment (TM-8), respectively (Fig. 1A). Login to comment
87 When E292V, E690K, and T1114M mutant ABCA3-GFP proteins were transiently expressed in HEK-293 cells, most of the GFP fluorescence was located at intracellular vesicles, as with the wild-type protein (Fig. 1B). Login to comment
93 In the E292V, E690K, and T1114M mutant proteins, 50-60% of the 220-kDa protein remained as Endo H-insensitive complex-type protein (Fig. 1E), indicating that intracellular trafficking and processing of oligosaccharide of these mutant proteins are largely preserved and that these mutations are not type I mutations. Login to comment
103 B: intracellular localization of GFP, wild-type ABCA3-GFP protein (WT), and its mutants (E292V, E690K, and T1114M) transiently expressed in human embryonic kidney HEK-293 cells were determined by confocal microscopy. Login to comment
113 The level of LAMP3 in E292V transfectant was comparable to that in wild-type transfectant, whereas those in E690K and T1114M transfectants were lower than in wild-type transfectant (Fig. 2A and Supplemental Fig. 1A). Login to comment
119 The levels of choline-phospholipids were significantly increased 1.38- and 1.13-fold in wild-type and E292V transfectants, respectively, compared with the level in HEK-293 cells, whereas levels in E690K and T1114M transfectants were similar to that in HEK-293 cells (Fig. 2B). Login to comment
126 In E292V transfectant, choline-phospholipid content in fractions 2-4 was higher than that in HEK-293 cells and lower than that in wild-type transfectant. Login to comment
129 Considered together, these results suggest that although the lipid transport function of the E292V mutant protein is moderate, those of the E690K and T1114M mutant proteins are severely impaired. Login to comment
147 In vanadate-induced nucleotide trapping by the E292V and T1114M mutant proteins, ATP hydrolysis with production of a photoaffinity-labeled intermediate was decreased to 40 and 52% of that of wild-type protein, respectively (Fig. 3A, lanes 5, 6, 9, and 10, and B). Login to comment
162 A: 20,000-g membrane fraction prepared from HEK-293 cells stably expressing the WT ABCA3-GFP (lanes 3 and 4), E292V (lanes 5 and 6), E690K (lanes 7 and 8), T1114M (lanes 9 and 10), or untransfected HEK-293 cells (lanes 1 and 2) was incubated with 10 òe;M 8-azido-[ॷ-32 P]ATP in the absence (afa;) or presence (af9;) of 0.4 mM orthovanadate (Vi) and 3 mM MgCl2 for 10 min at 37&#b0;C. Protein was photoaffinity labeled with UV irradiation after removal of unbound ATP, electrophoresed on SDS-PAGE, and transferred to a PVDF membrane. Login to comment
167 C: 20,000-g membrane fraction prepared from HEK-293 cells stably expressing the WT ABCA3-GFP, E292V, E690K, T1114M, or untransfected HEK-293 cells was incubated with 40 òe;M 8-azido-[ॹ-32 P] and 3 mM MgCl2 for 10 min at 0&#b0;C. Protein was photoaffinity labeled with UV irradiation, immunoprecipitated with anti-human ABCA3 antibody, electrophoresed on SDS-PAGE, and transferred to a PVDF membrane. Membrane was analyzed by FLA-5000 (top) and IB using anti-GFP antibody (bottom). Login to comment
227 Although E292V, E690K, and T1114M mutant proteins were found to traffic to intracellular vesicles, the lipid transport function of E292V mutant protein was partially impaired, and those of E690K and T1114M mutant protein were severely impaired, accompanied by an aberrant catalytic cycle. Login to comment
229 Accordingly, E292V, E690K, and T1114M are type II mutations. Login to comment
231 On the other hand, patients carrying a type II/type II ABCA3 mutation (E292V/T1114M or E292V/E690K) exhibit pILD (4), suggesting that the type II/type II ABCA3 mutation produces a milder phenotype. Login to comment
236 Thus the E292V mutation might impede the transmission of conformational changes, resulting in moderate impairment of lipid transport in ABCA3 protein. Login to comment
249 Genotype-phenotype correlation for ABCA3 mutation ABCA3 Mutation Age of Symptoms Phenotype Ref. W1142X W1142X Neonate FSD 27 L101P L101P Neonate FSD 27 L1553P L1553P Neonate FSD 27 Ins1518 L1580P Neonate FSD 27 L982P G1221S Neonate FSD 27 E292V T1114M Neonate pILD 4 E292V E690K 5 or 7 yr pILD 4 W1148X T1114A 12 mo pILD 37 Type I and type II ATP binding cassette A3 (ABCA3) mutations are shown in italics and roman, respectively. Login to comment

PMID: 18804975 [PubMed] Epaud R et al: "[Lung diseases associated with inherited disorders of surfactant metabolism]."

No. Sentence Comment

35 Un de ´ficit en ABCA3 a e ´te ´ identifie ´ chez un patient et 3 patients portaient la mutation p.Glu292Val a ` l`e ´tat he ´te ´rozygote. Login to comment
128 La mutation p.Glu292Val a ` e ´te ´ trouve ´e a ` l`e ´tat he ´te ´rozygote chez plusieurs enfants pre ´sentant une pneumonie interstitielle chronique [9] et, plus re ´cemment, des mutations d`ABCA3 ont e ´te ´ trouve ´es a ` l`e ´tat he ´te ´rozygote associe ´es a ` d`autres mutations (SP-C) dans des pathologies interstitielles ou alve ´olo- interstitielles de l`enfant [9]. Login to comment

PMID: 18603241 [PubMed] Shanklin DR et al: "Cerebropulmonary dysgenetic syndrome."

No. Sentence Comment

3 Autopsy revealed severe interstitial pulmonary fibrosis at age 8 days with heterozygotic mutation p.E292V of ABCA3 and severe dystrophic retardation of cerebral cortex and cerebellum. Login to comment
56 Genetic report From Ambry Genetics (Aliso Viejo, CA): heterozygotic mutation of ABCA3 full gene, known mutation p.E292V, the same mutation found in case #8 of Somaschini et al. (2007), in 10 of 11 patients reported by Bullard et al. (2005) but not by Matsumura et al. (2006) or Shulenin et al. (2004). Login to comment
85 The ABCA3 sequence is highly conserved in humans, rats, and mice in the region of the E292V mutation (Bullard et al., 2005), enhancing the validity of applying the results of Tachikawa et al. (2005) in mice to the scope of disorders here described as the cerebropulmonary dysgenetic syndrome. Login to comment
90 Bullard et al. (2005), described three older individuals (ages 11,16, and 23 years) with the same missense mutation, E292V, found in our index patient, with a second mutation. Login to comment
55 Genetic report From Ambry Genetics (Aliso Viejo, CA): heterozygotic mutation of ABCA3 full gene, known mutation p.E292V, the same mutation found in case #8 of Somaschini et al. (2007), in 10 of 11 patients reported by Bullard et al. (2005) but not by Matsumura et al. (2006) or Shulenin et al. (2004). Login to comment
84 The ABCA3 sequence is highly conserved in humans, rats, and mice in the region of the E292V mutation (Bullard et al., 2005), enhancing the validity of applying the results of Tachikawa et al. (2005) in mice to the scope of disorders here described as the cerebropulmonary dysgenetic syndrome. Login to comment
89 Bullard et al. (2005), described three older individuals (ages 11,16, and 23 years) with the same missense mutation, E292V, found in our index patient, with a second mutation. Login to comment

PMID: 18628224 [PubMed] Young LR et al: "Usual interstitial pneumonia in an adolescent with ABCA3 mutations."

No. Sentence Comment

70 that have been studied in vitro have been associated with abnormal ABCA3 intracellular trafficking and/or function, indicating that it is loss of ABCA3 function that is responsible for lung disease.14,15 One missense mutation, E292V, was identified in multiple unrelated children who were compound heterozygotes for ABCA3 mutations and who had milder lung disease, suggesting that some ABCA3 genotypes may predict phenotype.6 The ABCA3 variants identified in this patient of Spanish ancestry have not been previously reported. Login to comment
73 that have been studied in vitro have been associated with abnormal ABCA3 intracellular trafficking and/or function, indicating that it is loss of ABCA3 function that is responsible for lung disease.14,15 One missense mutation, E292V, was identified in multiple unrelated children who were compound heterozygotes for ABCA3 mutations and who had milder lung disease, suggesting that some ABCA3 genotypes may predict phenotype.6 The ABCA3 variants identified in this patient of Spanish ancestry have not been previously reported. Login to comment

PMID: 18317237 [PubMed] Garmany TH et al: "Population and disease-based prevalence of the common mutations associated with surfactant deficiency."

