ABCMdb

PMID: 18317237

Garmany TH, Wambach JA, Heins HB, Watkins-Torry JM, Wegner DJ, Bennet K, An P, Land G, Saugstad OD, Henderson H, Nogee LM, Cole FS, Hamvas A
Population and disease-based prevalence of the common mutations associated with surfactant deficiency.
Pediatr Res. 2008 Jun;63(6):645-9., [PubMed]

Sentences

No. Mutations Sentence Comment

2 ABCA3 p.Glu292Val We resequenced the ATP-binding cassette member A3 gene (ABCA3) in E292V carriers and computationally inferred ABCA3 haplotypes. Login to comment 3 ABCA3 p.Glu292Val The population-based frequencies of 121ins2, E292V, and I73T were rare (Ͻ0.4%). Login to comment 4 ABCA3 p.Glu292Val E292V was present in 3.8% of newborns with RDS, a 10-fold greater prevalence than in the Missouri cohort (p Ͻ 0.001). Login to comment 5 ABCA3 p.Glu292Val We did not identify other loss of function mutations in ABCA3 among patients with E292V that would account for their RDS. Login to comment 6 ABCA3 p.Glu292Val E292V occurred on a unique haplotype that was derived from a recombination of two common ABCA3 haplotypes. Login to comment 7 ABCA3 p.Glu292Val ABCA3 p.Glu292Val E292V was over-represented in newborns with RDS suggesting that E292V or its unique haplotype impart increased genetic risk for RDS. Login to comment 20 ABCA3 p.Glu292Val A missense mutation which introduces a valine for glutamic acid substitution at codon 292 (E292V), when associated with another mutation on the other ABCA3 allele, has been described in older, unrelated children with chronic lung disease (16). Login to comment 28 ABCA3 p.Glu292Val The frequencies of I73T and E292V in this population, and the frequencies of the three common surfactant pathway mutations in other geographically and ethnically diverse populations are unknown, as are their contributions to respiratory distress syndrome (RDS) in unselected populations of symptomatic newborns. Login to comment 46 ABCA3 p.Glu292Val We used BsrG1 restriction enzyme analysis to screen for E292V after amplifying a 682 base pair nucleotide fragment of exon 8 that contained the adenine to thymine transversion (16)(supplemental material, online). Login to comment 47 ABCA3 p.Glu292Val ABCA3 p.Glu292Val To determine whether those newborns with E292V and RDS carried other unique, functionally disruptive mutations in ABCA3, we then amplified and sequenced 2 kb of the promoter region, the 30 coding and 2 noncoding exons, and splice site junctions of ABCA3 for all 11 infants heterozygous for E292V and for 12 race and gestational age matched CON infants from the case-control cohort. Login to comment 51 ABCA3 p.Glu292Val To determine whether the E292V mutation occurred on a common haplotype background, we computationally inferred ABCA3 haplotypes using a Bayesian approach implemented in the PHASE computer software, and the 29 detected variants with minor allele frequency Ն5% (18). Login to comment 64 ABCA3 p.Glu292Val We found E292V in 0.3-0.4% of the predominantly European descent cohorts (Norway and Missouri) but in Ͻ0.1% of the Asian or African descent cohorts (Table 2). Login to comment 67 ABCA3 p.Glu292Val ABCA3 p.Glu292Val In contrast, the prevalence of E292V in the RDS cohort was 10-fold higher than that in the Missouri cohort (3.8%, p Ͻ 0.001); the prevalence of E292V in the CON cohort was not different from that of the Missouri cohort (1.1%, p ϭ 0.2). Login to comment 68 ABCA3 p.Glu292Val One set of twins in each of the CON and RDS groups was positive for E292V. Login to comment 69 ABCA3 p.Glu292Val No patient heterozygous for E292V in the RDS group carried SNPs that would be predicted to disrupt splice site junctions or alter ABCA3 protein sequence (Table 4), nor were any large insertions or deletions detected. Login to comment 75 ABCA3 p.Glu292Val ABCA3 p.Glu292Val Among the 15 ABCA3 