ABCMdb

ABCC7 p.Ile148Thr

ClinVar:	c.443T>A , p.Ile148Asn ? , not provided c.443T>C , p.Ile148Thr N , Benign
CF databases:	c.443T>C , p.Ile148Thr N , Non CF-causing ; CFTR1: This mutation was found in only one CF patient with PI on his maternal chromosome; the change was not found in 81 normal chromosomes and 125 other CF chromosomes. c.442A>T , p.Ile148Phe (CFTR1) ? , The patient is compound heterozygote, the second mutation is F508del; the mutation was detected after sequencing of the whole CFTR gene and was detected only once in our cohort of CF-patients c.443T>A , p.Ile148Asn (CFTR1) ? , Patient was from Brazil and of Afro-American origin. The mutation was detected by SSCA and direct sequencing.
Predicted by SNAP2:	A: D (75%), C: D (71%), D: D (95%), E: D (95%), F: D (85%), G: D (95%), H: D (95%), K: D (95%), L: D (59%), M: D (63%), N: D (95%), P: D (95%), Q: D (95%), R: D (95%), S: D (91%), T: D (75%), V: N (57%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: N, C: N, D: D, E: D, F: N, G: D, H: D, K: D, L: N, M: N, N: D, P: D, Q: N, R: D, S: N, T: N, V: N, W: D, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Blood immunoreactive trypsinogen concentrations ar... Acta Paediatr. 1999 Mar;88(3):338-41. Lecoq I, Brouard J, Laroche D, Ferec C, Travert G
Blood immunoreactive trypsinogen concentrations are genetically determined in healthy and cystic fibrosis newborns.
Acta Paediatr. 1999 Mar;88(3):338-41., [PMID:10229049]

Abstract [show]
Newborns with cystic fibrosis (CF) have increased blood immunoreactive trypsinogen concentrations. When screening for CF in the newborn by immunoreactive trypsinogen measurement, an abnormally high proportion of healthy deltaF508 carriers is found among false-positive neonates, suggesting that a relationship could exist between immunoreactive trypsinogen concentration at birth and the genetic status. Therefore, this study analysed the possible relationships between neonatal blood immunoreactive trypsinogen concentrations and genotype in 1842 healthy newborns and 111 CF patients detected by a neonatal screening programme. A close correlation was found between immunoreactive trypsinogen and deltaF508: the probability of a healthy newborn being a carrier of this mutation increased regularly with the neonatal immunoreactive trypsinogen concentration. In CF patients, there was a significant difference between deltaF508 homozygotes and deltaF508/X (X = other mutation) compound heterozygotes with respect to the mean neonatal blood immunoreactive trypsinogen concentration. CF neonates with two mutations affecting the nucleotide binding domains of the cystic fibrosis transmembrane conductance regulator protein had significantly higher mean immunoreactive trypsinogen concentrations than patients with one mutation affecting a membrane-spanning domain. The data strongly suggest that the neonatal immunoreactive trypsinogen concentration is, in part, genetically determined, with a wide range of variations, similar to the features which have been shown for the relations between the genotype and clinical phenotypes of CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Twins or unrelated patients with identical genotype had very similar neonatal IRT concentrations: DF508/I148T (twins), 1040 and 1055 mg LÀ1 ; N1303K/G149R (twins), 1600 and 1725 mg LÀ1 ; DF508/E585X, 900 and 945 mg LÀ1 ; DF508/ G542X, 1535 and 1660 mg LÀ1 ; DF508/L206W, 980, 1090 and 1100 mg LÀ1 . Login to comment
72 In this study, CF newborns with one mutation in an exon encoding for either NBD1 or NBD2 (DF508, G542X, G551D, E585X, N1303K, etc.) and the other affecting one of the MSD (R117H, 574delA, I148T, G149R, L206W, etc.) had significantly lower IRT concentrations than CF neonates with both mutations located in NBD. Login to comment

[hide] Blood concentrations of pancreatitis associated pr... Arch Dis Child Fetal Neonatal Ed. 1999 Mar;80(2):F118-22. Sarles J, Barthellemy S, Ferec C, Iovanna J, Roussey M, Farriaux JP, Toutain A, Berthelot J, Maurin N, Codet JP, Berthezene P, Dagorn JC
Blood concentrations of pancreatitis associated protein in neonates: relevance to neonatal screening for cystic fibrosis.
Arch Dis Child Fetal Neonatal Ed. 1999 Mar;80(2):F118-22., [PMID:10325788]

Abstract [show]
AIM: To determine whether pancreatitis associated protein (PAP) is a marker for cystic fibrosis which could be used in neonatal screening for the disease. METHODS: PAP was assayed on screening cards from 202,807 neonates. Babies with PAP > or = 15 ng/ml, or > or = 11.5 ng/ml and immunoreactive trypsinogen (IRT) > or = 700 ng/ml were recalled for clinical examination, sweat testing, and cystic fibrosis transmembrane regulator (CFTR) gene analysis. RESULTS: Median PAP value was 2.8 ng/ml. Forty four cases of cystic fibrosis were recorded. Recalled neonates (n = 398) included only 11 carriers. A receiver operating characteristic curve analysis showed that PAP above 8.0 ng/ml would select 0.76% of babies, including all those with cystic fibrosis, except for one with meconium ileus and two with mild CFTR mutations. Screening 27,146 babies with both PAP and IRT showed that only 0.12% had PAP > 8.0 ng/ml and IRT > 700 ng/ml, including all cases of cystic fibrosis. CONCLUSION: PAP is increased in most neonates with cystic fibrosis and could be used for CF screening. Its combination with IRT looks promising.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 Other genotypes were F508/G542X (n=4), F508/N1303K (n=2), F508/I148T (n=2), F508/R117H, F508/R553X, F508/1717-1G->A, F508/ 1078delT, F508/2789+5G->A, F508/ E1308X (a novel CFTR mutation), R553X/ 394delTT, and N1303K/R553X. Login to comment

[hide] Detection of five rare cystic fibrosis mutations p... Clin Chem. 1999 Jul;45(7):957-62. Castaldo G, Fuccio A, Cazeneuve C, Picci L, Salvatore D, Raia V, Scarpa M, Goossens M, Salvatore F
Detection of five rare cystic fibrosis mutations peculiar to Southern Italy: implications in screening for the disease and phenotype characterization for patients with homozygote mutations.
Clin Chem. 1999 Jul;45(7):957-62., [PMID:10388469]

Abstract [show]
BACKGROUND: The search for the eight most frequent mutations (i.e., DeltaF508, G542X, W1282X, N1303K, 1717-1G-->A, R553X, 2183AA-->G, and I148T) by allele-specific oligonucleotide dot-blot analysis revealed 78% of 396 cystic fibrosis alleles in Southern Italy. The observation of frequent haplotypes on the unidentified cystic fibrosis alleles suggested that a few mutations could account for a large number of unidentified alleles. METHODS: We screened most of the coding sequence of the cystic fibrosis transmembrane regulator gene by denaturing gradient gel electrophoresis to determine the spectrum of these mutations in 68 unrelated cystic fibrosis patients bearing one or both unidentified mutations. RESULTS: The screening revealed five mutations, R1158X, 711+1G-->T, 4016insT, L1065P, and G1244E, each of which had a frequency of 1.3-1.8% (7% collectively). The 7% increase in the detection rate (85% vs 78%) reduces by >50% the residual risk of being cystic fibrosis carriers for couples who had tested negative by molecular analysis. We therefore designed a second allele-specific oligonucleotide set to analyze the five mutations. Among the patients analyzed, one patient homozygous for the L1065P mutation expressed a mild pulmonary and intestinal form of the disease with pancreatic insufficiency. Two other patients, homozygous for mutations R1158X and 4016insT, both expressed a severe cystic fibrosis phenotype. CONCLUSIONS: Five cystic fibrosis mutations are peculiar to patients from Southern Italy. The method described for their analysis is efficient, inexpensive, and can be semi-automated by use of a robotic workstation. The results obtained in patients from Southern Italy may have an impact on laboratories in other countries, given the large migrations of populations from Southern Italy to other countries in the last two centuries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 All patients were first analyzed for eight CF mutations, i.e., ⌬F508, N1303K, G542X, W1282X, 1717-1G3A, R553X, 2183AA3G, and I148T (9). Login to comment
39 methods The eight CF mutations (i.e., ⌬F508, N1303K, G542X, W1282X, 1717-1G3A, R553X, 2183AA3G, and I148T) were identified with a semi-automated procedure based on a single multiplex PCR amplification followed by the allele-specific oligonucleotide (ASO) identification we described previously (9). Login to comment

[hide] Two buffer PAGE system-based SSCP/HD analysis: a g... Eur J Hum Genet. 1999 Jul;7(5):590-8. Liechti-Gallati S, Schneider V, Neeser D, Kraemer R
Two buffer PAGE system-based SSCP/HD analysis: a general protocol for rapid and sensitive mutation screening in cystic fibrosis and any other human genetic disease.
Eur J Hum Genet. 1999 Jul;7(5):590-8., [PMID:10439967]

Abstract [show]
The large size of many disease genes and the multiplicity of mutations complicate the design of an adequate assay for the identification of disease-causing variants. One of the most successful methods for mutation detection is the single strand conformation polymorphism (SSCP) technique. By varying temperature, gel composition, ionic strength and additives, we optimised the sensitivity of SSCP for all 27 exons of the CFTR gene. Using simultaneously SSCP and heteroduplex (HD) analysis, a total of 80 known CF mutations (28 missense, 22 frameshift, 17 nonsense, 13 splicesite) and 20 polymorphisms was analysed resulting in a detection rate of 97.5% including the 24 most common mutations worldwide. The ability of this technique to detect mutations independent of their nature, frequency, and population specificity was confirmed by the identification of five novel mutations (420del9, 1199delG, R560S, A613T, T1299I) in Swiss CF patients, as well as by the detection of 41 different mutations in 198 patients experimentally analysed. We present a three-stage screening strategy allowing analysis of seven exons within 5 hours and analysis of the entire coding region within 1 week, including sequence analysis of the variants. Additionally, our protocol represents a general model for point mutation analysis in other genetic disorders and has already been successfully established for OTC deficiency, collagene deficiency, X-linked myotubular myopathy (XLMTM), Duchenne and Becker muscular dystrophy (DMD, BMD), Wilson disease (WD), Neurofibromatosis I and II, Charcot-Marie-Tooth disease, hereditary neuropathy with liability to pressure palsies, and defects in mitochondrial DNA. No other protocol published so far presents standard SSCP/HD conditions for mutation screening in different disease genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 The distribution of analysed known mutations is similar to that of the total number of mutations in the entire CFTR gene: missense mutations account for 35% (G27E, G85E, R117H, A120T, I148T, H199Y, R334W, T338I, R347P, R347H, A455E, M718K, S5449N, S5449I, G551D, R560T, R560S, S945L, S977P, I1005R, R1066C, R1070Q, M1101K, D1152H, S1235R, R1283M, N1303K, N1303H), followed by 28% of frameshift mutations (175delC, 394delTT, 457TAT- > G, 905delG, 1078delT, I507, F508, 1609delCA, 1677delTA, 2143delT, 2176insC, 218delA, 2184insA, 2869insG, 3659delC, 3732delA, 3821delT, 3905insT, 4016insT, 4172delGC, 4382delA), 21% of nonsense mutations (Q30X, Q39X, Q220X, W401X, Q525X, G542X, Q552X, R553X, V569X, E585X, K710X, R792X, Y1092X, R1162X, S1255X, W1282X, E1371X), and 16% of splice site mutations (621 + 1G- > T, 711 + 1G- > T, 711 + 5G- > A, 1717-1G- > A, 1898 + 1G- > A, 1898 + 5G- > T, 2789 + 5G- > A, 3271 + 1G- > A, 3272-26A- > G, 3601-17T- > C, 3849 + 4A- > G, 3849 + 10kbC- > T, 4374 + 1G- > T). Login to comment
34 Intron 19, all 27 exons and their exon-intron boundaries, including the 24 most common mutations worldwide (G85E, R117H, 621 + 1G- > T, 711 + 1G- > T, 1078delT, R334W, R347P, A455E, I507, F508, 1717-1G- > A, G542X, S549N, G551D, R553X, R560T, 1898 + 1G- > A, 2184delA, 2789 + 5G- > A, R1162X, 3659delC, 3849 + 10kbC- > T, W1282X, N1303K) (Cystic Fibrosis Genetic Analysis Consortium 1994), and the 15 most common mutations in our population (I148T, 1078delT, R334W, R347P, F508, 1717-1G- > A, G542X, R553X, 2347delG, D1152H, R1162X, 3849 + 10kbC- > T, 3905insT, W1282X, N1303K), were considered in this study. Login to comment
92 The technique developed demonstrates excellent single-strand separation and non-radioactive visualisation on polyacrylamide gels, and is time-saving and directly Table 2 Known mutations identified in 198 CF patients analysed investigatively Exon (E) Number of CFTR mutations intron (I) chromosomes Patient`s nationality Highest prevalence ∆F508 E10 212 miscellaneous 3905insT E20 025 Swiss Swiss, Amish, Arcadian R553X E11 020 Swiss, German German 1717-1G->A I10 017 Swiss, Italian Italian N1303K E21 011 Swiss, French, Italian Italian W1282X E20 014 Swiss, Italian, Israelit Jewish-Askhenazi G542X E11 009 Swiss, Spanish, Italian Spanish 2347delG E13 008 Swiss R1162X E19 006 Swiss, Italian, Russian Italian 3849+10kbC->T I19 005 German, French R347P E07 004 Swiss T5 I08 004 Swiss R334W E07 003 Swiss Q525X E10 003 Swiss 3732delA E19 003 Swiss S1235R E19 003 Italian, Turkish G85E E03 002 Italian, Greek I148T E04 002 Austrian, Turkish French-Canadian 621+1G->T I04 002 French French-Canadian 1078delT E07 002 Swiss E585X E12 002 Italian 2176insC E13 002 Swiss, Italian 2789+5G->A I14b 002 Italian Spanish D1152H E18 002 Swiss, French 4016insT E21 002 Turkish Q39X E02 001 Swiss 394delTT E03 001 Swiss Nordic, Finnish R117H E04 001 Swiss A120T E04 001 Swiss G126D E04 001 Swiss 711+5G->A I05 001 Russian M348K E07 001 Italian L568F E12 001 Italian 2183AA->G E13 001 Italian Italian K710X E13 001 Swiss S945L E15 001 French 3272-26A.->G I17a 001 Swiss M1101K E17b 001 Swiss Huttite 3601-17C->T I18 001 Swiss R1158X E19 001 Swiss 4005+1G-A I20 001 Italian applicable to early diagnostic testing, carrier detection and prenatal diagnosis. Login to comment

[hide] Three common CFTR mutations should be included in ... Clin Genet. 1999 Oct;56(4):318-22. Schaedel C, Hjelte L, de Monestrol I, Johannesson M, Kollberg H, Kornfalt R, Holmberg L
Three common CFTR mutations should be included in a neonatal screening programme for cystic fibrosis in Sweden.
Clin Genet. 1999 Oct;56(4):318-22., [PMID:10636451]

Abstract [show]
Children with cystic fibrosis (CF) diagnosed by neonatal screening have a better nutritional development and other advantages compared with those in a nonscreened group. The two-tier immunoreactive trypsinogen (IRT)/DNA screening protocol has been found superior to the single-tier IRT approach, improving the positive predictive value and thus reducing the false-positive rate. However, variations of the DNA test are required for different populations. In this study we examined CFTR (cystic fibrosis transmembrane conductance regulator) mutations in 331 CF patients attending the centres in Stockholm, Lund and Uppsala, comprising about 75% of the CF population in Sweden. The frequency of deltaF508 among CF alleles was 68.3%. There were two other mutations, 394delTT and 3659delC, found to be fairly frequent, amounting to 8.5 and 7.9%, respectively. Other mutations were comparatively rare. A simple and effective method of analysing the three mutations from Guthrie cards has been developed. Assuming Hardy-Weinberg equilibrium, 90% of our CF patients will be expected to carry at least one deltaF508 allele and 97.6% to carry at least one deltaF508, 394delTT or 3659delC copy. Including the latter two in a screening programme would thus substantially reduce the risk of a false-negative outcome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 patients 1 S549I/S549I Lebanon I148T/unknown1 Turkey 1 711+3GA/ Italy G1244E R553X/G551D1 France 2 R553X/unknown Sweden, Germany 175insT/175insT Sweden2 R117H/unknown2 Sweden 3 Unknown/unknown Sweden, Syria, Turkey early intervention (1, 3). Login to comment

[hide] A new approach for identifying non-pathogenic muta... Hum Genet. 2000 Feb;106(2):172-8. Bombieri C, Giorgi S, Carles S, de Cid R, Belpinati F, Tandoi C, Pallares-Ruiz N, Lazaro C, Ciminelli BM, Romey MC, Casals T, Pompei F, Gandini G, Claustres M, Estivill X, Pignatti PF, Modiano G
A new approach for identifying non-pathogenic mutations. An analysis of the cystic fibrosis transmembrane regulator gene in normal individuals.
Hum Genet. 2000 Feb;106(2):172-8., [PMID:10746558]

Abstract [show]
Given q as the global frequency of the alleles causing a disease, any allele with a frequency higher than q minus the cumulative frequency of the previously known disease-causing mutations (threshold) cannot be the cause of that disease. This principle was applied to the analysis of cystic fibrosis transmembrane conductance regulator (CFTR) mutations in order to decide whether they are the cause of cystic fibrosis. A total of 191 DNA samples from random individuals from Italy, France, and Spain were investigated by DGGE (denaturing gradient gel electrophoresis) analysis of all the coding and proximal non-coding regions of the gene. The mutations detected by DGGE were identified by sequencing. The sample size was sufficient to select essentially all mutations with a frequency of at least 0.01. A total of 46 mutations was detected, 20 of which were missense mutations. Four new mutations were identified: 1341+28 C/T, 2082 C/T, L1096R, and I11131V. Thirteen mutations (125 G/C, 875+40 A/G, TTGAn, IVS8-6 5T, IVS8-6 9T, 1525-61 A/G, M470V, 2694 T/G, 3061-65 C/A, 4002 A/G, 4521 G/A, IVS8 TG10, IVS8 TG12) were classified as non-CF-causing alleles on the basis of their frequency. The remaining mutations have a cumulative frequency far exceeding q; therefore, most of them cannot be CF-causing mutations. This is the first random survey capable of detecting all the polymorphisms of the coding sequence of a gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 Out of the 20 missense mutations, three (G85E, ∆F508, and N1303K) are certainly CF-causing, and several (R31C, K68E, R75Q, I148T, V562L, G576A-R668C, L997F, F1052V, S1235R) have been described in congenital bilateral absence of the vas deferens, in disseminated bronchiectasis, in pancreatitis, or in atypical CF cases mutations as reported in the CFGAC website (). Login to comment
80 Many (13 out of 20) of the missense mutations change highly conserved (5/5 species analyzed) amino acid residues (R75Q, G85E, I148T, I506V, R668C, G622D, L997F, I1027T, F1052V, L1096R, I1131V, R1162L, N1303K); others affect amino acid residues conserved in 4/5 species (K68 E, R170H, M470V, V562L, S1235R), or in 3/5 species (R31C and G576A; Tucker et al. 1992). Login to comment
96 Moreover, 1525-61 A/G (i 9) and 3601-65 C/A (i 18) were detected by SSCA performed in the Spanish sample only (14/82 and 12/80, respectively); these mutations were not identifiable by DGGE as used in the present work The totals are: a378; b362; c380; d356 genes eCertainly a CF-causing mutations fThe most common allele at this site is (TTGA)7 gThe most common allele at this site is T7 hThe frequency shown is that of the M allele Mutation Position North-Central Southern Spain Total East Italy Italy France 82 genes 100 genes 100 genes 100 genes 382 genes % 125 G/C 5`UTR 1 2 7 3 13 3.4 R31C 2 1 1 1 0 3 0.8 K68E 3 1 0 0 0 1 0.3 R75Q 3 1 1 2 0 4 1.0 G85Ee 3 0 1 0 0 1 0.3 406-6 T/C i 3 0 0 1 0 1 0.3 I148T 4 1 0 0 0 1 0.3 621+3 A/G i 4 0 1 0 0 1 0.3 R170H 5 1 0 0 0 1 0.3 875+40 A/G i 6a 11 5 5 2 23 6.0 (TTGA)6 f i 6a 17 11 7 13 48 12.6 1341+28 C/T i 8 1 0 0 0 1 0.3 IVS8-6g T5 i 8 8 2 4 3/78 17a 4.5 IVS8-6g T9 i 8 10 7 10 11/78 38a 10.0 M470Vh 10 42 30 39 27 138 36.1 I506V 10 1 0 0 0 1 0.3 ∆F508e 10 1 0 2 0 3 0.8 1716 G/A 10 2 1 0 5 8 2.1 V562L 12 0 0 1 0 1 0.3 G576A 12 1 0/80 1 0 2b 0.6 G622D 13 0 0/80 1 0 1b 0.3 R668C 13 1 0/80 1 0 2b 0.6 2082 C/T 13 1 0/80 0 0 1b 0.3 2377 C/T 13 0 0/80 0 1 1b 0.3 2694 T/G i 14a 33 23 33 14/80 103c 27.1 2752-15 C/G i 14b 0 3 0 0 3 0.8 3041-71 G/C i 15 0 1 2 0 3 0.8 L997F 17a 0 2 0 0 2 0.5 I1027T 17a 1 0 0 0 1 0.3 F1052V 17b 1 0 0 0 1 0.3 L1096R 17b 0 0 1 0 1 0.3 3417 A/T 17b 1 0 1 0 2 0.5 I1131V 18 0 1 0 0 1 0.3 R1162L 19 0 1 0 0 1 0.3 3690 A/G 19 0 0 0 1/80 1c 0.3 S1235R 19 1 0 0 0 1 0.3 4002 A/G 20 2 3 3 3/80 11c 2.9 4005+28insA i 20 0 1 0 0 0.3 4029 A/G 21 1 0 0 0 1 0.3 N1303Ke 21 1 0 0 0 1 0.3 4404 C/T 24 1 0 1 0 2 0.5 4521 G/A 24 21 16 14/80 15/76 66d 18.5 Total 165 113 137 98 513 encountered in the present survey are possible. Login to comment

[hide] A novel mutation in the CFTR gene correlates with ... J Med Genet. 2000 Mar;37(3):215-8. Wang J, Bowman MC, Hsu E, Wertz K, Wong LJ
A novel mutation in the CFTR gene correlates with severe clinical phenotype in seven Hispanic patients.
J Med Genet. 2000 Mar;37(3):215-8., [PMID:10777364]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
570 SYLVAIN R RIVARD* CHRISTIAN ALLARD† JEAN-PIERRE LEBLANC† MARCEL MILOT† GERVAIS AUBIN† FERNAND SIMARD† CLAUDE FÉREC‡ MARC DE BRAEKELEER†§¶ *Département des Sciences Fondamentales, Université du Québec à Chicoutimi, Canada Table 1 Distribution of cystic fibrosis patients diagnosed before the age of 5 by age groups in Saguenay-Lac-Saint-Jean, (A) by genotype, (B) by mutation 0-10 years 10.1-20 years Over 20 years All ages No % No % No % No % (A) Genotype F508/ F508 15 (1) 40.5 21 (2) 36.2 18 (3) 42.9 54 (6) 39.4 F508/621+1G→T 12 (1) 32.4 16 (1) 27.6 10 (1*) 23.8 38 (3*) 27.7 F508/A455E 1 2.7 6 10.3 5 11.9 12 8.8 F508/I148T 1 2.7 1 1.7 2 1.5 F508/Y1092X 3 (1) 5.2 1 2.4 4 (1) 2.9 F508/Q890X 1 2.4 1 0.7 F508/R1158X 1 2.4 1 0.7 621+1G→T/621+1G→T 2 (1) 5.4 4 6.9 1 2.4 7 (1) 5.1 621+1G→T/A455E 1 2.7 4 6.9 3 7.1 8 5.8 621+1G→T/711+1G→T 2 (1) 5.4 2 (1) 3.4 4 (2) 2.9 621+1G→T/Y1092X 1 2.7 1 0.7 621+1G→T/S489X 1 2.7 1 0.7 621+1G→T/G85E 1 (1) 1.7 1 (1) 2.4 2 (2) 1.5 A455E/R117C 1 2.7 1 0.7 N1303K/I148T 1 2.4 1 0.7 Total 37 58 42 137 Death (4) 10.8 (6) 10.3 (5*) 11.9 (15*) 10.9 (B) Mutation F508 16 (1) 43.2 25 (3) 43.1 21 (3) 51.2 62 (7) 45.6 621+1G→T 18 (3) 48.6 23 (3) 39.7 12 (2*) 29.3 53 (8*) 39.0 A455E 3 8.1 10 17.2 8 19.5 21 15.4 Total 37 58 41 136 Death (4) 10.8 (6) 10.3 (5*) (12.2) (15*) (11.0) ( ): Number of deaths. Login to comment

[hide] Spectrum of CFTR mutations in Mexican cystic fibro... Hum Genet. 2000 Mar;106(3):360-5. Orozco L, Velazquez R, Zielenski J, Tsui LC, Chavez M, Lezana JL, Saldana Y, Hernandez E, Carnevale A
Spectrum of CFTR mutations in Mexican cystic fibrosis patients: identification of five novel mutations (W1098C, 846delT, P750L, 4160insGGGG and 297-1G-->A).
Hum Genet. 2000 Mar;106(3):360-5., [PMID:10798368]

Abstract [show]
We have analyzed 97 CF unrelated Mexican families for mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Our initial screening for 12 selected CFTR mutations led to mutation detection in 56.66% of the tested chromosomes. In patients with at least one unknown mutation after preliminary screening, an extensive analysis of the CFTR gene by single stranded conformation polymorphism (SSCP) or by multiplex heteroduplex (mHET) analysis was performed. A total of 34 different mutations representing 74.58% of the CF chromosomes were identified, including five novel CFTR mutations: W1098C, P750L, 846delT, 4160insGGGG and 297-1G-->A. The level of detection of the CF mutations in Mexico is still lower than that observed in other populations with a relatively low frequency of the deltaF508 mutation, mainly from southern Europe. The CFTR gene analysis described here clearly demonstrated the high heterogeneity of our CF population, which could be explained by the complex ethnic composition of the Mexican population, in particular by the strong impact of the genetic pool from southern European countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
69 First, we tested these patients for 12 mutations selected for the following reasons: five are the most common mutations worldwide (∆F508, G542X, N1303K, G551D and R553X; CFGAC 1994); 362 Table 1 Frequency of the CFTR gene mutations in 97 (194 chromosomes) Mexican patients Mutation Number of Frequency affected alleles (%) ∆F508 79 40.72 G542X 12 6.18 ∆I507 5 2.57 S549N 5 2.57 N1303K 4 2.06 R75X 3 1.54 406-1G→A 3 1.54 I148T 3 1.54 2055del9→A 2 1.03 935delA 2 1.03 I506T 2 1.03 3199del6 2 1.03 2183AA→G 2 1.03 G551D 1 0.51 R553X 1 0.51 1924del7 1 0.51 G551S 1 0.51 1078delT 1 0.51 Y1092X 1 0.51 R117H 1 0.51 G85E 1 0.51 3849+10KbC→T 1 0.51 1716G→A 1 0.51 W1204X 1 0.51 W1098Ca 1 0.51 846delTa 1 0.51 P750La 1 0.51 V754M 1 0.51 R75Q 1 0.51 W1069X 1 0.51 L558S 1 0.51 4160insGGGGa 1 0.51 297-1G→Aa 1 0.51 H199Y 1 0.51 2869insG 0 0 R1162X 0 0 3120+1G→A 0 0 Total 34 145 74.58% aNovel mutations detected in this study Fig.1 Sequencing ladders showing the CFTR novel mutations. Login to comment

[hide] Genotype-phenotype correlation in three homozygote... J Med Genet. 2000 Apr;37(4):307-9. Kilinc MO, Ninis VN, Tolun A, Estivill X, Casals T, Savov A, Dagli E, Karakoc F, Demirkol M, Huner G, Ozkinay F, Demir E, Seculi JL, Pena J, Bousono C, Ferrer-Calvete J, Calvo C, Glover G, Kremenski I
Genotype-phenotype correlation in three homozygotes for the cystic fibrosis mutation 2183AA-->G shows a severe phenotype.
J Med Genet. 2000 Apr;37(4):307-9., [PMID:10819640]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
468 Identification of four new mutations in the cystic fibrosis transmembrane conductance regulator gene: I148T, L1077P, Y1092X, 2183AA→G. Hum Mutat 1994;3:330-2. 3 Cystic Fibrosis Genetic Analysis Consortium. Login to comment

[hide] Identification of novel mutations in Arabs with cy... Eur J Pediatr. 2000 May;159(5):303-9. Kambouris M, Banjar H, Moggari I, Nazer H, Al-Hamed M, Meyer BF
Identification of novel mutations in Arabs with cystic fibrosis and their impact on the cystic fibrosis transmembrane regulator mutation detection rate in Arab populations.
Eur J Pediatr. 2000 May;159(5):303-9., [PMID:10834512]

Abstract [show]
The cystic fibrosis transmembrane regulator (CFTR) gene in Arab patients with cystic fibrosis (CF) (sweat chloride > 60 mmol/l) from 61 unrelated families was screened for mutations in exons 3, 4, 5, 7, 10, 11, 16 and 19 and for mutations W1282X, N1303K and 3,849 + 10kbC --> T. Eight novel mutations were identified. These are: in exon 4: a) 425del42 (an in-frame 42 bp deletion that removes 14 amino acids and causes Gln98 --> His at the point of deletion), b) 475G --> T (Glu115 --> Stop) and c) 548A --> T (His139 --> Leu); in intron 5,711 + 1G --> A (splice site mutation); in exon 10, 1548delG (deletion of a "G" nucleotide causing a frameshift mutation that alters the amino acid sequence at residue 473 and results in translation termination at residue 526); in exon 11, a) 1729T --> C (Ph533E --> Leu) and b) 1,811 + 2 (splice site mutation) and finally in exon 19,3361A --> T (Lys1177 --> Stop). All mutations were detected by heteroduplex analysis and identified by sequencing. Of more than 850 known CFTR mutations, only 9 were encountered. The comparative frequencies of the most common mutations are: 1548delG> 1123V = deltaF508 = 3,120 + 1G --> A > H139L. Screening for these five mutations identifies 60% of the CF alleles in Arab populations. The novel mutation 1548delG is the most frequent (17%) among Arabs. CONCLUSION: Novel Arab-specific mutations were identified in the CFTR gene underlying cystic fibrosis. As a result of this study, the CFTR mutation detection rate among Arabs with cystic fibrosis is now comparable to that of other populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 One with the I148T (585C ® T) mutation in exon 4 and the other with DF508 in exon 10. Login to comment

[hide] Aberrant CFTR-dependent HCO3- transport in mutatio... Nature. 2001 Mar 1;410(6824):94-7. Choi JY, Muallem D, Kiselyov K, Lee MG, Thomas PJ, Muallem S
Aberrant CFTR-dependent HCO3- transport in mutations associated with cystic fibrosis.
Nature. 2001 Mar 1;410(6824):94-7., 2001-03-01 [PMID:11242048]

Abstract [show]
Cystic fibrosis (CF) is a disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR). Initially, Cl- conductance in the sweat duct was discovered to be impaired in CF, a finding that has been extended to all CFTR-expressing cells. Subsequent cloning of the gene showed that CFTR functions as a cyclic-AMP-regulated Cl- channel; and some CF-causing mutations inhibit CFTR Cl- channel activity. The identification of additional CF-causing mutants with normal Cl- channel activity indicates, however, that other CFTR-dependent processes contribute to the disease. Indeed, CFTR regulates other transporters, including Cl(-)-coupled HCO3- transport. Alkaline fluids are secreted by normal tissues, whereas acidic fluids are secreted by mutant CFTR-expressing tissues, indicating the importance of this activity. HCO3- and pH affect mucin viscosity and bacterial binding. We have examined Cl(-)-coupled HCO3- transport by CFTR mutants that retain substantial or normal Cl- channel activity. Here we show that mutants reported to be associated with CF with pancreatic insufficiency do not support HCO3- transport, and those associated with pancreatic sufficiency show reduced HCO3- transport. Our findings demonstrate the importance of HCO3- transport in the function of secretory epithelia and in CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 Two of the mutations, I148T and R117H, are relatively common, and thus the clinical data are solid. Login to comment
23 To validate the ability of this procedure to accurately report Cl-channel activity, we determined the correlation between expression ef®ciency (green ¯uorescent protein (GFP) ¯uorescence), Cl- current and changes in [Cl- ]i in cells transfected with CFTR, CFTR(I148T) and CFTR(R117H). Login to comment
24 Figure 1a±h shows that similar results are reported by measurement of Cl- current and [Cl- ]i for CFTR and the mutants. Therefore, the Cl-transport capacity of all other CFTR letters to nature 94 NATURE | VOL 410 | 1 MARCH 2001 |www.nature.com NO3 - NO3 - NO3 - Forskolin 5 µM Forskolin 5 µM Forskolin 5 µM Cl-free Forskolin 5 µM Cl-free Cl-free Forskolin 5 µM Forskolin 5 µM 0.25 pHunits 250 s e WT f I148T g R117H i WT j I148T k R117H 10mMCl- 200 s 0 0.2 0.4 [Cl- ]change (mMs-1 ) n=6 n=4 n=3 WT R117H I148T 0 0.2 0.4 0.6 0.8 1.0 HCO3 -transport (∆pH+ min-1 ) n=8 n=4 n=3 I148T R117H WT l a WT b I148T c d h R117H 0 8 16 24 n=5 n=4n=3 WT I148T R117H Current (pApF-1 perGFP fluorescence) 120 s 100pA For 5 µMFor 5 µMFor 5 µM Figure 1 cAMP-stimulated Cl- and HCO3 transport by wild-type (WT) CFTR and the CFTR mutants I148T and R117H. Login to comment
32 (c) 2001 Macmillan Magazines Ltd mutants was evaluated from changes in [Cl- ]i. Figure 1e±l shows the experimental protocols used to measure the effect of the I148T and R117H mutations on Cl- and HCO3 transport. Login to comment
33 The I148T mutant is normally processed and mediates macroscopicCl- current(Fig.1d;ref.16),single-channelproperties16 and Cl- ¯uxes (Fig. 1h) indistinguishable from those of wild-type CFTR, but is associated with CF with pancreatic insuf®ciency. Login to comment
34 Replacing external Cl- with NO3 in non-stimulated cells caused a slow Clef¯ux in cells expressing CFTR or the I148T mutant. Login to comment
36 Similar rates were measured for the I148T, G178R, A1067T, G1244E, S1255P and G1349D mutants (see Fig. 3 for location of these mutations in CFTR), all of which are associated with CF with pancreatic insuf®- ciency. Login to comment
44 Results for the I148T mutant are shown in Fig. 1, and the averaged results for all mutants are listed in Table 1 in the Supplementary Information. Login to comment
186 letters to nature 96 NATURE |VOL 410 |1 MARCH 2001 |www.nature.com HCO3 -/Cl- transportratio 0 0.25 0.50 0.75 1.00 WT I148T G178R R297Q G551D H620Q G970R A1067T G1244E S1255P G1349D E193K G551S A800G H949Y R1070Q Pancreatic insufficient Pancreatic sufficientD648V N CI148T G178R E193K R297Q R117H A1067T R1070Q G1244E S1255P G1349D NBD2 RD H949Y G970R CL4CL3CL2CL1 NBD1 G551D G551S H620Q D648V A800G Figure 3 The HCO3:Cl-transport ratio of CFTR mutants associated with CF. Login to comment

[hide] CFTR gene mutations--including three novel nucleot... Hum Genet. 2001 Mar;108(3):216-21. Tzetis M, Efthymiadou A, Strofalis S, Psychou P, Dimakou A, Pouliou E, Doudounakis S, Kanavakis E
CFTR gene mutations--including three novel nucleotide substitutions--and haplotype background in patients with asthma, disseminated bronchiectasis and chronic obstructive pulmonary disease.
Hum Genet. 2001 Mar;108(3):216-21., [PMID:11354633]