No. Sentence Comment

2 We resequenced the ATP-binding cassette member A3 gene (ABCA3) in E292V carriers and computationally inferred ABCA3 haplotypes. Login to comment
3 The population-based frequencies of 121ins2, E292V, and I73T were rare (Ͻ0.4%). Login to comment
4 E292V was present in 3.8% of newborns with RDS, a 10-fold greater prevalence than in the Missouri cohort (p Ͻ 0.001). Login to comment
5 We did not identify other loss of function mutations in ABCA3 among patients with E292V that would account for their RDS. Login to comment
6 E292V occurred on a unique haplotype that was derived from a recombination of two common ABCA3 haplotypes. Login to comment
7 E292V was over-represented in newborns with RDS suggesting that E292V or its unique haplotype impart increased genetic risk for RDS. Login to comment
20 A missense mutation which introduces a valine for glutamic acid substitution at codon 292 (E292V), when associated with another mutation on the other ABCA3 allele, has been described in older, unrelated children with chronic lung disease (16). Login to comment
28 The frequencies of I73T and E292V in this population, and the frequencies of the three common surfactant pathway mutations in other geographically and ethnically diverse populations are unknown, as are their contributions to respiratory distress syndrome (RDS) in unselected populations of symptomatic newborns. Login to comment
46 We used BsrG1 restriction enzyme analysis to screen for E292V after amplifying a 682 base pair nucleotide fragment of exon 8 that contained the adenine to thymine transversion (16)(supplemental material, online). Login to comment
47 To determine whether those newborns with E292V and RDS carried other unique, functionally disruptive mutations in ABCA3, we then amplified and sequenced 2 kb of the promoter region, the 30 coding and 2 noncoding exons, and splice site junctions of ABCA3 for all 11 infants heterozygous for E292V and for 12 race and gestational age matched CON infants from the case-control cohort. Login to comment
51 To determine whether the E292V mutation occurred on a common haplotype background, we computationally inferred ABCA3 haplotypes using a Bayesian approach implemented in the PHASE computer software, and the 29 detected variants with minor allele frequency Ն5% (18). Login to comment
64 We found E292V in 0.3-0.4% of the predominantly European descent cohorts (Norway and Missouri) but in Ͻ0.1% of the Asian or African descent cohorts (Table 2). Login to comment
67 In contrast, the prevalence of E292V in the RDS cohort was 10-fold higher than that in the Missouri cohort (3.8%, p Ͻ 0.001); the prevalence of E292V in the CON cohort was not different from that of the Missouri cohort (1.1%, p ϭ 0.2). Login to comment
68 One set of twins in each of the CON and RDS groups was positive for E292V. Login to comment
69 No patient heterozygous for E292V in the RDS group carried SNPs that would be predicted to disrupt splice site junctions or alter ABCA3 protein sequence (Table 4), nor were any large insertions or deletions detected. Login to comment
75 Among the 15 ABCA3 haplotypes computationally inferred from the E292V and control cohorts (n ϭ 23), we identified two common haplotypes among the 35 alleles that did not carry E292V: haplotype 1 with 13 (37%) and haplotype 2 with 9 (26%) (Table 5). Login to comment
76 Among the 11 E292V carrying alleles, we identified one common haplotype (n ϭ 8) and three unique haplotypes. Login to comment
77 The E292V haplotypes have two distinct blocks in common with each of the two most common nonE292V haplotypes: a 5-7 locus block from intron 1 to exon 9, seen in haplotype 2, and a 23-25 locus block from intron 8 through intron 28, seen in haplotype 1. Login to comment
81 was not seen in the absence of E292V, suggesting that E292V arose in conjunction with a recombination event between these two blocks and further suggests that the disease effect, if any, may not be solely because of E292V, but the unique combination of associated variants along the gene. Login to comment
82 To assess whether E292V is associated with unique RDS characteristics, we compared demographic and clinical features in groups of RDS infants with and without E292V. Login to comment
83 Although the size of the cohort rendered limited statistical detection power, it appeared that the infants with E292V had a higher incidence of pneumothoraces (Table 6). Login to comment
84 The two most immature newborns with E292V (29 and 26 wk gestation) had evidence of more respiratory dysfunction (mechanical ventilation for Ͼ1 y and death because of chronic lung disease at 8 mo, respectively) than observed in newborn of similar gestational ages without E292V. Login to comment
86 Exonic and splice site SNPs identified in subjects with E292V Subject Race/Sex SNP(s)* Location Number of non-E292V controls with variant BW (kg) GA (wks) Outcome CON1 B/M Rs170447 (A)† Ex 13 ϩ30 1 3.6 41 Rs323043 ͓P585P͔ (B)† Ex 14 7 CON2 W/F A, B 2.6 37 RDS1 W/M A, B 3.6 38 PTX; vent 4 d, O2 5 d; discharged RA RDS2A W/F A, B 2.3 35 Vent 10 d, O2 5 d; discharged RA RDS2B W/F B 2.1 35 PTX; vent 14 d, O2 4 d; discharged RA RDS3 W/M 16669 Ex 5 -11 2 Vent 1 y, O2 1 y A Rs313908 Ex 18 -33 0 Rs313909 Ex 18 ϩ34 0 Rs149532 ͓S1372͔ Ex 26 0 RDS4 W/M B 2.9 37 PTX; vent 10 d, O2 6 d; discharged RA RDS5 W/M 45305 Ex 17 -17 1 3.8 36 Vent 4 d, O2 1 d; discharged RA RDS6 W/F Rs149532 ͓S1372S͔ Ex 26 0 2.5 33 Vent for 12 d, O2 for 18 d, then RA; died at 8 wks, non respiratory causes RDS7 W/F 21289 ͓A227A͔ Ex 7 1 3.1 39 CPAP for 2 d, Rs13332547 Ex 9 -20 3 O2 for 4 d; discharged RA Rs13332514 ͓F353F͔ Ex 9 3 RDS8 W/M None 0.7 26 Died at 8 mo, entirely vent dependent RDS9 W/M None 2.6 37 PTX, vent for 13 d, O2 for 6 mo * rs numbers through dbSNP (http://www.ncbi.nlm.nih.gov/SNP); if no rs number available, then the number refers to the genomic location from the ABCA3 sequence generated by Seattle SNPs (http://pga.gs.washington.edu/data/abca3/abca3.ColorFasta.html). Login to comment
91 Population-based frequencies Norway South Africa-black Korea Missouri Overall p value across cohorts 121ins2 3/2501 (0.1%) 0/2044 (0%) 0/2596 (0%) 8/10,044 (0.08%)* 0.2 I73T - - - 0/4464 (0%) - E292V 8/2515 (0.3%) 0/1686 (0%) 0/1541 (0%) 4/1107 (0.4%) 0.004 * Reported in Ref. 17. Login to comment
93 Disease-based frequencies CON (N ϭ 181) RDS (N ϭ 239) p value* between groups 121ins2 0 1 (0.4%) 1.0 I73T 0 0 - E292V 2 (1%) 9 (3.8%) 0.12 * Fisher`s exact probabilities. Login to comment
99 We only screened for E292V in ABCA3, and, whereas the E292V carrier frequency is 3- to 5-fold higher than 121ins2 or I73T carrier frequencies in population-based cohorts of primarily European descent (Norway and Missouri) and we cannot exclude the possibility that other mutations in ABCA3 are just as common, the 10-fold enrichment in E292V prevalence in our RDS cohort suggests that E292V may increase the risk and/or severity of RDS in susceptible newborns. Login to comment
101 Although disease-causing variants other than 121ins2 and E292V in SFTPB and ABCA3 are highly prevalent in cohorts of infants selected for lethal respiratory distress, they have primarily been identified in single individuals or families (3,14,26). Login to comment
106 The mechanism by which E292V may disrupt surfactant synthesis is unknown. Login to comment
109 Computational haplotypes identified in 23 individuals Group Haplotype # Haplotype Alleles, N (%)* nonE292V 1 CCGACCCCGGCAATCCGAAACTACAGGGTA 13 (37) 1a CCGACCCCGGCADCTCCAAAGCACTGGGCC 1 (3) 1b CCGACCCCGGCGDCTGCGGACCGCATAATC 1 (3) 1c CCGACCCCGGAGDTTCCGGACCGCATAATC 2 (6) 1d CCGACCCTGGCAATCCGAAACTACAGGGTA 1 (3) 1e CCGACTTTGGAGDTTCCGGACCGCATAATC 2 (6) 1f TTGACCCCGGCAATCCGAAACTACAGGGTA 1 (3) 1g TTGACTTTGGAGDTTCCGGACCGCATAATC 2 (6) nonE292V 2 CCAAACCTAACGDCTGGAAGGCATTGGGCC 9 (26) 2a CCAAACCTAACADCTGGAAGGCATTGGGCC 2 (6) 2b CCAAACCTAACGDCTGGAAGCCATTGGGCC 1 (3) E292V 3 CCAT†ACCCGGCAATCCGAAACTACAGGGTA 8 (73) 3a CCATACCCGGCAATCCGAAGCTACAGGGTA 1 (9) 3b CCATACCCGGCAATTCGAAACTACAGGGTC 1 (9) 3c CCATACCCGACAATCCGAAACTACAGGGTA 1 (9) * Percent of alleles with or without E292V. Login to comment
110 † E292V is an AϾT transversion; shaded CC is indeterminate as to which haplotype from which it was derived. Login to comment
112 Comparison of E292V positive newborns with RDS cohort (including twins) E292V with RDS N ϭ 10 RDS without E292V N ϭ 237 p value BW 2.6 (0.7-3.8) 1.8 (0.5-4.5) 0.10* 201 EGA 36 (26-39) 34 (23-43) 0.30* 218 Race (ED/AD) 10/0 139/72/26w 0.04† Sex (F/M) 4/6 101/133 1.0† Pneumothorax 4 (40%) 29 (15%) 0.06† Duration mech vent/CPAP 8 (1-450) 14 (0-358) 0.46* 171 Duration O2 18 (3-800) 26 (0-358) 0.90* 171 Outcome at discharge On O2 3 (38%) 75 (43%) 0.71* Vent 1 (10%) 9 (5%) 0.24* Survive 8 (80%) 147 (86%) 0.64* * Kruskal-Wallis test. Login to comment
116 These observations, along with other reports of lethal and chronic respiratory disease in the presence of a single mutation in ABCA3, suggest that E292V itself, or through interactions with variants in other genes, could disrupt ABCA3 function in developmentally susceptible individuals (14,16,26,34). Login to comment
118 The unique haplotype associated with E292V raises the possibility that a specific combination of variants within this new block could confer the phenotype. Login to comment
119 Our resequencing strategy that focused on coding regions and flanking sequence did not identify any coding or splice site variants either upstream or downstream of E292V that would obviously alter ABCA3 function, but it is possible that functional intronic or promoter variants reside within the regions that were not sequenced or in other genes along the surfactant synthetic pathway. Login to comment
120 Taken together, these data suggest that E292V may increase RDS susceptibility in the context of currently unknown developmental, genetic, or environmental traits. Login to comment
121 Even though the 121ins2, I73T, and E292V mutations are rare in the general population, they are sufficiently prevalent to warrant evaluation in the context of respiratory compromise that seems disproportionate for gestational age. Login to comment