haplotypes computationally inferred from the E292V and control cohorts (n ϭ 23), we identified two common haplotypes among the 35 alleles that did not carry E292V: haplotype 1 with 13 (37%) and haplotype 2 with 9 (26%) (Table 5). Login to comment 76 ABCA3 p.Glu292Val Among the 11 E292V carrying alleles, we identified one common haplotype (n ϭ 8) and three unique haplotypes. Login to comment 77 ABCA3 p.Glu292Val The E292V haplotypes have two distinct blocks in common with each of the two most common nonE292V haplotypes: a 5-7 locus block from intron 1 to exon 9, seen in haplotype 2, and a 23-25 locus block from intron 8 through intron 28, seen in haplotype 1. Login to comment 81 ABCA3 p.Glu292Val ABCA3 p.Glu292Val ABCA3 p.Glu292Val was not seen in the absence of E292V, suggesting that E292V arose in conjunction with a recombination event between these two blocks and further suggests that the disease effect, if any, may not be solely because of E292V, but the unique combination of associated variants along the gene. Login to comment 82 ABCA3 p.Glu292Val ABCA3 p.Glu292Val To assess whether E292V is associated with unique RDS characteristics, we compared demographic and clinical features in groups of RDS infants with and without E292V. Login to comment 83 ABCA3 p.Glu292Val Although the size of the cohort rendered limited statistical detection power, it appeared that the infants with E292V had a higher incidence of pneumothoraces (Table 6). Login to comment 84 ABCA3 p.Glu292Val ABCA3 p.Glu292Val The two most immature newborns with E292V (29 and 26 wk gestation) had evidence of more respiratory dysfunction (mechanical ventilation for Ͼ1 y and death because of chronic lung disease at 8 mo, respectively) than observed in newborn of similar gestational ages without E292V. Login to comment 86 ABCA3 p.Glu292Val ABCA3 p.Glu292Val Exonic and splice site SNPs identified in subjects with E292V Subject Race/Sex SNP(s)* Location Number of non-E292V controls with variant BW (kg) GA (wks) Outcome CON1 B/M Rs170447 (A)† Ex 13 ϩ30 1 3.6 41 Rs323043 ͓P585P͔ (B)† Ex 14 7 CON2 W/F A, B 2.6 37 RDS1 W/M A, B 3.6 38 PTX; vent 4 d, O2 5 d; discharged RA RDS2A W/F A, B 2.3 35 Vent 10 d, O2 5 d; discharged RA RDS2B W/F B 2.1 35 PTX; vent 14 d, O2 4 d; discharged RA RDS3 W/M 16669 Ex 5 -11 2 Vent 1 y, O2 1 y A Rs313908 Ex 18 -33 0 Rs313909 Ex 18 ϩ34 0 Rs149532 ͓S1372͔ Ex 26 0 RDS4 W/M B 2.9 37 PTX; vent 10 d, O2 6 d; discharged RA RDS5 W/M 45305 Ex 17 -17 1 3.8 36 Vent 4 d, O2 1 d; discharged RA RDS6 W/F Rs149532 ͓S1372S͔ Ex 26 0 2.5 33 Vent for 12 d, O2 for 18 d, then RA; died at 8 wks, non respiratory causes RDS7 W/F 21289 ͓A227A͔ Ex 7 1 3.1 39 CPAP for 2 d, Rs13332547 Ex 9 -20 3 O2 for 4 d; discharged RA Rs13332514 ͓F353F͔ Ex 9 3 RDS8 W/M None 0.7 26 Died at 8 mo, entirely vent dependent RDS9 W/M None 2.6 37 PTX, vent for 13 d, O2 for 6 mo * rs numbers through dbSNP (http://www.ncbi.nlm.nih.gov/SNP); if no rs number available, then the number refers to the genomic location from the ABCA3 sequence generated by Seattle SNPs (http://pga.gs.washington.edu/data/abca3/abca3.ColorFasta.html). Login to comment 91 ABCA3 p.Glu292Val Population-based frequencies Norway South Africa-black Korea Missouri Overall p value across cohorts 121ins2 3/2501 (0.1%) 0/2044 (0%) 0/2596 (0%) 8/10,044 (0.08%)* 0.2 I73T - - - 0/4464 (0%) - E292V 8/2515 (0.3%) 0/1686 (0%) 0/1541 (0%) 4/1107 (0.4%) 0.004 * Reported in Ref. 17. Login to comment 93 ABCA3 p.Glu292Val Disease-based frequencies CON (N ϭ 181) RDS (N ϭ 239) p value* between groups 121ins2 0 1 (0.4%) 1.0 I73T 0 0 - E292V 2 (1%) 9 (3.8%) 0.12 * Fisher`s exact probabilities. Login to comment 99 ABCA3 p.Glu292Val ABCA3 p.Glu292Val ABCA3 p.Glu292Val ABCA3 p.Glu292Val We only screened for E292V in ABCA3, and, whereas the E292V carrier frequency is 3- to 5-fold higher