Abstract [show]
In order to investigate the incidence of cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations and unclassified variants in chronic pulmonary disease in children and adults, we studied 20 patients with asthma, 19 with disseminated bronchiectasis (DB) of unknown aetiology, and 12 patients with chronic obstructive pulmonary disease (COPD), and compared the results to 52 subjects from the general Greek population. Analysis of the whole coding region of the CFTR gene and its flanking intronic regions revealed that the proportion of CFTR mutations was 45% in asthma (P<0.05), 26.3% in DB (P>0.05), 16.7% in COPD (P>0.05), compared to 15.4% in the general population. Seventeen different molecular defects involved in disease predisposition were identified in 16 patients. Three potentially disease-causing mutations, T388 M, M1R and V11I, are novel, found so far only in three asthma patients. The hyperactive M470 allele was found more frequently in COPD patients (frequency 70.8%, P<0.01) than in the controls. The study of the TGmTnM470 V polyvariant CFTR allele revealed the presence of CFTR function-modulating haplotypes TG13/T5/M470, TG11/T5/M470, TG12/T5/V470 and TG12/T7, combined with M470 or V470, in six asthma patients, four DB patients (P<0.01), and two COPD patients (P<0.05). These results confirm the involvement of the CFTR gene in asthma, DB and possibly in COPD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 Of the 17 mutations in the patients, 9 (Y301C, I148T, R297Q, S1235R, T896I, S977F, L997F, F1052 V, A120T) have been listed by the Cystic Fibrosis Genetic Analysis Consortium (see website: http://www.cf.genet.sickkids. Login to comment
60 of CFTR gene IVS8-(T)n IVS8-(TG)m M470 V tested cases mutationa Asthma 20 1 L997F, T338Mb 9/7 10/12 M/V 1 Y301C 7/7 11/11 V/V 1 M1Rb, V11Ib 7/7 12/10 M/M 1 I148T/- 9/9 10/10 M/V 1 L997F/- 9/9 11/9 M/V 1 R297Q/- 5/5 13/11 M/M 1 R297Q/- 7/7 11/11 V/V 1 R75Q/- 7/7 11/11 V/V 1 A120T/ 5/7 11/11 V/V 1 -/- 7/7 11/12 M/V 1 -/- 7/9 11/11 M/M 2 -/- 7/7 12/10 M/V 7 -/- 7/7 11/11 V/V DB 19 1 F508del, I1027T 9/9 10/10 M/M 1 D565G, R668C 7/7 11/11 M/V 1 T896I/- 7/7 11/10 M/V 1 I148T/- 7/9 11/10 M/V 1 F508del/S977F 5/9 12/10 M/V 1 -/- 7/9 12/10 V/V 1 -/- 7/9 10/10 M/V 1 -/- 7/7 11/12 M/M 2 -/- 7/7 11/10 1 M/V, 1 V/V 2 -/- 7/7 12/10 1 V/V, 1 M/M 3 -/- 7/9 11/10 1 M/M, 2 V/V 4 -/- 7/7 11/11 1 V/V, 3 M/V COPD 12 1 F1052 V/- 7/7 11/10 M/V 1 S1235R/- 7/9 12/10 M/M 1 -/- 5/5 11/12 M/V 1 -/- 7/9 10/10 M/M 2 -/- 7/9 11/10 1 M/M,1 M/V 3 -/- 7/7 11/10 M/V 3 -/- 7/7 11/11 1 M/V, 2 M/M Controls 52 1 F508del/- 7/9 10/10 M/M 1 F1052 V/- 5/7 10/11 M/V 1 F1052 V/- 7/7 11/11 M/M 1 R668C, D565G/- 7/7 11/11 M/M 1 R688C, D565G/- 7/7 11/10 M/V 1 R75Q/- 7/7 11/11 V/V 1 R297Q/- 7/7 11/10 M/V 1 L997F/- 7/9 10/10 M/V 1 -/- 7/7 10/10 M/V 1 -/- 7/9 10/10 M/M 1 -/- 7/9 12/10 M/M 4 -/- 7/9 11/10 1 M/M, 1 V/V, M/V 15 -/- 7/7 11/10 13 M/V, 2 V/V 22 -/- 7/7 11/11 18 V/V, 3 M/V, 1 M/M been found that affect the same codon, of which M1 K affects the same nucleotide (T>A) (Cystic Fibrosis Genetic Analysis Consortium website). Login to comment
72 The proportion of CFTR alleles in each group is expressed as c/d (e), where c indicates the number of alleles with the genotype indicated at left, d indicates the number of total alleles examined in each group and e represents the percentage aMutation name according to the Cystic Fibrosis Genetic Analysis Consortium bNovel mutations, reported for the first time in this study Mutationa Control Pulmonary disease patients Greek CF population patients (PS; PI) (n=52) Asthma DB COPD (n=426) (n=20) (n=19) (n=12) R75Q (356 G/A, exon 3) 1 (0.96%) 1 (2.5%) - - 1 (0.1%) R668C (2134 C/T, exon 13) 2 (1.9%) - 1 (2.6%) - 1 (0.1%) L997F (3123 G>C, exon 17a) 1 (0.96%) 2 (5%) - - - F508del 1 (0.96%) - 2 (5.3%) - 465 (54.6%) D565G (A>G at 1825, exon 12) 2 (1.9%) - 1 (2.6%) - 1 (0.1%) F1052 V (T>G at 3286, exon 17b) 2 (1.9%) - - 1 (4.2%) 1 (0.1%) R297Q (G>A at 1022, exon 7) 1 (0.96%) 2 (5%) - - - Y301C (A>G at 1034, exon 7) - 1 (2.5%) - - - I148T (T>C at 575, exon 4) - 2 (5%) - - 1 (0.1%) T388Mb (C>T at 1295, exon 8) - 1 (2.5%) - - - M1Rb (T>G at 134, exon 1) - 1 (2.5%) - - - V11Ib (G>A at 163, exon 1) - 1 (2.5%) - - - I1027T (3212 T/C, exon 17a) - - 1 (2.6%) - 1 (0.1%) T896I (C>T at 2819, exon 15) - - 1 (2.6%) - - S977F (C>T at 3062, exon 16) - - 1 (2.6%) - - A120T (G>A at 490, exon 4) - 1 (2.5%) - - - S1235R (T>G at 3837, exon 19) - - - 1 (4.2%) - Table 3 Frequency of M470 and (TG)mTn alleles in pulmonary disease patients and controls (DB disseminated bronchiectasis, COPD chronic obstructive pulmonary disease, n number of cases, ND not detected) Clinical status Allele M470 TG11/T7 TG10/T7 TG12/T7 TG10/T9 TG11/T5 TG12/T5 TG13/T5 Asthmaa (n=20) 13 (32.5%) 23 (57.5%) 3 (7.5%) 5 (12.5%) 3 (7.5%) 2 (5%) ND 1 (2.5%) DB (n=19) 17 (44.7) 18 (47.4%) 6 (15.8%) 4 (10.5%) 9 (23.7%) ND 1 (2.6%) ND COPD (n=12) 17 (70.8) 12 (50%) 5 (20.8%) 1 (4.2%) 4 (16.7%) 1 (4.2%) 1 (4.2%) ND Controls (n=52) 37 (35.5%) 71 (68.%) 23 (22.1%) 1 (0.96%) 6 (5.8%) 1 (0.96%) ND ND aAlleles TG11/T9 (2) and TG9/T9 (1) also detected alleles, P<0.01) were both found more frequently in patients with COPD. Login to comment
93 Mutation I148T is a CF-causing mutation, first reported in a pancreatic-insufficient CF patient (Cystic Fibrosis Genetic Analysis Consortium website). Login to comment

[hide] XV-2c/KM-19 haplotype analysis of cystic fibrosis ... Am J Med Genet. 2001 Aug 15;102(3):277-81. Orozco L, Gonzalez L, Chavez M, Velazquez R, Lezana JL, Saldana Y, Villarreal T, Carnevale A
XV-2c/KM-19 haplotype analysis of cystic fibrosis mutations in Mexican patients.
Am J Med Genet. 2001 Aug 15;102(3):277-81., 2001-08-15 [PMID:11484207]

Abstract [show]
We analyzed 97 unrelated Mexican cystic fibrosis (CF) patients and their first-degree relatives to study the association of XV2C/TaqI/KM19/PstI haplotypes with CF mutations in this population. Haplotype phases could be established in 148 CF and 110 normal chromosomes, and haplotype distributions of normal and CF chromosomes differed significantly (P < 0.001). DeltaF508 and G542X mutations accounted for 56% of CF chromosomes and were found to be associated with haplotype B in 97.2% and 72.7% of chromosomes, respectively. The haplotype distribution of CF chromosomes carrying other rare and unknown mutations was similar to that of normal chromosomes (P > 0.05), haplotypes A and C being the most frequent. This is in accordance with the extensive heterogeneity and the spectrum of mutations reported in Mexican CF patients. We also report the haplotype distribution of all informative chromosomes bearing rare mutations; some were found to be associated with previously reported haplotypes, whereas others were found on different haplotypes. Recombination or recurrence of mutations may explain these different associations, although other intragenic markers must be used to better understand the origin and dispersion of CF mutations in our country. XK haplotype analysis allowed carrier detection among sibs in 24.3% of families, showing that this method may be useful for carrier detection in populations with high allelic heterogeneity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 Distribution of XK Haplotype on Chromosomes Bearing Uncommon Cystic Fibrosis (CF) Mutations A B C D S549N 4/4 DI507 3/3 N1303K 3/3 2055 del9!A 2/2 I148T 1/1 406-1G!A 1/1 R75X 1/1 I506T 1/1 935delA 1/1 2183AA!G 1/1 1924del7 1/1 G551S 1/1 1078delT 1/1 R117H 1/1 384910KbC!T 1/1 1716G!A 1/1 W1204X 1/1 W1098C 1/1 846delT 1/1 R75Q 1/1 W1069X 1/1 L558S 1/1 4160insGGGG 1/1 297-1G!A 1/1 Fig. Login to comment
84 As regards other mutations (Table II), DI507 was associated with haplotype D as previously described in southern France [Claustres et al., 1996]; I148T with haplotype B as described in Italy and southern France [Castaldo et al., 1996; Claustres et al., 1996]; and 1078delT with haplotype C as found in France [Claustres et al., 1996]. Login to comment

[hide] Analysis of exocrine pancreatic function in cystic... Eur J Clin Invest. 2001 Sep;31(9):796-801. Walkowiak J, Herzig KH, Witt M, Pogorzelski A, Piotrowski R, Barra E, Sobczynska-Tomaszewska A, Trawinska-Bartnicka M, Strzykala K, Cichy W, Sands D, Rutkiewicz E, Krawczynski M
Analysis of exocrine pancreatic function in cystic fibrosis: one mild CFTR mutation does not exclude pancreatic insufficiency.
Eur J Clin Invest. 2001 Sep;31(9):796-801., [PMID:11589722]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most common cause of exocrine pancreatic insufficiency in childhood. The aim of the present study is to evaluate the correlation between genotype and exocrine pancreatic insufficiency in CF patients. The special emphasis was put on the analysis of mild CFTR mutations. DESIGN: The study comprised 394 CF patients and 105 healthy subjects (HS). Elastase-1 concentrations were measured in all subjects. RESULTS: Severe pancreatic insufficiency was associated with the presence of two CFTR gene mutations (DeltaF508, N1303K, CFTR dele 2,3 (21kb), G542X, 1717-1G-A, R533X, W1282X, 621GT, 2183AAG, R560T, 2184insA and DeltaI507, G551D, 895T) and mild insufficiency with the presence of at least one mutation (R117H, 3171insC, A155P2, 138insL, 296 + 1G-A, E92GK, E217G, 2789 + 5G-A. 3849 + 1kbC-T/3849 + 1kbC-T) genotype resulted in high elastase-1-values. However, in case of patients with genotype DeltaF508/3849 + 10kbC-T, 1717-1GA/3849 + 10kbC-T as well as with DeltaF508/R334W, both high and low elastase-1 concentrations were found. Low E1 values were found in a patient with DeltaF508/R347P genotype. CONCLUSION: Patients who carry two 'severe' mutations develop pancreatic insufficiency, whereas those who carry at least one 'mild' usually remain pancreatic sufficient. However, the presence of one mild mutation does not exclude pancreatic insufficiency.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 Kristidis et al. [10] reported that pancreatic insufficiency strongly correlates also with two alleles of DI507, Q493X, G542X, R553X, W1282X, 621 1 1G-T, 1717±1G-A, 556delA, 3659delC, I148T, G480C, V520F and R560T while one or two mutations such as R117H, R334W, A455E, and P574H were correlated with a pancreatic sufficient phenotype. Login to comment

[hide] Improved detection of CFTR mutations in Southern C... Hum Mutat. 2001 Oct;18(4):296-307. Wong LJ, Wang J, Zhang YH, Hsu E, Heim RA, Bowman CM, Woo MS
Improved detection of CFTR mutations in Southern California Hispanic CF patients.
Hum Mutat. 2001 Oct;18(4):296-307., [PMID:11668613]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause cystic fibrosis (CF), a common autosomal recessive disease in Caucasians. The broad mutation spectrum varies among different patient groups. Current molecular diagnoses are designed to detect 80-97% of CF chromosomes in Caucasians and Ashkenazi Jews but have a much lower detection rate in Hispanic CF patients. Grebe et al. [1994] reported a 58% detection rate in Hispanic patients. Since then, there has been no large-scale, complete mutational analysis of Hispanic CF patients. In this study, the mutations in 62 Hispanic patients from southern California were investigated. The entire coding and flanking intronic regions of the CFTR gene were analyzed by temporal temperature gradient gel electrophoresis (TTGE) followed by sequencing to identify the mutations. Eleven novel mutations were discovered in this patient group: 3876delA, 406-1G>A, 935delA, 663delT, 3271delGG, 2105-2117del13insAGAAA, 3199del6, Q179K, 2108delA, 3171delC, and 3500-2A>T. Among the mutations, seven were out-of-frame insertions and deletions that result in truncated proteins, two were splice-site mutations, one was an in-frame 6 bp deletion, and one was a missense mutation that involved the non-conservative change of glutamine-179 to lysine. All patients presented severe classical clinical course with pancreatic insufficiency and poor growth, consistent with the nature of truncation mutation. The results indicate that TTGE screening following the analysis of recurrent mutations will substantially improve the mutation detection rate for Hispanic CF patients from southern California.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
96 Seven other mutations, I148T, S549N, R334W, 3120+1G to A, 406-1G>A, 935delA, and R1066C, occurred twice. Login to comment
117 Summary of Mutations Found in This Group of Hispanic Patients Exon or Number of Mutation intron chromosomes Frequency % Mutations detected before full gene analysis 91 73.38% 1 F508 10 64 51.6 2 G542X 11 5 4 3 3849+10kb C>T Intron 19 5 4 4 S549N 11 3 2.4 5 I148T 4 2 1.6 6 3120+1G>A 16 2 1.6 7 R334W 7 2 1.6 8 G551D 11 1 0.8 9 N1303K 21 1 0.8 10 W1282X 20 1 0.8 11 R1162X 19 1 0.8 12 G85E 3 1 0.8 13 W1089X 17b 1 0.8 14 Y1092X 17b 1 0.8 15 P205S 6a 1 0.8 Mutations detected by full gene screening 26 20.97% 16 R1066Ca 17b 2 1.6 17 1949del84 13 1 0.8 18 2184delA 13 1 0.8 19 Q98R 4 1 0.8 20 R75X 3 1 0.8 21 G1244E 20 1 0.8 22 3876delA 20 7 5.65 23 935delA 6b 2 1.6 24 406-1G>A Intron 2 2 1.6 25 3271delGG 17a 1 0.8 26 2105-2117del13insAGAAA 13 1 0.8 27 663delT 5 1 0.8 28 3171delC 17a 1 0.8 29 2108delA 13 1 0.8 30 Q179K 5 1 0.8 31 3199del6 17a 1 0.8 32 3500-2 A->T Intron 17b 1 0.8 Total identified 117 (177)b 94.35 (97.5)b Unidentified 7 (3)b 5.65 (2.5)b Total 124 (120)b 100 (100)b a This mutation was also detected by SSCP. Login to comment
122 Clinical Presentations of Hispanic Cystic Fibrosis Patients With Novel Genotypes Patient number 1 2 3 4 5 6 7 8 9 Age/age at 7/1 (31)/0.5 23/1.2 18/9.5 (21)/15 13/0.3 18/at birth 12/7 15/0.5 diagnosisa Genotype ∆F508/3171delC W1089X/Q179K ∆F508/R75X 3271delGG/S549N I148T/3199del6 ∆F508/406-1G->A R334W/3500-2A->T 406-1G->A/unk Y1092X/R1162X Sweat Cl- 87 mEq/L (1) 79 mEq/L (0.5) 86 mEq/L (0.5) 73 mEq/L (10) 102 mEq/L (15) 100 mEq/L (0.5) 104 mEq/L (at birth) 72 mEq/L (4) 64 mEq/L (1) (age) FVC (age)b NA 59% (29) 54% (22) 75% (17) 45% (22) 81% (11); 99 (12) 60% (18) 73% (11); 71 (12) 45% (13) FEV1 (age)c NA 26% (29) 38% (22) 53% (17) 24% (22) 59% (11); 78 (12) 44% (18) 30% (11); 58 (12) 31% (13) Pancreatic Insufficient Insufficient Insufficient Insufficient Insufficient Insufficient Insufficient Insufficient Insufficient functiond Microbial Enterobacter Pseudomonas Staphylococcus Pseudomonas E. coli Staphylococcus Pseudomonas Staphylococcus Pseudomonas colonization Cloacae Aspergillus Pseudomonas Pseudomonas Staphylococcus Pseudomonas Acintobacter Aspergillus Height/weight/ 5/18/4 5/5/30 5/5/22 77/91/17 20/46/20 9/11/12 5/5/18 12/5/12 24/31/13 agee Complications Hypothyroidism RU/RML Learning Diabetes, Hypersplenism, Meconium PPD converter Chronic bronchictasis disability, depression portal ileus constipation requiring chronic hypertension, lobectomy abdominal pain liver cysts a Age and age at diagnosis are in years. Login to comment
134 Patient 5 was also compound heterozygous for a missense mutation I148T. Login to comment

[hide] Increased prevalence of mutations in the cystic fi... Pediatrics. 2002 Jan;109(1):E13. Raman V, Clary R, Siegrist KL, Zehnbauer B, Chatila TA
Increased prevalence of mutations in the cystic fibrosis transmembrane conductance regulator in children with chronic rhinosinusitis.
Pediatrics. 2002 Jan;109(1):E13., [PMID:11773581]

Abstract [show]
OBJECTIVE: Chronic rhinosinusitis results in significant morbidity in the pediatric population; however, no predisposing factor is found in many cases. Cystic fibrosis (CF) is a recognized cause of chronic rhinosinusitis. Although the carrier frequency for CF ranges from 3% to 4% in the general white population, the prevalence of mutations in the CF transmembrane conductance regulator (CFTR) among children with chronic rhinosinusitis is unknown. Our objective was to study the frequency of CFTR mutations among children with chronic rhinosinusitis. METHODS: Fifty-eight white children who were from the St Louis metropolitan area and had chronic rhinosinusitis, none of whom satisfied diagnostic criteria for CF, underwent sweat testing and genotyping for CFTR mutations using an assay that detects 90% of mutations seen in this ethnic group. RESULTS: Seven of the 58 patients (12.1%) tested harbored CFTR mutations as compared with the expected rate of 3% to 4% in this ethnic group. Five patients had the DeltaF508, 1 had the R117H, and 1 had the I148T mutation. Only 1 of the 7 children had a borderline abnormal sweat test. Two of the 58 patients experienced recurrent Pseudomonas aeruginosa rhinosinusitis, and both were DeltaF508 heterozygotes. Three other children with no detectable CFTR mutation had borderline elevated sweat-test results. The CFTR intron 8 5T polymorphism was found at a frequency comparable to that reported for the general population. CONCLUSION: There is an increased occurrence of CFTR mutations in children who have chronic rhinosinusitis and do not meet diagnostic criteria for CF, usually in the setting of a normal sweat chloride. These results suggest a role for CFTR mutations in predisposition to chronic rhinosinusitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Five patients had the ⌬F508, 1 had the R117H, and 1 had the I148T mutation. Login to comment
68 None of the patients had a family history of CF. Seven of the 58 patients were found to have CFTR mutations, including 5 with the ⌬F508 mutation, 1 with the R117H mutation, and 1 with the I148T mutation. Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment
110 Germany ∆F508 (71.8%) 1789+5G→A (0.9%) 87.6 76.7 17 5662/1316 Dörk et al. [1992]; Dörk et al. R553X (2.0%) 3272-26A→G (0.9%) [1994]; Tümmler et al. [1996]; N1303K (1.8%) W1282X (0.7%) Estivill et al. [1997]; Dörk et G542X (1.2%) 2143delT (0.7%) al. [2000] R347P (1.2%) 1078delT (0.6%) CFTRdele2,3 (1.2%) 2183AA→G (0.6%) 3849+10KbC→T (1.0%) 2184insA (0.6%) G551D (0.9% 3659delC (0.6%) 1717-1G→A (0.9%) Greece ∆F508 (52.9%) 3272-26A→G (0.8%) 82.2 67.6 22 2097/718 Kanavakis et al. [1995]; Estivill 621+1G→T (5.0%) R1070Q (0.8%) et al. [1997]; Tzetis et al. G542X (4.1%) W496X (0.7%) [1997]; Macek et al. [2002] N1303K (3.3%) 621+3A→G (0.7%) 2183AA→G (1.8%) ∆I507 (0.7%) 2789+5G→A (1.7%) W1282X (0.7%) E822X (1.6%) 574delA (0.7%) R117H (1.2%) 1677delTA (0.7%) R334W (1.1%) A46D (0.6%) R1158X (1.0%) 3120+1G→A (0.6%) G85E (1.0%) G551D (0.5%) Hungary ∆F508 (54.9%) W1282X (1.8%) 68.3 46.6 9 1133/976 CFGAC [1994]; Estivill et al. 1717-1G→A (1.9%) G542X (1.7%) [1997]; Macek et al. [2002] R553X (2.1%) N1303K (1.3%) Y1092X (1.8%) G551D (1.0%) S1196X (1.8%) Ireland ∆F508 (70.4%) G542X (1.0%) 82.1 67.4 7 801/509 CFGAC [1994]; Estivill et al. G551D (5.7%) 621+1G→T (0.8%) [1994] R117H (2.4%) 1717-1G→A (0.6%) R560T (1.2%) Italy ∆F508 (50.9%) ∆I507 (0.65%) 60.3 36.4 9 3524 Estivill et al. [1997] (total) G542X (3.1%) W1282X (0.62%) 1717-1G→A (1.6%) Y122K (0.59%) N1303K (1.4%) G551D (0.53%) R553X (0.94%) Italy ∆F508 (47.6%) R553X (1.3%) 87.1 75.9 15 225 Bonizzato et al. [1995] (Northeast) R1162X (9.8%) 2789+G→A (1.3%) 2183AA→G (9.3%) Q552X (1.3%) N1303K (4.0%) 621+1G→T (0.9%) G542X (2.7%) W1282X (0.9%) 711+5G→A (2.7%) 3132delTG (0.9%) 1717-1G→A (2.2%) 2790-2A→G (0.9%) G85E (1.3%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS583 Italy ∆F508 (56.4%) 711+1G→T (1.3%) 85.7 73.4 13 660/396 Castaldo et al. [1996]; Castaldo (southern) N1303K (6.8%) G1244E (1.3%) et al. [1999] G542X (5.7%) R1185X (1.3%) W1282X (3.8%) L1065P (1.3%) 1717-1G→A (2.3%) R553X (1.1%) 2183AA→G (1.9%) I148T (0.7%) 4016insT (1.8%) Latvia 1) DF508 (58.3%) 4) CFTRdele2,3 (2.8%) - - 6 36 Dörk et al. [2000]; Macek et al. 2) 3849+10KbC®T (8.3%) 5) W1282X (2.8%) [2002] 3) N1303K (5.6%) 6) 394delTT (2.8%) Lithuania ∆F508 (31.0%) N1303K (2.0%) 39.0 15.2 4 94 Dörk et al. [2000]; Macek et al. R553X (4.0%) CFTRdele2,3 (2.0%) [2002] Macedonia ∆F508 (54.3%) 711+3A→G (1.0%) 69.2 47.9 12 559/226 Petreska et al. [1998]; Dörk et G542X (4.2%) 3849G→A (1.0%) al. [2000]; Macek et al. N1303K (2.0%) 2184insA (0.9%) [2002] CFTRdele2,3 (1.3%) 457TAT→G (0.7%) 621+1G→T (1.3%) V139E (0.7%) 611-1G→T (1.2%) 1811+1G→C (0.6%) Netherlands ∆F508 (74.2%) R1162X (0.9%) 86.8 75.3 9 3167/1442 Gan et al. [1995]; Estiville et al. A455E (4.7%) S1251N (0.9%) [1997]; Collee et al. [1998] G542X (1.8%) N1303K (0.9%) 1717-1G→A (1.5%) W1282X (0.7%) R553X (1.2%) Norway ∆F508 (60.2%) G551D (1.2%) 69.8 48.7 6 410/242 Schwartz et al. [1994]; Estivill 394delTT (4.2%) G542X (0.6%) et al. [1997] R117H (3.0%) N1303K (0.6%) Poland ∆F508 (57.1%) CFTRdele2,3 (1.8%) 73.5 54.0 11 4046/1726 CFGAC [1994]; Estivill et al. 3849+10Kb C→T (2.7%) R560T (1.5%) [1997]; Dörk et al [2000]; G542X (2.6%) W1282X (0.7%) Macek et al. [2002] 1717-1G→A (2.4%) ∆I507 (0.5%) R553X (1.9%) G551D (0.5%) N1303K (1.8%) Portugal ∆F508 (44.7%) R334W (0.7%) 49.7 24.7 5 739/454 CFGAC [1994]; Estivill et al. G542X (1.6%) N1303K (0.7%) [1997] R1066C (2.0%) Romania ∆F508 (36.6%) G542X (1.4%) 51.5 26.5 11 224/74 CFGAC [1994]; Estivill et al. 2043delG (2.0%) R553X (1.4%) [1997]; Popa et al. [1997]; W1282X (1.7%) G576X (1.4%) Macek et al. [2002] 1717-2A→G (1.4%) 1898+1G→A (1.4%) I148T (1.4%) 2183AA→G (1.4%) 621+1G→T (1.4%) Russia ∆F508 (54.4%) 552insA (0.9%) 70.7 50.0 12 5073/2562 CFGAC [1994]; Estivill et al. CFTRdele2,3 (5.0%) G542X (0.9%) [1997]; Dörk et al. [2000]; R553X (3.5%) R334W (0.9%) Macek et al. [2002] 2183AA→G (1.3%) 1677delTA (0.8%) W1282X (1.0%) Y122X (0.5%) 394delTT (1.0%) 1367del5 (0.5%) (Continued) BOBADILLAETAL. Login to comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment
112 Jewish 1) 405+1G®A (48.0%) 3) W1282X (17.0%) - - 4 23 Kerem et al. [1995] (Tunisia) 2) DF508 (31.0%) 4) 3849+10KbC®T (4.0%) Jewish 1) G85E 4) G542X - - 6 10 Kerem et al. [1995] (Turkey) 2) DF508 5) 3849+10KbC®T 3) W1282X 6) W1089X Jewish (Yemen) None - - 0 5 Kerem et al. [1995] Lebanon 1) DF508 (35.0%) 6) 4096-28G®A (2.5%) - - 9 40 Desgeorges et al. [1997] 2) W1282X (20.0%) 7) 2789+5G®A (2.5%) 3) 4010del4 (10.0%) 8) M952I (2.5%) 4) N1303K (10.0%) 9) E672del (2.5%) 5) S4X (5.0%) Reunion ∆F508 (52.0%) 1717-1G→A (0.7%) 90.4 81.7 9 138 Cartault et al. [1996] Island Y122X (24.0%) G542X (0.7%) 3120+1G→A (8.0%) A309G (0.7%) A455E (2.2%) 2789+5G→A (0.7%) G551D (1.4%) Saudi North: 3) H139L - - North 1 49 families El-Harith et al. [1997]; Arabia 1) 1548delG 4) L1177X Central 3 Kambouris et al. [1997]; Central: 5) DF508 South 4 Banjar et al. [1999] 1)I1234V 6) 3120+1G®A West 9 2)1548delG 7) 425del42 East 6 3)DF508 8) R553X South: 9) N1303K 1) I1234V East: 2) 1548delG 1) 3120+1G®A 3) 711+1G®T 2) H139L 4) 3120+1G®A 3) 1548delG West: 4) DF508 1) I1234V 5) S549R 2) G115X 6) N1303K Tunisia ∆F508 (17.6%) G85E (2.6%) 58.7 34.5 11 78 Messaoud et al. [1996] G542X (8.9%) W1282X (2.6%) 711+1G→T (7.7%) Y122X (1.3%) N1303K (6.4%) T665S (1.3%) 2766del8NT (6.4%) R47W+D1270N (1.3%) R1066C (2.6%) Turkeye ∆F508 (24.5%) 1066L (1.3%) 80.6 65.0 36 1067/670 Yilmaz et al. [1995]; Estivill et al. 1677delTA (4.1%) E822X (1.3%) [1997]; Onay et al. [1998]; 2789+5G→A (3.9%) 2183+5G→A+2184insA (1.3%) Macek et al. [2002] 2181delA (3.8%) D110H (0.8%) R347H (3.6%) P1013L (0.8%) N1303K (2.9%) 3172delAC (0.8%) 621+1G→T (2.6%) 1259insA (0.8%) G542X (2.6%) M1028I (0.8%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS587 E92K (2.6%) 4005+1G→A (0.7%) A96E (2.6%) W1282X (0.7%) M152V (2.6%) I148T (0.6%) 2183AA→G (2.5%) R1162X (0.6%) 296+9A→T (1.6%) D1152H (0.6%) 2043delG (1.4%) W1098X (0.6%) E92X (1.4%) E831X (0.6%) K68N (1.4%) W496X (0.6%) G85E (1.3%) F1052V (0.5%) R1158X (1.3%) L571S (0.5%) United Arab S549R (61.5%) ∆F508 (26.9%) 88.4 78.1 2 86/52 Frossard et al. [1988]; Emirates Frossard et al. [1999] North/Central/South Americas Argentina ∆F508 (58.6%) N1303K (1.8%) 69.1 47.7 5 326/228 CFGAC [1994]; Chertkoff et al. W1282X (3.9%) 1717-1G→A (0.9%) [1997] G542X (3.9%) Brazilf ∆F508 (47.7%) W1282X (1.3%) 66.8 44.6 10 820/500 CFGAC [1994]; Cabello et al. (total) G542X (7.2%) G85E (1.3%) [1999]; Raskin et al. [1999]; R1162X (2.5%) R553X (0.7%) Bernardino et al. [2000] R334W (2.5%) L206W (0.6%) N1303K (2.4%) 2347delG (0.6%) South East: >∆F508, G542X South: >N1303K Brazil ∆F508 (31.7%) N1303K (2.5%) 42.5 18.1 3 120 Parizotto and Bertuzzo [1997] (Sao Paulo) G542X (8.3%) Canada ∆F508 (59.0%) G542X (0.5%) 98.5 97.0 13 381/200 Rozen et al. [1992]; (Lac St. Jean) 621+1G→T (24.3%) N1303K (0.5%) De Braekeleer et al. [1998] A445E (8.2%) Q890X (0.5%) Y1092X (1.2%) S489X (0.5) 711+1G→T (1.0%) R117C (0.5%) I148T (1.0%) R1158 (0.5%) G85E (0.8%) Canada ∆F508 (71.4%) ∆I507 (1.3%) 90.9 82.6 7 77 Rozen et al. [1992] (Quebec City) 711+1G→T (9.1%) Y1092X (1.3%) 621+1G→T (5.2%) N1303K (1.3%) A455E (1.3%) Canada ∆F508 (70.9%) W1282X (0.9%) 82.0 67.2 10 632 Kristidis et al. [1992] (Toronto) G551D (3.1%) R117H (0.9%) G542X (2.2%) 1717-1G→A (0.6%) 621+1G→T (1.3%) R560T (0.6%) N1303K (0.9%) ∆I507 (0.6%) Chile ∆F508 (29.2%) R553X (4.2%) 33.4 11.2 2 72 Rios et al. [1994] Columbia 1) DF508 (35.4%) 3) N1303K (2.1%) - - 4 48 Restrepo et al. [2000] 2) G542X (6.3%) 4) W1282X (2.1%) Ecuador 1) DF508 (25%) - - 1 20 Paz-y-Mino et al. [1999] (Continued) BOBADILLAETAL. Login to comment
113 Mexico ∆F508 (41.6%) G551S (0.5%) 75.5 57.0 35 374/194 Orozco et al.[1993]; Villalobos- G542X (5.6%) 1078delT (0.5%) Torres et al. [1997]; Liang et al. ∆I507 (2.5%) Y1092X (0.5%) [1998]; Orozco et al. [2000] S549N (1.9%) R117H (0.5%) N1303K (1.7%) G85E (0.5%) R75X (1.5%) 1716G→A (0.5%) 406-1G→A (1.5%) W1204X (0.5%) I148T (1.5%) W1098C (0.5%) 3849+10KbC→T (1.5%) 846delT (0.5%) 621+1G→T (1.2%) P750L (0.5%) 2055del9→A (1.0%) V754M (0.5%) 935delA (1.0%) R75Q (0.5%) I506T (1.0) W1096X (0.5%) 3199del6 (1.0%) L558S (0.5%) 2183AA→G (1.0%) 4160insGGGG (0.5%) G551D (0.5%) 297-1G→A (0.5%) R553X (0.5%) H199Y (0.5%) 1924del7 (0.5%) United States ∆F508 (68.6%) R553X (0.9%) 79.7 63.5 10 25048 Cystic Fibrosis Foundation (total) G542X (2.4%) 621+1G→T (0.9%) [1998] G551D (2.1%) 1717-1G→A (0.7%) W1282X (1.4%) 3849+10KbC→T (0.7%) N1303K (1.3%) R117H (0.7%) United States ∆F508 (48.0%) S1255X (1.4%) 77.3 59.8 16 160/148 Carles et al. [1996]; Macek et al. (African 3120+1G→A (12.2%) 444delA (0.7%) [1997]; Dörk et al. [1998]; American) 2307insA (2.0%) R334W (0.7%) Friedman et al. [1998] A559T (2.0%) ∆I507 (0.7%) R553X (2.0%) 1717-1G→A (0.7%) ∆F311 (2.0%) G542X (0.7%) G480C (1.4%) S549N (0.7%) 405+3A→C (1.4%) G551D (0.7%) United States 1) L1093P - - 1 2 Yee et al. [2000] (Cherokee) United States Non-French: French: Non- Non- Non- Non- Bayleran et al. [1996] (Maine) ∆F508 (82.0%) ∆F508 (58%) French: French: French: French: G542X (2.6%) 711+1G→T (8.3%) 95.3 90.8 11 191 G551D (2.6%) I148T (4.2%) French: French: French: French: N1303K (2.1%) A455E (4.2%) 80.3 64.5 8 72 R560T (1.0%) 1717-1G→A (1.4%) Total: 621+1G→T (1.0%) G85E (1.4%) 263 711+1G→T (1.0%) 621+1G→T (1.4%) R117H (1.0%) Y1092X (1.4%) 1717-1G→A (1.0%) G85E (0.5%) W1282X (0.5%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS589 United States ∆F508 (46.0%) R334W (1.6%) 58.5 34.2 7 129 Grebe et al. [1994] (SW Hispanic) G542X (5.4%) W1282X (0.8%) 3849+10KbC→T (2.3%) R553X (0.8%) R1162X (1.6%) United States 1) R1162X - - 3 17 Mercier et al. [1992] (SW Native 2) D648V American) 3) G542X United States 1) R1162X 3) G542X - - 4 16 Mercier et al. [1994] (Zuni Pueblo) 2) 3849+10KbC®T 4) D648V Venezuela ∆F508 (29.6%) G542X (3.7%) 33.3 11.1 2 54 Restrepo et al. [2000] Other Regions Australia ∆F508 (76.9%) 621+1G→T (1.1%) 88.7 78.7 8 761/464 CFGAC [1994] G551D (4.5%) N1303K (0.9%) G542X (2.8%) W1282X (0.6%) R553X (1.3%) R117H (0.6%) East Asia 1) 1898+1G®T 2) 1898+5G®T - - 2 28 Suwanjutha et al. [1998] Hutterite 1) M1101K (69.0%) 2) DF508 (31.0%) - - 2 32 Zielenski et al. [1993] Brethren New Zealand ∆F508 (78.0%) N1303K (1.9%) 87.4 76.4 5 636 CFGAC [1994] G551D (4.4%) 621+1G→T (1.1%) G542X (2.0%) *This table presents the mutation panels for all regions investigated in this study. Login to comment
213 Ideal Recommended CFTR Mutation Screening Panel for 2001 Neonatal Screening in the USA* Location Estimated Mutation in CFTRa percentageb Reason for inclusion DF508 Exon 10 68.6% CFF registry, >1%, Pan-European G542X Exon 11 2.4% CFF registry, >1%, Mediterranean G551D Exon 11 2.1% CFF registry, >1%, Celtic W1282X Exon 20 1.4% CFF registry, >1%, Ashkenazi Jew N1303K Exon 21 1.3% CFF registry, >1%, Mediterranean R553X Exon 11 0.9% CFF registry, >0.5%, Hispanic 621+1G®T Intron 4 0.9% CFF registry, >0.5%, multi-ethnic 1717-1G®A Intron 10 0.7% CFF registry, >0.5%, Italian 3849+10KbC®T Intron 19 0.7% CFF registry, >0.5%, Hispanic R117Hc Exon 4 0.7% CFF registry, >0.5% 1898+1G→T Intron 12 0.4% CFF registry, >0.1%, East Asian DI507 Exon 10 0.3% CFF registry, >0.1%, Hispanic 2789+5G®A Intron 14b 0.3% CFF registry, >0.1% G85E Exon 3 0.3% CFF registry, >0.1% R347P Exon 7 0.2% CFF registry, >0.1% R334W Exon 7 0.2% CFF registry, >0.1%, multi-ethnic R1162X Exon 19 0.2% CFF registry, >0.1%, multi-ethnic R560T Exon 11 0.2% CFF registry, >0.1% 3659delC Exon 19 0.2% CFF registry, >0.1% A455E Exon 9 0.2% CFF registry, >0.1% 2184delA Exon 13 0.1% CFF registry, >0.1% S549N Exon 11 0.1% CFF registry, >0.1%, multi-ethnic 711+1G®T Intron 5 0.1% CFF registry, >0.1% R75X Exon 3 0.2% Hispanic 406-1G→A Intron 3 0.2% Hispanic I148T Exon 4 0.2% Hispanic, French 2055del9→A Exon 13 0.1% Hispanic 935delA Exon 6b 0.1% Hispanic I506T Exon 10 0.1% Hispanic 3199del6 Exon 17a 0.1% Hispanic 2183AA→G Exon 13 0.1% Hispanic 3120+1G®A Intron 16 1.5% African American, Arabian 2307insA Exon 13 0.2% African American A559T Exon 11 0.2% African American ∆F311 Exon 7 0.2% African American G480C Exon 10 0.2% African American 405+3A→C Intron 3 0.2% African American S1255X Exon 20 0.2% African American L1093P Exon 17b Undetermined Native American D648V Exon 13 Undetermined Native American I1234V Exon 19 Undetermined Arabian linkage S549R Exon 11 Undetermined Arabian linkage 1898+5G→T Intron 12 Undetermined East Asian linkage CFTRdele2,3 Exons 2,3 Undetermined Eastern European linkage (Slavic) Y1092X Exon 17b Undetermined French linkage 394delTT Exon 3 Undetermined Nordic linkage Y569D Exon 12 Undetermined Pakistani linkage 3905insT Exon 20 Undetermined Swiss linkage (also: Amish, Acadian, Mennonite) 1898+1G®A Intron 12 Undetermined Welsh linkage M1101k Exon 17b Undetermined Hutterite ancestry *This table presents the top 50 mutations in the USA based on the Cystic Fibrosis Foundation CF Registry data from 1997 [Cystic Fibrosis Foundation, 1998], and data generated during our investigation. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment
35 ACMG 25 mutation panel (ACMG25): The following mutations are the recommended core mutations for general population CF carrier screening by American College of Medical Genetics (ACMG) (Grody, et al 2001): ∆F508, G542X, N1303K, G551D, W1282X, 1717-1G→A, R553X, 621ϩ1G→T, R1162X, R117H, ∆I507, 1898ϩ1G→A, G85E, R347P, A455E, R560T, R334W, 3849ϩ10kbC→T, 3659delC, 1078delT, 2789ϩ5G→A, 711ϩ1G→T, 2184delA, 3120ϩ1G→A and I148T. Login to comment

[hide] Variant cystic fibrosis phenotypes in the absence ... N Engl J Med. 2002 Aug 8;347(6):401-7. Groman JD, Meyer ME, Wilmott RW, Zeitlin PL, Cutting GR
Variant cystic fibrosis phenotypes in the absence of CFTR mutations.
N Engl J Med. 2002 Aug 8;347(6):401-7., 2002-08-08 [PMID:12167682]