PMID: 18024538 [PubMed] Doan ML et al: "Clinical, radiological and pathological features of ABCA3 mutations in children."

No. Sentence Comment

45 Five patients eventually Table 1 Characteristics of nine children with ABCA3 mutations Patient no Age of onset, manifestation Clinical features (age at evaluation) CT imaging (age at examination) Mutational analysis Outcomes (current age) 1 Newborn, respiratory failure Ta, Cr, Wh, Cl, Hy (4 years) GGO, ST, PE (2 weeks) Nt622C.T (R208W) Nt2279T.G (M760R) Transplanted (died) (5 years)* 2 Newborn, respiratory failure Ta, Hy (1 month) None Nt289insA Nt4648C.T (R1550W) Transplanted (died) (3 months)* 3 3 months, acute respiratory distress Ta, FTT, Hy (3 months) GGO, ST (3 months) Nt2646insC Nt3757C.T (P1253S) Died (4 months)* 4 2 years, acute respiratory distress Ta, Cr, Cl, FTT, Hy (2 years) GGO, ST, PE (2 years) Nt4732G.A (E1578K) Nt4772A.C (Q1591P) Alive, ILD score 4 (15 years) 5 1 year, recurrent hypoxaemia Ta, Cl, FTT, Hy (3 years) GGO, ST, PE, cysts (2 years) Nt59G.T (R20L) Nt2879T.C (L960S) Alive, ILD score 4 (8 years) 6 Newborn, pneumonia Ta, Cr, Cl, FTT, Hy (10 years) GGO, ST, PE (4 years) Nt875A.T (E292V) Nt3341C.T (T1114M) Transplanted (alive) (12 years)* 7 Newborn, respiratory failure Ta, Cl, FTT (6 years) GGO, ST, PE, cysts (6 years) Nt875A.T (E292V) Nt4706delTCA (deltaI1569) Alive, ILD score 1 (18 years) 8 Newborn, pneumonia Ta, Cr, Cl, Hy (6 years) GGO, PE (6 years) Nt629G.T (G210V) Nt3609delCTT (deltaF1203) Alive, ILD score 3 (11 years) 9 4 years, recurrent hypoxaemia Ta, Cr, Hy (exertional) (8 years) GGO, ST (7 years) Nt128G.A (R43H) Nt1609 in/del (end exon 13) Alive, ILD score 2 (13 years) Ta, tachypnoea; Cr, crackles; Wh, wheezing; Cl, clubbing; Hy, hypoxaemia; FTT, failure to thrive; GGO, ground-glass opacification; ST, septal thickening; PE, pectus excavatum. Login to comment
83 Five of these mutations (R20L, DF1203, E292V, T114M, Q1591P) have been previously identified in subjects with chILD, whereas the remainder are novel. Login to comment
84 The E292V mutation was the only one found in more than one patient. Login to comment
149 The E292V mutation found in two of our patients has been reported as the most common defect in the ABCA3 gene leading to chILD.20 Our study shows that the outcome in children with ABCA3 mutations is also quite variable. Login to comment

PMID: 18246475 [PubMed] Karjalainen MK et al: "Haplotype analysis of ABCA3: association with respiratory distress in very premature infants."

No. Sentence Comment

59 Selection of SNPs, haplotype prediction, and data analysis Intronic SNPs with a validated minor allele frequency (MAF) >0.1 among Caucasians and all coding SNPs (cSNPs) indicated in the dbSNP database (http://ncbi.nih.gov/SNP/) within the ABCA3 gene in the NCBI entry NT_037887, a novel intronic SNP (320-17GwA) and 875AwT (E292V) were initially screened. Login to comment
81 Additionally, a novel SNP (320-17GwA) and a single-base change (875AwT) corresponding to a glutamine-to-valine substitution at amino acid position 292 (E292V) were included in the analysis, as this position has been reported to be frequently mutated in infants suffering from ILD (22). Login to comment
90 SNP rs149532 (corresponding to residue S1372S) was rare (MAF50.02) in our population, and it was thus excluded from further analysis, together with the nonpolymorphic cSNPs (rs28936412, 875AwT, rs13332760, rs28936690, and rs28936691, corresponding to residues L101P, E292V, V839F, L1552P, and Q1591P, respectively). Login to comment
94 SNP No. or position a Alleles (major/minor) Position b Location Affected residue Minor allele frequency tSNPs c Best pairwise r2 value and the corresponding tSNP d rs28936412 T/C 2316029 Exon 5 L101P 0 - 320-17GwA G/A 2314550 Intron 5 0.055 tSNP1 875AwT A/T 2307765 Exon 9 E292V 0 - rs13332547 C/T 2307425 Intron 9 0.093 tSNP2, r2 51 rs13332514 C/T 2307337 Exon 10 F353F 0.093 tSNP2 rs323069 G/C 2304052 Intron 10 0.271 tSNP3 rs323073 C/T 2298761 Intron 10 0.283 tSNP3, r2 50.831 rs323074 G/A 2298314 Intron 11 0.201 tSNP5, r2 50.848 rs323033 A/G 2296546 Intron 11 0.259 tSNP4 rs323040 G/A 2290527 Intron 12 0.168 tSNP5 rs170447 A/G 2289372 Intron 14 0.396 tSNP6, r2 50.832 rs2240523 T/C 2288658 Intron 14 0.381 tSNP6, r2 50.849 rs17183533 A/G 2285389 Intron 18 0.420 tSNP7, r2 50.986 rs13332760 G/T 2279621 Exon 20 V839F 0 - rs313909 C/T 2277994 Intron 21 0.373 tSNP6 rs2014467 A/G 2276395 Intron 22 0.424 tSNP7 rs2238464 G/A 2272578 Intron 26 0.420 tSNP8 rs149532 T/C 2271431 Exon 27 S1372S 0.020 - rs150926 G/C 2270170 Intron 28 0.372 tSNP6, r2 50.975 rs150928 C/T 2268651 Intron 29 0.226 tSNP9 rs28936690 T/C 2268353 Exon 30 L1552P 0 - rs28936691 A/C 2268018 Exon 31 Q1591P 0 - a rs numbers are shown for SNPs with entries in dbSNP. SNPs without entries in dbSNP are numbered from start codon as advised in (34). Login to comment
129 None of the five nonsynonymous cSNPs (rs28936412, 875AwT, rs13332760, rs28936690, and rs28936691, corresponding to residues L101P, E292V, V839F, L1552P, and Q1591P, respectively) were detected in any individuals. Login to comment
214 Additionally, we screened for the E292V mutation, which has been associated with pediatric ILD (22). Login to comment
215 However, E292V was not detected either in term or in preterm infants in our population. Login to comment

PMID: 17597647 [PubMed] Bullard JE et al: "Heterozygosity for ABCA3 mutations modifies the severity of lung disease associated with a surfactant protein C gene (SFTPC) mutation."