than 121ins2 or I73T carrier frequencies in population-based cohorts of primarily European descent (Norway and Missouri) and we cannot exclude the possibility that other mutations in ABCA3 are just as common, the 10-fold enrichment in E292V prevalence in our RDS cohort suggests that E292V may increase the risk and/or severity of RDS in susceptible newborns. Login to comment 101 ABCA3 p.Glu292Val Although disease-causing variants other than 121ins2 and E292V in SFTPB and ABCA3 are highly prevalent in cohorts of infants selected for lethal respiratory distress, they have primarily been identified in single individuals or families (3,14,26). Login to comment 106 ABCA3 p.Glu292Val The mechanism by which E292V may disrupt surfactant synthesis is unknown. Login to comment 109 ABCA3 p.Glu292Val ABCA3 p.Glu292Val ABCA3 p.Glu292Val Computational haplotypes identified in 23 individuals Group Haplotype # Haplotype Alleles, N (%)* nonE292V 1 CCGACCCCGGCAATCCGAAACTACAGGGTA 13 (37) 1a CCGACCCCGGCADCTCCAAAGCACTGGGCC 1 (3) 1b CCGACCCCGGCGDCTGCGGACCGCATAATC 1 (3) 1c CCGACCCCGGAGDTTCCGGACCGCATAATC 2 (6) 1d CCGACCCTGGCAATCCGAAACTACAGGGTA 1 (3) 1e CCGACTTTGGAGDTTCCGGACCGCATAATC 2 (6) 1f TTGACCCCGGCAATCCGAAACTACAGGGTA 1 (3) 1g TTGACTTTGGAGDTTCCGGACCGCATAATC 2 (6) nonE292V 2 CCAAACCTAACGDCTGGAAGGCATTGGGCC 9 (26) 2a CCAAACCTAACADCTGGAAGGCATTGGGCC 2 (6) 2b CCAAACCTAACGDCTGGAAGCCATTGGGCC 1 (3) E292V 3 CCAT†ACCCGGCAATCCGAAACTACAGGGTA 8 (73) 3a CCATACCCGGCAATCCGAAGCTACAGGGTA 1 (9) 3b CCATACCCGGCAATTCGAAACTACAGGGTC 1 (9) 3c CCATACCCGACAATCCGAAACTACAGGGTA 1 (9) * Percent of alleles with or without E292V. Login to comment 110 ABCA3 p.Glu292Val ABCA3 p.Glu292Val † E292V is an AϾT transversion; shaded CC is indeterminate as to which haplotype from which it was derived. Login to comment 112 ABCA3 p.Glu292Val ABCA3 p.Glu292Val ABCA3 p.Glu292Val Comparison of E292V positive newborns with RDS cohort (including twins) E292V with RDS N ϭ 10 RDS without E292V N ϭ 237 p value BW 2.6 (0.7-3.8) 1.8 (0.5-4.5) 0.10* 201 EGA 36 (26-39) 34 (23-43) 0.30* 218 Race (ED/AD) 10/0 139/72/26w 0.04† Sex (F/M) 4/6 101/133 1.0† Pneumothorax 4 (40%) 29 (15%) 0.06† Duration mech vent/CPAP 8 (1-450) 14 (0-358) 0.46* 171 Duration O2 18 (3-800) 26 (0-358) 0.90* 171 Outcome at discharge On O2 3 (38%) 75 (43%) 0.71* Vent 1 (10%) 9 (5%) 0.24* Survive 8 (80%) 147 (86%) 0.64* * Kruskal-Wallis test. Login to comment 116 ABCA3 p.Glu292Val These observations, along with other reports of lethal and chronic respiratory disease in the presence of a single mutation in ABCA3, suggest that E292V itself, or through interactions with variants in other genes, could disrupt ABCA3 function in developmentally susceptible individuals (14,16,26,34). Login to comment 118 ABCA3 p.Glu292Val The unique haplotype associated with E292V raises the possibility that a specific combination of variants within this new block could confer the phenotype. Login to comment 119 ABCA3 p.Glu292Val Our resequencing strategy that focused on coding regions and flanking sequence did not identify any coding or splice site variants either upstream or downstream of E292V that would obviously alter ABCA3 function, but it is possible that functional intronic or promoter variants reside within the regions that were not sequenced or in other genes along the surfactant synthetic pathway. Login to comment 120 ABCA3 p.Glu292Val Taken together, these data suggest that E292V may increase RDS susceptibility in the context of currently unknown developmental, genetic, or environmental traits. Login to comment 121 ABCA3 p.Glu292Val Even though the 121ins2, I73T, and E292V mutations are rare in the general population, they are sufficiently prevalent to warrant evaluation in the context of respiratory compromise that seems disproportionate for gestational age. Login to comment