Abstract [show]
BACKGROUND: Cystic fibrosis is a life-limiting autosomal recessive disorder with a highly variable clinical presentation. The classic form involves characteristic findings in the respiratory tract, gastrointestinal tract, male reproductive tract, and sweat glands and is caused by loss-of-function mutations in the cystic fibrosis transmembrane conductance regulator (CFTR ) gene. Nonclassic forms of cystic fibrosis have been associated with mutations that reduce but do not eliminate the function of the CFTR protein. We assessed whether alteration in CFTR function is responsible for the entire spectrum of variant cystic fibrosis phenotypes. METHODS: Extensive genetic analysis of the CFTR gene was performed in 74 patients with nonclassic cystic fibrosis who had been referred by 34 medical centers. We evaluated two families that each included a proband without identified mutations and a sibling with nonclassic cystic fibrosis to determine whether there was linkage to the CFTR locus and to measure the extent of CFTR function in the sweat gland and nasal epithelium. RESULTS: Of the 74 patients studied, 29 had two mutations in the CFTR gene, 15 had one mutation, and 30 had no mutations. A final genotype of two mutations was more common among patients who had been referred after screening for common cystic fibrosis-causing mutations identified one mutation than among those who had been referred after screening had identified no such mutations (26 of 34 patients vs. 3 of 40 patients, P<0.001). Comparison of clinical features and sweat chloride concentrations revealed no significant differences among patients with two, one, or no CFTR mutations. Haplotype analysis in the two families revealed no linkage to CFTR. Although each of the affected siblings had elevated sweat chloride concentrations, measurements of cyclic AMP-mediated ion and fluid transport in the sweat gland and nasal epithelium demonstrated the presence of functional CFTR. CONCLUSIONS: Factors other than mutations in the CFTR gene can produce phenotypes clinically indistinguishable from nonclassic cystic fibrosis caused by CFTR dysfunction.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 MUTATION IDENTIFIED BY SCREENING FOR COMMON MUTATIONS MUTATION IDENTIFIED BY DNA SEQUENCING NO. OF PATIENTS ∆F508 5T* 3 ∆F508 D1152H 2 ∆F508 2789+2insA 2 ∆F508 R117C 2 ∆F508 D110H 1 ∆F508 2789+5G→A 1 ∆F508 P205S 1 ∆F508 L967S 1 ∆F508 I1027T 1 ∆F508 L206W 1 ∆F508 T1053I and 5T 1 ∆F508 V920M and 5T 1 ∆F508 R1070W 1 ∆F508 D579G 1 ∆F508 P67L 1 ∆F508 2811G→T†‡ 1 G85E F191V† 1 R117H G103X and 5T 1 I148T I556V 1 G542X R1162L 1 W1282X D1152H 1 None L138ins and 3272-26 A→G 1 None G463D† and 5T 1 None F693L and 5T 1 ∆F508 None 6 G551D None 1 W1282X None 1 None 5T 4 None 2307insA 1 None L997F 1 None V520I 1 None None 30 in Subject II-2 in Family 1. Login to comment

[hide] The I148T CFTR allele occurs on multiple haplotype... Genet Med. 2002 Sep-Oct;4(5):319-23. Rohlfs EM, Zhou Z, Sugarman EA, Heim RA, Pace RG, Knowles MR, Silverman LM, Allitto BA
The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis.
Genet Med. 2002 Sep-Oct;4(5):319-23., [PMID:12394343]

Abstract [show]
PURPOSE: To determine whether intragenic changes modulate the cystic fibrosis (CF) phenotype in individuals who are positive for the I148T allele. METHODS: The genes from individuals who carried at least one copy of the I148T allele were analyzed for additional changes that may be acting as genetic modifiers. RESULTS: Seven of eight individuals with a known or suspected diagnosis of CF who carried I148T in combination with a severe CF mutation also carried 3199del6. Eight apparently healthy adult individuals who were compound heterozygous for I148T and a severe CF mutation or homozygous for I148T did not carry the deletion ( = 0.0014). The I148T allele occurs on at least three haplotypes: an IVS-8 9T background, a 7T background, or a 9T + 3199del6 background. The 3199del6 allele was not identified in 386 non-CF chromosomes. CONCLUSIONS: It is concluded that I148T occurs on at least three haplotypes and the complex allele I148T + 9T + 3199del6 is associated with a classic CF phenotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 The I148T CFTR allele occurs on multiple haplotypes: A complex allele is associated with cystic fibrosis Elizabeth M. Rohlfs, PhD1 , Zhaoqing Zhou, PhD1 , Elaine A. Sugarman, MS1 , Ruth A. Heim, PhD1 , Rhonda G. Pace, BS2 , Michael R. Knowles, MD2 , Lawrence M. Silverman, PhD3 , and Bernice A. Allitto, PhD1 Purpose: To determine whether CFTR intragenic changes modulate the cystic fibrosis (CF) phenotype in individuals who are positive for the I148T allele. Login to comment
1 Methods: The CFTR genes from individuals who carried at least one copy of the I148T allele were analyzed for additional changes that may be acting as genetic modifiers. Login to comment
2 Results: Seven of eight individuals with a known or suspected diagnosis of CF who carried I148T in combination with a severe CF mutation also carried 3199del6. Login to comment
3 Eight apparently healthy adult individuals who were compound heterozygous for I148T and a severe CF mutation or homozygous for I148T did not carry the deletion (P ϭ 0.0014). Login to comment
4 The I148T allele occurs on at least three haplotypes: an IVS-8 9T background, a 7T background, or a 9T ϩ 3199del6 background. Login to comment
6 Conclusions: It is concluded that I148T occurs on at least three haplotypes and the complex allele I148T ϩ 9T ϩ 3199del6 is associated with a classic CF phenotype. Login to comment
13 The I148T allele has been identified in CF patients from several countries and has been characterized as a "severe" CF mutation be- causesomeofthesepatientshadpancreaticinsufficientCF.10-13 It accounts for 0.7% of CF chromosomes in Italian patients,12 0.2% in Canadian patients,14 1.1% in US patients from the state of Maine,15 0.08% in French patients,16 and 9.1% in French-Canadian patients.17 In addition, the substitution changes a conserved amino acid and occurs in the first cytoplasmic loop of the first membrane spanning domain (MSD1).18,19 Based on such data, I148T was included in the ACMG/ACOG recommended CF mutation screening panel.20,21 Functional analysis of the I148T allele in transfected cell lines indicates that the protein product from this allele is fully glycosylated and biosynthetically mature. Login to comment
14 Anion conduction, as measured by iodide efflux, is normal in cells containing the I148T allele, and the cells have gating properties identical with those of wild-type cells.19 While this analysis does not rule out the possibility that the I148T allele affects other functions, such as its ability to function as a sodium channel, several major CFTR functions are retained. Login to comment
21 5 a r t i c l e Genetics IN Medicine We now have evidence that the I148T allele is associated with variable phenotypes. Login to comment
22 First, we had previously identified apparently healthy individuals who were compound heterozygotes for ⌬F508 and I148T.22 Second, we observed that the frequency of I148T is significantly higher in CF carriers than CF patients.22,23 To determine whether additional changes within the CFTR gene were influencing the CF phenotype when I148T was present, we sequenced the coding regions of the CFTR gene in apparently healthy individuals and CF patients who were compound heterozygous or homozygous for I148T. Login to comment
23 Here we show that the variable phenotypes are due to the occurrence of an in-frame deletion in cis with I148T on some chromosomes. Login to comment
25 No age limit was applied when determining the frequency of I148T in carriers, CF patients, or suspected CF patients. Login to comment
27 As described below, carriers, CF patients, and suspected CF patients who carried I148T and a severe mutation were tested for the 3199del6 allele. Login to comment
28 Carriers of a single I148T allele were also tested for 3199del6. Login to comment
29 Individuals homozygous for I148T or compound heterozygous for I148T and a severe CF allele were ascertained from January 1, 1998, to December 1, 2001. Login to comment
38 Sequence analysis To search for additional sequence changes in individuals who carried the I148T allele, coding exons of the CFTR gene were sequenced by single PCR amplifications spanning each exon followed by BigDye terminator cycle sequencing. An ABI 310 automated sequencer was used to analyze the cycle sequencing products. Login to comment
49 RESULTS Frequency of I148T in carriers, CF patients, and suspected CF patients Carrier testing of 42,784 individuals without a family history of CF identified 1,754 individuals who carried one mutation (carrier frequency approximately 1/24). Login to comment
50 One hundred thirteen of the identified mutations were I148T (6.4%). Login to comment
52 However, only 6 (0.06%) of the affected CF chromosomes were I148T. Login to comment
53 This represents a 106-fold difference in frequency of I148T between the carrier and affected groups. Login to comment
54 In a group of 10,231 patients referred for testing due to a suspected diagnosis of CF, 1.1% of the identified CF chromosomes were I148T. Login to comment
55 CFTR analysis of apparently healthy individuals and CF patients with the I148T allele Carrier testing identified seven compound heterozygotes (⌬F508/I148T) and one I148T homozygote who were apparently unaffected with CF (Table 1). Login to comment
57 The presence of the I148T and ⌬F508 on the same chromosome was ruled out in two individuals by genotyping of additional family members. Login to comment
58 Diagnostic testing of individuals affected with CF, or suspected of having CF, identified eight individuals who were compound heterozygous for a severe mutation (⌬F508, N1303K, or Q890X) and I148T (Table 2). Login to comment
61 Analysis of the intron 8 polythymidine tract determined that there was no significant difference in the poly(T) background of the I148T chromosomes between the healthy and affected groups (Tables 1 and 2). Login to comment
62 The I148T allele appears to occur most frequently on a 9T chromosomal background. Login to comment
65 However, in individual 38 it is most likely that the ⌬F508 is on the 9T chromosome and the I148T is on the 7T chromosome.7 Analysis of additional CFTR exons from healthy and affected patients identified a 6-bp deletion at nucleotide 3199 in some individuals. Login to comment
73 Sequencing of all exons did not identify any CFTR mutations in addition to I148T and ⌬F508. Login to comment
74 None of the eight apparently healthy individuals (⌬F508/I148T or I148T/ I148T) carried the deletion. Login to comment
75 The frequency of 3199del6 in individuals who are compound heterozygous or homozygous for I148T and not affected with CF versus those who are affected with or suspected of having CF is significantly different (P ϭ 0.0014 by Fisher exact test). Login to comment
76 Analysis of 3199del6 on other chromosomal backgrounds Inasmuch as one individual in the healthy group is presumed to carry I148T on a 7T chromosomal background, we Table 1 3199del6 analysis in apparently healthy adult individuals compound heterozygous or homozygous for I148T Indiv no. Indication for testing Ethnicity Age (yr) Mutation 1 Mutation 2 Intron 8 poly(T) 3199del6 12 Carrier testing w/FH NEC 56 I148T I148T 9, 9 neg 13 Screening NEC 40 ⌬F508 I148T 9, 9 neg 14 Carrier testing w/FH Hispanic 32 ⌬F508 I148T 9, 9 neg 15 Carrier testing w/FH NEC 29 ⌬F508 I148T 9, 9 neg 16 Carrier testing w/FH NEC 21 ⌬F508 I148T 9, 9 neg 23 Screening NEC 34 ⌬F508 I148T 9, 9 neg 38 Carrier testing w/FH NEC, SEC 31 ⌬F508 I148T 7, 9 neg 40 Carrier testing Caucasian 30 ⌬F508 I148T 9, 9 neg FH, family history; NEC, Northern European Caucasian; SEC, Southern European Caucasian. Login to comment
77 Table 2 3199del6 analysis in patients with a known or suspected diagnosis of CF and compound heterozygous for I148T and a severe CF mutation Indiv no. Indication for testing Ethnicity Age (yr) Mutation 1 Mutation 2 Intron 8 poly(T) 3199del6 17 Suspected CF NEC 4 ⌬F508 I148T 9, 9 pos 18 Suspected CF Caucasian, N. American 1 ⌬F508 I148T 9, 9 pos 19 Affected CF NEC Ͻ1 N1303K I148T 9, 9 pos 20 Suspected CF NEC 5 ⌬F508 I148T 9, 9 nega 22 Affected CF NEC 14 ⌬F508 I148T 9, 9 pos 39 Pancreatic steatorrhea NEC 3 ⌬F508 I148T 9, 9 pos 41 Suspected CF Hispanic 10 Q890X I148T 7, 9 pos 42 Affected CF NEC 20 ⌬F508 I148T 9, 9 pos NEC, Northern European Caucasian. Login to comment
79 tested 14 individuals who carried one copy of I148T, and who were homozygous for 7T, for the 3199del6 deletion (Table 3). Login to comment
80 From this analysis, the I148T-7T haplotype does not appear to carry the 3199del6 deletion. Login to comment
81 Poly(T) analysis of 76 additional individuals who carried one copy of I148T identified 8 who were homozygous for 9T and 64 who were compound heterozygous for 7T and 9T. Login to comment
83 Of those individuals whose indication for testing was screening, 1 of 55 I148T carriers also carried the deletion. Login to comment
84 Since we did not identify any individuals who were 5T/5T, we were unable to determine whether I148T occurs on a 5T background. Login to comment
85 To determine whether 3199del6 occurred on CF chromosomes without I148T, we analyzed 95 CF patients with one or no identified CFTR mutations for the deletion. Login to comment
90 This was first appreciated when the frequency of R117H in carriers was observed to be 16-fold higher than the frequency in CF patients.25 In the ethnically diverse US population reported here, the I148T allele is 100-fold more frequent in carriers than in CF patients. Login to comment
93 In contrast, while considered a severe mutation, I148T has not been included in most routine testing. Login to comment
94 This has likely limited the detection of healthy carriers of I148T/⌬F508 up to this time. Login to comment
95 In addition, screening of affected CF populations by allele-specific assays continues to identify I148T in those with CF. Login to comment
97 The 3199del6 mutation was reported to the CF Consortium Mutation Database in 1998, and it was noted to occur on the same chromosome as I148T.28 Our data corroborate this finding since the CF patients with the deletion and I148T also carried one of three different severe CF alleles. Login to comment
105 The deletion is apparently a rare allele, inasmuch as it was identified in only 2 of 90 individuals who carried one copy of I148T and was not identified in 386 non-CF chromosomes. Login to comment
106 It appears most likely that 3199del6 arose on a chromosome that carried the I148T mutation, and thus all chromosomes that have the deletion also have I148T. Login to comment
109 In vitro studies of chloride channel function showed that R74W Table 3 3199del6 and poly(T) analysis in individuals who carry one copy of I148T Intron 8 poly (T) Indication for testing no. Login to comment
113 WehavenowdeterminedthattheI148Talleleoccursonatleast three chromosomal backgrounds (I148T ϩ 7T, I148T ϩ 9T, and I148T ϩ 9T ϩ 3199del6) and that only the complex allele, I148T ϩ 9T ϩ 3199del6, appears to be associated with a classic CF phenotype. Login to comment
114 Our data do not support the occurrence of the deletion alone;therefore,wecannotassesswhetherthecombinationofthe missense mutation and the deletion on the same chromosome is pathogenic or whether the entire phenotypic effect is due to the deletion.Withthecurrentrecommended25mutationCFscreen- ing panel in place,20,21 we recommend that an I148T positive result be followed by reflex testing for the 3199del6 mutation until the data presented here and from other laboratories are reviewed by the ACMG/ACOG Committee. Login to comment
115 The presence of the complex allele in combination with another severe CF allele confers a CF phenotype, whereas I148T alone, even when a severe allele is on the other chromosome, confers no apparent phenotype. Login to comment
116 Long-term follow-up studies may be necessary to confidently rule out an association with I148T alone and single-organ or late-onset clinical expression. Login to comment

[hide] Standards and guidelines for CFTR mutation testing... Genet Med. 2002 Sep-Oct;4(5):379-91. Richards CS, Bradley LA, Amos J, Allitto B, Grody WW, Maddalena A, McGinnis MJ, Prior TW, Popovich BW, Watson MS, Palomaki GE
Standards and guidelines for CFTR mutation testing.
Genet Med. 2002 Sep-Oct;4(5):379-91., [PMID:12394352]

Abstract [show]
One mission of the ACMG Laboratory Quality Assurance (QA) Committee is to develop standards and guidelines for clinical genetics laboratories, including cytogenetics, biochemical, and molecular genetics specialties. This document was developed under the auspices of the Molecular Subcommittee of the Laboratory QA Committee by the Cystic Fibrosis (CF) Working Group. It was placed on the "fast track" to address the preanalytical, analytical, and postanalytical quality assurance practices of laboratories currently providing testing for CF. Due to the anticipated impact of the ACMG recommendation statement endorsing carrier testing of reproductive couples, it was viewed that CF testing would increase in volume and that the number of laboratories offering CF testing would also likely increase. Therefore, this document was drafted with the premise of providing useful information gained by experienced laboratory directors who have provided such testing for many years. In many instances, "tips" are given. However, these guidelines are not to be interpreted as restrictive or the only approach but to provide a helpful guide. Certainly, appropriately trained and credentialed laboratory directors have flexibility to utilize various testing platforms and design testing strategies with considerable latitude. We felt that it was essential to include technique-specific guidelines of several current technologies commonly used in laboratories providing CF testing, since three of the four technologies discussed are available commercially and are widely utilized. We take the view that these technologies will change, and thus this document will change with future review.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 For example, R117H and I148T mutations may produce a more variable clinical phenotype, depending upon genetic modifiers, some of which may not be well defined. Login to comment
307 ⌬F508 R553X R1162X 2184delA 3120ϩ1GϾA ⌬I507 G542X G551D W1282X N1303K 621ϩ1GϾT R117H 1717-1GϾA A455E R560T G85E R334W R347P 711ϩ1GϾT 1898ϩ1GϾA 1078delT 3849ϩ10kbCϾT 2789ϩ5GϾA 3659delC I148T CF 3.3.2 Inclusion of the common R117H mutation in the test panel screens for CBAVD as well as for CF: The phenotypic consequences of the R117H mutation are modulated in cis by the 5/7/9T polypyrimidine tract in intron 8 such that R117H/7T is associated with CBAVD and R117H/5T is associated with CF.34 Moreover, the 5T allele is associated as a trans mutation in CBAVD.35 It is recommended that the 5/7/9T variant be excluded from the routine carrier screen but tested as a reflex for carriers shown to be heterozygous for the R117H mutation. Login to comment

[hide] Highest heterogeneity for cystic fibrosis: 36 muta... Am J Med Genet. 2002 Dec 1;113(3):250-7. Kilinc MO, Ninis VN, Dagli E, Demirkol M, Ozkinay F, Arikan Z, Cogulu O, Huner G, Karakoc F, Tolun A
Highest heterogeneity for cystic fibrosis: 36 mutations account for 75% of all CF chromosomes in Turkish patients.
Am J Med Genet. 2002 Dec 1;113(3):250-7., 2002-12-01 [PMID:12439892]

Abstract [show]
We analyzed the CFTR locus in 83 Turkish cystic fibrosis patients to identify mutations, haplotypes, and the carrier frequency in the population. We detected 36 different mutations in 125 (75%) of the total 166 CF chromosomes. Seven novel mutations were identified: four missense (K68E, Q493P, E608G, and V1147I), two splice-site (406 -3T > C and 3849 +5G > A), and one deletion (CFTRdele17b,18). The data showed that the Turkish population has the highest genetic heterogeneity at the CFTR locus reported so far. The results of this thorough molecular analysis at the CFTR locus of a population not of European descent shows that CF is not uncommon in all such populations. The large number of mutations present, as well as the high heterogeneity in haplotypes associated with the mutations suggests that most of the mutations have persisted for a long time in the population. Consistently, the carrier frequency is assessed to be high, indicating that the disease in the population is ancient.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 Haplotypes Associated With the Mutations Identified in 83 Turkish CF Patients* Mutation Total number of alleles Number of alleles Number of patients Haplotypes Homo Hetero DF508 39 (23.5) 6 7 23 M 28 13 1 0 1 6 7 23 M 30 13 1 0 1 6 9 23 M 31 13 1 0 1 6 7 23 M 31 13 11 4 3 6 7 23 M 7 17 2 0 2 6 7 16 M 31 13 3 1 1 6 7 17 M 31 13 17 5 7 6 7 17 M 32 13 3 1 1 1677delTA 12 (7.2) 7 7 16 V 30 13 12 5 2 2183AA > G 7 (4.2) 7 7 16 M 30 13 1 0 1 7 9 16 M 31 13 4 2 0 7 7 16 M 32 13 2 1 0 G542X 6 (3.6) 6 7 23 M 32 13 6 3 0 F1052V 5 (3.0) 6 7 17 M 7 13 4 1 2 7 5 17 M 7 17 1 0 1 W1282X 5 (3.0) 7 7 17 M 7 17 4 1 2 7 7 17 M 7 18 1 0 1 E92K 4 (2.4) 7 7 16 V 46 13 3 1 1 7 7 17 V 46 13 1 0 1 1525 À 1G > A 4 (2.4) 7 7 17 M 7 17 4 2 0 2789 þ 5G > A 4 (2.4) 7 9 17 M 7 17 3 1 1 7 5 17 M 7 17 1 0 1 N1303K 4 (2.4) 7 7 23 M 31 13 2 0 2 6 7 22 M 30 13 1 0 1 6 7 23 M 30 13 1 0 1 A46D 3 (1.8) 6 9 23 M 31 13 1 0 1 6 7 23 M 31 13 2 1 0 2184insA 3 (1.8) 7 5 17 V 30 13 1 0 1 7 7 16 V 30 13 2 0 2 R1070Q 3 (1.8) 7 7 16 M 31 13 1 0 1 7 7 17 M 31 13 2 0 2 Q493Pa 2 (1.2) 6/7 5 16 M 46 13 2 1 0 3849 þ 5G > Aa 2 (1.2) 7 7 16 M 31 13 2 1 0 CFTRdele17b,18a 2 (1.2) 6 9 16 V - - 2 1 0 K68Ea 1 (0.6) 6 9 17 M 7 13 1 0 1 R74W 1 (0.6) 6 7 16 M 32 16 1 0 1 306delTAGA 1 (0.6) 7 7 16 M 7 17 1 0 1 D110H 1 (0.6) 7 9 16 V 30 13 1 0 1 I125T 1 (0.6) 6 7 23 V 7 16 1 0 1 406 À 3T > Ca 1 (0.6) 7 7 16 V 33 17 1 0 1 I148T 1 (0.6) 6/7 7 16/17 M 7 17/23 1 0 1 621 þ 1G > T 1 (0.6) 6 7 21 V 31 13 1 0 1 R347P 1 (0.6) 7 9 17 V 30 13 1 0 1 S466X 1 (0.6) 7 7 23 M 33 13 1 0 1 L571S 1 (0.6) 7 7 16 V 29 13 1 0 1 1717 À 1G > A 1 (0.6) 7 9 17 M 7 16 1 0 1 E608Ga 1 (0.6) 7 9 16 M/V 29/31 13 1 0 1 2043delG 1 (0.6) 7 9 17 M 7 17 1 0 1 P1013L 1 (0.6) 6 5 16 M 21 18 1 0 1 R1066L 1 (0.6) 7 7 17 M 7 13 1 0 1 3129del4 1 (0.6) 7 7 16 V 29 13 1 0 1 V1147Ia 1 (0.6) 6 7 17 M 33 17 1 0 1 S1235R 1 (0.6) 6 7 17 M 39 13 1 0 1 CFTRdele2,3 1 (0.6) 7 7 16 V 33 13 1 0 1 Total 125 (75) 125 32 61 *The order of the polymorphisms is IVS6GATT, Tn, IVS8CA, M470V, IVS17BTA and IVS17BCA. Login to comment

[hide] Cystic fibrosis carrier screening: issues in imple... Genet Med. 2002 Nov-Dec;4(6):407-9. Watson MS, Desnick RJ, Grody WW, Mennuti MT, Popovich BW, Richards CS
Cystic fibrosis carrier screening: issues in implementation.
Genet Med. 2002 Nov-Dec;4(6):407-9., [PMID:12509709]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
52 Efforts continue to maintain high standards for testing laboratories as new technologies are used in CFTR mutation testing.10 I148T The I148T mutation was included in the panel on the basis of its prevalence of 0.1% in CF patients. Login to comment
54 At the time the panel was determined, there were one or two anecdotal reports of individuals with I148T but without CF in families in which there were individuals with CF and I148T. Login to comment
55 After the introduction of general population carrier screening, it was observed that the I148T mutation was appearing at rates 60 to 100 times above that expected based on the rate in the CF patient population (E.M. Rohlfs, personal communication, 2002).11-14 This suggested that there was likely a modifier of the expression of I148T or that I148T was modifying the effects of another mutation. Login to comment
56 Rohlfs et al.13 recently reported that I148T segregates on at least two genetic backgrounds distinguished by the 5T/7T/9T polymorphism and a CFTR deletion, 3199del6. Login to comment
57 Among five unaffected individuals with I148T and the ⌬F508 or another I148T mutation, all had I148T on a 9T background. Login to comment
58 Among five individuals with CF and with ⌬F508 or N1303K mutation and I148T, four had I148T on a background of 9T and 3199del6. Login to comment
59 More cases with I148T on the 3199del6 background need to studied and predictive values established. Login to comment
60 In the meantime, when I148T is found in patients with CF, the haplotype background should be tested as a reflex test. Login to comment
61 When found in a carrier screening program, care should be taken communicating results and laboratories should consider reflex testing to determine the genetic background on which I148T sits. Login to comment
66 I148T represents an example of a genetic change that requires follow-up testing to fully understand its implications. Login to comment
100 Rohlfs EM, Zhou Z, Sugarman EA, Heim RA, Pace RG, Knowles MR, Silverman LM, Allitto BA. The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis. Login to comment

[hide] Extensive sequencing of the cystic fibrosis transm... Genet Med. 2003 Jan-Feb;5(1):9-14. Strom CM, Huang D, Chen C, Buller A, Peng M, Quan F, Redman J, Sun W
Extensive sequencing of the cystic fibrosis transmembrane regulator gene: assay validation and unexpected benefits of developing a comprehensive test.
Genet Med. 2003 Jan-Feb;5(1):9-14., [PMID:12544470]

Abstract [show]
PURPOSE: To develop a sequencing assay for the gene to identify mutations in patients with cystic fibrosis (CF). METHODS: An automated assay format was developed to sequence all exons and splice junctional sequences, the promotor region, and parts of introns 11 and 19. RESULTS: After validating the assay using 20 known samples, DNA of seven patients, four of whom were heterozygous for a known CF mutation, was sequenced. Known CF mutations were detected in seven of the eight chromosomes, and a novel missense mutation was detected in the eighth. In addition, this assay allowed 14 ambiguous results obtained using the Roche CF gold strips to be resolved. Three false-positive diagnoses were prevented; a different mutation at the same codon was identified in two patients and confirmation was provided in the remaining nine cases. CONCLUSIONS: Sequencing of the gene provides important information for CF patients and is a valuable adjunct to a carrier screening program to resolve ambiguities in panel testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Table 2 Mutant samples used for validation of sequencing assay Mutation expected wt/wt (3 patients) delta F508/wt (2 patients) R117H/wt (3 patients) 2789 ϩ 5 G 3 A/2789 ϩ 5 G 3 A (both parents confirmed carriers) R117H/delta F508 (2 patients) delta F508/I148T delta F508/R1066C delta F508/3848 ϩ 10 kb C 3 T delta F508/G542X R117H/I148T (2 patients) 2307 delA/N1303K deltaF 508/711 ϩ 1 G 3 T deltaF 508/1898 ϩ 1 G 3 A G551D/N1303K 2789 ϩ 5G3A. Login to comment
97 However, previous studies have shown that two such mutations, I148T and D1270N, are probably polymorphisms or low penetrance alleles.7 For those reasons, caution must be used when interpreting the presence of a rare or novel mutation found in the sequencing assay. Login to comment
127 The discovery that the I148T and D1270N mutations are likely to be polymorphisms and not causative CF mutations points out the danger in assuming that all mutations listed in the CF database are causative mutations. Login to comment
132 A new use for single exon sequencing is the recent observation that I148T is only a CF chromosome in a haplotype that includes the 9T IVS8 polymorphism and 3199del6.11 In patients with I148T and 9T, single exon sequencing can determine whether 3199del6 is present. Login to comment

[hide] Chronic pancreatitis and cystic fibrosis. Gut. 2003 May;52 Suppl 2:ii31-41. Witt H
Chronic pancreatitis and cystic fibrosis.
Gut. 2003 May;52 Suppl 2:ii31-41., [PMID:12651880]

Abstract [show]
Recent discoveries of trypsinogen and trypsin inhibitor mutations in patients with chronic pancreatitis (CP) support the hypothesis that an inappropriate activation of pancreatic zymogens to active enzymes within the pancreatic parenchyma starts the inflammatory process. Current data suggest that CP may be inherited dominant, recessive, or complex as a result of mutations in the above mentioned or yet unidentified genes. Evaluation of patients with CP should include genetic testing. Cystic fibrosis (CF) is an autosomal recessive inherited disorder caused by mutations in the CF transmembrane conductance regulator (CFTR) gene and is characterised by pancreatic insufficiency and chronic bronchopulmonary infection. The progression and severity of pulmonary disease differs considerably between people with identical CFTR mutations and does not seem to correlate with the type or class of the CFTR mutation. The identification of further disease modifying genetic factors will increase the pathophysiological understanding and may help to identify new therapeutic targets.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
494 Moreover, two of the CFTR mutations found were previously reported as non-disease causing polymorphisms (R1162L, T1220I), five alterations were described for the first time and have not been demonstrated in a previous study of 640 Spanish CF patients.154 In summary, only 4 of 144 asthmatic patients (2.8%) possessed a verified CF causing mutation (R74W, I148T, T582R, and R1066C). Login to comment

[hide] Clinical characteristics and genotype analysis of ... Clin Otolaryngol Allied Sci. 2003 Apr;28(2):125-32. Cimmino M, Cavaliere M, Nardone M, Plantulli A, Orefice A, Esposito V, Raia V
Clinical characteristics and genotype analysis of patients with cystic fibrosis and nasal polyposis.
Clin Otolaryngol Allied Sci. 2003 Apr;28(2):125-32., [PMID:12680831]

Abstract [show]
The prevalence of nasal polyps in a group of paediatric patients with cystic fibrosis was prospectively studied in comparison with a control group with cystic fibrosis but without polyps. Clinical variables, including pulmonary function tests, skin testing and mucociliary transport, were carried out in both groups, as well as genotype analysis. Endoscopic intranasal evaluation identified polyps in 29 of 89 patients (33%). Statistical analysis revealed that patients with nasal polyposis had better pulmonary function, a higher rate of Pseudomonas aeruginosa colonization, more hospitalizations, and more prevalence of allergy to Aspergillus fumigatus than did the comparison group. We found no statistically different genotype distribution between the polyposis and the control group. However, it can be emphasized that the prevalence of the compound heterozygous genotype is higher in the nasal polyposis group than in controls. Our observations suggest that other genetic and environmental factors could play an important role in the development of nasal polyposis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 Analysis of mutations in the CFTR gene as tested by the multiplex polymerase chain reaction (PCR), followed by the reverse dot-blot technique, which searches for 29 of the most frequent mutations (DF508, N1303K, G542X, W1282X, 1717±1 G-A, R553X, 2183 AA-G, DI507, G551D, R560T, 3849 10kbC > T, R1162X, 3659delC, 3905insT, G85E, 621 1GT, R117H, R347P, R334W, A455E, 2789 5GA, Q552X, S1251N, 3905insT, 394delTT, E60X, 2143delT, 2184delA, 711 5G > A), and by ASO dot-blot for the following mutations: I148T, R1158X, 4016 1T, G1244E G >A.26 Statistical analysis was performed using multivariate analysis, by forward stepwise comparison; it was done to ®nd out which of the examined characteristics could be associated (P < 0.01) to nasal polyposis. Login to comment

[hide] Detection of cystic fibrosis mutations by peptide ... Clin Chem. 2003 Aug;49(8):1318-30. Malehorn DE, Telmer CA, McEwen SB, An J, Kinsey AD, Retchless AC, Mason C, Vieta WM, Jarvik JW
Detection of cystic fibrosis mutations by peptide mass signature genotyping.
Clin Chem. 2003 Aug;49(8):1318-30., [PMID:12881448]

Abstract [show]
BACKGROUND: The diversity of genetic mutations and polymorphisms calls for the development of practical detection methods capable of assessing more than one patient/one nucleotide position per analysis. METHODS: We developed a new method, based on peptide mass signature genotyping (PMSG), for the detection of DNA mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Exons of the gene were amplified, cloned, and expressed in Escherichia coli as peptide fusions, in natural as well as unnatural reading frames. Peptide analytes were purified by immobilized metal affinity chromatography and analyzed by matrix-assisted, laser desorption/ionization time-of-flight mass spectrometry. Synthetic and natural DNA samples with the 25 mutations recommended for CFTR carrier screening (Grody et al. Genet Med 2001;3:149-54) were assessed using the PMSG test for the CFTR gene. RESULTS: Peptide analytes ranged from 6278 to 17 454 Da and varied 30-fold in expression; highly expressing peptides were observed by electron microscopy to accumulate as inclusion bodies. Peptides were reliably recovered from whole-cell lysates by a simple purification method. CFTR mutations caused detectable changes in resulting mass spectrometric profiles, which were >95% reliably detected in blinded testing of replicate synthetic heterozygous DNA samples. Mutation detection was possible with both sample pooling and multiplexing. The PMSG CFTR test was used to determine compound heterozygous mutations in DNA samples from cystic fibrosis patients, which were confirmed by direct DNA sequencing. CONCLUSIONS: The PMSG test of the CFTR gene demonstrates unique capabilities for determining the sequence status of a DNA target by sensitively monitoring the mass of peptides, natural or unnatural, generated from that target.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
161 Several of the mutations (I148T, 1078⌬T, 1898 ϩ 1 GϾA, and 2789 ϩ 5 GϾA) could be represented in only heterozygous form using synthetic mixtures. Login to comment
181 The heterozygous mutations depicted are as follows: (A), exon 3 wt/G85E; (B), exon 4.1 wt/R117H; (C), exon 4.2 wt/I148T; (D), exon 4.2 wt/621 ؉ 1G>T; (E), exon 5 wt/711 ؉ 1G>T; (F), exon 7.1 wt/1078⌬T; (G), exon 7 wt/R334W; (H), exon 7 wt/R347P; (I), exon 9 wt/A455E; (J), exon 10.2 wt/⌬I507; (K), exon 10.2 wt/⌬F508; (L), exon 11.2 wt/1717-1G>A; (M), exon 11 wt/G542X; (N), exon 11 wt/G551D; (O), exon 11 wt/R553X; (P), exon 11 wt/R560T; (Q), exon 12 wt/1898 ؉ 1G>A; (R), exon 13.2A wt/2184⌬A; (S), exon 14B wt/2789 ؉ 5G>A; (T), exon 16 wt/3120 ؉ 1G>A; (U), exon 19 wt/R1162X; (V), exon 19 wt/3659⌬C; (W), intron 19 wt/3849 ؉ 10kbC>T; (X), exon 20 wt/W1282X; (Y), exon 21 wt/N1303K. typical yield of purified protein was 1-30 ␮g/test well, depending on the analyte species. Login to comment

[hide] High allelic heterogeneity between Afro-Brazilians... Genet Test. 2003 Fall;7(3):213-8. Raskin S, Pereira L, Reis F, Rosario NA, Ludwig N, Valentim L, Phillips JA 3rd, Allito B, Heim RA, Sugarman EA, Probst CM, Faucz F, Culpi L
High allelic heterogeneity between Afro-Brazilians and Euro-Brazilians impacts cystic fibrosis genetic testing.
Genet Test. 2003 Fall;7(3):213-8., [PMID:14641997]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by at least 1,000 different mutations in the cystic fibrosis transmembrane conductance regulator gene (CFTR). To determine the frequency of 70 common worldwide CFTR mutations in 155 Euro-Brazilian CF patients and in 38 Afro-Brazilian CF patients, we used direct PCR amplification of DNA from a total of 386 chromosomes from CF patients born in three different states of Brazil. The results show that screening for seventy mutations accounts for 81% of the CF alleles in Euro-Brazilians, but only 21% in the Afro-Brazilian group. We found 21 different mutations in Euro-Brazilians and only 7 mutations in Afro-Brazilians. The frequency of mutations and the number of different mutations detected in Euro-Brazilians are different from Northern European and North American populations, but similar to Southern European populations; in Afro-Brazilians, the mix of CF-mutations is different from those reported in Afro-American CF patients. We also found significant differences in detection rates between Euro-Brazilian (75%) and Afro-Brazilian CF patients (21%) living in the same state, Minas Gerais. These results, therefore, have implications for the use of DNA-based tests for risk assessment in heterogeneous populations like the Brazilians. Further studies are needed to identify the remaining CF mutations in the different populations and regions of Brazil.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 FREQUENCIES OF 70 CFTR MUTATIONS IN DIFFERENT STATES OF BRAZIL, BY CONTINENTA L GROUP CFTR mutations SC PR MG detected n n n n % n % N % DF508 53 39 54 146 47.1 8 10.5 154 39.9 G542X 6 9 8 23 7.4 1 1.3 24 6.2 R1162X 9 2 4 15 4.8 2 2.6 17 4.4 N1303K 5 5 0 10 3.2 0 0 10 2.6 R334W 5 1 4 10 3.2 0 0 10 2.6 G85E 2 2 4 8 2.6 1 1.3 9 2.3 1717-1G®A 1 3 2 6 1.9 0 0 6 1.6 W1282X 4 1 1 6 1.9 0 0 6 1.6 3849110kbC®T 1 3 1 5 1.6 0 0 5 1.3 R553X 0 2 0 2 0.7 0 0 2 0.5 1812-1G®A 0 1 3 4 1.3 1 1.3 5 1.3 2183AA®G 2 1 0 3 1.0 0 0 3 0.8 312011G®A 0 0 2 2 0.7 2 2.6 4 1.0 Y1092X 0 1 1 2 0.7 1 1.3 3 0.8 G551D 0 0 0 0 0 0 0 0 0 W1089X 0 0 1 1 0.3 0 0 1 0.3 6211G®T 0 1 0 1 0.3 0 0 1 0.3 Q1238X 0 1 0 1 0.3 0 0 1 0.3 711-1G®T 0 1 0 1 0.3 0 0 1 0.3 R347P 1 0 0 1 0.3 0 0 1 0.3 189811G®A 1 0 0 1 0.3 0 0 1 0.3 I507 0 0 1 1 0.3 0 0 1 0.3 Subtotal 91 73 86 250 80.7 16 21.1 266 68.9 Alleles with CFTR 5 27 28 60 19.4 60 79.0 120 31.1 mutations not detected Total 96 100 114 310 100.0 76 100.0 386 100.0 Detection rate (%) 94.8 73.0 75.4 250 80.7 16 21.1 266 68.9 The following 70 CFTR mutations were selected and tested on the basis of frequency in various populations, known association with CF, or predicted deleterious effect on the CFTR protein product; DF508, G542X, N1303K, G551D, R553X, DI507, A455E, A559T, C524X, D1270N, E60X, G178R, G330X, G85E, 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, I148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P 2307insA, 1148T, K710X, P574H, Q1238X, Q493X, Q890X, R1158X, R1162X, R117H, R334W, R347H, R347P, R352Q, R560T, S1196X, S1255X, S364P, S549N, S549R, V520F, W1089X, W1282X, W1310X, W1316X, Y1092X, Y122X, Y563D, 1078delT,1677delTA,1717-1G-A,1812-1G-A,1898 1 1G-A, 2043delG,2183delAA-G, 2184delA, 2789 1 5G-A, 2869insG, 2909delT, 3120 1 1G-A, 3120G-A, 3358delAC, 3659delC, 3662delA, 3750delAG, 3791delC, 3821delT, 3849 1 10KbC-T, 3849 1 4A-G, 3905insT, 405 1 1G-A, 444delA, 556delA, 574delA, 621 1 1G-T, and 711 1 1G-T. aSC, Santa Catarina State; PR, Parana State; MG, Minas Gerais State; n, number of chromosomes. Login to comment

[hide] Prenatal screening for cystic fibrosis: past, pres... Expert Rev Mol Diagn. 2004 Jan;4(1):49-62. Richards CS, Grody WW
Prenatal screening for cystic fibrosis: past, present and future.
Expert Rev Mol Diagn. 2004 Jan;4(1):49-62., [PMID:14711349]