No. Sentence Comment

44 The restriction endonuclease BsrGI was purchased from New England Biolabs (Beverly, MA) and used according to manufacturer`s specifications for analysis of ABCA3 E292V, as reported previously (23). Login to comment
48 ABCA3 E292V was assayed for in the 19 children because of its association with multiple unrelated children and lung disease (23). Login to comment
49 Two infants were identified with ABCA3 E292V and had the onset of their symptoms at younger than 2 mo of age. Login to comment
53 Sequencing confirmed that patients 1 and 2 had the ABCA3 E292V mutation and no other mutation. Login to comment
67 Circle, female; square, male; shaded quarter symbol, SFTPC I73T; solid quarter symbol, ABCA3 E292V; check- ered quarter symbol, ABCA3 L212M; slash through symbol, deceased; IPF, idiopathic pulmonary fibrosis; RSV, respiratory syncytial virus. Login to comment
72 Two of the four infants had ABCA3 E292V, a mutation that has been associated with pILD (23). Login to comment
73 The population frequency of ABCA3 E292V is low, approximately one in 275 individuals (personal communication, T. Garmany and A. Hamvas). Login to comment
74 Thus, the finding of ABCA3 E292V in two of the 19 patients with SFTPC I73T seems unlikely to have occurred by chance. Login to comment
75 The third infant had a different missense mutation, ABCA3 L212M, which results in a conservative neutral substitution. Login to comment

PMID: 17517255 [PubMed] Somaschini M et al: "Unexplained neonatal respiratory distress due to congenital surfactant deficiency."

No. Sentence Comment

51 Characteristics of patients n GA (W) BW (G) Sex Familial Therapies Age at death Gene/mutation Histology Immunostaining Electron microscopy 1 40 3400 M No MV, surfactant, HFOV 4 hours No mutations NA NA NA 2 40 3700 F No MV 2 hours No mutations NA NA NA 3 37 3110 M No Corticosteroids, MV, surfactant, prostacyclin, HFOV 3 days No mutations HMD ϩ SP-B - proSP-C, alveolar epithelium NA 4 40 3050 F Yes Corticosteroids, MV, surfactant, prostacyclin, iNO, HFOV 28 days SFTPB mutations 121ins2/ 122delC PAP Absent SP-B and proSP-B PAP material pro-SP-C ϩ NA 5 39 3200 F Yes MV, surfactant 38 days SFTPB mutations 121ins2/ 122delC PAP Absent SP-B and proSP-B PAP material pro-SP-C ϩ NA 6 38 3650 F Yes MV, surfactant 27 days ABCA3 mutations 4240delC/ W165X DIP ϩ SP-B ϩ proSP-C, alveolar epithelium NA 7 39 2850 M No MV 2 days ABCA3 mutation R280C/wt NA NA NA 8 35 3000 M No MV, surfactant 2 days ABCA3 mutation E292V/wt NA NA NA 9 40 3700 F No MV, surfactant 37 days ABCA3 mutations R208W/ T1423I DIP ϩ SP-B ϩ proSP-C, alveolar epithelium Numerous small LBs with dense cores 10 40 3220 M Yes MV, surfactant 30 days ABCA3 mutations 3997delAG/3997delAG DIP ϩ SP-B ϩ proSP-C, alveolar epithelium Few small LBs with dense cores 11 38 2700 F Yes MV, surfactant, corticosteroids 13 days ABCA3 mutations R155Q/ R155Q DIP ϩ SP-B ϩ proSP-C, alveolar epithelium 12 40 3050 M No MV, surfactant, iNO, prostacyclin 30 days ABCA3 mutations R43L/ R1482W DIP ϩ SP-B ϩ proSP-C, alveolar epithelium Numerous small LBs with dense cores 13 41 3420 F No MV, surfactant 180 days ABCA3 mutation S341N/wt NA NA NA 14 39 3150 M Yes MV, surfactant 64 days ABCA3 mutations P248L/ P248L DIP ϩ SP-B ϩ proSP-C, alveolar epithelium NA 15 38 3280 M Yes MV, surfactant, HFOV, corticosteroids 66 days ABCA3 mutations 4240delC/ W165X NA NA NA 16 41 3000 F No MV, surfactant, HFOV 50 days ABCA3 mutations R208W/ 4296_4301delATCACG NA NA NA 17 33 1750 M No MV, surfactant, HFOV 206 days ABCA3 mutations P147L/ R155Q DIP ϩ SP-B ϩ proSP-C, alveolar epithelium Numerous small LBs with dense cores GA, gestational age; BW, birth weight; MV, mechanical ventilation; HFOV, high-frequency oscillatory ventilation; iNO, inhaled nitric oxide; wt, wild type; LB, lamellar body; HMD, hyaline membrane disease; PAP, pulmonary alveolar proteinosis; DIP, desquamative intersititial pneumonia; HMD, hyaline membrane disease; NA, not available. Login to comment
48 Characteristics of patients n GA (W) BW (G) Sex Familial Therapies Age at death Gene/mutation Histology Immunostaining Electron microscopy 40 3400 M No MV, surfactant, HFOV 4 hours No mutations NA NA NA 2 40 3700 F No MV 2 hours No mutations NA NA NA 3 37 3110 M No Corticosteroids, MV, surfactant, prostacyclin, HFOV 3 days No mutations HMD af9; SP-B afa; proSP-C, alveolar epithelium NA 4 40 3050 F Yes Corticosteroids, MV, surfactant, prostacyclin, iNO, HFOV 28 days SFTPB mutations 121ins2/ 122delC PAP Absent SP-B and proSP-B PAP material pro-SP-C af9; NA 5 39 3200 F Yes MV, surfactant 38 days SFTPB mutations 121ins2/ 122delC PAP Absent SP-B and proSP-B PAP material pro-SP-C af9; NA 6 38 3650 F Yes MV, surfactant 27 days ABCA3 mutations 4240delC/ W165X DIP af9; SP-B af9; proSP-C, alveolar epithelium NA 7 39 2850 M No MV 2 days ABCA3 mutation R280C/wt NA NA NA 8 35 3000 M No MV, surfactant 2 days ABCA3 mutation E292V/wt NA NA NA 9 40 3700 F No MV, surfactant 37 days ABCA3 mutations R208W/ T1423I DIP af9; SP-B af9; proSP-C, alveolar epithelium Numerous small LBs with dense cores 10 40 3220 M Yes MV, surfactant 30 days ABCA3 mutations 3997delAG/3997delAG DIP af9; SP-B af9; proSP-C, alveolar epithelium Few small LBs with dense cores 11 38 2700 F Yes MV, surfactant, corticosteroids 13 days ABCA3 mutations R155Q/ R155Q DIP af9; SP-B af9; proSP-C, alveolar epithelium 12 40 3050 M No MV, surfactant, iNO, prostacyclin 30 days ABCA3 mutations R43L/ R1482W DIP af9; SP-B af9; proSP-C, alveolar epithelium Numerous small LBs with dense cores 13 41 3420 F No MV, surfactant 180 days ABCA3 mutation S341N/wt NA NA NA 14 39 3150 M Yes MV, surfactant 64 days ABCA3 mutations P248L/ P248L DIP af9; SP-B af9; proSP-C, alveolar epithelium NA 15 38 3280 M Yes MV, surfactant, HFOV, corticosteroids 66 days ABCA3 mutations 4240delC/ W165X NA NA NA 16 41 3000 F No MV, surfactant, HFOV 50 days ABCA3 mutations R208W/ 4296_4301delATCACG NA NA NA 17 33 1750 M No MV, surfactant, HFOV 206 days ABCA3 mutations P147L/ R155Q DIP af9; SP-B af9; proSP-C, alveolar epithelium Numerous small LBs with dense cores GA, gestational age; BW, birth weight; MV, mechanical ventilation; HFOV, high-frequency oscillatory ventilation; iNO, inhaled nitric oxide; wt, wild type; LB, lamellar body; HMD, hyaline membrane disease; PAP, pulmonary alveolar proteinosis; DIP, desquamative intersititial pneumonia; HMD, hyaline membrane disease; NA, not available. Login to comment

PMID: 17142158 [PubMed] Bullard JE et al: "ABCA3 deficiency: neonatal respiratory failure and interstitial lung disease."

No. Sentence Comment

93 Interestingly all 3 children shared the same mutation on 1 allele, a substitution of valine for glutamic acid in codon 292 (called E292V). Login to comment
95 These findings argue that E292V is not a benign sequence variant. Login to comment
96 The E292V mutation was not found on 200 control alleles from individuals without lung disease screened anonymously, indicating that it is not a common polymorphism. Login to comment
97 However, when 150 additional children with chronic lung disease enrolled in the study were then screened for the presence of this mutation, 7 additional patients were identified who had the E292V mutation on 1 allele, and a second ABCA3 mutation identified on the other allele in 5 of these patients. Login to comment
116 A recent study presented in preliminary form examined the role of one ABCA3 gene variant in RDS.52 Specifically the frequency of the ABCA3 E292V mutation was ascertained in a study group of premature infants with RDS and compared with a control group without RDS. Login to comment
117 Nine of 181 (5%) infants with RDS had the E292V mutation on one allele, whereas only 2 control infants (out of 167) were found to have the mutation. Login to comment
118 Moreover, the incidence of air leak was very high (7 of 9, 78%) in infants with the E292V mutation. Login to comment
135 The etiology of PIG/ NBD1 NBD2 25 42 285 262 304 326 346 368 373 395 448 470 926 946 1098 1120 1141 1167 1180 1202 1212 1234 1303 1324 * E292V Figure 2 Model of ABCA3 protein structure. Login to comment
137 The location of the most frequently identified mutation (E292V) associated with ILD is indicated. Login to comment
94 Interestingly all 3 children shared the same mutation on 1 allele, a substitution of valine for glutamic acid in codon 292 (called E292V). Login to comment
98 However, when 150 additional children with chronic lung disease enrolled in the study were then screened for the presence of this mutation, 7 additional patients were identified who had the E292V mutation on 1 allele, and a second ABCA3 mutation identified on the other allele in 5 of these patients. Login to comment
119 Moreover, the incidence of air leak was very high (7 of 9, 78%) in infants with the E292V mutation. Login to comment
136 The etiology of PIG/ NBD1 NBD2 25 42 285 262 304 326 346 368 373 395 448 470 926 946 1098 1120 1141 1167 1180 1202 1212 1234 1303 1324 * E292V Figure 2 Model of ABCA3 protein structure. Login to comment
138 The location of the most frequently identified mutation (E292V) associated with ILD is indicated. Login to comment

PMID: 16959783 [PubMed] Matsumura Y et al: "Characterization and classification of ATP-binding cassette transporter ABCA3 mutants in fatal surfactant deficiency."

No. Sentence Comment

270 Very recently, it has been reported that the E292V mutation of the ABCA3 gene is responsible in the genetic etiology of pediatric interstitial lung disease related to abnormal surfactant function (24), the phenotype of which is milder than that of fatal surfactant deficiency. Login to comment
271 It is possible that the E292V mutation causes less severe disruption of intracellular trafficking or ATP hydrolysis activity. Login to comment
268 Very recently, it has been reported that the E292V mutation of the ABCA3 gene is responsible in the genetic etiology of pediatric interstitial lung disease related to abnormal surfactant function (24), the phenotype of which is milder than that of fatal surfactant deficiency. Login to comment
269 It is possible that the E292V mutation causes less severe disruption of intracellular trafficking or ATP hydrolysis activity. Login to comment

PMID: 17095348 [PubMed] Prestridge A et al: "Persistent tachypnea and hypoxia in a 3-month-old term infant."

No. Sentence Comment

78 contain more densely packed membranes with eccentrically placed, electron-dense inclusion bodies.20,21 Histological evaluation of the lung in patients with mutations in ABCA3 reveals diffuse hyperplasia of alveolar type II cells and accumulation of proteinaceous material in distal air spaces.21 ABCA3 mutations were first identified in neonates with severe lung disease whose lung histopathology findings were consistent with some forms of ILD, as well as with inheritance of the disorder as an autosomal recessive condition.21 In a subsequent study, older children with histopathology diagnoses of ILD were found to have ABCA3 mutations, particularly a missense mutation, E292V.28 Presumably decreased but not complete loss of function of the ABCA3 protein accounted for the milder phenotype than that seen in the neonates. Login to comment
77 contain more densely packed membranes with eccentrically placed, electron-dense inclusion bodies.20,21 Histological evaluation of the lung in patients with mutations in ABCA3 reveals diffuse hyperplasia of alveolar type II cells and accumulation of proteinaceous material in distal air spaces.21 ABCA3 mutations were first identified in neonates with severe lung disease whose lung histopathology findings were consistent with some forms of ILD, as well as with inheritance of the disorder as an autosomal recessive condition.21 In a subsequent study, older children with histopathology diagnoses of ILD were found to have ABCA3 mutations, particularly a missense mutation, E292V.28 Presumably decreased but not complete loss of function of the ABCA3 protein accounted for the milder phenotype than that seen in the neonates. Login to comment

PMID: 16721150 [PubMed] Nogee LM et al: "Genetics of pediatric interstitial lung disease."

No. Sentence Comment

72 Three of these patients were found to be compound heterozygotes for two ABCA3 mutations, and all three shared a common ABCA3 mutation, a substitution of valine (V) for glutamic acid (E) in codon 292 (E292V). Login to comment
73 Seven additional patients with the E292V mutation were then identified (out of 153 screened), five of whom had a second ABCA3 mutation. Login to comment
107 Table 1 Characteristics of lung disease associated with SFTPC or ABCA3 mutations SFTPC ABCA3 Gene locus 8p21 16p13.3 Inheritance Autosomal dominant or sporadic (de-novo mutation) Autosomal recessive Age of onset of symptoms Rare in neonatal period Common in neonatal period Infancy to adult May be asymptomatic Clinical features Tachypnea Hypoxemia in room air Failure to thrive Clubbing Histopathology Alveolar type II cell hyperplasia Foamy macrophages in airspaces Variable amounts of proteinaceous material in airspaces Interstitial thickening Pulmonary fibrosis Electron microscopy Normal lamellar bodies Small, dense lamellar-bodies with eccentrically placed electron-dense bodies ('fried-egg` appearance) Disease mechanism Dominant negative Loss-of-function mutations Toxic gain-of-function Most frequently found mutation I73T E292V Acknowledgements This work was supported by grants from the National Institutes of Health (HL-54703, HL-56387) and by the Eudowood Foundation. Login to comment

PMID: 16216835 [PubMed] Deterding R et al: "Surfactant dysfunction mutations in children's interstitial lung disease and beyond."

No. Sentence Comment

91 Three of four patients had a common missense ABCA3 mutation (E292V) on one allele and a second unique mutation identified on the other, consistent with an autosomal recessive disorder. Login to comment
92 Second, the remaining DNA samples, not positive for other SPB or SPC mutations, were screened for the E292V mutation, with seven more children identified. Login to comment
94 Clarifying these issues could have major implications for E292V as a genetic modifier for other pediatric and adult lung diseases. Login to comment
95 In this population of children with chronic lung disease, 5% had the common ABCA3 mutation (E292V) in contrast to 14% who had an SPC mutation and 1% who had an SPB mutation. Login to comment
96 This likely recognizes only a small fraction of ABCA3 mutations, as only the E292V mutation was screened for and only SPC and SPB genes fully sequenced. Login to comment
99 The current age of survival for the E292V group was reported as 6 to 32 years. Login to comment
104 However, the identification of a common mutation (E292V) and pathology techniques, such as surfactant protein staining patterns, as reported by Bullard, and electron microscopy to look for abnormal lamellar bodies (5), could provide a starting point. Login to comment

PMID: 15976379 [PubMed] Bullard JE et al: "ABCA3 mutations associated with pediatric interstitial lung disease."