Abstract [show]
Prenatal screening for cystic fibrosis is reviewed. The disease, gene involved, molecular basis of disease, genotype/phenotype correlations and pilot trials are discussed, as well as historical perspectives, background and American College of Medical Genetics/American College of Obstetricians and Gynecologists recommendations. A number of complex challenges to the implementation of cystic fibrosis screening exist, including mutation testing of the cystic fibrosis transmembrane conductance regulator gene (CFTR), as well as laboratory and clinical issues. Current technologies for CFTR testing include reverse dot blots, amplification refractory mutation detection systems, oligonucleotide ligation assays, the Invader assay and NanoChip system. Emerging technologies are also considered, as well as quality assurance measures including analytical and clinical validation, reporting, residual risk calculations and prenatal diagnosis. An even greater challenge is clinical implementation, which focuses upon education and communication, choosing models, reporting, counseling and prenatal diagnosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
209 The second example of a mutation with variable expression depending on haplotype is I148T. Login to comment
212 Using that standard, I148T had been reported by the CF registry at just over 0.1%. Login to comment
213 Within a relatively short period following screening (<1 year), reports from large testing laboratories surfaced indicating that I148T was identified almost 100-times more frequently in the general population as compared with the CF population, a story all-too familiar at this point [46,47]. Login to comment
214 Rolhfs and coworkers identified a genetic modifier, a deletion of six base pairs (3199del6), resulting in an in-frame deletion of two amino acids in the CFTR protein that traveled with I148T when it was a CF disease-causing allele [46]. Login to comment
215 No CF patients were identified with I148T that did not also have 3199del6. Login to comment
216 The questions then became: is 3199del6 the real CF mutation and I148T simply a polymorphism in linkage disequilibrium; does 3199del6 alone cause CF and is it ever found unlinked; or can it also be linked with other CFTR mutations? Login to comment
225 A danger of expanding to more rare and less studied mutations is that their clinical significance may be questionable, as has already been experienced with I148T. Login to comment
230 The committee to review the panel of mutations has reconvened and is currently deliberating the merits of inclusion or exclusion of the R117H, 5T, I148T and 3199del6 mutations/variants. Login to comment
358 The first changes are likely to be minor, perhaps involving the I148T or R117H mutations. Login to comment

[hide] Improved detection of cystic fibrosis mutations in... Hum Reprod. 2004 Mar;19(3):540-6. Epub 2004 Jan 29. Danziger KL, Black LD, Keiles SB, Kammesheidt A, Turek PJ
Improved detection of cystic fibrosis mutations in infertility patients with DNA sequence analysis.
Hum Reprod. 2004 Mar;19(3):540-6. Epub 2004 Jan 29., [PMID:14998948]

Abstract [show]
BACKGROUND: Accurate determination of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene is critical for genetic counselling and treatment of obstructive azoospermia. Of concern is that detection rates with routine CFTR mutation panels vary widely depending on patient ancestry; and such panels have limited value for azoospermic patients, who are more likely to carry rare mutations. An alternative approach offers comprehensive, CFTR mutation analysis by a DNA sequence method. We investigated whether this method could improve CFTR detection rates in men with obstructive azoospermia in a prospective study of men with obstructive azoospermia and their partners who were referred for genetic counselling and testing at one of two institutions. METHODS: Sixteen patients with congenital absence of the vas deferens (CAVD, n = 14) or idiopathic obstructive azoospermia (n = 2) were studied. DNA from all patients was analysed for mutations by the DNA sequence method. In addition to this method, six men underwent CFTR analysis by a common 25 or 31 mutation panel coupled with poly T analysis. In 10 subjects, common mutation panel findings were inferred from DNA sequence method results. RESULTS: Overall, 12/16 (75%) azoospermic patients had one or more CFTR mutations and/or 5T alleles, including 12 mutations in 10 patients (two compound heterozygotes) and seven 5T alleles in six patients (one homozygote). The sequence method detected all mutations and three variants of unknown significance. By comparison, the common mutation panels detected only 3/12 mutations (25%) and 0/3 variants. CONCLUSION: The DNA sequence method detects more CFTR mutations than common mutation panels. Given the serious, clinical consequences of transmitting such mutations, this study underscores the importance of accurate, CFTR mutation detection in men with obstructive azoospermia and their partners.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Polyacrylamide gels were analysed for the presence of mutations following staining in ethidium bromide (EtBr) and image capture under UV using the Gel Doc 1000 system Table I. List of CFTR mutations included in common mutation panels American College of Medical Genetics CF panel (25 mutations) DF508 G542X G551D R117H W1282X N1303K R1162X 3849+10kbC®T DI507 R553X 1717-1G®A 621+1G®T R560T 3659delC 3120+1G®A I148T G85E R334W A455E 1898+1G®A 2148delA 711+1G®T 2789+5G®A R347P 1078delT Six additional mutations and one polymorphism in UCSF panel (31 mutations) Y1092X R347H 3849+4 Q493X 3905insT S549N F508C (polymorphism) (BioRad). Login to comment

[hide] Multiplexed genetic analysis using an expanded gen... Clin Chem. 2004 Nov;50(11):2019-27. Epub 2004 Aug 19. Johnson SC, Marshall DJ, Harms G, Miller CM, Sherrill CB, Beaty EL, Lederer SA, Roesch EB, Madsen G, Hoffman GL, Laessig RH, Kopish GJ, Baker MW, Benner SA, Farrell PM, Prudent JR
Multiplexed genetic analysis using an expanded genetic alphabet.
Clin Chem. 2004 Nov;50(11):2019-27. Epub 2004 Aug 19., [PMID:15319316]

Abstract [show]
BACKGROUND: All states require some kind of testing for newborns, but the policies are far from standardized. In some states, newborn screening may include genetic tests for a wide range of targets, but the costs and complexities of the newer genetic tests inhibit expansion of newborn screening. We describe the development and technical evaluation of a multiplex platform that may foster increased newborn genetic screening. METHODS: MultiCode PLx involves three major steps: PCR, target-specific extension, and liquid chip decoding. Each step is performed in the same reaction vessel, and the test is completed in approximately 3 h. For site-specific labeling and room-temperature decoding, we use an additional base pair constructed from isoguanosine and isocytidine. We used the method to test for mutations within the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The developed test was performed manually and by automated liquid handling. Initially, 225 samples with a range of genotypes were tested retrospectively with the method. A prospective study used samples from >400 newborns. RESULTS: In the retrospective study, 99.1% of samples were correctly genotyped with no incorrect calls made. In the perspective study, 95% of the samples were correctly genotyped for all targets, and there were no incorrect calls. CONCLUSIONS: The unique genetic multiplexing platform was successfully able to test for 31 targets within the CFTR gene and provides accurate genotype assignments in a clinical setting.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 3199del6 was added because several lines of evidence indicate that 3199del6 is a disease-causing mutation and may replace I148T (20). Login to comment

[hide] Prenatal screening for cystic fibrosis: an early r... Genet Med. 2004 May-Jun;6(3):115-6. Palomaki GE
Prenatal screening for cystic fibrosis: an early report card.
Genet Med. 2004 May-Jun;6(3):115-6., [PMID:15354327]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 An unanticipated problem occurred when one of the mutations that had not been subjected to evaluation during pilot trials was introduced directly into routine practice. The I148T mutation is known to occur about once in every 1000 genes among patientsclinicallyaffectedwithcysticfibrosis.Whentestingisper- formed in the general population, however, this mutation is found100timesmoreoftenthanexpected.8 Itisnowthoughtthat I148T is a polymorphism that is tightly linked to the actual disease-causing mutation 3199del6. Login to comment

[hide] Cystic fibrosis screening: lessons learned from th... Genet Med. 2004 May-Jun;6(3):136-40. Strom CM, Crossley B, Redman JB, Buller A, Quan F, Peng M, McGinnis M, Sun W
Cystic fibrosis screening: lessons learned from the first 320,000 patients.
Genet Med. 2004 May-Jun;6(3):136-40., [PMID:15354331]

Abstract [show]
PURPOSE: To examine the data from > 335,000 Cystic fibrosis (CF) tests to detect unsuspected findings and obtain clinical data when indicated to optimize genetic counseling. METHODS: A proprietary database containing 335,204 consecutive CF DNA tests and 445 CF prenatal diagnostic tests was queried. Clinical information was obtained for prenatal and selected nonprenatal cases by telephone contact with physician offices. RESULTS: The mutation 1078delT was found in much lower frequency than expected with rates of only 1:55,867 tests and 0.06% of CF mutations. This level is below the threshold set by the American College of Medical Genetics. Homozygosity was observed for 2789+5G>A in a 29-year-old women and compound heterozygosity with delta F408 in a 40-year-old woman with isolated chronic sinusitis. Many patients elected prenatal diagnosis when not at a 1:4 risk due to echogenic bowel or IVS-8 5T issues. CONCLUSIONS: With the exception of 1078delT, all CF mutations in the ACMG panel were detected with a frequency of > 0.1% of CF chromosomes. When ACMG guidelines are strictly adhered to, population-based CF carrier screening will accurately identify couples at risk for having children with CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
14 Further work by another laboratory established that in CF patients, the I148T caused CF almost exclusively when coupled with a second, much rarer mutation, 3199del6.11-13 This haplotype also includes the IVS-8 9T allele. Login to comment
15 In response to these new data, the ACMG published an advisory recommending that any patient who is discovered to have I148T and 9T should be tested for 3199del6. Login to comment
17 Based on this new information it is possible an unaffected fetus might have been terminated based on a genotype of I148T and another CF mutation. Login to comment
24 3 testing is that one or both parents carries I148T, is to contact the physician and advise him or her. Login to comment
36 Because current evidence suggests that I148T is not CF causing mutation (see earlier) the 1,136 patients with I148T have been considered "wild type" and excluded from the table. Login to comment
42 Using the data from Table 1, which omits I148T cases, excludes carriers of the mild mutation R117H without 5T, and also excludes half of the patients with R117H and 5T (because only half would be predicted to have the 5T in cis), there are 10,139 carriers of classic CF. Login to comment
47 Frequency, all tests Frequency, CF mutations (%) delta F508 7610 1:44 75% R117H/7T or 9T 1030 1:325 NAb R117H/5T 103 1:3,254 0.51c W1282X 529 1:625 5.2 G542X 382 1:909 3.8 G551D 278 1:1,250 2.7 N1303K 201 1:1,668 2.0 3849ϩ10kb CϾT 167 1:2,007 1.6 1717-1 GϾA 102 1:3,286 1.0 R553X 102 1:3,286 1.0 621ϩ1 GϾT 98 1:3,420 0.97 2789ϩ5 GϾA 82 1:4,087 0.80 3120ϩ1 GϾA 73 1:4,591 0.72 R1162X 54 1:6,207 0.53 R334W 54 1:6,207 0.53 685E 52 1:6,446 0.51 R560T 52 1:6,446 0.51 Delta I507 51 1:6,572 0.50 711ϩ1 GϾT 40 1:8,380 0.39 1898ϩ1 GϾA 37 1:9,059 0.36 3659 del C 36 1:9,311 0.36 A455E 34 1:9,858 0.33 R347P 33 1:10,158 0.32 2184 del A 14 1:23,943 0.14 1078 del T 6 1:55,867 0.06 a I148T has been eliminated from these data. Login to comment
54 We detected 1,136 patients with I148T in this series. Login to comment
55 After the publication of the association of the haplotype I148T/ IVS-8 9T/3199del6 with CF,13 we began analyzing the IVS-8 status for all patients found to have I148T. Login to comment
56 Of 544 heterozygous patients for I148T, only 86 (16%) lacked the 9T allele. Login to comment
57 Because most patients with I148T will have the 9T allele and the number of patients in the initial published study13 was only 9, we believe that all patients found to have I148T should be offered 3199del6 testing regardless of their IVS-8 genotype. Login to comment
58 Approximately 1% of more than 400 patients with I148T were found to have 3199del6 (data submitted elsewhere). Login to comment
59 In our series of 335,204 tests, 1,136 patients had I148T, predicting that approximately 11 patients would be expected to have 3199del6. Login to comment
74 Excluding patients with I148T and R117H without 5T, in our series of 335,204 patients, only 4 patients were discovered to have 2 CF mutations who did not previously have the diagnosis of CF, yielding a "false positive" rate of 0.0012% for 2 CF mutations. Login to comment
80 In all, 5 prenatal diagnoses were performed identifying one parent as heterozygous for I148T. Login to comment
81 One mother was a compound heterozygote for delta F508 and R117H (without 5T), the father was heterozygous for I148T, and the fetal genotype was delta F508/I148T. Login to comment
82 This couple received counseling regarding the significance of I148T and elected to continue the pregnancy. Login to comment
86 Table 3 Patients with 2 CF mutations and unexpected phenotypes Genotype Gender Age Symptoms ⌬F508/R117H Female 22 years no respiratory symptoms (5T/9T) 3 episodes of pancreatitis ⌬F508/3849 ϩ 10kb CϾT Female Adult chronic pancreatitis 2789ϩ5 GϾA/2789ϩ5 GϾAa Female 29 years chronic sinusitis ⌬F508/2789ϩ5 GϾA Female 40 years recurrent sinusitits requiring surgery a Both parents confirmed to be carriers of 2789ϩ5 GϾA. I148T and the other for delta F508 had potentially affected genotypes and no pregnancy losses occurred. Login to comment
131 The single genotype/phenotype error regarding I148T was recognized quickly and interpretative reporting comments adjusted accordingly. Login to comment

[hide] Preconception and prenatal cystic fibrosis carrier... Genet Med. 2004 May-Jun;6(3):141-4. Monaghan KG, Bluhm D, Phillips M, Feldman GL
Preconception and prenatal cystic fibrosis carrier screening of African Americans reveals unanticipated frequencies for specific mutations.
Genet Med. 2004 May-Jun;6(3):141-4., [PMID:15354332]

Abstract [show]
PURPOSE: It is recommended that cystic fibrosis (CF) carrier screening be made available to African Americans who are either pregnant or planning a pregnancy. We analyzed the carrier and mutant allele frequencies for African Americans undergoing CF carrier screening in our laboratories. METHODS: Between December 2001 and September 2003, we performed carrier screening for 2189 African Americans, testing for at least the 25 recommended mutations. RESULTS: A total of 33 CF carriers were identified. The most common mutations detected were deltaF508, G622D, R117H/7T, and G551D. The G622D allele frequency among African Americans was 0.18%. We did not detect any 3120 + 1G --> A carriers, although 4 were expected (P < 0.05). CONCLUSIONS: When considering only the 25 recommended CF mutations, 1 in 75 African Americans screened in our laboratories were carriers (within the expected range, given a 69% mutation detection rate). The addition of 2 mutations, G622D and Q98R (incidentally identified while screening for ACOG/ACMG mutations), increased the observed carrier frequency to 1 in 66, which is not significantly different from the known African American carrier frequency of 1 in 65. The frequencies of several specific mutations detected were unanticipated, as was the absence of 3120 + 1G --> A carriers. Further studies on African American patients with classic CF are needed to examine the incidence of CF mutations that are not part of the current panel, such as G622D.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
28 DOI: 10.1097/01.GIM.0000127269.42279.83 May/June 2004 ⅐ Vol. 6 ⅐ No. 3 a r t i c l e Genetics IN Medicine duplex analysis (exons 4 and 13) and RFLP analysis to test for 3 additional mutations recommended by ACOG/ACMG, but not included in CF OLA v2.0 (I148T, 2184delA, and 3120ϩ1G3A, respectively). Login to comment
36 Reflex testing for the 3199del6 and intron 8 polyT locus was performed for carriers of the I148T and R117H mutations, respectively. Login to comment
51 R117H has been previously reported at an increased frequency among individuals undergoing carrier screening compared to those with a diagnosis of cystic fibrosis.8 An unexpected result was the lack of 3120ϩ1G3A carriers, although 4 were expected given that this mutation accounts for Ϸ12% of the CF muta- Table 1 Summary of carrier screening results using various methods employed between December 2001 and September 2003 OLA v2.0, heteroduplex analysis (exons 4 and 13) and RFLP analysis (3120ϩ1G3A) OLA v3.0 INNO-LiPA Total screened 818 1274 97 No. of carriers identified 16 14 3 Observed carrier frequency 1/51 1/81 Mutations identified ⌬F508 (6), G622D (3), R117H/7T (3), I148T (3199del6 negative), Q98R, 1898ϩ1G3A, and G551Da ⌬F508 (14), R117H/7T, R553X, and G551D a In addition, 2 persons were positive for F693L (TTG) and 1 was positive for P140S (C3T at 550); both are variants of unknown clinical significance. Login to comment
80 However, laboratories, which receive a large proportion of specimens from individuals with a lower Table 2 Summary of ACOG/ACMG CF mutations identified among 2189 African Americans (4378 chromosomes) undergoing carrier screening Mutation Carriers identified Mutation frequency (%) (this study) Published mutation frequency (%)6,7 ⌬F508 20/33 61 29a -48 R117H/7T 4/33 12 1 G551D 2/33 6 1 I148T (3199del6 negative) 1/33 3 0 1898ϩ1G3A 1/33 3 1 R553X 1/33 3 0.5 3120ϩ1G3A 0 0 12-14 a The lower frequency of ⌬F508 reported by Heim et al. was most likely due to ascertainment bias. Login to comment
83 As we have learned from I148T,16,17 it is of limited benefit to screen for sequence changes that do not result in a classic CF phenotype. Login to comment

[hide] Cystic fibrosis population carrier screening: 2004... Genet Med. 2004 Sep-Oct;6(5):387-91. Watson MS, Cutting GR, Desnick RJ, Driscoll DA, Klinger K, Mennuti M, Palomaki GE, Popovich BW, Pratt VM, Rohlfs EM, Strom CM, Richards CS, Witt DR, Grody WW
Cystic fibrosis population carrier screening: 2004 revision of American College of Medical Genetics mutation panel.
Genet Med. 2004 Sep-Oct;6(5):387-91., [PMID:15371902]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 The mutation/variant I148T occurs at rates 50 to 100 times higher than in the general population being tested for carrier status than in patients.8,9 It was shown that CFTR genes bearing I148T in CF patients have a second mutation termed 3199del6. Login to comment
55 The vast majority of individuals in the general population with I148T do not have the 3199del6 mutation. Login to comment
57 One, CF patients have been described who lack I148T but have 3199del6 in association with another CF causing mutation.10 Two, unaffected individuals have been described who have a CF mutation associated with severe CF and I148T but lacking 3199del6.7-11 Because the frequency of I148T alone is 0.05% and I148T with 3199del6 in this analysis is considerably lower than 0.1% and because I148T does not cause classical CF by itself, we recommend removing I148T from the CF carrier screening panel. Login to comment
79 Recent experience with I148T serves to demonstrate the importance of evaluating distribution among both affected and carrier screening populations to discern discrepancies before inclusion in a screening panel. Login to comment

[hide] CFTR mutation distribution among U.S. Hispanic and... Genet Med. 2004 Sep-Oct;6(5):392-9. Sugarman EA, Rohlfs EM, Silverman LM, Allitto BA
CFTR mutation distribution among U.S. Hispanic and African American individuals: evaluation in cystic fibrosis patient and carrier screening populations.
Genet Med. 2004 Sep-Oct;6(5):392-9., [PMID:15371903]

Abstract [show]
PURPOSE: We reviewed CFTR mutation distribution among Hispanic and African American individuals referred for CF carrier screening and compared mutation frequencies to those derived from CF patient samples. METHODS: Results from CFTR mutation analyses received from January 2001 through September 2003, were analyzed for four populations: Hispanic individuals with a CF diagnosis (n = 159) or carrier screening indication (n = 15,333) and African American individuals with a CF diagnosis (n = 108) or carrier screening indication (n = 8,973). All samples were tested for the same 87 mutation panel. RESULTS: In the Hispanic population, 42 mutations were identified: 30 in the patient population (77.5% detection rate) and 33 among carrier screening referrals. Five mutations not included in the ACMG/ACOG carrier screening panel (3876delA, W1089X, R1066C, S549N, 1949del84) accounted for 7.55% detection in patients and 5.58% among carriers. Among African American referrals, 33 different mutations were identified: 21 in the patient population (74.4% detection) and 23 in the carrier screening population. Together, A559T and 711+5G>A were observed at a detection rate of 3.71% in CF patients and 6.38% in carriers. The mutation distribution seen in both the carrier screening populations reflected an increased frequency of mutations with variable expression such as D1152H, R117H, and L206W. CONCLUSIONS: A detailed analysis of CFTR mutation distribution in the Hispanic and African American patient and carrier screening populations demonstrates that a diverse group of mutations is most appropriate for diagnostic and carrier screening in these populations. To best serve the increasingly diverse U.S. population, ethnic-specific mutations should be included in mutation panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Specimens positive for D1270N (see later) or I148T in the absence of 3199del6 were reclassified as negative for the purpose of this analysis. Login to comment
34 Specimens identified as I148T positive before the start of 3199del6 reflex testing are included in the analysis because their disease causing status is unknown. Login to comment
35 87 mutation panel The following mutations were included in the panel: ⌬F508, ⌬F311, ⌬I507, A455E, A559T, C524X, D1152H, D1270N, E60X, G178R, G330X, G480C, G542X, G551D, G85E, G91R, I148T, K710X, L206W, M1101K, N1303K, P574H, Q1238X, Q359K/T360K, Q493X, Q552X, Q890X, R1066C, R1158X, R1162X, R117C, R117H, R1283M, R334W, R347H, R347P, R352Q, R553X, R560T, S1196X, S1251N, S1255X, S364P, S549I, S549N, S549R, T338I, V520F, W1089X, W1282X, Y1092X, Y563D, 1078delT, 1161delC, 1609delCA, 1677delTA, 1717-1GϾA, 1812-1GϾA, 1898ϩ1GϾA, 1898ϩ5GϾT, 1949del84, 2043delG, 2143delT, 2183delAAϾG, 2184delA, 2307insA, 2789ϩ5GϾA, 2869insG, 3120ϩ1GϾA, 3120GϾA, 3659delC, 3662delA, 3791delC, 3821delT, 3849ϩ10kbCϾT, 3849ϩ4AϾG, 3905insT, 394delTT, 405ϩ1GϾA, 405ϩ3AϾC, 444delA, 574delA, 621ϩ1GϾT, 711ϩ1GϾT, 711ϩ5GϾA, 712-1GϾT, 3876delA CFTR mutation analysis Genomic DNA was extracted from peripheral blood lymphocytes, buccal cell swabs, or bloodspots by Qiagen QIAmp 96 DNA Blood Kit. Specimens were tested for 87 mutations by a pooled allele-specific oligonucleotide (ASO) hybridization method as previously described.16,17 Two multiplex chain reactions (PCR) were used to amplify 19 regions of the CFTR gene. Login to comment
63 The most prevalent mutations were as follows: ⌬F508, D1152H, R117H, G542X, L206W, I148T (3199del6 status unknown), ⌬I507, R1066C, R553X, 3849ϩ10kbCϾT, and R334W representing 83.72% of the total identified. Login to comment
71 In the carrier screening group, 4 mutations, D1152H, R117H, ⌬I507, and L206W, had frequencies of 3.8% 1 CFTR mutation distribution among Hispanic CF patients and carrier screening referrals CFTR Mutation Identified CF Patients Carrier Screening Referrals # of CF Chromosomes % Detection # of Carrier Screen Referrals % of Positive Carriers ⌬F508a 118 37.11c 136 47.39 G542Xa 11 3.46 12 4.18 R334Wa 11 3.46 6 2.09 3120 ϩ 1G Ͼ Aa 7 2.20 5 1.74 3876delAb 7 2.20 4 1.39 W1089Xb 7 2.20 R1066Cb 6 1.89 9 3.14 3849 ϩ 10kbC Ͼ Ta 3 0.94 6 2.09 R1162Xa 2 0.63 5 1.74 G85Ea 2 0.63 3 1.05 S549Nb 2 0.63 2 0.70 711 ϩ 1G Ͼ Ta 2 0.63 1 0.35 2789 ϩ 5G Ͼ Aa 2 0.63 1 0.35 1949del84b 2 0.63 1 0.35 R117Ha 1 0.31 14 4.88 ⌬I507a 1 0.31 11 3.83 R553Xa 1 0.31 7 2.44 ⌬F311b 1 0.31 1 0.35 1078delTa 1 0.31 1 0.35 621 ϩ 1G Ͼ Ta 1 0.31 1 0.35 3659delCa 1 0.31 1 0.35 Q890Xb 1 0.31 1 0.35 G551Da 1 0.31 1812 - 1G Ͼ Ab 1 0.31 I148T ϩ 3199del6a 1 0.31 A559Tb 1 0.31 1717 - 1G Ͼ Aa 1 0.31 3905insTb 1 0.31 3821delTb 1 0.31 G178Rb 1 0.31 D1152Hb 18 6.27 L206Wb 11 3.83 I148T (3199del6 status unknown)a 10 3.48 N1303Ka 4 1.39 W1282Xa 4 1.39 R117Cb 4 1.39 R352Qb 2 0.70 712 - 1G Ͼ Tb 2 0.70 Y1092Xb 1 0.35 444delAb 1 0.35 S549Rb 1 0.35 1609delCAb 1 0.35 Negative for mutations analyzed 120 37.74 15046 Total 318 62.20d 15333 100.00 a Mutation included in the ACMG/ACOG Recommended Core Mutation Panel for general population CF carrier screening.4,5 b Mutation not included in the ACMG/ACOG Recommended Core Mutation Panel for general population CF carrier screening. Login to comment

[hide] Clinical sensitivity of prenatal screening for cys... Genet Med. 2004 Sep-Oct;6(5):405-14. Palomaki GE, FitzSimmons SC, Haddow JE
Clinical sensitivity of prenatal screening for cystic fibrosis via CFTR carrier testing in a United States panethnic population.
Genet Med. 2004 Sep-Oct;6(5):405-14., [PMID:15371905]

Abstract [show]
PURPOSE: To estimate CFTR mutation frequencies, clinical sensitivities (proportions of carrier couples or affected fetuses detected), and birth prevalence estimates for broad racial/ethnic groups and for a panethnic U.S. population. METHODS: Published sources of information were identified, corrected when appropriate, and summarized. Combining racial/ethnic-specific mutation frequencies and birth prevalence estimates allowed the computation of panethnic estimates. RESULTS: Two of the 25 recommended mutations do not meet the 0.1% threshold in a panethnic population set by the American College of Medical Genetics. The clinical sensitivities are estimated to be 71.9%, 51.7%, 41.6%, 88.6%, and 23.4% for non-Hispanic Caucasians, Hispanic Caucasian, African American, Ashkenazi Jewish Caucasian, and Asian American couples, respectively. Birth prevalence estimates are 1:2,500, 1:13,500, 1:15,100, 1:2,270, and 1:35,100, whereas the number of couples needed to screen to detect an affected fetus are about 3,200, 26,120; 36,040; 2,600, and 129,600, respectively, for the same racial/ethnic groups. CONCLUSIONS: Overall, the panethnic estimates for CFTR mutation frequencies are similar to those for non-Hispanic Caucasians. However, large differences in both clinical sensitivity and birth prevalence exist between the broad racial/ethnic groups examined. Whether and how the differences in the numbers of couples needed to screen to detect an affected fetus are to be included in prenatal screening for cystic fibrosis needs to be more explicitly addressed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Data from the International Cystic Fibrosis Consortium were taken from Table 1 of its publication.4 Data from the Cystic Fibrosis Foundation National Patient Registry were taken from the year 1999 and stratified according to whether or not the patient was seen Table 1 CFTR mutation frequencies among Hispanic Caucasians with cystic fibrosis within the recommended minimum testing panel Ordera Mutation Mutation frequency (%) CF Consortiumb CF Foundationc Average Cumulative 1 delF508 45.51 63.25 54.38 54.38 2 G542X 5.11 5.09 5.10 59.48 8 delI507 0.59 5.02 2.81 62.29 22 R334W 2.25 1.31 1.78 64.07 6 N1303K 1.65 1.67 1.66 65.73 10 3849 ϩ 10kbC Ͼ T 1.60 1.53 1.57 67.30 7 R553X 0.63 0.73 0.68 67.98 5 W1282X 0.53 0.73 0.63 68.61 19 R1162X 0.57 0.58 0.58 69.19 3 G551D 0.31 0.80 0.56 69.75 12 1717 - 1G Ͼ T 0.10 0.44 0.27 70.02 4 621 ϩ 1G Ͼ T 0.00 0.51 0.26 70.28 14 711 ϩ 1G Ͼ T 0.10 0.36 0.23 70.51 18 G85E 0.10 0.36 0.23 70.74 11 2789 ϩ 5G Ͼ A 0.10 0.22 0.16 70.90 13 R347P 0.10 0.22 0.16 71.06 20 2184delA 0.10 0.22 0.16 71.22 24 3120 ϩ 1G Ͼ T 0.10 0.22 0.16 71.38 17 3569delC 0.10 0.15 0.13 71.51 9 R117H 0.00 0.22 0.11 71.62 23 I148T 0.10 0.07 0.09 71.71 25 1078delT 0.10 0.07 0.09 71.80 16 A455E 0.10 0.00 0.05 71.85 21 1898 ϩ 1G Ͼ A 0.10 0.00 0.05 71.90 15 R560T 0.00 0.00 0.00 71.90 All 25 59.95 83.77 71.90 a The order is based on that found for non-Hispanic Caucasians.3 b Based on between 178 and 958 chromosomes (International Cystic Fibrosis Genetic Analysis Consortium.4 c Based on 1374 chromosomes from clinically diagnosed persons registered in the Cystic Fibrosis Foundation National Patient Registry. Login to comment
80 The larger data- Table 2 CFTR mutation frequencies among African American individuals with cystic fibrosis within the recommended minimum testing panel Ordera Mutation Mutation frequency (%) CF Consortiumb CF Foundationc Average Cumulative 1 delF508 35.50 52.63 44.07 44.07 24 3120 ϩ 1G Ͼ T 12.50 6.64 9.57 53.64 8 delI507 0.74 3.89 2.32 55.96 7 R553X 2.37 1.37 1.87 57.83 2 G542X 1.18 1.72 1.45 59.28 3 G551D 0.59 1.83 1.21 60.49 4 621 ϩ 1G Ͼ T 1.18 1.03 1.11 61.60 19 R1162X 0.74 0.57 0.66 62.26 22 R334W 0.74 0.23 0.49 62.75 12 1717 - 1G Ͼ T 0.74 0.00 0.37 63.12 6 N1303K 0.00 0.69 0.35 63.47 5 W1282X 0.00 0.47 0.24 63.71 10 3849 ϩ 10kbC Ͼ T 0.00 0.34 0.17 63.88 15 R560T 0.00 0.34 0.17 64.05 18 G85E 0.00 0.23 0.12 64.17 9 R117H 0.00 0.11 0.06 64.23 13 R347P 0.00 0.11 0.06 64.29 17 3569delC 0.00 0.11 0.06 64.35 21 1898 ϩ 1G Ͼ A 0.00 0.11 0.06 64.41 20 2184delA 0.10 0.00 0.05 64.46 23 I148T 0.10 0.00 0.05 64.51 11 2789 ϩ 5G Ͼ A 0.00 0.00 0.00 64.51 14 711 ϩ 1G Ͼ T 0.00 0.00 0.00 64.51 16 A455E 0.00 0.00 0.00 64.51 25 1078delT 0.00 0.00 0.00 64.51 All 25 56.46 72.42 64.51 a The order is based on that found for non-Hispanic Caucasians.3 b Based on between 79 and 169 chromosomes reported by the International Cystic Fibrosis Genetic Analysis Consortium.4 c Based on 874 chromosomes from clinically diagnosed persons registered in the Cystic Fibrosis Foundation National Patient Registry. Login to comment
107 An earlier article10 reported that 97% of mutations were identified in 90 chromosomes from Ashkenazi Jewish individ- Table 3 CFTR mutation frequencies among Ashkenazi Jewish Caucasian individuals with cystic fibrosis within the recommended minimum testing panel Ordera Mutation Mutation frequency (%) CF Consortiumb Cumulative 5 W1282X 45.92 45.92 1 delF508 31.41 77.33 2 G542X 7.55 84.88 10 3849 ϩ 10kbC Ͼ T 4.77 89.65 6 N1303K 2.78 92.43 12 1717 - 1G Ͼ T 0.67 93.10 7 R553X 0.22 93.32 3 G551D 0.22 93.54 24 3120 ϩ 1G Ͼ T 0.10 93.64 21 1898 ϩ 1G Ͼ A 0.10 93.74 20 2184delA 0.10 93.84 23 I148T 0.10 93.94 11 2789 ϩ 5G Ͼ A 0.10 94.04 14 711 ϩ 1G Ͼ T 0.10 94.14 8 delI507 0.00 94.14 19 R1162X 0.00 94.14 22 R334W 0.00 94.14 4 621 ϩ 1G Ͼ T 0.00 94.14 15 R560T 0.00 94.14 18 G85E 0.00 94.14 9 R117H 0.00 94.14 13 R347P 0.00 94.14 17 3569delC 0.00 94.14 16 A455E 0.00 94.14 25 1078delT 0.00 94.14 Sum 94.14 a The order is based on that found for non-Hispanic Caucasians.3 b Based on between 57 and 503 chromosomes reported by the International Cystic Fibrosis Genetic Analysis Consortium.4 uals with cystic fibrosis, using a panel of 11 mutations. Login to comment
115 In an- Table 4 CFTR mutation frequencies among Asian American individuals with cystic fibrosis within the recommended minimum testing panel Ordera Mutation Mutation frequency (%) Heim et al.1b CF Foundationc Average Cumulative 1 delF508 18.80 59.09 38.95 38.95 10 3849 ϩ 10kbC Ͼ T 0.00 10.61 5.31 44.26 3 G551D 6.30 0.00 3.15 47.41 6 N1303K 0.00 1.52 0.76 48.17 8 delI507 0.00 1.52 0.76 48.93 2 G542X 0.00 0.00 0.00 48.93 4 621 ϩ 1G Ͼ T 0.00 0.00 0.00 48.93 5 W1282X 0.00 0.00 0.00 48.93 7 R553X 0.00 0.00 0.00 48.93 9 R117H 0.00 0.00 0.00 48.93 11 2789 ϩ 5G Ͼ A 0.00 0.00 0.00 48.93 12 1717 - 1G Ͼ T 0.00 0.00 0.00 48.93 13 R347P 0.00 0.00 0.00 48.93 14 711 ϩ 1G Ͼ T 0.00 0.00 0.00 48.93 15 R560T 0.00 0.00 0.00 48.93 16 A455E 0.00 0.00 0.00 48.93 17 3569delC 0.00 0.00 0.00 48.93 18 G85E 0.00 0.00 0.00 48.93 19 R1162X 0.00 0.00 0.00 48.93 20 2184delA 0.00 0.00 0.00 48.93 21 1898 ϩ 1G Ͼ A 0.00 0.00 0.00 48.93 22 R334W 0.00 0.00 0.00 48.93 23 I148T 0.00 0.00 0.00 48.93 24 3120 ϩ 1G Ͼ T 0.00 0.00 0.00 48.93 25 1078delT 0.00 0.00 0.00 48.93 Sum 25.10 72.74 48.93 a The order is based on that found for non-Hispanic Caucasians.3 b Based on 20 chromosomes. Login to comment
163 An interesting finding is that two mutations originally included in the ACMG minimum recommended panel (I148T and 1078delT) fall below the 0.1% level in a panethnic population initially chosen as a lower limit for inclusion. Login to comment
167 the I148T mutation/polymorphism have been discussed elsewhere.18 All of the results provided in the current study assume that each individual belongs to a single racial/ethnic group and that both of the partners belong to the same racial/ethnic group. Login to comment
173 For exam- Table 7 Estimated number of carriers of the 25 recommended CFTR mutations by racial/ethnic group and weighted average, representing the panethnic population in the United States for 2002 Order CFTR mutation Number of CFTR Mutation Carriers Panethnic frequency, % Non-Hispanic Caucasian Hispanic Caucasian African American Asian American Ashkenazi Jewish Total 1 delF508 64,779 8,207 4,272 886 796 78,940 66.31 2 G542X 2,039 770 141 0 191 3,141 2.64 5 W1282X 1,342 95 23 0 1,164 2,624 2.20 3 G551D 2,013 85 117 72 6 2,293 1.93 4 621 ϩ 1G Ͼ T 1,404 39 108 0 0 1,551 1.30 6 N1303K 1,136 251 34 17 70 1,508 1.27 7 R553X 778 424 225 17 0 1,444 1.21 8 delI507 787 103 181 0 6 1,077 0.90 10 3849 ϩ 10kbC Ͼ T 519 237 16 121 121 1,014 0.85 24 3120 ϩ 1G Ͼ T 72 24 928 0 3 1,027 0.86 9 R117H 626 17 6 0 0 649 0.55 12 1717 - 1G Ͼ T 429 41 36 0 17 523 0.44 11 2789 ϩ 5G Ͼ A 429 24 0 0 3 456 0.38 13 R347P 403 24 6 0 0 433 0.36 14 711 ϩ 1G Ͼ T 385 35 0 0 3 423 0.36 22 R334W 125 269 47 0 0 441 0.37 15 R560T 340 0 16 0 0 356 0.30 19 R1162X 206 88 64 0 0 358 0.30 17 3569delC 304 20 6 0 0 330 0.28 16 A455E 304 8 0 0 0 312 0.26 18 G85E 259 35 12 0 0 306 0.26 20 2184delA 152 24 5 0 3 184 0.15 21 1898 ϩ 1G Ͼ A 143 8 6 0 3 160 0.13 23 I148T 80 14 5 0 3 102 0.09 25 1078delT 18 14 0 0 0 32 0.03 All 79,072 10,856 6,193 1,113 2,389 99,684 84.00 Bolded numbers indicate mutations that are more likely to be found in a racial/ethnic group other than non-Hispanic Caucasians. Login to comment

[hide] Premarital and prenatal screening for cystic fibro... Genet Med. 2004 Sep-Oct;6(5):415-20. Kornreich R, Ekstein J, Edelmann L, Desnick RJ
Premarital and prenatal screening for cystic fibrosis: experience in the Ashkenazi Jewish population.
Genet Med. 2004 Sep-Oct;6(5):415-20., [PMID:15371906]

Abstract [show]
PURPOSE: Since the early 1990s, Dor Yeshorim (DY) and the Mount Sinai School of Medicine (MSSM) have conducted premarital and prenatal carrier screening for cystic fibrosis (CF) in the Ashkenazi Jewish (AJ) population as part of their genetic testing programs, respectively. Together, over 170,000 screenees have been tested. In this study, we report the CF mutation frequencies in over 110,000 screenees who reportedly were of 100% AJ descent from the DY program and MSSM. In addition, the CF mutation frequencies in a group of > 7,000 screenees for AJ diseases who were of < 100% AJ descent are reported. METHODS: Testing for CF mutations was performed by either PCR and restriction digestion or ASO hybridization analyses at MSSM or sent to various academic and commercial laboratories by DY. RESULTS: The overall (and individual) carrier frequency for the five common AJ mutations, W1282X (0.020), DeltaF508 (0.012), G542X (0.0024), 3849+10kb C>T (0.0020), and N1303K (0.0016), among screenees who were 100% AJ was 1 in 26; when D1152H and the rare 1717-1G>A were included, the overall carrier frequency increased to approximately 1 in 23. In four families with D1152H, five compound heterozygotes for D1152H and W1282X (n = 2), DeltaF508 (1) or 3849+10kb C>T (1) were identified. In contrast, the carrier frequency for screenees reporting < 100% AJ descent was approximately 1 in 30 for the seven mutations. CONCLUSIONS: The carrier frequency for five common CF mutations in a large 100% AJ sample increased from 1 in 26 to 1 in 23 when D1152H was included in the panel. Addition of D1152H to mutation panels when screening the AJ population should be considered because compound heterozygosity is associated with a variable disease phenotype. Further studies to delineate the phenotype of CF patients with this mutation are needed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
54 Among the over 2,300 AJ screenees tested, one screenee was identified who carried R117H, one carried G551D and two carried I148T. Login to comment
55 The two I148T carriers were tested for the 3199del6 mutation by direct sequencing and were found to be negative for this putative-disease causing mutation.18-20 In the DY program, over 7,000 100% AJ individuals were screened for up to 87 mutations and only one screenee was found to be an I148T carrier and another was an 1898ϩ1GϾA carrier. Login to comment
62 The additional mutations that were detected were R117H (n ϭ 7), I148T (6), A455E (2), R334W (2), G551D (1), and R553X (1). Login to comment
86 For example, W1282X was the most prevalent mutation among Ashkenazi Jews, present in 46.4% of AJ carriers, whereas it was present in only 1.5% of non-Hispanic Caucasian CF patients.8 ⌬F508, the most common mutation in non-Hispanic Caucasian CF pa- Table 3 Frequency of CFTR mutations among screenees reporting 100% AJ or Ͻ 100% AJ descent who requested carrier testing for CF and at least one other AJ recessive disease CF mutation % of mutations in carriers reporting 100% AJ descent (n ϭ 45,530-117,145) % of mutations among carriers reporting Ͻ100% AJ descent (n ϭ 7,393) % of Non-Hispanic Caucasian CF patient chromosomes8 (n ϭ 37,263) W1282X 46.4 (n ϭ 117,136) 32.3 1.5 ⌬F508 27.1 (n ϭ 117,145) 35.7 71.5 D1152H 12.0 (n ϭ 44,530) 8.7 0.03 G542X 5.3 (n ϭ 117,140) 6.1 2.3 3849ϩ10kb CϾT 4.8 (n ϭ 117,135) 4.9 0.7 N1303K 3.8 (n ϭ 117,141) 3.0 1.3 1717-1GϾA 0.6 (n ϭ 60,191) 1.9 0.7 R117H a 2.7 0.8 I148T a 2.3 0.05 R334W - 0.76 0.16 A455E - 0.76 0.19 G551D a 0.38 2.5 R553X - 0.38 1.0 a These mutations were detected when screening Ϸ2,300 100% AJ individuals with the ACMG recommended panel. Login to comment
94 When MSSM and DY testing laboratories introduced expanded screening panels, several other CF mutations were found among AJ screenees; these were R117H, G551D, I148T, and 1898ϩ1GϾA. Login to comment
96 In addition, three screenees were found to carry I148T. Login to comment
97 However, the two individuals identified at MSSM were found to be negative for the 3199del6 mutation that presumably is the disease-causing mutation in cis with the I148T variant.18-20 Of the five individuals identified by DY who were compound heterozygotes for D1152H and W1282X, ⌬F508 or 3849ϩ10kb CϾT, anecdotal information from the two individuals from one family with the D1152H/W1282X genotype indicated a mild form of CF. Login to comment
107 Approximately half of the MSSM 100% AJ screenees were also tested for the ACMG 25 panethnic mutation panel and only two had another mutation, excluding I148T. Login to comment

[hide] Genotype-phenotype correlation and frequency of th... Genet Med. 2004 Sep-Oct;6(5):421-5. Monaghan KG, Highsmith WE, Amos J, Pratt VM, Roa B, Friez M, Pike-Buchanan LL, Buyse IM, Redman JB, Strom CM, Young AL, Sun W
Genotype-phenotype correlation and frequency of the 3199del6 cystic fibrosis mutation among I148T carriers: results from a collaborative study.
Genet Med. 2004 Sep-Oct;6(5):421-5., [PMID:15371907]

Abstract [show]
PURPOSE: We expect that the mutation panel currently recommended for preconception/prenatal CF carrier screening will be modified as new information is learned regarding the phenotype associated with specific mutations and allele frequencies in various populations. One such example is the I148T mutation, originally described as a severe CF mutation. After implementation of CF population-based carrier screening, we learned that I148T exists as a complex allele with 3199del6 in patients with clinical CF, whereas asymptomatic compound heterozygotes for I148T and a second severe CF mutation were negative for 3199del6. METHODS: We performed reflex testing for 3199del6 on 663 unrelated specimens, including I148T heterozygotes, compound heterozygotes, and a homozygous individual. RESULTS: Less than 1% of I148T carriers were also positive for 3199del6. Excluding subjects tested because of a suspected or known CF diagnosis or positive family history, 0.6% of I148T-positive individuals were also positive for 3199del6. We identified 1 I148T homozygote and 6 unrelated compound heterozygous individuals with I148T and a second CF variant (2 of whom also carried 3199del6). In addition, one fetus with echogenic bowel and one infertile male were heterozygous for I148T (3199del6 negative). CONCLUSIONS: Reflex testing for 3199del6 should be considered whenever I148T is identified. Reflex testing is of particular importance for any symptomatic patient or whenever one member of a couple carries a deleterious CF mutation and the other member is an I148T heterozygote. Further population data are required to determine if I148T, in the absence of 3199del6, is associated with mild or atypical CF or male infertility.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 Requested testing for 3199del6 was performed using a laboratory-developed direct sequence analysis of exon 17a of the CFTR gene.13 Baylor College of Medicine CF direct mutation analysis was done using a matrix assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry platform (Sequenom), which includes the I148T and 3199del6 mutations. Login to comment
37 Greenwood Genetic Center CF studies for I148T were performed by PCR amplification followed by either laboratory-developed sequencing analysis or oligonucleotide ligation assay (CF OLA v3.0) (Celera Diagnostics/Abbott Diagnostics/Applied Biosystems). Login to comment
39 RESULTS A summary of the 3199del6- and/or I148T-positive patients identified is shown in Table 1. Login to comment
40 Data were collected on 662 un- Table 1 Summary of 3199del6 and/or I148T chromosomes identified among 663 individuals undergoing CF DNA testing Indication for DNA testing Race/Ethnicity I148T positive 3199del6 positive Carrier screen Caucasian 71 0 Unspecifieda Caucasian 128 0 Carrier screen Hispanic 8 0 Unspecifieda Hispanic 14 1 Carrier screen Middle Eastern 7 0 Unspecifieda Middle Eastern 6 0 Carrier screen Other 2 0 Carrier screen Asian 5 0 Unspecifieda Asian 14b 0 Carrier screen African American 3 0 Carrier screen Unspecified 47 0 Unspecifieda Other 3 0 Unspecifieda Unspecified 341 3 Subtotal 649 4 (0.6%) Fetus with echogenic bowel Middle Eastern 1 0 Fetus with echogenic bowel Asian 1 0 Male infertility Caucasian 1 0 Male infertility Unspecified 2 0 Rule-out CF Unspecified 6 0 Rule-out CF African American 1 0 Clinical CF Caucasian 1 1 Family history of CF mutation Armenian 1 1 Family history of a CF mutation Caucasian 1 0 Subtotal 15 2 (13.3%) Total 664 6 (0.9%) a The majority of persons undergoing CF DNA testing for an unspecified indication are presumably undergoing carrier screening. Login to comment
41 b 12 individuals were heterozygous for I148T, and 1 individual was I148T homozygous. Login to comment
42 related I148T heterozygotes and 1 I148T homozygote (total of 663 persons or 664 I148T chromosomes). Login to comment
43 Overall, we identified 6 unrelated individuals positive for both I148T and 3199del6 (0.9%). Login to comment
44 With the exception of Case 6 (Table 2), the phase of the I148T/3199del6 was not determined; however, they are presumed in-cis based on previous haplotype studies.9 These studies demonstrated that I148T occurs on a 7T or 9T background, whereas the I148T/3199del6 occurs on a 9T background. Login to comment
46 Excluding 15 cases referred for CF DNA testing because of a known or suspected diagnosis of CF (including fetal echogenic bowel and male infertility) or a positive family history, 0.6% of I148T carriers were positive for 3199del6. Login to comment
48 An unaffected I148T homozygote (Case 1) was detected during routine prenatal screening. Three males (cases 2-4) with congenital bilateral absence of the vas deferens (CBAVD) (I148T/ ⌬F508), obstructive azoospermia (I148T carrier), and infertility (I148T/S1235R) were identified, the latter 2 negative for 5T at the intron 8 polyT locus. Login to comment
49 We cannot exclude the possibility that finding I148T in the heterozygous state in a male with obstructive azoospermia (Case 3) is merely a coincidence. Login to comment
51 Case 5 was a fertile male, compound heterozygous for I148T and ⌬F508, who had a child identified by newborn screening as heterozygous for ⌬F508. Login to comment
53 Case 6, a female for whom no clinical information is available, was compound heterozygous for D110H and I148T/ 3199del6. Login to comment
54 Her son was noted to be positive for I148T/3199del6, confirming the haplotype in this family (assuming that his father is not a carrier for I148T or 3199del6). Login to comment
55 Case 7 had a clinical diagnosis of CF and was positive for V520F, a CF mutation associated with pancreatic insufficiency, and I148T/3199del6. Login to comment
56 Two fetuses with I148T and echogenic bowel were identified, both before the availability of 3199del6 reflex testing for I148T carriers. Login to comment
60 Parental CF DNA testing identified one parent as a carrier for ⌬F508, and the other had an unusual heteroduplex pattern in exon 4, which was later identified as I148T (before the availability of 3199del6 reflex testing). Login to comment
63 DNA testing performed after delivery was positive for I148T, but negative for ⌬F508. Login to comment
66 Sex Race Indication Genotype Poly T status Clinical information 1 Female Asian Carrier screening I148Ta /I148Ta12 9T/9T Asymptomatic 2 Male Not provided Infertility I148Ta /⌬F508 Not determined CBAVD 3 Male Not provided Infertility I148Ta heterozygote Negative for 5T Obstructive azoospermia 4 Male Caucasian Infertility I148Ta /S1235R20 7T/9T None available 5 Male Caucasian Family history of CF mutation I148Ta /⌬F508 9T/9T Fertile male who underwent carrier screening after the identification of ⌬F508 in the heterozygous form in his child during newborn screening, child`s mother is negative for 25 mutation ACOG/ACMG CF panel 6 Female Armenian Family history of CF mutation D110H/I148T (3199del6 positive) Not determined Clinical information on this individual is not available, despite multiple attempts to obtain. Login to comment
67 DNA testing on her son revealed I148T/3199del6 7 Not provided Caucasian Affected with CF V520F/I148T (3199del6 positive) Not determined None available 8 Prenatal test Middle Eastern Fetal echogenic bowel I148Ta carrier Not determined Healthy male reported at age 2 years. Login to comment
68 A subsequent pregnancy of this couple was diagnosed with ⌬F508/I148T (before the availability of 3199del6 reflex testing) and was terminated. Login to comment
71 pregnancy, performed by CVS was positive for ⌬F508 and I148T (again, prior to the availability of 3199del6 reflex testing). Login to comment
72 The parents were counseled regarding the inability to prenatally predict the course of symptoms and severity of CF, though ⌬F508 and I148T were typically associated with pancreatic insufficient (PI) CF. Login to comment
75 In 2003, 3199del6 reflex testing was performed, and the I148T carrier parent was negative for 3199del6. Login to comment
78 One parent was positive for I148T. Login to comment
83 However, due to the presence of fetal echogenic bowel, one parent a carrier of I148T (classified as a CF mutation at that time), and the other parent a carrier of a variant of unknown clinical significance, prenatal CF testing was performed by amniocentesis. Login to comment
85 CF testing was positive for I148T and M82I. Login to comment
94 DISCUSSION I148T results from a T to C substitution at nucleotide 575 in exon 4 of the CFTR gene. Login to comment
95 This sequence change was initially reported to the CF Consortium in 1990.1 I148T is located in the first cytoplasmic loop of the first membrane spanning domain of CFTR14 and results in the substitution of a hydrophobic amino acid, isoleucine, for a polar amino acid, threonine. Login to comment
96 This region is conserved in humans, mouse, and bovine.15 Despite the fact that functional studies revealed normal processing, gating, and conductance of the CFTR,14 I148T was considered to be a severe CF mutation due to its presence in patients with classic CF and a second pathological CF mutation.4,5,7 3199del6, a deletion of ATAGTG from nucleotide 3199, is located in CFTR exon 17a and results in the deletion of isoleucine and valine at codons 1023 to 1024 within the second membrane-spanning domain. Login to comment
97 3199del6 was reported to the CF Consortium in 1998 in a pancreatic insufficient CF patient with I148T and 3199del6onthesamechromosomeand⌬F508ontheotherchro- mosome.1 Another study noted a patient with severe CF and 3199del6 and I148T, though it is not noted specifically whether thesemutationsarein-cisorin-trans.16 3199del6alsooccursinthe absence of I148T, as a patient with severe CF has been reported with 3199del6 (negative for I148T) and G542X.17 Recent data suggests that 3199del6 is the deleterious mutation among I148T/3199del6 complex alleles.9 It is puzzling that early reports of patients with classic CF and I148T/⌬F508 did not identify 3199del6, despite the fact that 2 reports described performing mutation analysis of the entire CFTR coding region and splice site junctions either by a screening method (DDGE) or DNA sequencing.5,7 However, a recent report identified 3199del6 in 24 French-Canadian CF patients originally described as compound heterozygous for I148T and a severe CF mutation.11 Though there is little doubt that 3199del6 is a deleterious CF mutation, the clinical significance of I148T in the absence of 3199del6 is unclear, as we have identified this genotype in 3 males with infertility, two of the obstructive type. Login to comment
98 In 2001, I148T was included in the ACMG/ACOG CF panel due to its high incidence in the general population.2,3 However, recent data revealed that I148T accounts for Ϸ0.06% of CF chromosomes,9 less than the 0.1% frequency for inclusion in the CF screening panel. Login to comment
99 Therefore, based on its low frequency among CF patients and questions concerning the phenotype associated with I148T, its inclusion in the CF screening panel should be reconsidered. Login to comment
102 In our collaborative study of 663 I148T carriers, 0.9% also had 3199del6. Excluding subjects tested because of a suspected or clinical diagnosis of CF or positive family history, the frequency of 3199del6 decreased to 0.6%. Login to comment
103 We identified 7 unrelated individuals with I148T and a second CF variant, 2 of whom also carried 3199del6. Login to comment
107 One of her sons was subsequently found positive for I148T/3199del6. Login to comment
108 D110H is a rare CF sequence variant, originally reported in a mildly affected CF patient,18 and recently in homozygous form in an infant with metabolic alkalosis.19 The remaining I148T compound heterozygotes were negative for 3199del6. Login to comment
109 Among these include a fertile male with the genotype I148T/⌬F508 who underwent carrier screening due to the presence of a ⌬F508 in his child identified by newborn screening and an asymptomatic female, homozygous for I148T, identified by routine CF prenatal carrier screening. Three males with infertility were I148T positive. Login to comment
110 One with obstructive azoospermia was heterozygous for I148T, but no other mutation (including 5T) was detected. Login to comment
111 A male with unspecified infertility was compound heterozygous for I148T and S1235R (7T/9T)20 and a male with CBAVD was compound heterozygous for I148T and ⌬F508 (polyT status not determined). Login to comment
112 Two fetuses with echogenic bowel and I148T were identified, both before the availability of 3199del6 reflex testing; however, both I148T carrier parents were subsequently shown to be negative for 3199del6. Login to comment
113 One fetus was compound heterozygous for I148T and M82I, a previously unreported variant of unknown clinical significance. Login to comment
116 One parent was identified as a ⌬F508 heterozygote and the other with an unknown sequence change in exon 4, later identified as I148T. Login to comment
117 Their child was positive for I148T only and at age 2 was reported as healthy. Login to comment
118 This couple underwent prenatal CF testing for a subsequent pregnancy, and the fetus was identified as positive for ⌬F508 and I148T. Login to comment
119 After genetic counseling, which included the inability to prenatally predict the course of symptoms and severity of CF, although ⌬F508 and I148T were typically associated with PI CF, the couple chose to terminate the pregnancy. Login to comment
120 The I148T carrier parent in this relationship is now known to be negative for 3199del6. Login to comment
121 Our data supports previous findings that a small number of individuals with I148T are positive for 3199del6. Login to comment
122 The identification of 3 males with infertility and I148T (2 of the obstructive type and 2 who are compound heterozygous for I148Tand another CF mutation) cannot exclude the possibility that I148T alone may be associated with atypical or mild CF. Login to comment
124 Unfortunately, we were unable to obtain detailed information for all patients in whom I148T was identified; therefore, we cannot make reliable predictions on the phenotype of I148T alone. Login to comment
125 Reflex testing for 3199del6 should be considered whenever I148T is identified. Login to comment
126 Such testing is of particular importance in any patient with features of CF or whenever one member of a couple carries a deleterious CF mutation and the other member carries I148T. Login to comment
127 Further studies are necessary to determine if I148T, in the absence of 3199del6, is associated with mild or atypical CF, including male infertility. Login to comment
128 In summary, these data suggest that I148T is not an appropriate mutation for CF screening in the general population. Login to comment
130 We recommend that I148T be deleted from the CF screening panel and that 3199del6 not be added. Login to comment

[hide] Use of MALDI-TOF mass spectrometry in a 51-mutatio... Genet Med. 2004 Sep-Oct;6(5):426-30. Buyse IM, McCarthy SE, Lurix P, Pace RP, Vo D, Bartlett GA, Schmitt ES, Ward PA, Oermann C, Eng CM, Roa BB
Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: evidence that 3199del6 is a disease-causing mutation.
Genet Med. 2004 Sep-Oct;6(5):426-30., [PMID:15371908]

Abstract [show]
PURPOSE: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. METHODS: This assay utilizes an integrated matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry system. RESULTS: CF testing was performed on over 5,000 individuals, including a 3-year-old Hispanic-American patient with a compound heterozygous G542X/3199del6 genotype. He is negative for I148T, or other mutations assessed by CFTR gene sequencing. CONCLUSION: These results demonstrate the successful implementation of MALDI-TOF mass spectrometry in CF clinical testing, and establish 3199del6 as a disease-causing CF mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Use of MALDI-TOF mass spectrometry in a 51-mutation test for cystic fibrosis: Evidence that 3199del6 is a disease-causing mutation Inge M. Buyse, PhD1 , Sarah E. McCarthy1 , Paul Lurix, PhD1 , Robert P. Pace, MS1 , David Vo1 , George A. Bartlett1 , Eric S. Schmitt, PhD, MS1 , Patricia A. Ward, MS1 , Christopher Oermann, MD2 , Christine M. Eng, MD1 , and Benjamin B. Roa, PhD1 Purpose: We developed a 51-mutation extended cystic fibrosis (CF) panel that incorporates the 25 previously recommended CFTR mutations, plus 26 additional mutations including 3199del6, which was associated with I148T. Login to comment
3 He is negative for I148T, or other mutations assessed by CFTR gene sequencing. Login to comment
7 The disease-causing CFTR gene lies on chromosome 7q31.2 and was cloned in 1989.1-3 The clinical spectrum ranges from a severe CF phenotype characterized by progressive lung disease, pancreatic insufficiency, male infertility, and elevated sweat chloride, to a milder presentation that includes congenital bilateral absence of the vas deferens (CBAVD) in males.4 Over 1300 CFTR mutations have been identified to date, wherein certain mutations are correlated with a mild or severe clinical phenotype.5 CF carrier screening for couples of reproductive age is recommended in the U.S. using a core panel of 25 common CF mutations.6 Although laboratories vary in the number of mutations and methodologies used for CF testing, many labs offer a CF testing panel that is applied to both carrier screening and diagnostic cases. One controversial component of the recommended panel is I148T, which was initially classified as a severe CF mutation. Login to comment
8 However, in vitro studies indicated that the major CFTR functions are retained by the I148T protein.7 Population screening studies revealed that the frequency of I148T is approximately 100-fold greater in asymptomatic carriers versus CF patients, which is more consistent with a benign variant than a disease-causing mutation.8,9 An in-frame deletion in exon 17a, 3199del6, was previously identified in association with I148T; moreover, I148T was found to be associated with a severe CF phenotype only when present in a complex haplotype of I148T/3199del6/9T, paired with a severe CF mutation on the opposite chromosome.4,8 The clinical significance of the 3199del6/I148 haplotype is unclear from the limited data available, because the few laboratories that test for 3199del6 mostly do reflex testing limited to patients who are positive for I148T. Login to comment
12 Moreover, our testing strategy evaluates each patient`s 3199del6 status independently of I148T, which is useful for refining genotype-phenotype correlations. Login to comment
18 An additional 11 patients who were previously identified as I148T carriers by allele-specific oligonucleotide (ASO) anal- From the 1 Medical Genetics Laboratories, Department of Molecular and Human Genetics, and the 2 Department of Pediatrics, Baylor College of Medicine, Houston, Texas. Login to comment
39 Statistical analysis The observed CF carrier frequency in our screening population, and the frequency of I148T in particular, were statistically compared to previously reported CF and I148T carrier frequencies8 using the Fisher exact test, with a two-sided P-value reported. Login to comment
45 positives (Freq) I148T 3199del6 4839 Carrier screening 173 (3.5% Ϸ1/28) 16 1 155 Diagnostic 30 (19.4% Ϸ1/5) 0 1 34 Parental/FEBa 3 (8.8%) 1 0 10 Prenatal study 5 (50%)b 0 0 53 Family history 20 (37.7%) 0 0 277 Not specified 10 (3.6%) 0 0 a Fetal echogenic bowel b Either heterozygous or homozygous positive for parental mutations. Login to comment
46 Table 2 Description of 28 identified I148T heterozygous individualsa No. Login to comment
47 Genotype Indication EthnicityI148T 3199del6 Others 1 ϩ - - Diagnostic Not specified 1 ϩ - ⌬F508 Parental FEBb Caucasian 18 ϩ - - Carrier screen Caucasian 1 ϩ - - Carrier screen Asian Indian 4 ϩ - - Carrier screen Not specified 2 ϩ - - Not specified Not specified 1 ϩ ϩ - Carrier screen Caucasian a Includes 17 I148T carriers found in a consecutive dataset by MALDI-TOF Mass Spectrometry (also contributed to ref 14), and 11 I148T carriers previously identified by ASO analysis. Login to comment
55 We observed a disproportionately high frequency of the I148T allele among heterozygous carriers with no family history (16/173 CF carriers), compared to patients referred with a definite or possible diagnosis of CF (0/155 CF patients). Login to comment
56 Our findings are consistent with significantly elevated I148T allele frequencies in asymptomatic carriers versus CF patients by previous reports.8,9 In addition, two patients out of 5368 consecutive cases were found to be positive for 3199del6 (Table 1), and details on these two cases are provided in the following sections. Login to comment
57 Description of I148T-positive individuals A composite group of 28 individuals who tested positive for the I148T allele is listed in Table 2. Login to comment
58 This group included 17 individuals in our consecutive dataset who were simultaneously tested for I148T and 3199del6, plus 11 additional I148T carriers who were previously identified by ASO and subsequently tested by MALDI-TOF. Login to comment
59 Population screening was the indication for testing among the majority of the I148T carriers (24 out of 28); among these, 23 I148T carriers tested negative for 3199del6. Login to comment
60 One individual of European Caucasian descent referred to our lab for carrier screening was genotyped positive for both I148T and 3199del6. Login to comment
61 However, the configuration of the I148T and 3199del6 alleles could not be determined on this asymptomatic individual because parental samples were not submitted for analysis. Login to comment
62 Of the four remaining I148T carriers who were referred for reasons other than carrier screening, one was a male patient with obstructive azoospermia who was heterozygous positive for I148T and negative for the 3199del6 and 5T alleles. Login to comment
64 She tested heterozygous positive for the I148T and ⌬F508 mutations, and negative for the 3199del6 and the 5T alleles (9T/9T). Login to comment
66 These findings are consistent with reports of apparently healthy individuals with a ⌬F508-positive, I148T-positive, and 3199del6-negative genotype.8,9 This individual`s spouse was also referred for testing and found to be negative for 51 CF mutations and the 5T allele (7T/7T). Login to comment
77 This assay also demonstrated heterozygosity for the G542X mutation, and reflex testing for the 5T variant at CFTR intron 8 showed a genotype of 7T/9T in this patient (data not Table 3 Description of the 16 multiplex assays designed to analyze 51 CFTR mutations Multiplex Mutations Exon 1 1078delT, G314E, R352Q, G330X 7 2 R347H, R347P, R334W, 1717-1A 7, 11 3 R553X, S549N, R1162X 11, 19 4 A559T, R560T, G551D 11 5 G542X, S549R, 621ϩ1T, Y122X 4, 11 6 W1282X, 3876delA, 3905insT, D1152H 18, 20 7 3849ϩ4G, 3659delC, 1898ϩ1A 12, 19 8 405ϩ1A, 405ϩ3C, 3120A, 3120ϩ1A 3, 16 9 394delTT, E60X, G85E 3 10 A455E, ⌬F508a 9, 10 11 G480C, Q493X, V520F 10 12 711ϩ1T, G178R, 3199del6 5, 17a 13 2143delT, 2184delA, K710X, F316L 7, 13 14 I148T, R117H, R117C 4 15 N1303K, 2789ϩ5A, 3849ϩ10kbT 14b, intron19, 21 16 ⌬I507a 10 17 5Tb intron 8 a F508C and I507V, I506V, I506M variants are tested for concurrently with the ⌬F508 and ⌬I507 assays respectively. Login to comment
103 Among unaffected individuals who tested positive on carrier screening, the I148T allele was found in approximately 9.2% of carriers (16/173), compared to Ϸ6.4% from the previously cited study8 (P ϭ 0.21). Login to comment
104 In contrast to carrier screening results, none of the 155 diagnostic cases tested by MALDI-TOF mass spectrometry were positive for I148T. Login to comment
105 This finding is consistent with the significantly elevated I148T frequency in carrier screens versus diagnostic cases,8,9 and the relatively small number of diagnostic tests in our study. Login to comment
106 This observed difference in frequency suggests that I148T is a benign variant, and that 3199del6 could instead represent the actual mutation. Login to comment
107 Up until now, limited data had been available for 3199del6 because systematic analysis was largely based on reflex testing of I148T-positive samples. Login to comment
109 In contrast, our assay tests for 3199del6 simultaneously with I148T in an extended panel for CF. Login to comment
113 The identification of a CF patient with a compound heterozygous 3199del6/G542X genotype represents the first report of 3199del6 that is not associated with I148T on a CF chromosome. Login to comment
114 This indicates that 3199del6 is a disease-causing mutation that can occur on a haplotype without I148T. Login to comment
116 In addition to our Hispanic CF patient, we identified an asymptomatic Caucasian individual who tested positive on carrier screening for 3199del6 and I148T (phase unknown). Login to comment
119 Our results provide additional support to the interpretation of I148T as a benign variant, although its interaction with the 3199del6 mutation is not fully delineated. Login to comment
120 These findings provide additional support for removing I148T from the ACMG recommended carrier screening panel for CF. Login to comment

[hide] Cystic fibrosis carrier screening: validation of a... Genet Med. 2004 Sep-Oct;6(5):431-8. Edelmann L, Hashmi G, Song Y, Han Y, Kornreich R, Desnick RJ
Cystic fibrosis carrier screening: validation of a novel method using BeadChip technology.
Genet Med. 2004 Sep-Oct;6(5):431-8., [PMID:15371909]

Abstract [show]
PURPOSE: To validate a novel BeadChip assay system for cystic fibrosis (CF) mutation testing using the panel of 25 ACMG recommended mutations and D1152H. METHODS: DNA from 519 individuals originally tested for CF mutation status by allele specific oligonucleotide hybridization (ASOH) were blindly analyzed by the BeadChip assay and the results were compared. The elongation mediated multiplexed analysis of polymorphisms (eMAP) protocol, which combines multiplex amplification of genomic DNA and multiplex detection of mutations on color-coded bead arrays, was used to analyze 26 CF mutations in two separate groups. RESULTS: The system accurately distinguished the 26 CF genotypes and had 100% concordance with the ASOH technique with an assay failure rate of 1.7%. Benign variants of exon 10 codons 506, 507, and 508 did not interfere with mutation identification and reflex testing for the 5/7/9T IVS8 polymorphism was performed on a separate array. CONCLUSIONS: The BeadChip assay system provided accurate and rapid identification of the ACMG recommended CF mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Mutation controls included DNA from previously identified positive patient samples (I148T, D1152H, W1282X, R117H, G85E, A455E, delF508, N1303K) and DNA from NIGMS Human Genetic Cell Repositories (Coriell Cell Repositories) (delF508, delI507, G542X, R560T, 3849ϩ10kbCϾT, N1303K, G85E; G551D, R553X, 621ϩ1GϾT, 1717-1GϾA, A455E, R334W, R347P, R1162X, 3659delC; 711ϩ1GϾT, 2789ϩ5GϾA, 3120ϩ1GϾA). Login to comment
46 Mutant ASOs were end-labeled with ␥-32 P-ATP and pooled into three subgroups (IA-IC) for Group I and four subgroups (IIA-IID) for Group II mutations with the following breakdown of mutations: IA: delF508, delI507, W1282X, R117H; IB: G542X, R560T, 3849ϩ10kbCϾT, N1303K, G85E; IC: G551D, R553X, 621ϩ1GϾT, 1717-1GϾA, I148T; IIA: A455E, R334W, D1152H; IIB: R347P, 1078delT, R1162X, 3659delC; IIC: 711ϩ1GϾT, 1898ϩ1GϾA, 2789ϩ5GϾA, 3120ϩ1GϾA; IID: 2184delA. Login to comment
160 I II III IV V VI VII VIII Totals Samples tested 87 57 69 72 66 35 72 61 519 Controls testedk 0h 17h 20 29 22 16 20 21 145 PCR Failuresi 4 4 2 1 1 2 1 3 18 (3.5%) Assay Failuresi 2 0 1 0 2 2 1 1 9 (1.7%) Positives 4a 3b 0 3c 4d 2e 2f 1g 19 (3.7%) a W1282X, delF508, D1152H, W1282X b delF508, delF508, D1152H c delF508, R117H, R117H d G542X, delF508, D1152H, N1303K (does not include proficiency samplesj ) e W1282X, delF508 f I148T, 3849ϩ10kbCϾT g I148T h Runs I and II were amplified with the same master mix and used the same control samples. Login to comment

[hide] A large-scale study of the random variability of a... Eur J Hum Genet. 2005 Feb;13(2):184-92. Modiano G, Bombieri C, Ciminelli BM, Belpinati F, Giorgi S, Georges M, Scotet V, Pompei F, Ciccacci C, Guittard C, Audrezet MP, Begnini A, Toepfer M, Macek M, Ferec C, Claustres M, Pignatti PF
A large-scale study of the random variability of a coding sequence: a study on the CFTR gene.
Eur J Hum Genet. 2005 Feb;13(2):184-92., [PMID:15536480]

Abstract [show]
Coding single nucleotide substitutions (cSNSs) have been studied on hundreds of genes using small samples (n(g) approximately 100-150 genes). In the present investigation, a large random European population sample (average n(g) approximately 1500) was studied for a single gene, the CFTR (Cystic Fibrosis Transmembrane conductance Regulator). The nonsynonymous (NS) substitutions exhibited, in accordance with previous reports, a mean probability of being polymorphic (q > 0.005), much lower than that of the synonymous (S) substitutions, but they showed a similar rate of subpolymorphic (q < 0.005) variability. This indicates that, in autosomal genes that may have harmful recessive alleles (nonduplicated genes with important functions), genetic drift overwhelms selection in the subpolymorphic range of variability, making disadvantageous alleles behave as neutral. These results imply that the majority of the subpolymorphic nonsynonymous alleles of these genes are selectively negative or even pathogenic.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 In the Tajima`s test,19 the null hypothesis of neutrality is rejected if a statistically significant difference between p Common and rare nonsynonymous and synonymous cSNSs G Modiano et al European Journal of Human Genetics Table 1 List of the 61 cSNSsa encountered in the present survey The random samples of genes (and the technique utilized) cSNS variants found NE Italy (DGGE) Central Italy (DGGE) Southern France (DGGE) Northern France (DHPLC) Spain (SSCA) Czechia (DGGE) Hb Â 104 Exon Exon Length (bp) Ref. no. SNS SASc 1st 100d 2nd 500 1st 100d 2nde 1st 100d 2nd 500 1st 100 2nde 82d 72 Abs. Freq. Total sample size q Â 104 se Â 104 NSf Sf 1g 53 0 0 0 0 0/452 0 924 2 111 1 223C4T R31C 1 1 1/500 1 1 0 0/450 0 5 (11) 1 932 (2 432) 45.23 13.61 90 2 224G4T R31L 0 0 0/500 0 0 0 1/450 0 1 1 932 5.17 5.17 10 3 257C4T S42F 0 0 1/500 0 0 0 0/450 0 1 1 932 5.17 5.17 10 3 109 4 334A4G K68E 1 0 0 0/498 0 0 0 0/452 0 0 1 2 504 3.99 3.99 8 5 352C4T R74W 0 0 0 0/498 0 0 0 1/452 0 0 1 2 504 3.99 3.99 8 6 356G4A R75Q 1 7 1 7/498 2 9 2 9/452 0 2 40 (40) 2 504 (2 544) 157.23 24.66 310 7 386G4A G85E 0 0 1 1/498 0 0 0 0/452 0 0 2 2 504 7.99 5.65 16 4 216 8 482G4A R117H 0 0 0 0/292 0 2 0 1/456 0 0 3 2 302 13.03 7.52 26 9 528T4G I132M 0 0 0 0/292 0 0 0 1/456 0 0 1 2 302 4.34 4.34 8 10 575T4C I148T 1 2 0 1/292 0 0 0 1/456 0 1 6 2 302 26.06 10.63 52 5 90 11 640C4T R170C 0 0 0 0/6 0 0 1/448 0 1 1 436 6.96 6.96 14 12 641G4A R170H 1 1 0 0/6 0 0 2/448 0 4 (4) 1 436 (1 930) 20.73 10.35 41 6a 164 0 0 0/6 0 0 0/432 0 0 992 6b 126 0 0 0/6 0 0 0/454 0 942 7 247 0 0 0/6 0 0 0/796 0 1 284 8 93 13 1281G4A L383 0 0 0 0/6 0 0 1/456 0 0 1 1 516 6.60 6.60 13 9 183 14 1402G4A G424S 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 15 1459G4T D443Y 0 0 0/6 0 0 1/454 0 1 940 10.64 10.64 21 10 192 16 1540A4G M470Vh 42 197 30 37/96 39 199 (i) (i) 27 571(736) 1 484 (1 912) 3849.37 111.28 4 735 17 1598C4A S489X 0 0 0 0/96 0 0 0 1/796 0 1 2 374 4.21 4.21 8 18 1648A4G I506V 1 0 0 0/96 0 0 0 0/796 0 1 2 374 4.21 4.21 8 19 1655T4G F508C 0 1 0 0/96 0 0 0 1/796 0 2 2 038 8.42 5.96 17 20 1716G4A Q528 2 16 1 0/96 0 19 i I 5 43 (58) 1 478 (2 024) 286.56 37.08 557 11 95 21 1756G4T G542X 0 2 0 0/134 0 0 0/796 0 0 2 1 984 10.08 7.12 20 22 1764T4G G544 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 23 1784G4A G551D 0 0 0 0/134 0 0 1/796 0 0 1 1 984 5.04 5.04 10 12 87 24 1816G4A V562I 0 0 0 0 1 0 0/450 0 0 1 (1) 2 004 (2 504) 3.99 3.99 8 25 1816G4C V562L 0 0 0 1 0 0 1/450 0 0 2 (3) 2 004 (2 504) 11.98 6.91 24 26 1859G4C G576A 1 2 0 1 11 0 8/450 0 0 23 (27) 2 004 (2 538) 106.38 20.36 213 13 724j 449 27 1997G4A G622D 0 0 0/80 0/96 1 0 0 0/444 0 1 2 002 5.00 5.00 10 28 2082C4T F650 1 0 0/80 0/20 0 0 0 0/444 0 1 (1) 1 926 (2 412) 4.15 4.15 8 29 2134C4T R668C 1 2 0/80 0/96 1 11 0 12/444 0 27(32) 2 002 (2 558) 125.10 21.98 247 275 30 2377C4T L748 0 0 0/6 0 1 1 388 25.77 25.77 52 14a 129 31 2670G4A W846X 0 0 0/6 0 1 0/452 0/80 0 1 1 010 9.90 9.90 20 32 2694T4G T854 33 23 0/6 33 38 149/452 14/80 11 301 1 010 2980.20 143.92 4 184 33 2695G4A V855I 0 0 0/6 0 0 1/452 0/80 0 1 1 010 9.90 9.90 20 14b 38 0 0 0 0/520 0 0 0 0/446 0 2 448 15 251 34 2816G4C S895T 0 0 0/6 0 0 2/436 0 0 2 996 20.08 14.18 40 35 2831A4C N900T 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 36 2988G4C M952I 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 37 3030G4A T966 (2)k (1)k 0 6/436 0 6 (25)k 618 (1814)k 137.82 27.37 272 38 3032T4C L967S 0 0 0/6 0 0 1/436 0 0 1 996 10.04 10.04 20 16 80 0 0 0/498 0 0 0/450 0 0 1 502 17a 151 39 3123G4C L997F 0 2 2 1/494 0 7 1 4/454 0 0 17 2 502 67.95 16.42 135 40 3157G4A A1009T 0 2 0 0/494 0 0 0 0/454 0 0 2 2 502 7.99 5.65 16 41 3212T4C I1027T 1 0 0 0/494 0 0 0 0/454 0 0 1 2 502 4.00 4.00 8 17b 228 42 3286T4G F1052V 1 1 0 1/194 0 0 0 0/452 0 0 3 (3) 2 200 (2 240) 13.39 7.73 27 43 3337G4A G1069R 0 1 0 0/194 0 0 0 0/452 0 0 1 2 200 4.55 4.55 9 CommonandrarenonsynonymousandsynonymouscSNSs GModianoetal 186 EuropeanJournalofHumanGenetics 44 3345G4T Q1071H 0 0 0 0/194 0 1 0 0/452 0 0 1 2 200 4.55 4.55 9 45 3417A4T T1995 1 3 0 0/194 1 1 0 0/452 0 0 6 (8) 2 200 (2 506) 31.92 11.27 64 46 3419T4G L1096R 0 0 0 0/194 1 0 0 0/452 0 0 1 2 200 4.55 4.55 9 47 3477C4A T1115 0 0 0 0/194 0 0 0 1/452 0 0 1 2 200 4.55 4.55 9 18 101 48 3523A4G I1131V 0 0 1 0/10 0 0 0/448 0 0 1 (2) 1 512 (1 908) 10.48 7.07 21 49 3586G4C D1152H 0 0 0 0/10 0 0 1/448 0 0 1 1 512 6.61 6.61 13 19 249 50 3617G4T R1162L 0 0 1 1/494 0 0/260 0 0/454 0 0 2 2 262 8.84 6.25 18 51 3690A4G Q1186 0 0 0 0/494 0 0/260 0 0/454 1 0 1 2 262 4.42 4.42 9 52 3813A4G L1227 0 1 0 0/494 0 0/260 0 0/454 0 0 1 2 262 4.42 4.42 9 53 3837T4G S1235R 1 1 0 1/494 0 4/260 0 7/454 0 1 15 (15) 2 262 (2 310) 69.94 16.71 140 20 156 54 4002A4G P1290 2 3 0/6 3 5 18/454 3/80 2 36 1 012 357.73 58.22 690 21 90 55 4009G4A V1293I 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 56 4029A4G T1299 1 0 0/6 0 1/300 0 1/456 0 0 3 (8) 1 316 (2 330) 34.33 12.12 69 57 4041C4G N1303K 1 0 0/6 0 0/300 0 0/456 0 0 1 1 316 7.60 7.60 15 58 4085T4C V1318A 0 0 0/6 0 0/300 0 1/456 0 0 1 1 316 7.60 7.60 15 22 173 0 0 0/18 0 0 0/450 0 0 1 022 23 106 0 0 0 0/6 0 0 0/448 0 1 436 24l 198+3 59 4404C4T Y1424 1 0 0/6 1 2 5/420 0 2 11 (32) 980 (2 516) 127.19 22.34 251 60m 4521G4A Q1463 (21) (16) (3/32) (14/80) (30) (94/420) 15/76 (17) 15 (227) 76 (1052) 2142.86 131.07 3 367 61 4563T4C D1477 0 0 0/6 0 1 0/420 0 0 1 980 10.20 10.20 20 Totals 6 525 9 584 16 109 The bracketed figures include also the RFLP analysis data (see Materials and methods); the NE Italy, Central Italy, Southern and Northern France are each subdivided into two samples where the 1st is made up of 100 genes. Login to comment