No. Sentence Comment

6 All three had the same missense mutation (E292V) and a second unique mutation. Login to comment
7 The E292V mutation was not found on 200 control alleles from adults without lung disease, but seven additional patients of the remaining study patients had the E292V mutation on one allele. Login to comment
69 This mutation results in the substitution of valine for glutamic acid in codon 292 (E292V) and introduces a new recognition site for the restriction endonuclease BsrG1. Login to comment
70 The E292V mutation was not found on any of the 200 alleles examined from 100 adults without lung disease and who were matched for ethnic background by restriction analysis of polymerase chain reaction products spanning exon 9. Login to comment
71 DNA samples from 153 of the remaining study patients, for whom the cause of lung disease remained undetermined, were then examined for the E292V mutations by restriction analysis. Login to comment
73 Seven additional patients with the E292V mutation on one allele were identified by restriction analysis and confirmed by DNA sequence analysis, including one pair of siblings (Table 2). Login to comment
86 All 10 patients had the identical ABCA3 mutation on one allele, E292V, a nonconservative amino acid substitution in a region of the protein that has been highly conserved during evolution (Figure 3). Login to comment
87 The E292V mutation was not found on 200 control alleles, indicating that it is TABLE 1. CHARACTERISTICS OF OLDER CHILDREN WITH CHRONIC LUNG DISEASE Patient 1 Patient 2 Patient 3 Patient 4 Race White White White White Age of symptoms Birth Ͻ 1 yr Ͻ 1 yr Birth Sex Female Female Male Male Lung biopsy DIP DIP DIP DIP Age at enrollment 23 yr 14 yr 10 yr 11 yr Current age 32 yr 16 yr 12 yr 11 yr Family history No Yes No No Outcome Lung transplant Alive Alive Alive ABCA3 mutations E292V/N1076K E292V/c3704-1 GϾT E292V/c1742-9 GϾA None Maternal allele NA c3704-1 GϾT E292V NA Paternal allele NA NA c1742-9 GϾA NA Definition of abbreviations: DIP ϭ desquamative interstitial pneumonitis; NA ϭ not available. Login to comment
90 The early onset of disease, similar lung histopathology, and finding of a common mutation all support the idea that ABCA3 mutations in general, and the E292V mutation in particular, are responsible for the genetic etiology of pILD related to abnormal surfactant function. Login to comment
104 phenotype had the same variant supports the hypothesis that E292V is deleterious and not a neutral variant, although we cannot exclude the possibility that E292V is linked functionally to a more significant mutation in a region of the ABCA3 gene that we have not analyzed. Login to comment
105 In addition to the E292V mutation, five additional missense variants (N1076K, G1302E, P1301L, T1114M, E690K) and three splice junction site mutations (c3704-1 GϾT, c1742-9 GϾA, c1612-2 AϾG) that would likely alter RNA splicing were identified. Login to comment
110 A second mutation affecting ABCA3 expression or mRNA splicing may have been present in a region of the gene we did not examine, or other genetic or environmental factors in combination with the E292V mutation on one allele may have accounted for their lung disease. Login to comment
121 Some of this variability may reflect different stages of the disease and/or patchy distribution of disease within the lung, as well as TABLE 2. CHARACTERISTICS OF CHILDREN WITH CHRONIC LUNG DISEASE WHO SCREENED POSITIVE FOR E292V MUTATION Patient 5 Patient 6 Patient 7 Patient 8 Patient 9 Patient 10 Patient 11 Race White White White White White Hispanic White Age of symptoms Neonate Neonate Neonate 7 yr 5 yr Neonate Neonate Sex Female Female Male Male Male Male Male Lung biopsy Not done Not done Not done IP/PF Not done BO/fibrosis Normal Current age NA 11 yr 11 yr 11 yr 9 yr NA 6 yr Family history Yes No Yes Yes Yes No No Outcome Died at 11 yr Alive Alive Alive Alive Died at 6 mo Alive ABCA3 mutations E292V/c1612-2 E292V/G1302E E292V/T1114M E292V/E690K E292V/E690K E292V/none E292V/none AϾG/P1301L identified identified Definition of abbreviations: BO ϭ bronchiolitis obliterans; IP ϭ interstitial pneumonitis; NA ϭ not available; PF ϭ pulmonary fibrosis. Login to comment
124 However, both siblings with the E292V/E690K mutations reportedly did not develop symptoms of lung disease until 5 to 7 years of age. Login to comment
128 Lung tissue from Patient 1, with ABCA3 mutations (E292V/N1076) and prolonged survival (left column: A, D, G, J, M; original magnification, ϫ20). Login to comment
137 ABCA3 amino acid sequence is highly conserved in region of E292V mutation. Login to comment
144 The immunohistochemical staining pattern for the surfactant proteins in three of our E292V patients was abnormal, with robust staining for proSP-B but markedly reduced staining for mature SP-B, which was recovered with antigen retrieval. Login to comment
158 The relative contribution of ABCA3 mutations to lung disease may be even greater than we currently appreciate, because the majority of patients in our study group were screened only for the E292V mutation and have not yet had their ABCA3 gene sequenced or screened for other mutations. Login to comment
162 Thus, there is significant ascertainment bias that limits interpretation of the relative frequency of these genetic causes of lung disease, and the unusual nature of the lung disease in these patients may exaggerate the apparent contribution of E292V and other ABCA3 mutations to pILD. Login to comment

PMID: 23166334 [PubMed] Wambach JA et al: "Single ABCA3 mutations increase risk for neonatal respiratory distress syndrome."

No. Sentence Comment

52 Two mutations previously associated with respiratory disease in newborns and children, p.R288K (c.863G.A) and p.E292V (c.875A.T),22-24 accounted for 13 of the 16 mutated alleles among RDS infants. Login to comment
57 Although the European-descent RDS infants had a lower mean gestational age than non-RDS infants (Table 1), there was no statistical difference in mean gestational age or birth weight for European-descent infants with or without ABCA3 mutations, thereby suggesting that ABCA3 mutations are associated with RDS rather than TABLE 3 Rare Mutations Identified Among Infants of European Descent Gene Mutation RDS (n = 112) Non-RDS (n = 161) Missouri Population (n = 871) ESP (n = 3510) ABCA3 R20W 2 R43C 1 V129M 1 A132T 1 V133M 1 R208W 1 L212M 3 14 P246L 1 R280C 1 R280H 12 R288K 6 (5.3%)a 2 (1.2%)a 14 (1.6%)a 54 (1.5%)a E292V 7 (6.2%)a 1 (0.6%)a 1 (0.1%)a 32 (0.9%)a V480M 1 E522K 1 I561F 1 G594R 1 L654V 2 G668D 1 R671C 1 S693L 1 7 E725K 1 T761K 1 R1081W 1 I1117M 1 A1119E 1 A1297T 1 I1382M 1 T1424M 1 M1428L 2 R1457Q 1 A1466T 1 R1474W 1 3 8 29 V1495M 1 S1516N 1 R1561Q 1 V1588M 1 c.3863-98 C.T 1 ABCA3 allele (carrier) frequency 16 (14.3%)a 6 (3.7%)a 31 (3.6%)a 176 (5.0%)a SFTPC D15N 1 I26V 1 A53T 1 1 L110R 1 SFTPC allele (carrier) frequency 1 (0.1%)a 4 (0.1%)a CHPT1 S40W 4 W60C 1 D132E 2 CHPT1 allele (carrier) frequency 7 (0.2%)a LPCAT1 G110S 1 P230S 1 R237Q 1 M298V 1 E312K 1 F460V 1 R526W 1 LPCAT1 allele (carrier) frequency 1 (0.1%)a 6 (0.2%)a PCYT1B V192F 1(0.03%)a Identified mutations are predicted to be damaging according to both SIFT and PolyPhen (accessed March 2012) or previous association with pediatric respiratory disease. Blank boxes indicate the mutations were not observed in that specific cohort. Login to comment
67 Only 1 of these infants was compound heterozygous for ABCA3 mutations (p.E292V/p.P933L) and therefore had ABCA3 deficiency. Login to comment
74 TABLE 4 Rare Mutations Identified Among Infants of African Descent Gene Mutations RDS (n = 44) Non-RDS (n = 196) Missouri Population (n = 195) ESP (n = 1869) ABCA3 R20W 2 V129M 12 F245L 1 R280C 1 R280H 2 R288K 7 (0.4%)a E292V 4 (0.2%)a F353L 3 N555S 5 G571R 1 T574I 1 2 P585S 1 L707F 14 G739A 2 15 V968M 1 1 F1164V 1 N1418S 1 R1474W 1 1 A1660V 1 Infants with variant 2 (4.5%)a 3 (1.5%)a 3 (1.5%)a 72 (3.9%)a SFTPC R35C 1 V39M 1 G57S 1 R81C 1 SFTPC allele (carrier) frequency 4 (0.2%)a CHPT1 G70R 2 T87M 1 G115A 1 Y365H 3 CHPT1 allele (carrier) frequency 7 (0.4%)a LPCAT1 A194V 6 L255Q 2 D392H 1 R526W 1 LPCAT1 allele (carrier) frequency 10 (0.5%)a PCYT1B G199D 1 (0.05%)a Identified mutations are predicted to be damaging according to both SIFT and PolyPhen (accessed March 2012) or previous association with pediatric respiratory disease. Blank boxes indicate the mutations were not observed in that specific cohort. Login to comment
94 Only 2 of these mutations were found in our study: p.R280C, which disrupts ABCA3 folding and trafficking, and p.E292V, which disrupts ATP hydrolysis and decreases phospholipid transport across the lamellar body membrane.29,30 Our combined genomic, computational, and disease-based variant discovery strategy permits prioritization of mutations for further functionalinvestigation,whichiscritical for understanding disease pathogenesis. Login to comment

PMID: 23881110 [PubMed] Herber-Jonat S et al: "Abca3 haploinsufficiency is a risk factor for lung injury induced by hyperoxia or mechanical ventilation in a murine model."

No. Sentence Comment

11 Defined heterozygous mutations also contribute to lung disease, the most common of them being E292V (4), found to be present in 4-7% of neonates with respiratory distress syndrome, with an incidence of 0.4-1.3% in the Caucasian population (6-8). Login to comment
128 Heterozygous ABCA3 mutations, especially E292V, are common in neonates with respiratory distress syndrome (6,7,9), and this is associated with a greater incidence of pneumothorax and chronic lung disease in very preterm neonates (6). Login to comment
213 B&#e6;kvad-Hansen M, Nordestgaard BG, Dahl M. Heterozygosity for E292V in ABCA3, lung function and COPD in 64,000 individuals. Login to comment

PMID: 24136335 [PubMed] Epaud R et al: "Combined pulmonary fibrosis and emphysema syndrome associated with ABCA3 mutations."

No. Sentence Comment

47 Sequence analysis of the ABCA3 gene identified two mutations: 1) c.3081_3092delinsCG resulting in a serine to valine change at codon 1028 with the creation of a stop codon 103 amino acids downstream (p.Ser1028Valfs*103); and 2) the common mutation c.875A.T changing a glutamic acid to a valine at codon 292 (p.Glu292Val). Login to comment
63 The first is the common mutation p.Glu292Val, which is found in heterozygous form with a frequency of ,1% [8] and has been previously reported to be associated with mild lung disease. Login to comment
65 Such a ''null`` allele precludes any functional ABCA3 from being made resulting in abnormal lamellar bodies, but should be less deleterious in combination with the mild mutation p.Glu292Val. Login to comment

PMID: 24730976 [PubMed] Campo I et al: "A large kindred of pulmonary fibrosis associated with a novel ABCA3 gene variant."

No. Sentence Comment

233 A compound heterozygous mutation involving a substitution of valine for glutamic acid in codon 292 (E292V) on at least one allele has been identified in children with chronic ILD. Login to comment

PMID: 24871971 [PubMed] Wambach JA et al: "Genotype-phenotype correlations for infants and children with ABCA3 deficiency."

No. Sentence Comment

64 Five mutations were identified in more than five unrelated individuals: (1) p.E292V, (2) p.Y1515X, (3) IVS25-98 C . Login to comment
66 p.E292V is the most common ABCA3 mutation associated with childhood interstitial lung disease (13, 15, 21) and was identified among 16 subjects (Subjects 53, 129-143; see Table E2). Login to comment
67 One infant was homozygous for p.E292V, presented with neonatal respiratory failure, and died shortly after birth (Subject 129; see Table E2). Login to comment
68 The remaining 15 individuals were compound heterozygous for p.E292V and had variable outcomes (see Table E2). Login to comment

PMID: 25031143 [PubMed] Panigrahy N et al: "ATP-binding cassette transporter A3 (ABCA3) mutation in a late preterm with respiratory distress syndrome."

No. Sentence Comment

41 The clinical course of babies with ABCA3 deficiency varies from presentation in neonatal period to that in childhood presenting as interstitial lung disease.A common mutation involving substitution of valine for glutamic acid in codon 292(E292V), of the ABCA3 protein, has been identified in older children with chronic interstitial lung disease [1]. Login to comment

PMID: 25553246 [PubMed] Coghlan MA et al: "Sequencing of idiopathic pulmonary fibrosis-related genes reveals independent single gene associations."

No. Sentence Comment

10 No individual with IPF had two different mutations, but one individual with IPF was homozygous for p.E292V, the most common ABCA3 disease-causing variant. Login to comment
46 No individuals had single rare mutations in two different genes, although one individual was homozygous for ABCA3 p.E292V. Login to comment
69 Table 3 Mutations identified in IPF and COPD cohorts of European descent Gene Mutation Amino acid change IPF* (ED) (n=119) (n (MAF)) COPD (n=178) (n (MAF)) ESP (ED) (MAF), % p Value (IPF vs COPD) dbSNP number SFTPA2 c.532G>A V178M 1 (0.4%)ߤ 0 0.01 0.4 SFTPC c.218T>C I73T 3 (1.3%)ߤ 0 0 rs121917834 c.329T>G L110R 1 (0.4%) 0 0 c.334G>A A112T 1 (0.4%) 0 0 Collapsed frequency 2.1% 0.01 ABCA3 c.875A>T E292V 4 (1.68%) 3 (0.84%) 0.45 rs149989682 c.4420G>A R1474W 0 3 (0.84%) 0.36 rs146709251 Collapsed frequency 1.68% 1.68% 1.0 NKX2-1 0 0 NA TERT c.323G>C ߥR108P 1 (0.42%) 0 0 c.994C>T ߥL332F 1 (0.42%) 0 0 c.1775A>G ߥH592R 1 (0.42%)ߤ 0 0 c.2110C>T P704S 2 (0.84%) 0 0 rs199422297 Collapsed frequency 2.1% 0.01 *All individuals with mutations were of European descent. Login to comment
93 Homozygous recessive or compound heterozygous ABCA3 mutations cause neonatal respiratory failure and childhood ILD, and single ABCA3 mutations (p.E292V and p.D123N) interacting with SFTPC p.I73T have been reported in two families, one with childhood ILD and one with IPF.10 34 Our identification of one individual who was homozygous for ABCA3 p.E292V adds to the recent identification of a kindred with pulmonary fibrosis due to a p.G964D thus further supporting the possibility that adult-onset fibrotic lung disease due to homozygous or compound heterozygous mutations in ABCA3 may occur.11 In contrast to our previous study that demonstrated an enrichment of single ABCA3 mutations in newborns with RDS, suggesting a developmental interaction that increased risk or severity of disease, we did not find the frequency of single ABCA3 mutations in the IPF cohort to be greater than the 3-5% in the general population. Login to comment
94 This is consistent with a prior study showing single E292V mutations were not a major risk factor for pulmonary disease in the general population, and also suggests that interactions with other modifiers are less likely to increase risk for disease.35-37 Since mutations in NKX2-1 are extremely rare in the general population, the lack of identifiable mutations in NKX2-1 in our IPF and COPD cohorts may simply be a function of the limited sample size of our cohort, thus making it difficult to know the true prevalence of NKX2-1 mutations in patients with IPF. Login to comment

PMID: 25817392 [PubMed] Zarbock R et al: "ABCA3 protects alveolar epithelial cells against free cholesterol induced cell death."

No. Sentence Comment

35 Two clinically relevant mutations belonging to different categories were chosen for this study: p.Q215K leads to mistrafficking [20], while p.E292V causes limited functional impairment of ABCA3 transporter function [21]. Login to comment
42 Stable transfection of A549 cells with pUB6-ABCA3-WT/Q215K/ E292V vectors was carried out as previously described [22]. Login to comment
86 Free cholesterol was visualized by filipin staining in A549 cells stably transfected with ABCA3-WT, p.Q215K and p.E292V or mock transfected cells. Login to comment
106 Expression of ABCA3-E292V did neither significantly affect FC nor PC levels. Login to comment
111 Shown are mRNA levels of SREBPs and INSIGs in stably transfected A549 ABCA3-WT, ABCA3-Q215K and ABCA3-E292V cells and mock transfected cells. Login to comment
118 These vesicles are markedly smaller in ABCA3-E292V cells and completely absent in ABCA3-Q215K cells. Login to comment
121 This was also the case in cells expressing ABCA3-Q215K and ABCA3-E292V. Login to comment
124 In contrast, there was no apparent cholesterol accumulation visible in association with the small ABCA3-positive vesicles observed in cells expressing ABCA3-E292V. Login to comment
135 Shown are mRNA levels of SREBP target genes in stably transfected A549 ABCA3-WT, ABCA3-Q215K and ABCA3-E292V cells and mock transfected cells. Login to comment
141 Unlike expression of ABCA3-WT, expression of mutated ABCA3 failed to induce expression of SREBPs and INSIG1; mRNA levels of all three proteins were similar to mock controls in cells expressing either ABCA3-Q215K or ABCA3-E292V (Fig. 4A-C). Login to comment
145 While abundant lipid droplets were seen in cells expressing ABCA3-Q215K and ABCA3-E292V and also in mock transfected cells, they were scarcely present in ABCA3-WT expressing cells (Fig. 6). Login to comment
152 These vesicles were hardly found in ABCA3-E292V cells where the strongest staining was observed at the plasma membrane. Login to comment
155 While cell viability was almost unchanged in cells expressing wild type ABCA3 and only a slight reduction was seen in ABCA3 p.E292V and mock transfected cells, viability was reduced significantly in ABCA3-Q215K cells (Fig. 8A). Login to comment
160 Cells expressing ABCA3-WT, p.Q215K and p.E292V and mock transfected cells were treated with free cholesterol-b2;- methylcyclodextrin complex. Login to comment
165 Lipid droplets in stably transfected A549 ABCA3-WT, p.Q215K and p.E292V cells and mock transfected cells were visualized by Oil Red O staining and fluorescence microscopy. Login to comment
197 (A) Cells expressing ABCA3-WT, p.Q215K and p.E292V and mock transfected cells were treated with free cholesterol-b2;- methylcyclodextrin complex before cell viability was assessed by XTT assay. Login to comment
217 Here we also delineate differentially the effect of two clinically relevant ABCA3 mutations, i.e. p.Q215K and p.E292V. Login to comment
218 While p.Q215K was associated with severe respiratory distress and early death [34], p.E292V seems to permit longer survival [3,13]. Login to comment
219 Concordantly, our studies support earlier results that ABCA3-E292V function is moderately impaired [21]. Login to comment