[hide] Late diagnosis defines a unique population of long... Am J Respir Crit Care Med. 2005 Mar 15;171(6):621-6. Epub 2004 Dec 10. Rodman DM, Polis JM, Heltshe SL, Sontag MK, Chacon C, Rodman RV, Brayshaw SJ, Huitt GA, Iseman MD, Saavedra MT, Taussig LM, Wagener JS, Accurso FJ, Nick JA
Late diagnosis defines a unique population of long-term survivors of cystic fibrosis.
Am J Respir Crit Care Med. 2005 Mar 15;171(6):621-6. Epub 2004 Dec 10., 2005-03-15 [PMID:15591474]

Abstract [show]
Although the median survival for patients with cystic fibrosis (CF) is 32.9 years, a small group of patients live much longer. We analyzed the genotype and phenotype of CF patients 40 years and older seen between 1992 and 2004 at the National Jewish Medical and Research Center (n = 55). These patients were divided into two groups according to age at diagnosis: an early diagnosis (ED) group, median age at diagnosis 2.0 years (range 0.1-15 years, n = 28), and a late diagnosis (LD) group, median age of diagnosis 48.8 years (range 24-72.8 years, n = 27). Consistent with the hypothesis that the CFTR genotype affects the age at diagnosis, CFTR DeltaF508 homozygous individuals were more common in the ED group. Although patients in the ED group were predominantly male, the majority of LD patients were female. Patients with CF diagnosed late had a significantly lower prevalence of pancreatic insufficiency and CF-related diabetes, and better lung function. Fewer patients in the LD groups were infected with Pseudomonas aeruginosa, whereas a greater percentage had cultures positive for nontuberculous mycobacteria. This is the largest cohort of older patients with CF described to date, and our findings indicate that patients diagnosed as adults differ distinctly from survivors of long-term CF diagnosed as children.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 GENOTYPE DISTRIBUTION Early Diagnosis Late Diagnosis ⌬F508/⌬F508 10 1 ⌬F508/⌬I507 1 ⌬F508/G551D 1 ⌬F508/M1101K 1 ⌬F508/P67L/11027T 1 ⌬F508/3120G-A 1 ⌬F508/2789ϩ5G-A 1 2 ⌬F508/W1282X 1 ⌬F508/621ϩ1G-T 1 ⌬F508/R347P 1 ⌬F508/3849ϩ10kbC-T 1 1 ⌬F508/A455E 2 ⌬F508/R347H 2 ⌬F508/D1152H 1 ⌬508/I148T 1 ⌬F508/R117H 1 ⌬F508/Y109N 1 ⌬F508/IVS8-5T 1 ⌬F508/unknown 3 5 S1251N/D1152H 1 G542X/R117C 1 R117H/G551D 1 W1282X/D1152H 1 Unknown 4 4 Values represent number of individuals in each diagnostic group with each genotype. Login to comment

[hide] Comprehensive cystic fibrosis mutation epidemiolog... Ann Hum Genet. 2005 Jan;69(Pt 1):15-24. Castaldo G, Polizzi A, Tomaiuolo R, Cazeneuve C, Girodon E, Santostasi T, Salvatore D, Raia V, Rigillo N, Goossens M, Salvatore F
Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population.
Ann Hum Genet. 2005 Jan;69(Pt 1):15-24., [PMID:15638824]

Abstract [show]
We screened the whole coding region of the cystic fibrosis transmembrane regulator (CFTR) gene in 371 unrelated cystic fibrosis (CF) patients from three regions of southern Italy. Forty-three mutations detected 91.5% of CF mutated chromosomes by denaturing gradient gel electrophoresis analysis, and three intragenic CFTR polymorphisms predicted a myriad of rare mutations in uncharacterized CF chromosomes. Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711 + 1G > T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Several mutations frequently found in northern Italy (e.g., R1162X, 711 + 5G > T) and northern Europe (e.g., G551D, I507del and 621 + 1G > T) are absent from the studied population. The I148T-3195del6 complex allele was present in two CF chromosomes, whereas I148T was present in both alleles (as a single mutation) in another CF patient and in five CF carriers; this could result from crossover events. The haplotype analysis of three intragenic polymorphisms (IVS8CA, IVS17bTA and IVS17bCA) compared with data from other studies revealed that several mutations (3849 + 10kbC > T, 1717-1G > A, E585X, 3272-26G > A, L558S, 2184insA and R347P) originated from multiple events, whereas others (R1158X and S549R) could be associated with one or more intragenic recombinant events. Given the large population migration from southern Italy, knowledge of the CF molecular epidemiology in this area is an important contribution to diagnosis, counselling and interlaboratory quality control for molecular laboratories worldwide.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 The I148T-3195del6 complex allele was present in two CF chromosomes, whereas I148T was present in both alleles (as a single mutation) in another CF patient and in five CF carriers; this could result from crossover events. Login to comment
33 The 13 mutations in this panel are: F508del, N1303K, G542X, W1282X, 2183AA>G, 1717-1G>A, R553X, I148T, R1158X, 711+1G>T, 4016insT, L1065P and G1244E. Login to comment
62 A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n. Login to comment
71 Finally, two CF patients carried the I148T and 3195del6 mutations in cis, giving rise to a "complex allele." Login to comment
72 Another CF patient from the study, and five CF carriers (data not shown), carried I148T without 3195del6 in cis. Login to comment
73 Different haplotypes are linked to I148T alone and to the I148T "complex allele" (see Table 2, group c). Login to comment
103 Two CF patients from the present study carried the I148T mutation in cis with the 3195del6 mutation; another CF patient, five patients with CBAVD, and five unrelated CF carriers from our population (data not shown), carried I148T not associated in cis with 3195del6. Login to comment
104 The chromosomes bearing I148T alone are linked to a different haplotype (of two or three loci) than those linked to the I148T-3195del6 complex allele; a crossover event may be responsible for this. Login to comment
106 It is not clear whether I148T alone is a disease-causing mutation, even though it was described in a CF patient in whom no other CFTR mutation was detected in the whole coding region (Bozon et al. 1994). Login to comment
107 Furthermore, it has been demonstrated that I148T alone alters the transport of HCO3 - across the apical membrane of epithelial cells (Ahn et al. 2001). Login to comment
109 Genetists Table 4 Mutations linked to different haplotypes due to recombinant or recurrent events, characteryzed at the level of three CFTR intragenic loci (IVS8CA, IVS17bTA, IVS17bCA) Present study Other studies Cases Haplotype Cases Haplotype (n) (n. of repeats) (n) (n. of repeats) references* I148T and 3195del6 2/2 23-7-17 3 23-7-17 2,3 (in cis) I148T 1/1 23-32-13 S549R (A>C) 1/1 23-33-13 1 16-33-13 2 1717-1G>A 13/13 16-7-17 23 16-7-17 1,2,3 2 16-30-13 1 1 16-32-13 1 R1158X 6/6 16-7-17 1/2 16-7-17 2 1/2 6-45-13 2 1/1 16-31-13 3 1/1 16-45-13 3 3849 +10kbC>T 5/5 23-31-13 2 23-31-13 1 1 16-14-31 4 1 16-7-17 1 3 16-46-13 2 1 16-17-19 2 1 17-31-13 2 E585X 2/2 16-7-17 1 16-32-13 2 1 17-31-13 2 1 16-7-16 see 2 3272-26G>A 1/1 15-7-17 1 16-32-13 1 4 16-7-17 5 L558S 1/1 16-32-13 1 16-32-13 1 1 15-7-17 1 2184 ins A 1/1 16-29-13 1 16-45-13 1 1 16-7-17 1 1 16-24-13 3 * References 1: Morral et al. 1996b. Login to comment

[hide] Frequency and phenotypic consequences of the 3199d... Genet Med. 2005 Mar;7(3):210-1. Ruchon AF, Ryan SR, Fetni R, Rozen R, Scott P
Frequency and phenotypic consequences of the 3199del6 CFTR mutation in French Canadians.
Genet Med. 2005 Mar;7(3):210-1., [PMID:15775760]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Frequency and phenotypic consequences of the 3199del6 CFTR mutation in French Canadians To the Editor: The observation of healthy individuals bearing a severe cystic fibrosis (CF) mutation and I148T in trans but not carrying the 3199del6 mutation has suggested that I148T is not a CF-causing mutation.1,2 Moreover, 3199del6-positive CF patients lacking I148T, compound heterozygous with another CF mutation, indicate that 3199del6 is the disease-causing mutation in the complex allele I148T-3199del6.2,3 Here, we report on the 3199del6 testing results in our cohort of I148T-positive individuals, the frequency of this deletion in the French Canadian population, as well as the phenotype of our 3199del6-positive patients. Login to comment
54 The presence of the 3199del6 mutation was determined in a cohort of 32 I148T-positive samples: 27 unrelated CF French Canadian patients, referred for corroboration of CF diagnosis, and 5 carriers (3 French Canadians, 1 Lebanese, and 1 adopted of unknown origin). Login to comment
57 The phase of I148T and 3199del6 was verified in 17 patients and, in all (100%), both variants occurred in cis (I148T- 3199del6complexallele).Ofthepatientsreferredforcarrierstatus determination, the three French Canadians also carried the deletion, whereas the two others, one Lebanese and one of unknown origin, did not. Login to comment
60 This I148T-3199del6 frequency is in contrast to the previously reported I148T frequency of 9.1% in French Canadians.5 Explanations for this frequency discrepancy could be as follows: a sample bias, because we receive patients from all Quebec regions and the previousreportanalyzedonlyFrenchCanadiansfromtheQuebec Cityarea;ormorelikely,thatthe2.2%reflectsthefrequencyofthe real CF-causing mutation, 3199del6, in French Canadians, which inthispopulationcomplexesinciswithI148T,whereas9.1%corresponds to the I148T polymorphism frequency. Login to comment
66 In only one patient (F508del/I148T-3199del6) was a pancreatic sufficiency phenotype observed. Login to comment
69 Altogether, our observations further demonstrate that the 3199del6 mutation is associated with a classical pancreatic insufficiency CF phenotype, consistent with the suggestion of Buyse et al.7 Previous studies have identified 3199del6 in 1.8%, 0.9%, and 0.6% of I148T heterozygous carriers and determined the frequency of 3199del6 in the general North American population to beϽ0.1%,belowthefrequencythresholdcriteriaforinclusionin the ACMG CF mutation screening panel.1,8,9 In this study, we reporta2.2%frequencyforthe3199del6mutationamongFrench Canadian CF chromosomes. Login to comment
70 As mentioned, only two I148T carriers (one Lebanese and one of unknown origin) tested negative for the 3199del6 mutation in our cohort of 32 unrelated I148T individuals. Login to comment
71 In other words, in our samples, all I148T French Ca- nadianallelesalsohadthe3199del6mutation,probablyreflecting a founder effect, and justifying its inclusion in routine CF testing/ screening in this ethnic group. Login to comment
73 The 2004 ACMG mutation panel revision recommends exclusion of I148T from the CF mutation panel.10 However, in the French Canadian population, I148T testing must be replaced by 3199del6 testing, which can be done using a simple PCR-based heteroduplex assay. Login to comment
74 If I148T testing is continued, then the data presented here strongly support 3199del6 testing for every I148T-positive result. Login to comment
76 Rohlfs EM, Zhou Z, Sugarman EA, Heim RA, Pace RG, Knowles MR et al. The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis. Login to comment
94 Frequency of the cystic fibrosis 3199del6 mutation in individuals heterozygous for I148T. Login to comment
96 Monaghan KG, Highsmith WE, Amos J, Pratt VM, Roa B, Friez M et al. Genotype-phenotype correlation and frequency of the 3199del6 cystic fibrosis mutation among I148T carriers: Results from a collaborative study. Login to comment
104 To diagnose most of the Table 1 Genotype-phenotype correlation of CF patients bearing the complex allele I148T-3199del6 Genotype No. of patients Age (y) Pancreatic status Sweat test Age at diagnosis Ethnicity F508del/I148T-3199del6 18 3 to 31 PI 88 to 154 Birth to 12y Fr Cdn I507del/I148T-3199del6 1 4 PI 106 2 months Fr Cdn 621ϩ1GϾT/I148T-3199del6 1 PI 105 Fr Cdn N1303K/I148T-3199del6 1 35 PI 18 months Fr Cdn F508del/I148T-3199del6 1 24 PS 142 4 months Fr Cdn A455E/I148T-3199del6 2 23/55 PS 130 16/20 y Fr Cdn I148T-3199del6/Unk. Mut. 1 5 PI 108 3 months Fr Cdn I148T-3199del6/Unk. Mut. 1 Fr Cdn F508del/I148T-3199del6 1 Fr Cdn PI, pancreatic insufficiency; PS, pancreatic sufficiency; Fr Cdn, French Canadian. Login to comment
81 Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations? Login to comment

[hide] Cystic fibrosis prenatal screening in genetic coun... J Genet Couns. 2005 Feb;14(1):1-15. Langfelder-Schwind E, Kloza E, Sugarman E, Pettersen B, Brown T, Jensen K, Marcus S, Redman J
Cystic fibrosis prenatal screening in genetic counseling practice: recommendations of the National Society of Genetic Counselors.
J Genet Couns. 2005 Feb;14(1):1-15., [PMID:15789152]

Abstract [show]
For over a decade, prenatal screening for cystic fibrosis (CF) has been considered a model for the integration of genetic testing into routine medical practice. Data from pilot studies and public policy discourse have led to recommendations by some professional organizations that CF screening should be offered or made available to pregnant women and their partners, and to couples planning a pregnancy. It is crucial that genetic counselors gain thorough understanding of the complexities of CF and the implications of positive test results, so that they may serve as a reliable, educated referral base and resource for health care providers and their patients. While not all pregnant women will be referred for genetic counseling prior to CF carrier testing, genetic counselors often will be asked to counsel clients after they have a positive test result, or who are found to be at increased risk. Genetic counselors can play an important role in providing accurate and current information as well as support for patients' informed decisions. These recommendations were created by a multicenter working group of genetic counselors with expertise in CF and are based on personal clinical experience, review of pertinent English language medical articles, and reports of expert committees. The recommendations should not be construed as dictating an exclusive course of management, nor does the use of such recommendations guarantee a particular outcome. These recommendations do not displace a health care provider's professional judgment based on the clinical circumstances of a particular client.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
133 In addition, mutations such as R117H and I148T have been found at unexpectedly high frequencies in healthy populations, suggesting that they are not completely penetrant (Rohlfs et al., 2002; Strom et al., 2002; Witt et al., 1996). Login to comment
169 Complex CFTR genotypes-where more than one CFTR mutation or variant is present in the same copy of the gene (in cis) and the presence or absence of that variant affects phenotype- characterize two common CFTR mutations, I148T and R117H. Login to comment
170 With an allele frequency of 0.1% among affected CF patients, I148T is included in the ACMG/ACOG recommended panel (Grody et al., 2001). Login to comment
171 After testing for I148T in the general population, it has become apparent that its frequency among apparently healthy individuals is 60-100 times that expected based on the CF affected population (Buller et al., 2004). Login to comment
172 In addition, several asymptomatic individuals (including fertile males) were identified as compound heterozygotes for I148T and other CF mutations (Rohlfs et al., 2002; Strom et al., 2002). Login to comment
173 These observations led to the identification of the 3199del6 allele whose presence in cis with the I148T allele influences phenotype (Rohlfs et al., 2002). Login to comment
174 Among 8 apparently healthy adults who were compound heterozygotes or homozygotes for I148T, all were negative for 3199del6. Login to comment
175 In contrast, 7 of 8 individuals with a suspected or confirmed clinical diagnosis of CF had the 3199del6 allele in cis with I148T and a second CF mutation on the other chromosome. Login to comment
176 I148T in the absence of 3199del6 appears to be a polymorphism, given its presence in apparently healthy adults who are compound heterozygotes. Login to comment
177 Further studies would be required to determine whether I148T alone with a CFTR mutation on the other chromosome is associated with single-organ or late onset expression of disease. Login to comment
178 Counseling for I148T positive individuals is therefore best done with knowledge of 3199del6 status. Login to comment
179 The ACMG Cystic Fibrosis Working Group has recommended the removal of I148T from the ACMG panel because 3199del6 is the pathogenic finding (Watson et al., 2004). Login to comment
182 As with I148T, the background contributes to the phenotypic expression. Login to comment

[hide] Parallel single nucleotide polymorphism genotyping... Anal Chem. 2005 Apr 15;77(8):2400-5. Chen Y, Shortreed MR, Olivier M, Smith LM
Parallel single nucleotide polymorphism genotyping by surface invasive cleavage with universal detection.
Anal Chem. 2005 Apr 15;77(8):2400-5., 2005-04-15 [PMID:15828773]

Abstract [show]
Large-scale investigations of sequence variation within the human species will provide information about the basis of heritable variation in disease susceptibility and human migration. The surface invader assay (an adaptation of the invasive cleavage reaction to an array format) is capable of exquisitely sensitive and specific detection of genetic variation. It is shown here that this genotyping technology can be multiplexed in a DNA array format, permitting the parallel analysis of a panel of single nucleotide polymorphisms (SNPs) directly from an unamplified genomic DNA target. In addition, a "universal" mode of detection was developed that makes use of a mixture of degenerate templates for DNA ligation to the surface-bound cleaved oligonucleotides and thereby makes this strategy amenable to any desired SNP site or combination of SNP sites, without regard to their particular DNA sequences. This approach was demonstrated on a proof-of-principle scale using small DNA arrays to genotype 6 SNP markers in the PTPN1 gene and 10 mutations in the cystic fibrosis transmembrane conductance regulator gene. This ability to analyze many different genetic variations in parallel, directly from unamplified human genomic DNA samples, lays the groundwork for the development of high-density arrays able to analyze hundreds of thousands or even millions of SNPs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
170 508 of the protein product.23 The CF mutations chosen in this study, ∆F508, G551D, W1282X, N1303K, R117H, R560T, 3849+10kbCT, V520F, R334W, and I148T, are a subset of the standard panel. Login to comment

[hide] Time-motion analysis of 6 cystic fibrosis mutation... Clin Chem. 2005 Jul;51(7):1116-22. Epub 2005 Apr 28. Krafft AE, Lichy JH
Time-motion analysis of 6 cystic fibrosis mutation detection systems.
Clin Chem. 2005 Jul;51(7):1116-22. Epub 2005 Apr 28., [PMID:15860566]

Abstract [show]
BACKGROUND: A dramatic increase in requests for routine cystic fibrosis (CF) carrier screening prompted us to conduct a time-motion analysis comparing commercially available CF testing platforms. Questions addressed in the study included: (a) How much time is required to perform each step involved in carrying out the assay procedure? (b) Which system requires the minimum number of manual manipulations to complete a typical run? (c) What workflow benefits can be achieved by automation? METHODS: We used a 96-sample run for comparisons and analyzed each of the 6 methods to determine the number of pipetting steps and manual manipulations, the labor and instrument time, and the total time required to perform the assay. The survey participants included a staff of 4 technologists who perform complex molecular assays regularly. Time required for each procedure was determined by direct observation and from work logs completed by the technologists. RESULTS: The total number of pipetting motions varied from 78 to 344. Labor time ranged from 2.6 to 8.4 h, and total assay time from 7.6 to 13.7 h. CONCLUSION: Time-motion analysis allowed identification of a method that minimized pipetting motions and thus reduced the risk of repetitive stress injury.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 These included 58 patient DNA samples initially characterized by CF Gold 1.0, of which 28 were wild type and 30 contained 1 of the following 16 mutant alleles: F508del, R553X, 2184delA, 3120 ϩ 1GϾA, I507del, G542X, G551D, W1282X, N1303K, 621 ϩ 1GϾT, R117H, 1717-1GϾA, R560T, R334W, R347P, and I148T. Login to comment
169 The INNO-LiPA was the only system to test for the 3199del6 allele, which is now believed to be the pathogenic mutation that occurs on a haplotype with I148T (4). Login to comment

[hide] Novel, mechanism-based therapies for cystic fibros... Curr Opin Pediatr. 2005 Jun;17(3):385-92. Rubenstein RC
Novel, mechanism-based therapies for cystic fibrosis.
Curr Opin Pediatr. 2005 Jun;17(3):385-92., [PMID:15891431]

Abstract [show]
PURPOSE OF REVIEW: Cystic fibrosis results from disruption of the biosynthesis or function of the cystic fibrosis transmembrane conductance regulator. Cystic fibrosis transmembrane conductance regulator plays a critical role in the regulation of epithelial ion transport. Restoration of cystic fibrosis transmembrane conductance regulator function should improve the cystic fibrosis phenotype. RECENT FINDINGS: Recent investigations affording a better understanding of the mechanism of dysfunction of mutant cystic fibrosis transmembrane conductance regulators, as well as the roles of cystic fibrosis transmembrane conductance regulator in regulating epithelial ion transport, have led to development of therapeutic strategies based on repair or bypass of mutant cystic fibrosis transmembrane conductance regulator dysfunction. The former strategy, coined 'protein repair therapy,' is aimed at improving or restoring the function of mutant cystic fibrosis transmembrane conductance regulators, whereas the latter approach aims to augment epithelial ion transport to compensate for the absent function mutant cystic fibrosis transmembrane conductance regulator. SUMMARY: Strategies to improve mutant cystic fibrosis transmembrane conductance regulator function or to bypass mutant cystic fibrosis transmembrane conductance regulator function hold great promise for development of novel therapies aimed at correcting the underlying pathophysiology of cystic fibrosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
90 However, I148T, which is associated with a severe CF phenotype and pancreatic insufficiency, is defective in regulation of HCO3 ÿ transport, but transports Clÿ with similar efficiency to wild-type CFTR [63]. Login to comment

[hide] Complete cystic fibrosis transmembrane conductance... Gut. 2005 Oct;54(10):1456-60. Epub 2005 Jun 29. Weiss FU, Simon P, Bogdanova N, Mayerle J, Dworniczak B, Horst J, Lerch MM
Complete cystic fibrosis transmembrane conductance regulator gene sequencing in patients with idiopathic chronic pancreatitis and controls.
Gut. 2005 Oct;54(10):1456-60. Epub 2005 Jun 29., [PMID:15987793]

Abstract [show]
BACKGROUND: Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene-many of which cause cystic fibrosis-have also been reported in patients with chronic pancreatitis. The authors examine whether mild or severe CFTR mutations, homozygous or compound heterozygous CFTR mutations, or even simple cystic fibrosis carrier status alone increases the risk of developing pancreatitis. METHODS: After exclusion of patients with trypsinogen (PRSS1) mutations, cystic fibrosis, or pulmonary disease, and with known risk factors for pancreatitis 67 patients with idiopathic chronic pancreatitis (ICP) from northwest Germany and 60 geographically and ethnically matched controls were recruited. The entire coding region of the CFTR gene was sequenced in all patients and controls. ICP patients were also analysed for serine protease inhibitor Kazal type 1 (SPINK1) gene mutations. RESULTS: Abnormal CFTR alleles were found to be twice as frequent in ICP patients as in controls (25/134 v 11/120; p<0.05). Three of four severe CFTR mutations detected in patients were compound heterozygous with another abnormal CFTR allele, whereas among controls three severe CFTR mutations were found in heterozygous cystic fibrosis carriers. In ICP patients 19 uncommon/mild mutations, including combinations of the 5T allele with 12TG repeats, were identified compared with only five in controls (p = 0.012). Heterozygous SPINK1 mutations were detected in eight ICP patients (15% v 1% in controls) but only one also carried an additional mild CFTR mutation. CONCLUSIONS: These data show that not only compound heterozygosity, but also cystic fibrosis carrier status for different types of CFTR mutations, including uncommon/mild mutations, significantly increase the risk of developing pancreatitis. Although 45% of the study's ICP patients carried predisposing genetic risk factors (for example, mutations in CFTR or SPINK1), the authors found no evidence that the risk conveyed by CFTR mutations depends on co-inherited SPINK1 mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
256 The reason why numbers for compound heterozygous ICP patients in these studies are diverse (4/67 = 6% in our study) may be due to differences Table 1 CFTR and SPINK1 sequence variations identified in 30 of the 67 ICP patients PatientSex CFTR mutation T allele TG repeats PSTI mutation 1 M DF508/R117H 7/7 9/10 -/- 2 W DF508/A1087P 7/9 10/11 -/- 3 M DF508/D1152H 7/9 10/10 -/- 4 M S1235R/R668C 7/7 11/12 -/- 5 M 2184insA/- 7/7 10/12 -/- 6 M R31C/- 7/7 10/11 -/- 7 M R75Q/- 7/7 11/11 -/- 8 M R347P/- 7/7 11/12 -/- 9 M S1235R/- 7/7 11/12 -/- 10 W S1235R/- 7/7 11/12 -/- 11 M G576A/- 7/7 10/10 -/- 12 W M348V/- 7/9 10/10 -/- 13 M V754M/- 7/7 10/11 -/- 14 M -/- 5/7 11/12 -/- 15 W -/- 5/7 11/12 -/- 16 M -/- 5/7 11/12 -/- 17 W -/- 5/9 11/12 -/- 18 M -/- 5/7 11/12 -/- 19 M -/- 5/7 10/10 -/- 20 W -/- 5/7 10/10 -/- 21 W -/- 5/7 11/12 N34S/- 22 W -/- 7/7 10/11 N34S/- 23 M -/- 7/9 10/11 N34S/- 24 M -/- 7/7 11/11 N34S/- 25 M -/- 7/7 11/11 N34S/- 26 W -/- 7/7 11/11 N34S/- 27 M -/- 7/7 11/11 N34S/- 28 W -/- 7/7 10/11 N34S/- 29 W -/- 7/7 11/11 P55S/- 30 W -/- 7/7 11/11 IVS3+2TC/- Table 2 CFTR sequence variations identified in 11 of 60 healthy controls Control group Number DF508/- 3 R117H/- 2 I148T/- 1 L997F/- 1 5T/12TG 1 5T/11TG 3 in patient recruitment, the catchment populations, or the stringency with which cystic fibrosis patients were excluded. Login to comment

[hide] Genetics of idiopathic disseminated bronchiectasis... Semin Respir Crit Care Med. 2003 Apr;24(2):179-84. Luisetti M, Pignatti PF
Genetics of idiopathic disseminated bronchiectasis.
Semin Respir Crit Care Med. 2003 Apr;24(2):179-84., [PMID:16088537]

Abstract [show]
Bronchiectasis is an abnormal dilation of bronchi, consequent to the destruction of their walls. It is included in the category of obstructive pulmonary diseases, along with chronic obstructive pulmonary disease (COPD), asthma, and cystic fibrosis. In approximately 50% of cases, bronchiectasis is associated with underlying conditions; in the remainder, known causes are not ascertainable (idiopathic bronchiectasis). A search for genetic determinants of this phenotype, with the cystic fibrosis gene as a candidate, has been performed by three independent groups. The results of this search agreed on the association of bronchiectasis with cystic fibrosis gene mutations and polymorphisms. The cystic fibrosis gene is also associated with bronchiectasis due to rheumatoid arthritis and allergic bronchopulmonary aspergillosis. A few other genes have been investigated in idiopathic bronchiectasis, with negative results. Idiopathic bronchiectasis is, therefore, to be considered as an obstructive multifactorial disorder belonging to the category of cystic fibrosis monosymptomatic diseases (or CFTR-opathies), whose pathogenesis is influenced by environmental factors and other undetermined genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Greek M/F 11/12 5/16 na Mean age (yrs) 53 Ϯ 15 53 Ϯ 14 na CFTR gene 1 G576A-R668C/L997F 1 ⌬F508/D192N 1 ⌬F508,I1027T mutation 1 ⌬F508/L997F 1 ⌬I507/3849 + 10kb C → T 1 D565G, R668C 1 ⌬F508/- 1 ⌬F508/3849 + 10kb C → T 1 T896I/- 1 R1066C/- 1 H949Y/T1220I 1 I148T/- 1 3667ins4/- 1 ⌬F508/- 1 ⌬F508/S977F 1 R75Q/- 1 2183AA→G 1 M1137V/- 1 L997F/- IVS8-5T 5 5/7 1 5/9 1 5/5 CFTR, cystic fibrosis transmembrane conductance regulator; na, not available. Login to comment

[hide] Genetics of cystic fibrosis. Semin Respir Crit Care Med. 2003 Dec;24(6):629-38. Gallati S
Genetics of cystic fibrosis.
Semin Respir Crit Care Med. 2003 Dec;24(6):629-38., [PMID:16088579]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) gene, which encodes a protein expressed in the apical membrane of exocrine epithelial cells. CFTR functions principally as a cyclic adenosine monophosphate (cAMP)-induced chloride channel and appears capable of regulating other ion channels. Mutations affect CFTR through a variety of molecular mechanisms, which can produce little or no functional gene product at the apical membrane. More than 1000 different disease-causing mutations within the CFTR gene have been described. The potential of a mutation to contribute to the phenotype depends on its type, localization in the gene, and the molecular mechanism as well as on interactions with secondary modifying factors. Genetic testing can confirm a clinical diagnosis of CF and can be used for infants with meconium ileus, for carrier detection in individuals with positive family history and partners of proven CF carriers, and for prenatal diagnostic testing if both parents are carriers. Studies of clinical phenotype in correlation with CFTR genotype have revealed a very complex relationship demonstrating that some phenotypic features are closely determined by the underlying mutations, whereas others are modulated by modifier genes, epigenetic mechanisms, and environment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 In effect, virtually no func- Table 2 Unusually Common Cystic Fibrosis Mutations in Specific Populationsa Total Exon/ Number Number Frequency Mutation Intron Ethnic Origin Observed Screened (%) 296+12T→C intron 02 Pakistani 02 24 8.33 E60X exon 03 Belgian 06 394 1.52 G91R exon 03 French 04 266 1.50 394delTT exon 03 Scandinavian 78 1588 4.91 457TAT→G exon 04 Austrian 04 334 1.20 Y122X exon 04 Réunion Island 14 29 48.27 I148T exon 04 French Canadian 06 66 9.09 711+5G→A intron 05 Italian (North East) 06 225 2.67 1078delT exon 07 Celtic 27 475 5.68 1161delC exon 07 Pakistani 02 24 8.33 T338I exon 07 Italian, Sardinian 04 86 4.65 Q359K/T360K exon 07 Georgian Jews 07 8 87.50 R347H exon 07 Turkish 04 134 2.98 1609delCA exon 10 Spanish 03 96 3.12 1677delTA exon 10 Bulgarian 05 222 2.25 S549I exon 11 Arabs 02 40 5.00 Q552X exon 11 Italian (North East) 03 225 1.33 A559T exon 11 African-American 02 79 2.53 1811+1.2kbA→G intron 11 Spanish 22 1068 2.06 1898+5G→T intron 12 Chinese 03 10 30.00 1949del84 exon 13 Spanish 02 136 1.47 2143delT exon 13 Russian 04 118 3.39 2183AA→G exon 13 Italian (North East) 21 225 9.33 2184insA exon 13 Russian 03 118 2.54 3120+1G→A intron 16 African-American 14 112 12.50 3272-26A→G intron 17a Portugese, French 06 386 1.55 R1066C exon 17b Portugese 05 105 4.76 R1070Q exon 17b Bulgarian 04 166 2.41 Y1092X exon 17b French Canadian, 11 725 1.52 French M1101K exon 17b Hutterite 22 32 68.75 3821delT exon 19 Russian 03 118 2.54 S1235R exon 19 French (South) 04 340 1.18 S1251N exon 20 Dutch, Belgian 11 792 1.39 S1255X exon 20 African-American 02 79 2.53 3905insT exon 20 Swiss 45 982 4.58 Amish, Arcadian 13 86 15.12 W1282X Exon 20 Jewish-Ashkenazi 50 95 52.63 R1283M exon 20 Welsh 03 183 1.64 aAccording to the Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca/cftr/. Login to comment

[hide] A comparison of high-resolution melting analysis w... Am J Clin Pathol. 2005 Sep;124(3):330-8. Chou LS, Lyon E, Wittwer CT
A comparison of high-resolution melting analysis with denaturing high-performance liquid chromatography for mutation scanning: cystic fibrosis transmembrane conductance regulator gene as a model.
Am J Clin Pathol. 2005 Sep;124(3):330-8., [PMID:16191501]

Abstract [show]
High-resolution melting analysis (HRMA) was compared with denaturing high-performance liquid chromatography (dHPLC) for mutation scanning of common mutations in the cystic fibrosis transmembrane conductance regulator gene. We amplified (polymerase chain reaction under conditions optimized for melting analysis or dHPLC) 26 previously genotyped samples with mutations in exons 3, 4, 7, 9, 10, 11, 13, 17b, and 21, including 20 different genotypes. Heterozygous mutations were detected by a change in shape of the melting curve or dHPLC tracing. All 20 samples with heterozygous mutations studied by both techniques were identified correctly by melting (100% sensitivity), and 19 were identified by dHPLC (95% sensitivity). The specificity of both methods also was good, although the dHPLC traces of exon 7 consistently revealed 2 peaks for wild-type samples, risking false-positive interpretation. Homozygous mutations could not be detected using curve shape by either method. However, when the absolute temperatures of HRMA were considered, G542X but not F508del homozygotes could be distinguished from wild type. HRMA easily detected heterozygotes in all single nucleotide polymorphism (SNP) classes (including A/T SNPs) and 1- or 2-base-pair deletions. HRMA had better sensitivity and specificity than dHPLC with the added advantage that some homozygous sequence alterations could be identified. HRMA has great potential for rapid, closed-tube mutation scanning.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 ❚Table 1❚ Mutations Analyzed in the Study Position From 5' Exon (or Intron) Genotype* No. of Samples Nucleotide Change SNP Class† End/Amplicon Size (bp) 3 394delTT 1 Del‡ - 132/234 4 R117H 1 G→A 1 83/270 Y122X 1 T→A 4 99/270 I148T 2 T→C 1 176/270 Intron 4 621+1 2 G→T 2 233/270 7 R334W 1 C→T 1 208/345 R347P 1 G→C 3 248/345 9 A455E 2 C→A 2 155/263 10 I507del 1 Del‡ - 171/292 F508del 3 Del‡ - 174/292 F508del/F508del 1 Del - 174/292 F508C 1 T→G 2 175/292 11 G542X 1 G→T 2 90/175 G542X/G542X 1 G→T 2 90/175 G551D 1 G→A 1 118/175 R553X 2 C→T 1 123/175 R560T 1 G→C 3 145/175 13 2184delA 1 Del‡ - 356/458 17b M1101K 1 T→A 4 196/292 21 N1303K 1 C→G 3 175/250 bp, base pairs; SNP, single nucleotide polymorphism. Login to comment
55 Mutations altering a wild-type G::C bp (R117H and 621+1) showed greater differences than those that altered a wild-type T::A bp (I148T). Login to comment
57 The sequenced wild-type control sample showed a single peak, whereas the 621+1 and I148T traces had multiple peaks. Login to comment
72 Such double peaks usually are interpreted as Temperature (°C) Fluorescence 79 80 81 82 83 84 85 86 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - R117H het C::A T::G WT G::C Temperature (°C) Fluorescence 79 80 81 82 83 84 85 86 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - 621+1 het C::T A::G WT G::C Temperature (°C) Fluorescence 79 80 81 82 83 84 85 86 100 - 90 - 80 - 70 - 60 - 50 - 40 - 30 - 20 - 10 - 0 - I148T het C::A T::G WT T::A Time (min) Absorbance(mV) 0 1 2 3 20 - 19 - 18 - 17 - 16 - 15 - 14 - 13 - 12 - 11 - 10 - 9 - 8 - 7 - 6 - 5 - 4 - 3 - 2 - 1 - 0 - 621+1 het I148T het R117H het WT A B C D ❚Figure 1❚ High-resolution melting and denaturing high-performance liquid chromatography (dHPLC) analysis of exon 4 of the cystic fibrosis transmembrane conductance regulator gene. Login to comment
73 Melting data were normalized and temperature shifted as previously described.19 A, Heterozygous (het) R117H and the wild-type (WT) control sample. B, Heterozygous I148T and the WT control sample. C, Intronic heterozygous 621+1 G/T and the WT control sample. D,The dHPLC profile of heterozygous mutations in exon 4. Login to comment

[hide] Newborn screening for cystic fibrosis in Wisconsin... J Pediatr. 2005 Sep;147(3 Suppl):S73-7. Rock MJ, Hoffman G, Laessig RH, Kopish GJ, Litsheim TJ, Farrell PM
Newborn screening for cystic fibrosis in Wisconsin: nine-year experience with routine trypsinogen/DNA testing.
J Pediatr. 2005 Sep;147(3 Suppl):S73-7., [PMID:16202788]