PMID: 26186947 [PubMed] Mulugeta S et al: "Lost after translation: insights from pulmonary surfactant for understanding the role of alveolar epithelial dysfunction and cellular quality control in fibrotic lung disease."

No. Sentence Comment

267 Summary of reported phenotypic features for surfactant component mutations Mutation (Domain) Clinical Diagnosis Lung Phenotype (in vivo) Subcellular Localization Trafficking Cellular Responses (in vitro) References SFTPA2 F198S (CRD) G231V (CRD) Familial pulmonary fibrosis Total BAL [SP-A] Normal ER retention Intracellular aggregation Not secreted (af9;) ER stress, cleared by ERAD (af9;) TGFbeta1 elaboration 99, 100, 175 SFTPC Group A1 èc;Exon4 (BRICHOS) L188Q (BRICHOS) G100S (BRICHOS) NSIP (Children) IPF/UIP (Adult) Absence of mature SP-C (humans) Arrested lung development (mice) ER stress (humans; mice) 1Sensitivity to bleomycin (mice) Epithelial cytotoxicity ER retention&#a1; aggresomes Intracellular aggregates ERAD requires Erdj 4/5 MG132 blocks degradation 4-PBA improves aggregates (af9;) ER stress (af9;) Apoptosis (af9;) Incomplete or absent proSP-C processing (af9;) IL-8/TGFbeta1 expression (af9;) Polyubiquitinated isoforms 21, 39, 97, 98, 100, 111, 112, 116, 117, 120, 153, 159, 160, 173, 193 Group A2 L110R (BRICHOS) P115L (BRICHOS) A116D (BRICHOS) Unspecified ILD Unspecified ILD Unspecified chILD Phenotype not reported EEA-1 (af9;); Syntaxin2 (afa;) Intracellular aggregation 2 PC secretion (af9;) Aberrant processing, 2 cell viability 1 HSP response (af9;) Congo red aggregates 160, 193 Group B1 E66K (Linker) I73T (Linker) NSIP/PAP (Child) IPF/UIP (Adult) 1 Phospholipid; 1SP-A, PAS positive staining Biopsy: PM and EE localization Misprocessed SP-C (BAL) Misprocessed SP-B (BAL) Plasma membrane&#a1;EE&#a1;LE/MVB (af9;) Aberrantly processed protein (af9;) Late autophagy block 2 Mitophagy 1 Mysfunctional mitochondria 1, 19, 24, 26, 49, 116, 118, 128, 152 Group B2 èc;91-93 (Non-BRICHOS) NSIP/PAP 2 BAL SP-B 1 BAL SP-A 2 Surfactant surface tension (af9;) Intracellular aggregates (af9;) Congo red staining Plasma membraneߥ EEA1 (af9;) compartmentsߥ Not reported 55, 181 Group C P30L (NH2-terminal) Unspecified ILD Phenotype not reported (af9;) ER retention 1 Bip expression (af9;) Polyubiquitinated isoforms 13, 116, 160 ABCA3 Group I (Trafficking Defective) L101P (1st luminal loop) R280C (1st cytosolic loop) L982P (3rd luminal loop) G1221S (11th TM domain) L1553P (COOH-terminal) Q1591P (COOH-terminal) Surfactant deficiency* RDS* chILDߤ Phenotype not reported Phenotype not reported Phenotype not reported (af9;) ER retention Non-LRO cytosolic vesicles (af9;) ER stress 30, 31, 103, 147, 172, 177 Group II (Functionally Defective) R43L (1st luminal loop) D253H (1st luminal loop) E292V (1st cytosolic loop) N568D (ABC1) E690K (ABC1) T1114M (8thTM domain) T1173R (1st luminal loop) L1580P (COOH-terminal) Surfactant deficiency* RDS* chILD (CPI)ߤ Reduced SP-B and SP-C (afa;) ER retention Lysosomes or LROs (normal) Impaired lipid transport Impaired ATP hydrolysis Impaired ATP binding Abnormal LBs 1 IL8 secretion 20, 25, 103, 104, 147, 148, 177 *Seen with homozygous or compound heterozygous ABCA3 expression; ߤfound with heterozugous ABCA3 expression. Login to comment
337 In one adult FPF kindred all carrying the same SFTPC mutation, a functional genetic variant in ABCA3 (E292V) also found in the previous pediatric study appeared to also affect disease penetrance, suggesting interplay between the two genotypes (37), not surprising given their overlapping biology within the AT2 cell. Login to comment

PMID: 26295388 [PubMed] Paolini A et al: "Structural Features of the ATP-Binding Cassette (ABC) Transporter ABCA3."

No. Sentence Comment

111 In particular, we focused on the following mutations: p.E292V, p.E690K, p.R1333G, p.W1142X, p.Y1515X, and p.L1553P. Login to comment
113 The p.E292V mutation, one of the most frequently observed in humans [61], is localized in a loop very close to the terminal part of the transporter channel and we may hypothesize that this amino acid is involved in ATP or substrate binding. Login to comment

PMID: 26517903 [PubMed] Peca D et al: "ABCA3, a key player in neonatal respiratory transition and genetic disorders of the surfactant system."

No. Sentence Comment

72 In another large series of children with chronic interstitial lung disease, whereas the most frequent variants were mutations of SFTPC (the SP-C-encoding gene), 10 infants were compound heterozygous carriers of the same p.Glu292Val ABCA3 mutation, which appears to be more frequent and associated with a less severe phenotype [25]. Login to comment
85 The p.Glu292Val mutation, located on the intracellular loop 1 (ICL1) that mediates ATP-driven conformational change of the first transmembrane complex, results in moderately impaired lipid transfer into LBs and is indeed associated with a less severe, chronic interstitial lung disease phenotype [44]. Login to comment
94 The p.Glu292Val allele, which is carried by 1.3% of the Danish general population, resulted in a 5% FEV1 (forced expiratory Figure 2 Distribution of amino acid substitutions due to ABCA3 mutations The ABCA3 protein structure includes two transmembrane complexes composed of six domains each, coupled with two NBDs (NBD1 and 2) each containing two Walker domains A and B facing the cytosol and one major and two minor ECDs for each transmembrane complex (ECD1-3 and ECD4-6) facing the LB inner compartment. Login to comment
100 The impact of p.Glu292Val was also studied in a German cohort of >3000 very-low-birth-weight infants, showing no measurable difference on pulmonary outcome [49]. Login to comment

PMID: 26547207 [PubMed] Chen YJ et al: "Population-based frequency of surfactant dysfunction mutations in a native Chinese cohort."

No. Sentence Comment

56 of alleles Frequency Frequency Frequency p.G205R 0.00 0.999 2 0.002 p.E292V 0.00 0.999 1 0.001 0.005 0.001 p.L654V 0.01 0.999 1 0.002 0.0003 p.G668D 0.00 0.992 2 0.003 p.A823P 0.01 0.992 1 0.002 p.F144IS 0.00 0.996 1 0.002 p.G1608C 0.01 1.000 2 0.003 Collapsed MAF 3 0.003* 7 0.011* Collapsed carrier frequency Han and Zhuang combined, % 1.3ߤ Table 2. Login to comment