Abstract [show]
OBJECTIVE: To describe the development and follow-up confirmatory results of the routine cystic fibrosis (CF) newborn screening (NBS) program in Wisconsin. METHODS: CF NBS has been performed on a routine clinical basis in Wisconsin since July 1994. The 2-tiered immunoreactive trypsinogen (IRT)/DNA technique was used on dried blood on filter paper spots. From July 1994 to February 2002, mutation analysis was for the DeltaF508 allele. Beginning in March 2002, multimutation analysis of 25 CF mutations was performed. Infants with a positive result on NBS were seen in certified CF centers for sweat testing by means of quantitative pilocarpine iontophoresis, and families received genetic counseling. RESULTS: From July 1994 to February 2002, there were 120 cases of CF detected by means of NBS (509,794 infants screened), with 53 DeltaF508 homozygotes and 67 compound heterozygotes. There were 8 clinically diagnosed cases of CF (no DeltaF508 allele). The CF incidence was 1:3983 (95%CI, 1:3373-1:4774). From March 2002 to June 2003, multimutation analysis identified 21 cases of classic CF (90,142 infants screened). Sweat tests were successfully performed in infants younger than 1 month. CONCLUSIONS: Early diagnosis of CF through NBS was successfully performed, with an estimated sensitivity rate of 99% using the IRT/25 CFTR multimutation assay.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Mutations included in this assay are 2184delA, A455E, DI507, DF508, G542X, G551D, R553X, R560T, 1717-1G>A, R1162X, 3659delC, N1303K, W1282X, R334W, R347P, 1078delT, R117H, I148T, 62111G>T, 278915G>A, 3849110kbC>T, G85E, 109811G>A, 71111G>T and 312011G>A. Login to comment
56 §Eight cases of DF508/DF508, 1 case of DF508/312011G>A, 1 case of DF508/3849110kbC>T, 1 case of DF508/W1282X, 1 case of DF508/ R347P, 1 case of DF508/278915G>A, 1 case of DF508/I148T. Login to comment
64 Two alleles, with 1 being an R117H: 5 cases of DF508/R117H(7T/9T), 1 case of G542X/ R117H(7T/9T), 1 case of R117H/R117H(5T/7T), and 1 case of I148T/R117H(7T/9T). Login to comment
66 The sweat test values for these infants ranged from 20 to 40.8 mEq/L, with the exception of the infant with I148T/R117H(7T/9T), whose sweat chloride value was 11 mEq/L (testing for 3199del6 was not performed). Login to comment

[hide] Haplotype block structure study of the CFTR gene. ... Eur J Hum Genet. 2006 Jan;14(1):85-93. Pompei F, Ciminelli BM, Bombieri C, Ciccacci C, Koudova M, Giorgi S, Belpinati F, Begnini A, Cerny M, Des Georges M, Claustres M, Ferec C, Macek M Jr, Modiano G, Pignatti PF
Haplotype block structure study of the CFTR gene. Most variants are associated with the M470 allele in several European populations.
Eur J Hum Genet. 2006 Jan;14(1):85-93., [PMID:16251901]

Abstract [show]
An average of about 1700 CFTR (cystic fibrosis transmembrane conductance regulator) alleles from normal individuals from different European populations were extensively screened for DNA sequence variation. A total of 80 variants were observed: 61 coding SNSs (results already published), 13 noncoding SNSs, three STRs, two short deletions, and one nucleotide insertion. Eight DNA variants were classified as non-CF causing due to their high frequency of occurrence. Through this survey the CFTR has become the most exhaustively studied gene for its coding sequence variability and, though to a lesser extent, for its noncoding sequence variability as well. Interestingly, most variation was associated with the M470 allele, while the V470 allele showed an 'extended haplotype homozygosity' (EHH). These findings make us suggest a role for selection acting either on the M470V itself or through an hitchhiking mechanism involving a second site. The possible ancient origin of the V allele in an 'out of Africa' time frame is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 The T2A rate was much lower than 1 Frequencies of the CFTR variants within the M or the V alleles exon or intron VARIANT SITES in the M genes (MM subjects) in the V genes (VV subjects) A 5' UTR 125 g/c 8/144 (0.056) 3/356 (0.008) -80 1 2 R31C 5/226 (0.004) 1/576 (0.002) -56 in M genes in V genes 6 2 R75Q 1/226 (0.004) 15/576 (0.026) -51 M V (ttga)n 0.461 0.017 7 3 G85E 0/226 (0) 1/576 (0.002) -51 2.214 0.362 (tg)n 0.616 0.114 B i 3 406-6 t/c 0/226 (0) 6/576 (0.010) -29 (t)n 0.499 0.036 8 4 R117H 2/226 (0.009) 0/576 (0) -29 10 4 I148T 3/224 (0.013) 0/576 (0) -29 C i 4 621+3 a/g 1/224 (0.004) 0/576 (0) -29 12 5 R170H 1/158 (0.006) 0/402 (0) -26 D i 6a 875+40 a/g 6/36 (0.167)c 0/118 (0)c -25 i 6b (ttga)6 13/36 (0.361) 1/118 (0.008) -23 E i 6b 1001+11 c/t 5/60 (0.083) 0/166 (0) -23 F i 8 1341+28 c/t 1/152 (0.007) 0/464 (0) -18 i 8 (tg)10 39/76 (0.513) 5/218 (0.023) -11 i 8 (tg)11 21/76 (0.276) 205/218 (0.940) -11 i 8 (tg)12 16/76 (0.211) 8/218 (0.037) -11 i 8 t5 4/76 (0.053) 2/218 (0.009) -11 i 8 t7 48/76 (0.632) 214/218 (0.982) -11 i 8 t9 24/76 (0.316) 2/218 (0.009) -11 16 10 M470V H ex 10 F508del 3/226 (0.013) 0/572 (0) 0 19 10 F508C 0/226 (0) 1/572 (0.002) 0 20 10 1716g/a 15/226 (0.066) 0/572 (0) 0 21 11 G542X 1/158 (0.006) 0/400 (0) +28 24 12 V562I 1/226 (0.004) 0/576 (0) +30 25 12 V562L 1/226 (0.004) 0/576 (0) +30 26 12 G576A 3/226 (0.013) 0/576 (0) +30 28 13 2082c/t 1/104 (0.010) 0/226 (0) +32 29 13 R668C 3/224 (0.013) 0/562 (0) +32 32 14a 2694t/g 45/70 (0.643) 9/208 (0.043) +35 I i 14a 2752-15 c/g 0/226 (0) 5/576 (0.009) +44 37 15 3030g/a 1/158 (0.006) 7/402 (0.017) +44 O i 15 3041-71 g/c 5/226 (0.022) 0/576 (0) +47 39 17a L997F 1/226 (0.004) 4/576 (0.007) +51 40 17a A1009T 0/226 (0) 1/572 (0.002) +51 42 17b F1052V 1/226 (0.004) 0/572 (0) +52 43 17b G1069R 1/226 (0.004) 0/572 (0) +52 44 17b Q1071H 1/226 (0.004) 0/572 (0) +52 45 17b 3417a/t 0/226 (0) 4/572 (0.007) +52 46 17b L1096R 1/226 (0.004) 0/572 (0) +52 52 19 3813a/g 0/118 (0) 1/484 (0.002) +68 53 19 S1235R 3/100 (0.030) 0/294 (0) +68 54 20 4002a/g 5/56 (0.089) 1/168 (0.006) +83 q in the M alleles q in the V alleles 56 21 4029a/g 0/194 (0) 3/506 (0.006) +93 57 21 N1303K 1/92 (0.011) 0/272 (0) +93 59 24 4404c/t 3/226 (0.013) 14/576 (0.024) +107 60 24 4521g/a 21/56 (0.375) 2/172 (0.012) +107 "slow evolution" markers "fast evolution" markers (i.e. STRs) H is the sum of the degrees of heterozygosity of all the markers Ref.No.a ABSOLUTE AND RELATIVE FREQUENCIES distance from the M470V siteb (Kb) H associated with the…. Login to comment

[hide] Congenital bilateral absence of the vas deferens a... Eur J Hum Genet. 2006 Jul;14(7):801; author reply 801. Epub 2006 Apr 26. Haig D
Congenital bilateral absence of the vas deferens and recombination at CFTR.
Eur J Hum Genet. 2006 Jul;14(7):801; author reply 801. Epub 2006 Apr 26., [PMID:16639412]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 A conservative estimate of the region of 'extended haplotype homozygosity` that they report would extend from I148T (29 kb 50 of V470) to S1235R (68 kb 30 of V470). Login to comment

[hide] CFTR 5T variant has a low penetrance in females th... Genet Med. 2006 Jun;8(6):339-45. Sun W, Anderson B, Redman J, Milunsky A, Buller A, McGinniss MJ, Quan F, Anguiano A, Huang S, Hantash F, Strom C
CFTR 5T variant has a low penetrance in females that is partially attributable to its haplotype.
Genet Med. 2006 Jun;8(6):339-45., [PMID:16778595]

Abstract [show]
PURPOSE: The study's purpose was to understand the molecular basis for different clinical phenotypes of the 5T variant, a tract of 5 thymidines in intron 8 of the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which disrupts processing of CFTR mRNA and reduces synthesis from the corresponding CFTR alleles. METHOD: We analyzed the polymorphic TG dinucleotide repeat adjacent to the 5T variant in intron 8 and the codon 470 in exon 10. Patients selected for this study were positive for both the 5T variant and the major cystic fibrosis mutation, Delta F508. Almost all Delta F508 mutation alleles occur in a 10TG-9T-470M haplotype. Therefore, it is possible to determine the haplotype of the 5T variant in trans. RESULTS: Of the 74 samples analyzed, 41 (55%) were 11TG-5T-470M, 31 (42%) were 12TG-5T-470V, and 2 (3%) were 13TG-5T-470M. Of the 49 cases for which we had clinical information, 17.6% of females (6/34) and 66.7% of males (10/15) showed symptoms resembling atypical cystic fibrosis. The haplotype with the highest penetrance in females (42% or 5/12) and more than 80% (5/6) in males is 12TG-5T-470V. We also evaluated 12 males affected with congenital bilateral absence of vas deferens and positive for the 5T variant; 10 of 12 had the 12TG-5T-470V haplotype. CONCLUSION: Overall, the 5T variant has a milder clinical consequence than previously estimated in females. The clinical presentations of the 5T variant are associated with the 5T-12TG-470M haplotype.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
102 This comes to only a fraction (22%) of the individuals compound heterozygous for a CF mutation and the 5T variant (1/222) in that population.30 Previously,31 we described that the I148T CF mutation has a 113-fold increase in prevalence in our screening population when compared with a patient population with CF. Login to comment
103 An explanation for the differential pathogenicity of this apparently low penetrant mutation is that only 0.6% of the I148T alleles contains the 3199del6 mutation in exon 17a and 9T in IVS-8.29 Similarly, the penetrance of the 5T allele can also be caused by different gene background on which the variant arose. Login to comment

[hide] A new large CFTR rearrangement illustrates the imp... Hum Mutat. 2006 Jul;27(7):716-7. Niel F, Legendre M, Bienvenu T, Bieth E, Lalau G, Sermet I, Bondeux D, Boukari R, Derelle J, Levy P, Ruszniewski P, Martin J, Costa C, Goossens M, Girodon E
A new large CFTR rearrangement illustrates the importance of searching for complex alleles.
Hum Mutat. 2006 Jul;27(7):716-7., [PMID:16786510]

Abstract [show]
The p.Val754Met variant, described in 1996 in a CF patient, has been considered a CF mutation. However, biochemical aspects, results of functional studies and, finally, the identification of a complex deletion removing exons 3 to 10 and 14b to 16 in cis of p.Val754Met in a CF patient, argue against a strong deleterious effect. An inventory through the French CF network of patients carrying p.Val754Met led to the registration of seven patients (CF: n=4; idiopathic chronic pancreatitis: n=3) and six healthy individuals, all heterozygous for the variation. Extensive CFTR gene analysis was carried out, including the search for large rearrangements and other possible mutations. The complex deletion, whose breakpoints are described here, was found only in the four CF patients, in association with the same haplotype. This data, added to the fact that the p.[Phe508del]+[Val754Met] genotype was found in a healthy individual, bring further arguments against the association of p.Val754Met with CF. We thus suggest looking for a possible complex allele whenever p.Val754Met is detected and considering it neutral regarding genetic counseling when found in isolation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
13 Conversely, other mutations were initially reported as mutations because they were identified in CF patients, but are now reclassified as polymorphisms, as is the case for p.Ile148Thr (Rohlfs et al., 2002; Claustres et al., 2004). Login to comment

[hide] Abnormal regulatory interactions of I148T-CFTR and... Am J Physiol Cell Physiol. 2007 Jan;292(1):C603-11. Epub 2006 Jul 5. Suaud L, Yan W, Rubenstein RC
Abnormal regulatory interactions of I148T-CFTR and the epithelial Na+ channel in Xenopus oocytes.
Am J Physiol Cell Physiol. 2007 Jan;292(1):C603-11. Epub 2006 Jul 5., [PMID:16822950]

Abstract [show]
The mechanisms underlying regulatory interactions of the cystic fibrosis transmembrane conductance regulator (CFTR) and the epithelial Na(+) channel (ENaC) in Xenopus oocytes are controversial. CFTR's first nucleotide binding domain (NBD-1) may be important in these interactions, because mutations within NBD-1 impair these functional interactions. We hypothesized that an abnormal CFTR containing a non-NBD-1 mutation and able to transport chloride would retain regulatory interactions with murine ENaC (mENaC). We tested this hypothesis for I148T-CFTR, where the mutation is located in CFTR's first intracellular loop. I148T-CFTR has been associated with a severe CF phenotype, perhaps because of defects in its regulation of bicarbonate transport, but it transports chloride similarly to wild-type CFTR in model systems (Choi JY, Muallem D, Kiselyov K, Lee MG, Thomas PJ, Muallem S. Nature 410: 94-97, 2001). cRNAs encoding alphabetagamma-mENaC and I148T-CFTR were injected separately or together into Xenopus oocytes. mENaC and CFTR functional expression were assessed by two-electrode voltage clamp. mENaC whole oocyte expression was determined by immunoblotting, and surface expression was quantitated by surface biotinylation. Injection of I148T-CFTR cRNA alone yielded high levels of CFTR functional expression. In coinjected oocytes, mENaC functional and surface expression was not altered by activation of I148T-CFTR with forskolin/ IBMX. Furthermore, the CFTR potentiator genistein both enhanced functional expression of I148T-CFTR and restored regulation of mENaC surface expression by activated I148T-CFTR. These data suggest that the ability to transport chloride is not a critical determinant of regulation of mENaC by activated CFTR in Xenopus oocytes and provide further evidence that I148T-CFTR is dysfunctional despite maintaining the ability to transport chloride.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 First published 5 July 2006;Am J Physiol Cell Physiol Laurence Suaud, Wusheng Yan and Ronald C. Rubenstein oocytesXenopuschannel in+the epithelial Na Abnormal regulatory interactions of I148T-CFTR and You might find this additional info useful... 35 articles, 19 of which can be accessed free at:This article cites http://ajpcell.physiology.org/content/292/1/C603.full.html#ref-list-1 2 other HighWire hosted articlesThis article has been cited by [PDF][Full Text][Abstract] , April 1, 2007; 292 (4): C1553-C1561.Am J Physiol Cell Physiol Ronald C. Rubenstein Laurence Suaud, Wusheng Yan, Marcelo D. Carattino, Amal Robay, Thomas R. Kleyman and chloride transport is not necessary for inhibition of ENaC oocytes: evidence thatXenopusRegulatory interactions of N1303K-CFTR and ENaC in [PDF][Full Text][Abstract] , January , 2011; 300 (1): L88-L101.Am J Physiol Lung Cell Mol Physiol Yael Grumbach Ronald C. Rubenstein, Shannon R. Lockwood, Ellen Lide, Rebecca Bauer, Laurence Suaud and airway epithelial cells F508-CFTR in∆Regulation of endogenous ENaC functional expression by CFTR and including high resolution figures, can be found at:Updated information and services http://ajpcell.physiology.org/content/292/1/C603.full.html can be found at:AJP - Cell PhysiologyaboutAdditional material and information http://www.the-aps.org/publications/ajpcell This infomation is current as of August 8, 2011. Login to comment
7 It is published 12 timesAJP - Cell Physiology CALL FOR PAPERS Protein and Vesicle Trafficking, Cytoskeleton Abnormal regulatory interactions of I148T-CFTR and the epithelial Naϩ channel in Xenopus oocytes Laurence Suaud,1 Wusheng Yan,1 and Ronald C. Rubenstein1,2 1 Division of Pulmonary Medicine, Children`s Hospital of Philadelphia, and 2 Department of Pediatrics, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania Submitted 23 February 2006; accepted in final form 30 June 2006 Suaud L, Yan W, Rubenstein RC. Abnormal regulatory interactions of I148T-CFTR and the epithelial Naϩ channel in Xenopus oocytes. Login to comment
12 We tested this hypothesis for I148T-CFTR, where the mutation is located in CFTR`s first intracellular loop. Login to comment
13 I148T-CFTR has been associated with a severe CF phenotype, perhaps because of defects in its regulation of bicarbonate transport, but it transports chloride similarly to wild-type CFTR in model systems (Choi JY, Muallem D, Kiselyov K, Lee MG, Thomas PJ, Muallem S. Login to comment
15 cRNAs encoding ␣beta␥-mENaC and I148T-CFTR were injected separately or together into Xenopus oocytes. Login to comment
18 Injection of I148T-CFTR cRNA alone yielded high levels of CFTR functional expression. Login to comment
19 In coinjected oocytes, mENaC functional and surface expression was not altered by activation of I148T-CFTR with forskolin/ IBMX. Login to comment
20 Furthermore, the CFTR potentiator genistein both enhanced functional expression of I148T-CFTR and restored regulation of mENaC surface expression by activated I148T-CFTR. Login to comment
21 These data suggest that the ability to transport chloride is not a critical determinant of regulation of mENaC by activated CFTR in Xenopus oocytes and provide further evidence that I148T-CFTR is dysfunctional despite maintaining the ability to transport chloride. Login to comment
33 We aimed to test these alternate hypotheses by examining the regulatory interactions of murine ENaC (mENaC) with I148T-CFTR. Login to comment
34 I148T is a rare mutation of CFTR where the mutation is localized in CFTR`s first cytoplasmic loop (CL-1). Login to comment
36 sickkids.on.ca/cftr), I148T can be associated with phenotypically severe, pancreatic-insufficient CF. Login to comment
37 However, this association has been questioned by others, because I148T-containing alleles from patients with CF can harbor a second mutation in cis, 3199del6, which causes deletion of I1023 and V1024, that may itself be sufficient to cause CFTR dysfunction (10). Login to comment
38 Interestingly, in heterologous cells in the absence of this second mutation in cis, I148T-CFTR appears to maintain the ability to transport chloride at levels similar to wild-type CFTR (WT-CFTR) but appears deficient in its ability to regulate HCO3 - transport (9); this defective regulation of HCO3 - transport is hypothesized to underlie the pancreatic dysfunction associated with this mutation in CF. Login to comment
39 Our data suggest that cAMP-activated I148T-CFTR has robust capability to conduct Address for reprint requests and other correspondence: R. C. Rubenstein, Division of Pulmonary Medicine, Children`s Hospital of Philadelphia, Abramson 410C, 34th St. and Civic Center Blvd., Philadelphia, PA 19104 (e-mail: rrubenst@mail.med.upenn.edu). Login to comment
49 Expression of human I148T-CFTR and mouse ENaC in Xenopus oocytes. Login to comment
50 Human I148T-CFTR was constructed by site-directed mutagenesis of WT-CFTR cDNA by using a PCR-based mutagenesis technique, and its sequence was confirmed by automated analysis in The Children`s Hospital of Philadelphia Nucleic Acid and Protein Core. Login to comment
51 I148T-CFTR and ␣beta␥-mENaC were expressed in Xenopus oocytes as previously described (16, 33, 34, 37). Login to comment
52 I148T-CFTR and mouse ␣-, beta-, and ␥-ENaC cRNAs were prepared using the mMESSAGE mMACHINE cRNA synthesis kit (Ambion, Austin, TX) according to the manufacturer`s protocol, and cRNA concentrations were determined spectroscopically. Login to comment
55 Each batch of oocytes obtained from an individual frog was injected using a Nanoject II microinjector (Drummond Scientific, Broomall, PA) with either ␣-, beta-, and ␥-subunits of mENaC (0.33 ng/subunit), I148T-CFTR (10 ng), or a combination of ␣beta␥-mENaC and I148T-CFTR cRNAs dissolved in RNase-free water (50 nl/ oocyte). Login to comment
65 I148T-CFTR was activated by perfusion of the oocyte with modified ND96 buffer containing 10 ␮M forskolin and 100 ␮M IBMX for 25 min (16, 33, 34, 37). Login to comment
67 In all experiments, chloride current carried by I148T-CFTR was defined as the difference between amiloride-insensitive current measured before and after perfusion with forskolin/IBMX (or before and after perfusion with forskolin/IBMX/genistein). Login to comment
73 cRNAs for ␣beta-V5␥-mENaC were either injected into Xenopus oocytes alone or coinjected with cRNA encoding I148T-CFTR. Login to comment
83 A two-tailed t-test was used when comparing currents obtained from oocytes injected with a cRNA for a single transporter (i.e., ␣beta␥-mENaC or I148T-CFTR) versus oocytes coinjected with cRNAs for both ␣beta␥- mENaC and I148T-CFTR. Login to comment
87 RESULTS Functional expression of I148T-CFTR in Xenopus oocytes. Login to comment
88 We used the Xenopus oocyte expression system and TEV technique to examine the functional expression of I148T-CFTR. Login to comment
89 Prior data suggest that I148T-CFTR exhibits intracellular maturation (as assessed by molecular weight shifts due to glycolytic processing) and functional chloride transport similar to that of WT-CFTR but is deficient in its ability to regulate HCO3 - transport (4, 9, 32). Login to comment
90 We measured whole cell currents at varying clamping potentials in oocytes injected with 10 ␮g of I148T-CFTR cRNA and generated current/voltage (I-V) curves from data obtained before and after 20 min of incubation with 10 ␮M forskolin and 100 ␮M IBMX to activate endogenous protein kinase A (Fig. 1A). Login to comment
91 I148T-CFTR had a CFTR-characteristic linear I-V relationship, and whole cell currents, measured at a holding potential of -100 mV, increased 28-fold from -0.12 Ϯ 0.02 to -3.42 Ϯ 1.18 ␮A (mean Ϯ SE, n ϭ 19, P Յ 0.001) in response to forskolin/IBMX. Login to comment
93 These data suggest that expression of I148T leads to robust forskolin/IBMX-stimulated chloride currents in oocytes that are similar in magnitude to those of WT-CFTR. Login to comment
94 C604 REGULATORY INTERACTIONS OF I148T-CFTR AND ENaC AJP-Cell Physiol • VOL 292 • JANUARY 2007 • www.ajpcell.org onAugust,2011ajpcell.physiology.orgDownloadedfrom The isoflavone and CFTR potentiator genistein increases chloride transport by activated WT and mutant CFTRs, including ⌬F508-CFTR and G551D-CFTR (13, 33, 34). Login to comment
95 We assessed whether genistein would also enhance the function of I148T-CFTR. Login to comment
96 Figure 1B demonstrates the I-V relationship of I148T- expressing oocytes before and after incubation with 10 ␮M forskolin/100 ␮l IBMX for 25 min followed by incubation with 10 ␮M forskolin/100 ␮M IBMX/50 ␮M genistein for an additional 20 min. Login to comment
98 This enhancement of activated I148T-CFTR by genistein is similar in magnitude to the effect of genistein on WT-CFTR (ϳ2-fold; Ref. 34) but slightly smaller in magnitude compared with our previously observed enhancement of ⌬F508-CFTR-and G551D-CFTR-mediated currents by genistein (5.7and 4-fold, respectively) (33, 34). Login to comment
99 The forskolin/IBMX-stimulated currents mediated by I148T-CFTR were markedly reduced in Fig. 1B vs. Fig. 1A. Login to comment
102 Regulatory interactions of I148T-CFTR and ␣beta␥-ENaC. Login to comment
109 We therefore assessed the interregulation of I148T-CFTR and mENaC in oocytes. Login to comment
110 Figure 2 depicts whole cell currents measured at a holding potential of -100 mV in oocytes injected with I148T-CFTR (10 ng) or ␣beta␥-mENaC (0.33 ng/subunit) or both I148T-CFTR and ␣beta␥-mENaC cRNAs. Login to comment
111 Oocytes coinjected with I148T-CFTR and ␣beta␥-mENaC had no change in forskolin/IBMX-stimulated, amiloride-insensitive (I148T-CFTR-mediated) current compared with oocytes injected with I148T-CFTR alone [ICl ϭ -3.20 Ϯ 1.20 (I148T-CFTR, n ϭ 19) vs. -2.86 Ϯ 0.78 ␮A (I148T-CFTR/␣beta␥- mENaC, n ϭ 17), P ϭ not significant (NS); Fig. 2A]. Login to comment
112 Thus coexpression of ␣beta␥-mENaC in oocytes does not alter the functional expression of I148T-CFTR. Login to comment
115 Oocytes coinjected with both I148T-CFTR and ␣beta␥-mENaC expressed amiloride-sensitive whole cell currents before forskolin/IBMX stimulation (-0.32 Ϯ 0.10 ␮A, n ϭ 17) that were significantly lower than the amiloride-sensitive whole cell currents recorded under the same conditions in oocytes injected with ␣beta␥-mENaC alone (-2.06 Ϯ 0.62 ␮A, n ϭ 18, P ϭ 0.01). Login to comment
117 However, unlike WT-CFTR, activation of I148T-CFTR with forskolin/IBMX did not lead to a further Fig. 1. Login to comment
118 Expression of I148T-CFTR in Xenopus oocytes. Login to comment
119 A: I148T-CFTR was expressed in oocytes and two-electrode voltage clamp (TEV) was performed as described in EXPERIMENTAL PROCEDURES. Login to comment
122 B: I148T-CFTR was expressed in oocytes and TEV was performed. Login to comment
123 I-V relationships before stimulation of I148T-CFTR (F), after stimulation with 10 ␮M forskolin and 100 ␮M IBMX (E), and after stimulation with 10 ␮M forskolin, 100 ␮M IBMX, and 50 ␮M genistein () are shown. Login to comment
126 C605REGULATORY INTERACTIONS OF I148T-CFTR AND ENaC AJP-Cell Physiol • VOL 292 • JANUARY 2007 • www.ajpcell.org reduction in ␣beta␥-mENaC-mediated amiloride-sensitive whole cell currents in coinjected oocytes (-0.32 Ϯ 0.10 ␮A before forskolin/IBMX vs. -0.40 Ϯ 0.13 ␮A after forskolin/IBMX, n ϭ 17, P ϭ NS; Fig. 2B). Login to comment
128 These data are therefore consistent with activated I148T-CFTR having defective regulatory interactions with ␣beta␥-mENaC in Xenopus oocytes despite maintaining a robust ability to transport chloride. Login to comment
130 Expression of I148T-CFTR and murine epithelial sodium channel ␣beta␥-subunits (␣beta␥-mENaC) in Xenopus oocytes. Login to comment
131 I148T-CFTR (10 ng of cRNA) and ␣beta␥-mENaC (0.33 ng cRNA/subunit) were expressed separately or together in oocytes, and TEV was performed as described in EXPERIMENTAL PROCEDURES. A: changes in whole cell currents that were not inhibited by 10 ␮M amiloride (-100 mV holding potential) in oocytes injected with I148T-CFTR alone or in oocytes coinjected with I148T-CFTR and ␣beta␥-mENaC after stimulation with 10 ␮M forskolin/100 ␮M IBMX are shown. Login to comment
132 B: amiloride-sensitive whole cell currents (-100 mV holding potential) were determined in oocytes expressing ␣beta␥-mENaC or coexpressing ␣beta␥-mENaC and I148T-CFTR before (open bars) and after (shaded bars) stimulation with 10 ␮M forskolin/100 ␮M IBMX. Login to comment
133 Data obtained from the same I148T-CFTR/␣beta␥- mENaC coinjected oocytes are shown in A and B. Values are means Ϯ SE. Login to comment
135 Influence of I148T-CFTR on surface and whole oocyte expression of mENaC. Login to comment
136 ␣beta␥-mENaC (0.33 ng cRNA/subunit) where the beta-subunit contained a COOH-terminal V5 epitope was expressed in oocytes without or with I148T-CFTR (10 ng of cRNA). Login to comment
150 As shown in Fig. 3A, mENaC(beta-V5) expression at the oocyte surface was unaltered by treatment with forskolin/IBMX in oocytes injected with ␣beta␥-mENaC alone and decreased after coinjection of I148T-CFTR in the absence of forskolin/IBMX activation. Login to comment
151 Furthermore, mENaC surface expression did not change upon activation of I148T-CFTR with forskolin/IBMX in coinjected oocytes. Login to comment
154 The whole oocyte content of mENaC(beta-V5) was not altered by acute treatment with forskolin/IBMX in oocytes injected with ␣beta␥-mENaC alone, was decreased by coinjection with I148T-CFTR cRNA, and was not further decreased upon activation of I148T-CFTR by forskolin/IBMX. Login to comment
157 These data are therefore consistent with I148T-CFTR, in the absence of activation, maintaining the ability to decrease the whole oocyte expression of mENaC. Login to comment
158 This decrease in whole oocyte expression in coinjected oocytes parallels the decrease in surface expression and may result from I148T-CFTR decreasing the synthesis of mENaC and its trafficking to the oocyte membrane or increasing the rate at which mENaC is degraded either before or after reaching the plasma membrane. Login to comment
159 Interregulation of I148T-CFTR and ␣beta␥ mENaC after IBMX/forskolin/genistein stimulation. Login to comment
160 We examined whether the CFTR potentiator genistein, which improves functional interactions between ␣beta␥-mENaC and the G551D-CFTR and ⌬F508-CFTR mutants (33, 34), is similarly able to restore I148T-CFTR`s regulatory interactions with mENaC. Login to comment
161 As shown in Fig. 4A, the amiloride-insensitive, or I148T-CFTR-mediated, component of the forskolin/IBMX/genistein-stimulated whole cell current in oocytes coexpressing I148T-CFTR and ␣beta␥-mENaC was 1.7-fold greater than the forskolin/IBMX/ gensitein-stimulated current measured in oocytes expressing I148T-CFTR alone (I148T-CFTR: -3.06 Ϯ 0.81 ␮A, n ϭ 21 vs. I148T-CFTR/␣beta␥-mENaC: -5.29 Ϯ 0.81 ␮A, n ϭ 23, P ϭ 0.005). Login to comment
162 As described above, I148T-CFTR-mediated currents were increased approximately threefold with the addition of genistein alone (Fig. 1B), and coinjected oocytes had no greater amiloride-insensitive forskolin/IBMX-stimulated currents than oocytes injected with I148T-CFTR alone (Fig. 2A). Login to comment
163 In contrast, I148T-CFTR/mENaC coinjected oocytes had ϳ5.5-fold greater current with addition of genistein (-5.29 Ϯ 0.81 ␮A, n ϭ 23) than in forskolin/IBMX-stimulated oocytes injected with I148T-CFTR alone (-0.97 Ϯ 0.31 ␮A, n ϭ 19). Login to comment
164 These data suggest synergistic enhancement of I148T-CFTR functional expression by genistein and ␣beta␥-mENaC in the presence forskolin/IBMX, and are qualitatively similar to our previous observations of synergistic activation of G551D-CFTR by genistein and ␣beta␥-mENaC (33). Login to comment
165 These data are therefore consistent with genistein improving the regulation of I148T-CFTR by ␣beta␥-mENaC in oocytes. Login to comment
167 Influence of genistein on the regulatory interactions between I148T-CFTR and ␣beta␥-mENaC. Login to comment
168 I148T-CFTR (10 ng of cRNA) and ␣beta␥-mENaC (0.33 ng cRNA/subunit) were expressed separately or together in oocytes, and TEV was performed as described in EXPERIMENTAL PROCEDURES. A: changes in whole cell currents (-100 mV holding potential) after stimulation with 10 ␮M forskolin/100 ␮M IBMX/50 ␮M genistein that were not inhibited by 10 ␮M amiloride. Login to comment
169 B: amiloride-sensitive whole cell currents (-100 mV holding potential) were determined in oocytes expressing ␣beta␥-mENaC or coexpressing ␣beta␥-mENaC and I148T-CFTR before (open bars) and after (shaded bars) stimulation with 10 ␮M forskolin/100 ␮M IBMX/50 ␮M genistein. Login to comment
170 Data obtained from the same I148T-CFTR/␣beta425;-mENaC coinjected oocytes are presented in A and B. Values are means Ϯ SE. Login to comment
171 C607REGULATORY INTERACTIONS OF I148T-CFTR AND ENaC AJP-Cell Physiol • VOL 292 • JANUARY 2007 • www.ajpcell.org -4.44 Ϯ 1.12 ␮A (ϩforskolin/IBMX/genistein) n ϭ 17, P ϭ 0.048] in oocytes injected with ␣beta␥-mENaC alone (Fig. 4B). Login to comment
172 In oocytes coexpressing ␣beta␥-mENaC and I148T-CFTR, the amiloride-sensitive currents did not change following stimulation with forskolin/IBMX/gensitein [-0.82 Ϯ 0.17 ␮A (-forskolin/IBMX/gensitein) vs. -0.84 Ϯ 0.18 (ϩforskolin/IBMX/ genistein), n ϭ 23, P ϭ NS]. Login to comment
173 These data are similar to our previous observations with WT-, ⌬F508-, and G551D-CFTR, where this forskolin/IBMX/genistein stimulation in mENaC-mediated current observed in oocytes injected with ␣beta␥- mENaC alone was not present in CFTR/␣beta␥-mENaC coinjected oocytes; such data are consistent with improved regulation of ␣beta␥-mENaC by the forskolin/IBMX-activated mutant CFTRs in the presence of genistein (33, 34). Login to comment
174 We performed surface biotinylation and whole oocyte expression experiments to probe the mechanism by which genistein acts on mENaC and influences mENaC regulation by activated I148T-CFTR (Fig. 5). Login to comment
175 Data shown in Fig. 5A suggest that mENaC(beta-V5) expression at the oocyte surface was unaltered by treatment with forskolin/IBMX/genistein in oocytes injected with ␣beta␥-mENaC alone, was decreased with coinjection of I148T-CFTR in the absence of forskolin/IBMX/ genistein activation, and was further decreased upon activation of I148T-CFTR with forskolin/IBMX/genistein in coinjected oocytes. Login to comment
178 Furthermore, in coinjected oocytes, mENaC(beta-V5) surface expression acutely decreased upon activation of I148T-CFTR with forskolin/IBMX/genistein. Login to comment
180 These data are therefore consistent with genistein restoring the regulation of mENaC surface expression by activated I148T-CFTR. Login to comment
182 Similar to Fig. 3B, the whole oocyte content of mENaC(beta-V5) was not altered by acute treatment with forskolin/IBMX/genistein in oocytes injected with ␣beta␥- mENaC alone, was decreased by coinjection with I148T-CFTR cRNA, and was not further decreased upon activation of I148T-CFTR by forskolin/IBMX/genistein. Login to comment
183 These data are consistent with genistein not acutely altering whole oocyte expression of mENaC in oocytes injected with either ␣beta␥- mENaC alone or upon activation of I148T-CFTR in coinjected oocytes. Login to comment
186 ␣beta␥-mENaC (0.33 ng cRNA/subunit) where the beta-subunit contained a COOH-terminal V5 epitope was expressed in oocytes without or with I148T-CFTR (10 ng of cRNA). Login to comment
200 In the present study, we assessed the functional interactions of I148T-CFTR and mENaC to gain further insight into the mechanism underlying these interactions, as well as to examine in more detail potential functional defects in I148T-CFTR. Login to comment
201 These findings are discussed in the context of our group`s previous observations regarding the interactions of mENaC with WT-, ⌬F508-, and G551D-CFTR, which are summarized in Table 1. Login to comment
202 I148T-CFTR/mENaC functional interactions. Login to comment
203 Previous observations that I148T-CFTR maintains robust chloride transport function but may be clinically associated with a CF phenotype, perhaps because of an inability to regulate bicarbonate transport (9), prompted us to test the hypothesis that I148T-CFTR may also have defective interactions with ENaC. Login to comment
204 Of note, the I148T-CFTR construct used in this work, and in the work of Choi et al. Login to comment
205 (9), did not harbor a second mutation in cis, 3199del6, which causes deletion of I1023 and V1024, as has been described in patients with CF and an I148T allele. Login to comment
207 Thus any functional defects in I148T-CFTR noted in this or the previous studies regarding bicarbonate transport (9) are solely due to the I148T mutation and are not potentially confounded by a second mutation in cis. Login to comment
208 Our data confirm the observations of others (9) that I148T-CFTR maintains the ability to transport chloride at levels similar to WT-CFTR. Login to comment
209 However, despite this robust chloride transport, we found that I148T-CFTR had functional and regulatory interactions with mENaC that differed significantly from those of WT-CFTR previously observed by our group (34, 37). Login to comment
210 These data provide additional molecular support for the hypothesis that I148T-CFTR may be associated with a clinically apparent CF phenotype due to aberrant functional interactions with the transporters of other ions that result in defective regulation of transport of these other ions, such as Naϩ and bicarbonate, in epithelia. Login to comment
216 Furthermore, our present data suggest that forskolin/IBMX-stimulated I148T-CFTR does not acutely alter mENaC functional and surface expression despite the presence of robust ability to transport chloride. Login to comment
219 We have not directly measured changes in intracellular Cl- because of expression of WT- vs. I148T-CFTR in these experiments. Login to comment
220 However, it seems somewhat unlikely to us that intracellular Cl- would increase significantly more with activation of WT- vs. I148T-CFTR given the similar levels of whole oocyte CFTR-mediated current measured by TEV in the present study for I148T-CFTR and in our previous studies for WT-CFTR (34, 37). Login to comment
225 Wild type N/A Same Decrease* Decrease* Increased 34, 37 ⌬F508 NBD-1 Decreased No change No change No change 34 G551D NBD-1 Same Decrease No change Increased 33 I148T Intracellular loop 1 Same Decrease* No change* No change Present study WT, wild type; mENaC, murine epithelial sodium channel; NBD-1, nucleotide binding domain-1. Login to comment
227 C609REGULATORY INTERACTIONS OF I148T-CFTR AND ENaC AJP-Cell Physiol • VOL 292 • JANUARY 2007 • www.ajpcell.org regulation, these data also implicate NBD-1 as a critical element in such regulation. Login to comment
228 That a similar NBD-1/R peptide fragment containing the G551D mutation (20) and the CFTR mutants G551D (33) and ⌬F508 (34) do not manifest forskolin/ IBMX-regulated inhibition of ENaC also suggests that a structurally and functionally intact NBD-1 is required for this regulatory interaction. Login to comment
229 At first glance, I148T-CFTR should have a structurally and functionally intact NBD-1, because this mutation is located within CFTR`s first cytoplasmic loop. Login to comment
230 One would therefore have predicted that I148T-CFTR should demonstrate forskolin/ IBMX-dependent inhibition of mENaC functional and surface expression. Login to comment
231 Since I148T-CFTR does not acutely decrease mENaC functional activity and surface expression upon stimulation, these data suggest either that domains of CFTR other than NBD-1 may be important in the regulatory interactions of CFTR and mENaC or that changes in CFTR`s first cytoplasmic loop may influence NBD-1 form and/or function. Login to comment
235 Genistein potentiates CFTR (WT, ⌬F508, and G551D) chloride transport by increasing channel open probability (1, 36). Login to comment
237 In the present study, we have demonstrated that genistein is able to potentiate chloride transport by I148T-CFTR, to enable mENaC to potentiate chloride transport by I148T-CFTR in a synergistic fashion, and to restore the ability of activated I148T-CFTR to acutely decrease the surface expression of mENaC in coinjected oocytes. Login to comment
238 These latter two observations suggest that genistein improves the regulatory interactions of I148T-CFTR with mENaC. Login to comment
239 These effects are similar to genistein`s actions to potentiate ⌬F508- and G551D-CFTR-mediated chloride transport and improve the regulatory interactions of these mutants with mENaC (33, 34). Login to comment
241 Our data suggest that genistein slightly increases mENaC functional expression without altering surface expression in the absence of CFTR but is also able to "repair" the regulatory interactions between I148T-CFTR and mENaC. Login to comment
242 If there is a common mechanism by which activated CFTR regulates HCO3 - transport and ENaC trafficking/surface expression, we can speculate that genistein may also repair regulation of HCO3 - transport by I148T-CFTR. Login to comment
243 In conclusion, we have demonstrated that I148T-CFTR has abnormal regulatory interactions with mENaC in Xenopus oocytes despite maintaining robust levels of chloride transport. Login to comment
245 These data provide further molecular and physiological evidence that the I148T mutation is associated with significant CFTR regulatory dysfunction and are consistent with I148T being a CF disease-causing mutation. Login to comment
134 Fig. 3. Influence of I148T-CFTR on surface and whole oocyte expression of mENaC. Login to comment
149 As shown in Fig. 3A, mENaC(beta-V5) expression at the oocyte surface was unaltered by treatment with forskolin/IBMX in oocytes injected with ␣beta␥-mENaC alone and decreased after coinjection of I148T-CFTR in the absence of forskolin/IBMX activation. Login to comment
153 The whole oocyte content of mENaC(beta-V5) was not altered by acute treatment with forskolin/IBMX in oocytes injected with ␣beta␥-mENaC alone, was decreased by coinjection with I148T-CFTR cRNA, and was not further decreased upon activation of I148T-CFTR by forskolin/IBMX. Login to comment
156 These data are therefore consistent with I148T-CFTR, in the absence of activation, maintaining the ability to decrease the whole oocyte expression of mENaC. Login to comment
166 I148T-CFTR (10 ng of cRNA) and ␣beta␥-mENaC (0.33 ng cRNA/subunit) were expressed separately or together in oocytes, and TEV was performed as described in EXPERIMENTAL PROCEDURES. A: changes in whole cell currents (-100 mV holding potential) after stimulation with 10 ␮M forskolin/100 ␮M IBMX/50 ␮M genistein that were not inhibited by 10 ␮M amiloride. Login to comment
176 Furthermore, in coinjected oocytes, mENaC(beta-V5) surface expression acutely decreased upon activation of I148T-CFTR with forskolin/IBMX/genistein. Login to comment
181 These data are consistent with genistein not acutely altering whole oocyte expression of mENaC in oocytes injected with either ␣beta␥- mENaC alone or upon activation of I148T-CFTR in coinjected oocytes. Login to comment
197 In the present study, we assessed the functional interactions of I148T-CFTR and mENaC to gain further insight into the mechanism underlying these interactions, as well as to examine in more detail potential functional defects in I148T-CFTR. Login to comment
199 I148T-CFTR/mENaC functional interactions. Login to comment
206 However, despite this robust chloride transport, we found that I148T-CFTR had functional and regulatory interactions with mENaC that differed significantly from those of WT-CFTR previously observed by our group (34, 37). Login to comment
213 Furthermore, our present data suggest that forskolin/IBMX-stimulated I148T-CFTR does not acutely alter mENaC functional and surface expression despite the presence of robust ability to transport chloride. Login to comment
217 However, it seems somewhat unlikely to us that intracellular Cl- would increase significantly more with activation of WT- vs. I148T-CFTR given the similar levels of whole oocyte CFTR-mediated current measured by TEV in the present study for I148T-CFTR and in our previous studies for WT-CFTR (34, 37). Login to comment
222 Wild type N/A Same Decrease* Decrease* Increased 34, 37 ⌬F508 NBD-1 Decreased No change No change No change 34 G551D NBD-1 Same Decrease No change Increased 33 I148T Intracellular loop 1 Same Decrease* No change* No change Present study WT, wild type; mENaC, murine epithelial sodium channel; NBD-1, nucleotide binding domain-1. Login to comment
224 C609REGULATORY INTERACTIONS OF I148T-CFTR AND ENaC AJP-Cell Physiol • VOL 292 • JANUARY 2007 • www.ajpcell.org regulation, these data also implicate NBD-1 as a critical element in such regulation. Login to comment
226 At first glance, I148T-CFTR should have a structurally and functionally intact NBD-1, because this mutation is located within CFTR`s first cytoplasmic loop. Login to comment
234 In the present study, we have demonstrated that genistein is able to potentiate chloride transport by I148T-CFTR, to enable mENaC to potentiate chloride transport by I148T-CFTR in a synergistic fashion, and to restore the ability of activated I148T-CFTR to acutely decrease the surface expression of mENaC in coinjected oocytes. Login to comment
240 In conclusion, we have demonstrated that I148T-CFTR has abnormal regulatory interactions with mENaC in Xenopus oocytes despite maintaining robust levels of chloride transport. Login to comment

[hide] Identification of CFTR, PRSS1, and SPINK1 mutation... Pancreas. 2006 Oct;33(3):221-7. Keiles S, Kammesheidt A
Identification of CFTR, PRSS1, and SPINK1 mutations in 381 patients with pancreatitis.
Pancreas. 2006 Oct;33(3):221-7., [PMID:17003641]

Abstract [show]
OBJECTIVES: Chronic pancreatitis is a progressive inflammatory disorder leading to irreversible exocrine and/or endocrine impairment. It is well documented that mutations in the cationic trypsinogen (PRSS1) gene can cause hereditary pancreatitis. Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) and the serine protease inhibitor Kazal type 1 (SPINK1) genes are also associated with pancreatitis. METHODS: We analyzed 381 patients with a primary diagnosis of chronic or recurrent pancreatitis using the Ambry Test: Pancreatitis to obtain comprehensive genetic information for the CFTR, SPINK1, and PRSS1 genes. RESULTS: The results identified 32% (122/381) of patients with 166 mutant CFTR alleles, including 12 novel CFTR variants: 4375-20 A>G, F575Y, K598E, L1260P, G194R, F834L, S573C, 2789 + 17 C>T, 621+83 A>G, T164S, 621+25 A>G, and 3500-19 G>A. Of 122 patients with CFTR mutations, 5.5% (21/381) also carried a SPINK1 mutation, and 1.8% (7/381) carried a PRSS1 mutation. In addition, 8.9% (34/381) of all patients had 1 of 11 different SPINK1 mutations. Another 6.3% (24/381) of the patients had 1 of 8 different PRSS1 mutations. Moreover, 1.3% of the patients (5/381) had 1 PRSS1 and 1 SPINK1 mutation. A total 49% (185/381) of the patients carried one or more mutations. CONCLUSIONS: Comprehensive testing of the CFTR, PRSS1, and SPINK1 genes identified genetic variants in nearly half of all subjects considered by their physicians as candidates for genetic testing. Comprehensive test identified numerous novel variants that would not be identified by standard clinical screening panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Patients With 1 CFTR Mutation CFTR Mutation 1 No. of Patients 1717-1 G9A 1 2789+5 G9A 1 3849+10kb C9T 2 3849+45 G9A 1 621+3 A9G 2 A1364V 1 A349V 1 A455E 1 D1152H 1 D1445N 1 deltaF508 16 E217G 1 F1286C 1 F316L 1 G542X 1 G551D 1 I148T 1 I807M 1 L206W 1 L967S 2 L997F 2 P55S 1 Q179K 1 Q220X 1 R117H 3 R1453W 1 R297Q 1 R31C 1 R668C 2 S1235R 1 S573C 1 S945L 1 V562A 1 V754M 2 Y1092X 1 Total patients 58 MutationsinboldfacewouldnothavebeendetectedbytheACOG/ACMGmutationpanel. Login to comment

[hide] Regulatory interactions of N1303K-CFTR and ENaC in... Am J Physiol Cell Physiol. 2007 Apr;292(4):C1553-61. Epub 2006 Dec 20. Suaud L, Yan W, Carattino MD, Robay A, Kleyman TR, Rubenstein RC
Regulatory interactions of N1303K-CFTR and ENaC in Xenopus oocytes: evidence that chloride transport is not necessary for inhibition of ENaC.
Am J Physiol Cell Physiol. 2007 Apr;292(4):C1553-61. Epub 2006 Dec 20., [PMID:17182731]

Abstract [show]
Regulatory interactions of the cystic fibrosis transmembrane conductance regulator (CFTR) and the epithelial Na(+) channel (ENaC) are readily apparent in Xenopus oocytes. However, the mechanism underlying these interactions remains controversial. CFTR's first nucleotide binding fold (NBD-1) may be important in these interactions, as dysfunctional CFTRs containing mutations within NBD-1, such as DeltaF508 and G551D, lack such functional interactions with murine ENaC (mENaC). We hypothesized that a dysfunctional CFTR containing a non-NBD-1 mutation would retain regulatory interactions with mENaC and tested this hypothesis for N1303K-CFTR, where the mutation is located in CFTR's second nucleotide binding fold (NBD-2). cRNA for alphabetagamma-mENaC and N1303K-CFTR was injected separately or together into Xenopus oocytes. ENaC and CFTR functional expression was assessed by two-electrode voltage clamp. Injection of N1303K (class II trafficking mutation) yielded low levels of CFTR function on activation with forskolin and 3-isobutyl-1-methylxanthine (IBMX). In coinjected oocytes, N1303K did not alter mENaC functional expression or surface expression before activation of N1303K. This is similar to our prior observations with DeltaF508. However, unlike our observations with DeltaF508, activation of N1303K acutely decreased mENaC functional and surface expression, and N1303K currents were enhanced by coinjection of mENaC. Furthermore, genistein only mildly enhanced the functional expression of N1303K-CFTR and did not improve regulation of ENaC by N1303K-CFTR. These data suggest that a structurally and functionally intact CFTR NBD-1 in activated CFTR can regulate mENaC surface expression independent of Cl(-) transport in Xenopus oocytes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
212 These data demonstrate synergistic enhancement of N1303K-CFTR functional expression by genistein and ␣beta␥-mENaC in the presence of forskolin-IBMX, and are similar to our previous data suggesting synergistic enhancement of G551D-CFTR (31) and I148T-CFTR (33) function by genistein and ␣beta␥-mENaC. Login to comment
253 In contrast, we recently demonstrated that activation of I148T-CFTR, which maintains the ability to transport Cl- at levels similar to WT CFTR (9, 33), did not lead to inhibition of mENaC in oocytes despite supporting significantly higher Cl-transport (33) than N1303K-CFTR did in the present experiments. Login to comment

[hide] Hereditary chronic pancreatitis. Orphanet J Rare Dis. 2007 Jan 4;2:1. Rosendahl J, Bodeker H, Mossner J, Teich N
Hereditary chronic pancreatitis.
Orphanet J Rare Dis. 2007 Jan 4;2:1., [PMID:17204147]

Abstract [show]
Hereditary chronic pancreatitis (HCP) is a very rare form of early onset chronic pancreatitis. With the exception of the young age at diagnosis and a slower progression, the clinical course, morphological features and laboratory findings of HCP do not differ from those of patients with alcoholic chronic pancreatitis. As well, diagnostic criteria and treatment of HCP resemble that of chronic pancreatitis of other causes. The clinical presentation is highly variable and includes chronic abdominal pain, impairment of endocrine and exocrine pancreatic function, nausea and vomiting, maldigestion, diabetes, pseudocysts, bile duct and duodenal obstruction, and rarely pancreatic cancer. Fortunately, most patients have a mild disease. Mutations in the PRSS1 gene, encoding cationic trypsinogen, play a causative role in chronic pancreatitis. It has been shown that the PRSS1 mutations increase autocatalytic conversion of trypsinogen to active trypsin, and thus probably cause premature, intrapancreatic trypsinogen activation disturbing the intrapancreatic balance of proteases and their inhibitors. Other genes, such as the anionic trypsinogen (PRSS2), the serine protease inhibitor, Kazal type 1 (SPINK1) and the cystic fibrosis transmembrane conductance regulator (CFTR) have been found to be associated with chronic pancreatitis (idiopathic and hereditary) as well. Genetic testing should only be performed in carefully selected patients by direct DNA sequencing and antenatal diagnosis should not be encouraged. Treatment focuses on enzyme and nutritional supplementation, pain management, pancreatic diabetes, and local organ complications, such as pseudocysts, bile duct or duodenal obstruction. The disease course and prognosis of patients with HCP is unpredictable. Pancreatic cancer risk is elevated. Therefore, HCP patients should strongly avoid environmental risk factors for pancreatic cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 However, the role of some CFTR mutations has to be reconsidered since Rohlfs et al. demonstrated that the mutation I148T in Exon 4, which was classified as a severe cystic fibrosis causing mutation, is not associated to cystic fibrosis. Login to comment
100 According to their data the complex allele 3199del6 and I148T seems to be the relevant factor [55]. Login to comment

[hide] Contribution of the CFTR gene, the pancreatic secr... Clin Genet. 2007 May;71(5):451-7. Tzetis M, Kaliakatsos M, Fotoulaki M, Papatheodorou A, Doudounakis S, Tsezou A, Makrythanasis P, Kanavakis E, Nousia-Arvanitakis S
Contribution of the CFTR gene, the pancreatic secretory trypsin inhibitor gene (SPINK1) and the cationic trypsinogen gene (PRSS1) to the etiology of recurrent pancreatitis.
Clin Genet. 2007 May;71(5):451-7., [PMID:17489851]

Abstract [show]
Acute recurrent/chronic pancreatitis (CP) is a complex multigenic disease. This is a case-control study consisting of 25 Greek patients with CP and a control population of 236 healthy Greek subjects. The whole coding area and neighboring intronic regions of the three genes were screened. Seventeen of 25 patients (68%) had mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene: nine compound heterozygotes with either mild or severe mutations and eight heterozygotes. Four patients (16%) carried CFTR-modulating haplotypes V470-TG11-T5 and V470-TG12-T7. All were negative for PRSS1 gene mutations, while variants c.486C/T and c.738C/T were found in nine patients each, three homozygotes for the minor alleles. Two carried SPINK1 gene mutation p.N34S, one being transheterozygote with CFTR mutation p.F1052V. The promoter variant -253T>C was found in four individuals (one homozygous for the minor allele), all four being transheterozygotes with mutations in the CFTR gene as well. Finally two carried c.272C/T in the 3' untranslated region, one being a p.N34S carrier as well. In total, 80% (20/25) of patients had a molecular defect in one or both of the CFTR and SPINK1 genes, suggesting that mutations/variants in the CFTR plus or minus mutations in the SPINK1, but not the PRSS1 gene, may confer a high risk for recurrent pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Nine patients (36%) were compound heterozygotes for two CFTR mutations, both mild (class IV or V): p.I148T/p.R75Q, c.278915G.A/p.R75Q or mild and severe: three with p.F508del/p.R334W and four withc.444delA/p.R334W,p.E822X/c.278915G.A, p.E822X/p.R347H and p.F508del/c.3272226A.G, each. Login to comment
84 It is especially of note that p.I148T in our patient cohort was not found linked to c.3199del6, which has been considered the classic CF causing allele (27). Login to comment
90 Mutations and variants in the CFTR gene CFTR mutation/variant Patients with pancreatitis, n ¼ 25 (%) Controlsa , n ¼ 211 (%) Classic patients with CF, n ¼ 426 (%) p vs controls p vs patients with CF p.F508del 5 (10) 2 (0.47) 465 (54.6) ,0.0001 ,0.0001 p.R334W 4 (8) - 7 (8.2) 0.00011 0.0019 c.444delA 1 (2) - 1 (0.1) c.278915G.A 2 (4) - 11 (1.3) 0.011 CFTRdel2,3 (21 kb) 1 (2) - 2 (0.2) c.E822X 2 (4) - 12 (1.5) 0.011 p.R347H 1 (2) - - 0.055 p.R1070Q 3 (6) 1 (0.24) 7 (0.8) 0.004 0.013 p.G576A 1 (2) - 1 (0.1) p.F1052V 1 (2) 4 (0.95) 1 (0.1) p.I148T 1 (2) - 1 (0.1) c.3272226A.G 1 (2) - 7 (0.82) p.R75Q 2 (4) 4 (0.95) 1 (0.1) 0.0086 c.2752215G/C 1 (2) 4 (1) 5 (0.6) TG11T7 26 (52) 286 (67.7) ND TG11T5 2 (4) 5 (1.18) ND TG10T7 8 (16) 79 (18.7) ND TG10T9 8 (16) 14 (3.3) ND 0.0005 TG12T7 2 (4) 8 (1.9) ND M470 6 (12) 48 (11.4) ND V470 8 (16) 166 (39.3) ND 0.008 CF, cystic fibrosis; ND, not determined. Login to comment

[hide] Scanning the cystic fibrosis transmembrane conduct... Clin Chem. 2007 Nov;53(11):1891-8. Epub 2007 Sep 21. Montgomery J, Wittwer CT, Kent JO, Zhou L
Scanning the cystic fibrosis transmembrane conductance regulator gene using high-resolution DNA melting analysis.
Clin Chem. 2007 Nov;53(11):1891-8. Epub 2007 Sep 21., [PMID:17890437]

Abstract [show]
BACKGROUND: Complete gene analysis of the cystic fibrosis transmembrane conductance regulator gene (CFTR) by scanning and/or sequencing is seldom performed because of the cost, time, and labor involved. High-resolution DNA melting analysis is a rapid, closed-tube alternative for gene scanning and genotyping. METHODS: The 27 exons of CFTR were amplified in 37 PCR products under identical conditions. Common variants in 96 blood donors were identified in each exon by high-resolution melting on a LightScanner(R). We then performed a subsequent blinded study on 30 samples enriched for disease-causing variants, including all 23 variants recommended by the American College of Medical Genetics and 8 additional, well-characterized variants. RESULTS: We identified 22 different sequence variants in 96 blood donors, including 4 novel variants and the disease-causing p.F508del. In the blinded study, all 40 disease-causing heterozygotes (29 unique) were detected, including 1 new probable disease-causing variant (c.3500-2A>T). The number of false-positive amplicons was decreased 96% by considering the 6 most common heterozygotes. The melting patterns of most heterozygotes were unique (37 of 40 pairs within the same amplicon), the exceptions being p.F508del vs p.I507del, p.G551D vs p.R553X, and p.W1282X vs c.4002A>G. The homozygotes p.G542X, c.2789 + 5G>A, and c.3849 + 10kbC>T were directly identified, but homozygous p.F508del was not. Specific genotyping of these exceptions, as well as genotyping of the 5T allele of intron 8, was achieved by unlabeled-probe and small-amplicon melting assays. CONCLUSIONS: High-resolution DNA melting methods provide a rapid and accurate alternative for complete CFTR analysis. False positives can be decreased by considering the melting profiles of common variants.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
145 2 223CϾT R31C 3 355CϾT R75X 386GϾA G85E 4 482GϾA R117H 575TϾC I148T 621 ؉ 1GϾTb 5 711 ؉ 1GϾT 7 1078delT 1132CϾT R334W 1150delA 1172GϾC R347P 8 1341 ϩ 18AϾCc 9 1496CϾA A455E 10 1651-1653del I507del 1653-1655del F508deld 11 1717 - 1GϾA 1756GϾT G542Xe 1784GϾA G551Db 1789CϾT R553Xf 1811GϾC R560T 12 1898 ؉ 1GϾA 13 2184delA 14b 2789 ؉ 5GϾAe 16 3120 ؉ 1GϾA 18 3500 - 2AϾTg 19 3616CϾT R1162X 3659delC Intron 19 3849 ؉ 10kbCϾTe 20 3978GϾA W1282X 21 4041CϾG N1303K 22 4178GϾA G1349Dc a Disease-causing variants recommended for genotyping by the ACMG (4) are in bold. Login to comment

[hide] One multiplex control for 29 cystic fibrosis mutat... Genet Test. 2007 Fall;11(3):256-68. Lebo RV, Bixler M, Galehouse D
One multiplex control for 29 cystic fibrosis mutations.
Genet Test. 2007 Fall;11(3):256-68., [PMID:17949287]

Abstract [show]
A simple approach is described to synthesize and clone an inexhaustible supply of any homozygous and/or heterozygous controls diluted with yeast genomic DNA to mimic human genome equivalents for use throughout the entire multiplex mutation assay. As a proof of principle, the 25 cystic fibrosis mutation panel selected by the American College of Medical Genetics and four additional mutant sequences were prepared as a single control mixture. The 29 CFTR mutations were incorporated into 17 gene fragments by PCR amplification of targeted sequences using mutagenic primers on normal human genomic DNA template. Flanking primers selected to bind beyond all published PCR primer sites amplified controls for most assay platforms. The 17 synthesized 433-933-bp CFTR fragments each with one to four homozygous mutant sequences were cloned into nine plasmid vectors at the multiple cloning site and bidirectionally sequenced. Miniplasmid preps from these nine clones were mixed and diluted with genomic yeast DNA to mimic the final nucleotide molar ratio of two CFTR genes in 6 x 10(9) bp total human genomic DNA. This mixture was added to control PCR reactions prior to amplification as the only positive control sample. In this fashion >200 multiplex clinical PCR analyses of >4,000 clinical patient samples have been controlled simultaneously for PCR amplification and substrate specificity for 29 tested mutations without cross contamination. This clinically validated multiplex cystic fibrosis control can be modified readily for different test formats and provides a robust means to control for all mutations instead of rotating human genomic controls each with a fraction of the mutations. This approach allows scores of additional mutation controls from any gene loci to be added to the same mixture annually.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
167 The I148T mutation included in clone 1 is also detected on the same strip (Fig. 3, f1, left strip). Login to comment

[hide] Molecular analysis of mutations and polymorphisms ... Reprod Biomed Online. 2008 Jul;17(1):27-35. Tamburino L, Guglielmino A, Venti E, Chamayou S
Molecular analysis of mutations and polymorphisms in the CFTR gene in male infertility.
Reprod Biomed Online. 2008 Jul;17(1):27-35., [PMID:18616886]

Abstract [show]
Mutations of the cystic fibrosis transmembrane regulator (CFTR) gene and polymorphisms, such as the (TG)m and Tn polymorphic loci in intron 8 at the splice acceptor site of exon 9, can cause male infertility. The aim of this study was to investigate the frequency of the most prevalent cystic-fibrosis-causing mutations, the IVS8-Tn alleles and IVS8-TG12 variant in the presence of IVS8-5T in patients with altered semen parameters (group I with obstructive azoospermia, group II with secretory azoospermia and group III with severe oligozoospermia) compared with a control group with normozoospermia. CFTR mutations were found in 26.5% and 14.3% of chromosomes of patients of group I and II respectively (P < 0.001, P < 0.05). The frequency of the 5T allele was 23.5% in patients in group I (P < 0.01), and was linked exclusively with TG12 allele. The present study reports for the first time a high proportion of the 5T allele in patients in group III (9.2%, P < 0.05). These results underline the importance of performing molecular analysis of mutations and IVS8-Tn polymorphism in the CFTR gene and appropriate genetic counselling to all couples undergoing assisted reproductive technologies when the partner has azoospermia or severe oligozoospermia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
136 Cystic fibrosis transmembrane regulator (CFTR) and IV.S8-Poly T genotypes according to semen parameters. Semen analysis Group 1 Total Group !l Total Group m TutuI Group IV Total CFTR genotype AF508/- AF508/- 2789+5G_^A/- N13O3K/- G542X/- - / - - / - - / - AF508/- AF508/R1I7H» NI3Ü3K/- 3849+ 10kbC_T/3849+1 O k b C ^ P - / - -/_ - / - AF5O8/- N1303K/- 3849+!0kbC-+T/- - / - - / - - / - - / - - / - - / - AF508/- N1303K/- 3849+10kbC->T/- I148T/- WI282X/- - / - - / - _/_ - / - - / - -/_ genotype 5T/9T 7T/9T 7T/7T 5T/9T 5T/9T 5T/7T 5T/9T 7T/7T 7T/9T 7T/9T 7T/9T 7T/7T 5T/7T 7T/7T 7T/9T 5T/9T 7r/7T 7T/9T 5T/5T 5T/7T 5T/9T 7T/7T 7T/9T 9T/9T 7T/9T 7T/9T 7T/7T 7T/9T 7T/7T 5T/5T 5T/7r 5T/9T 7T/7T 7T/9T 9T/9T No. Login to comment

[hide] Best practice guidelines for molecular genetic dia... Eur J Hum Genet. 2009 Jan;17(1):51-65. Epub 2008 Aug 6. Dequeker E, Stuhrmann M, Morris MA, Casals T, Castellani C, Claustres M, Cuppens H, des Georges M, Ferec C, Macek M, Pignatti PF, Scheffer H, Schwartz M, Witt M, Schwarz M, Girodon E
Best practice guidelines for molecular genetic diagnosis of cystic fibrosis and CFTR-related disorders--updated European recommendations.
Eur J Hum Genet. 2009 Jan;17(1):51-65. Epub 2008 Aug 6., [PMID:18685558]

Abstract [show]
The increasing number of laboratories offering molecular genetic analysis of the CFTR gene and the growing use of commercial kits strengthen the need for an update of previous best practice guidelines (published in 2000). The importance of organizing regional or national laboratory networks, to provide both primary and comprehensive CFTR mutation screening, is stressed. Current guidelines focus on strategies for dealing with increasingly complex situations of CFTR testing. Diagnostic flow charts now include testing in CFTR-related disorders and in fetal bowel anomalies. Emphasis is also placed on the need to consider ethnic or geographic origins of patients and individuals, on basic principles of risk calculation and on the importance of providing accurate laboratory reports. Finally, classification of CFTR mutations is reviewed, with regard to their relevance to pathogenicity and to genetic counselling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
149 I148T Was initially described as a frequent CF-causing mutation. Login to comment
151 I148T should not be routinely screened for and is currently being removed from the panels of commercial assays.25 R117H Can be found in cis with IVS8 (T)5 or (T)7. Login to comment

[hide] A novel computational and structural analysis of n... Genomic Med. 2008 Jan;2(1-2):23-32. Epub 2008 May 14. George Priya Doss C, Rajasekaran R, Sudandiradoss C, Ramanathan K, Purohit R, Sethumadhavan R
A novel computational and structural analysis of nsSNPs in CFTR gene.
Genomic Med. 2008 Jan;2(1-2):23-32. Epub 2008 May 14., [PMID:18716917]

Abstract [show]
Single Nucleotide Polymorphisms (SNPs) are being intensively studied to understand the biological basis of complex traits and diseases. The Genetics of human phenotype variation could be understood by knowing the functions of SNPs. In this study using computational methods, we analyzed the genetic variations that can alter the expression and function of the CFTR gene responsible candidate for causing cystic fibrosis. We applied an evolutionary perspective to screen the SNPs using a sequence homology-based SIFT tool, which suggested that 17 nsSNPs (44%) were found to be deleterious. The structure-based approach PolyPhen server suggested that 26 nsSNPS (66%) may disrupt protein function and structure. The PupaSuite tool predicted the phenotypic effect of SNPs on the structure and function of the affected protein. Structure analysis was carried out with the major mutation that occurred in the native protein coded by CFTR gene, and which is at amino acid position F508C for nsSNP with id (rs1800093). The amino acid residues in the native and mutant modeled protein were further analyzed for solvent accessibility, secondary structure and stabilizing residues to check the stability of the proteins. The SNPs were further subjected to iHAP analysis to identify htSNPs, and we report potential candidates for future studies on CFTR mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
125 The nsSNPs which were predicted to be Table 1 List of nsSNPs that were predicted to be deleterious by SIFT and PolyPhen SNPs ID Alleles AA change Tolerance index PSIC rs1800072 G/A V11C 1.00 0.150 rs1800073 C/T R31C 0.18 2.288 rs1800074 A/T D44V 0.01 2.532 rs1800076 G/A R75Q 0.03 1.754 rs1800078 T/C L138P 0.01 2.192 rs35516286 T/C I148T 0.41 1.743 rs1800079 G/A R170H 0.05 1.968 rs1800080 A/G S182G 0.03 1.699 rs1800086 C/G T351S 0.30 1.600 rs1800087 A/C Q353H 0.03 2.093 rs4727853 C/A N417K 1.00 0.015 rs11531593 C/A F433L 0.65 0.694 rs1800089 C/T L467F 0.15 1.568 rs213950 G/A V470M 0.17 1.432 rs1800092 C/A/G I506M 0.00 1.574 rs1801178 A/G I507V 0.38 0.314 rs1800093 T/G F508C 0.00 3.031 rs35032490 A/G K532E 1.00 1.525 rs1800097 G/A V562I 0.13 0.345 rs41290377 G/C G576A 0.33 1.262 rs766874 C/T S605F 0.03 2.147 rs1800099 A/G S654G 0.03 1.611 rs1800100 C/T R668C 0.01 2.654 rs1800101 T/C F693L 0.61 0.895 rs1800103 A/G I807M 0.01 1.554 rs1800106 T/C Y903H 0.52 0.183 rs1800107 G/T S909I 0.10 1.624 rs1800110 T/C L967S 0.07 1.683 rs1800111 G/C L997F 0.24 1.000 rs1800112 T/C I1027T 0.03 1.860 rs1800114 C/T A1067V 0.04 1.542 rs36210737 T/A M1101K 0.05 2.637 rs35813506 G/A R1102K 0.52 1.589 rs1800120 G/T R1162L 0.00 2.038 rs1800123 C/T T1220I 0.22 0.059 rs34911792 T/G S1235R 0.45 1.483 rs11971167 G/A D1270N 0.12 1.739 rs4148725 C/T R1453W 0.00 2.513 Highly deleterious by SIFT and damaging by PolyPhen are indicated as bold deleterious in causing an effect in the structure and function of the protein by SIFT, PolyPhen and Pupasuite correlated well with experimental studies (Tsui 1992; Ghanem et al. 1994; Bienvenu et al. 1998) (Table 3). Login to comment

[hide] Clinical and radiological outcome of patients suff... Pancreas. 2008 Nov;37(4):371-6. Frulloni L, Scattolini C, Graziani R, Cavestro GM, Pravadelli C, Amodio A, Manfredi R, Scarpa A, Vantini I
Clinical and radiological outcome of patients suffering from chronic pancreatitis associated with gene mutations.
Pancreas. 2008 Nov;37(4):371-6., [PMID:18953248]

Abstract [show]
OBJECTIVES: Cystic fibrosis transmembrane conductance regulator (CFTR), cationic trypsinogen gene (PRSS1), and serine protease inhibitor kazal type 1 (SPINK1) gene mutations have been associated with chronic pancreatitis (CP). The aim of this study was to compare clinical and radiological findings in sporadic CP with (CPgm) and without (CPwt) gene mutations. METHODS: Data from patients observed between 2001 and 2006 were collected. All patients were tested for 25 CFTR gene mutations, for R122H and N29I on the PRSS1 gene, and for N34S mutation on the SPINK1 gene. RESULTS: We found 34 (17.2%) of 198 patients with CPgm, 23 (11.6%) of them on the CFTR gene, 11 (5.6%) on the SPINK1, and none on the PRSS1 gene. The age at clinical onset was younger in CPgm (36.2 +/- 17.2 years) than in CPwt (44 +/- 12.6 years; P = 0.005). There were more heavy drinkers among CPwt (33%) than among CPgm (9%; P = 0.003), and the same applied to smokers (69% vs 33%, respectively; P < 0.0001). In CPgm group, the onset of pancreatic calcifications was observed more frequently in drinkers and/or smokers. Exocrine and endocrine insufficiency occurred less frequently and later in CPgm than in CPwt patients. CONCLUSIONS: Clinical and radiological outcome differ in CPgm compared with CPwt. Alcohol, even in small quantities, and cigarette smoking influence the onset of pancreatic calcifications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 All patients were tested for 25 CFTR gene mutations ($F508, $I507, R117H, R1162X, 2183AAYG, N1303K, 3849 + 10KbCYT, G542X, G551D, 1717-1GYA, R347P, R352Q, R553X, Q552X, G85E, 711 + 5GYA, W1282X, 3272-26AYG, 3132delTG, R334W, I148T, 3659del_C, 3120 + 1GYA, 1898 + 1GYA, and 2789 + 5GYA), which cover approximately 72% of the cystic fibrosis mutations in the Italian population. Login to comment

[hide] Clinical practice and genetic counseling for cysti... Genet Med. 2008 Dec;10(12):851-68. Moskowitz SM, Chmiel JF, Sternen DL, Cheng E, Gibson RL, Marshall SG, Cutting GR
Clinical practice and genetic counseling for cystic fibrosis and CFTR-related disorders.
Genet Med. 2008 Dec;10(12):851-68., [PMID:19092437]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator-related disorders encompass a disease spectrum from focal male reproductive tract involvement in congenital absence of the vas deferens to multiorgan involvement in classic cystic fibrosis. The reproductive, gastrointestinal, and exocrine manifestations of cystic fibrosis transmembrane conductance regulator deficiency are correlated with CFTR genotype, whereas the respiratory manifestations that are the main cause of morbidity and mortality in cystic fibrosis are less predictable. Molecular genetic testing of CFTR has led to new diagnostic strategies and will enable targeting of molecular therapies now in development. Older diagnostic methods that measure sweat chloride and nasal potential difference nonetheless remain important because of their sensitivity and specificity. In addition, the measurement of immunoreactive trypsinogen and the genotyping of CFTR alleles are key to newborn screening programs because of low cost. The multiorgan nature of cystic fibrosis leads to a heavy burden of care, thus therapeutic regimens are tailored to the specific manifestations present in each patient. The variability of cystic fibrosis lung disease and the variable expressivity of mild CFTR alleles complicate genetic counseling for this autosomal recessive disorder. Widespread implementation of newborn screening programs among populations with significant cystic fibrosis mutation carrier frequencies is expected to result in increasing demands on genetic counseling resources.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
155 A longer TG tract (12 or 13) in conjunction Table 7 Molecular genetic testing used in CFTR-related disorders Test method Mutations detected Population Mutation detection rate (%) Targeted mutation analysis117,118 CFTR mutations using the original 25-mutation panela Ashkenazi Jewish 97 Non-Hispanic white 88.3 African American 69 Hispanic American 57 Asian American Unknown Sequence analysis73 CFTR sequence variantsb All groups 98.7 Deletion analysis CFTR exonic and whole gene deletions All groups Unknown a The original 25-mutation panel recommended by the ACMG includes the mutations listed in Table 3 as well as 1078delT and I148T.117 The 23-mutation panel recommended in 2004 is expected to have a similar mutation detection rate.7 Other panels may have significantly different mutation detection rates. Login to comment

[hide] A novel approach to CFTR mutation testing by pyros... Clin Chem. 2009 Jun;55(6):1083-91. Epub 2009 Apr 16. Bickmann JK, Kamin W, Wiebel M, Hauser F, Wenzel JJ, Neukirch C, Stuhrmann M, Lackner KJ, Rossmann H
A novel approach to CFTR mutation testing by pyrosequencing-based assay panels adapted to ethnicities.
Clin Chem. 2009 Jun;55(6):1083-91. Epub 2009 Apr 16., [PMID:19372188]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is a common autosomal recessive genetic disorder caused by a variety of sequence alterations in the CFTR gene [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)]. Because the relative prevalence of mutations strongly depends on the ethnic background, first-level testing of CF as defined by recent consensus recommendations ought to be adaptable to the ethnicity of patients. METHODS: We therefore developed and implemented a diagnostic approach to first-level testing for CF based on published mutation frequencies and Pyrosequencing (PSQ) technology that we complemented with standard procedures of mutation detection at the second level. RESULTS: The current test system of PSQ assays for 46 target CF mutations [including CFTRdele2,3 (21 kb) and 1342-6 (T)(n) (5T/7T/9T)] permits recombinations of single assays to optimize sensitivities for certain ethnicities. By easy expansion of the original mutation panel, the first-level test sensitivities with other ethnic groups would be increased, provided that the mutation frequencies are known. The test was validated with our local, ethnically mixed, but mainly German population (155 patients). The mutation-detection rate for the 92 patients whose CF was confirmed by the sweat test was 89.0% for the patients of German descent (73 of the 92 patients) and 73.7% for the patients of any other origin (19 of the 92 patients). Ethnicity-adapted testing panels for our foreign CF patients would increase the sensitivities for the respective groups by approximately 5%. CONCLUSIONS: PSQ-based genotyping is a reliable, convenient, highly flexible, and inexpensive alternative to conventional methods for first-level testing of CFTR, facilitating flexible adaptation of the analyzed mutation panel to any local ethnic group.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
86 The resulting PSQ assays targeted 44 CF/CBAVD mutations (potential detection of adjacent mutations not included) and 2 variations [I148T and 1342-6 (T)n (5T/7T/9T)]. Login to comment

[hide] Mutation-specific potency and efficacy of cystic f... J Pharmacol Exp Ther. 2009 Sep;330(3):783-91. Epub 2009 Jun 2. Caputo A, Hinzpeter A, Caci E, Pedemonte N, Arous N, Di Duca M, Zegarra-Moran O, Fanen P, Galietta LJ
Mutation-specific potency and efficacy of cystic fibrosis transmembrane conductance regulator chloride channel potentiators.
J Pharmacol Exp Ther. 2009 Sep;330(3):783-91. Epub 2009 Jun 2., [PMID:19491324]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channel. The mutations G551D and G1349D, which affect the nucleotide-binding domains (NBDs) of CFTR protein, reduce channel activity. This defect can be corrected pharmacologically by small molecules called potentiators. CF mutations residing in the intracellular loops (ICLs), connecting the transmembrane segments of CFTR, may also reduce channel activity. We have investigated the extent of loss of function caused by ICL mutations and the sensitivity to pharmacological stimulation. We found that E193K and G970R (in ICL1 and ICL3, respectively) cause a severe loss of CFTR channel activity that can be rescued by the same potentiators that are effective on NBD mutations. We compared potency and efficacy of three different potentiators for E193K, G970R, and G551D. The 1,4-dihydropyridine felodipine and the phenylglycine PG-01 [2-[(2-1H-indol-3-yl-acetyl)-methylamino]-N-(4-isopropylphenyl)-2-phenylac etamide] were strongly effective on the three CFTR mutants. The efficacy of sulfonamide SF-01 [6-(ethylphenylsulfamoyl)-4-oxo-1,4-dihydroquinoline-3-carboxylic acid cycloheptylamide], another CFTR potentiator, was instead significantly lower than felodipine and PG-01 for the E193K and G970R mutations, and almost abolished for G551D. Furthermore, SF-01 modified the response of G551D and G970R to the other two potentiators, an effect that may be explained by an allosteric antagonistic effect. Our results indicate that CFTR potentiators correct the basic defect caused by CF mutations residing in different CFTR domains. However, there are differences among potentiators, with felodipine and PG-01 having a wider pharmacological activity, and SF-01 being more mutation specific. Our observations are useful in the prioritization and development of drugs targeting the CF basic defect.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
91 To this respect, we considered I148T, I175V, Q179K, and E193K in ICL1 (Seibert et al., 1997) and G970R in ICL3 (Seibert et al., 1996). Login to comment
99 In contrast, I148T and Q179K had a forskolin response that was 45 to 55% than that of the normal protein, a behavior that is not consistent with such amino acid changes being CF-causing mutations (Fig. 1A). Login to comment
222 However, I148T and Q179K activity was ϳ50% that of wild-type CFTR. Login to comment
224 In fact, it has been shown that I148T is in linkage disequilibrium with a deletion of two amino acids (3199del6) localized more distantly toward the carboxyl terminus (Rohlfs et al., 2002; Monaghan et al., 2004) and that this latter sequence change is the one causing CFTR loss of function. Login to comment
228 Therefore, it is possible that some mutations such as I175V and I148T have a more profound effect on CFTR as a regulator of other proteins (Schreiber et al., 1999). Login to comment

[hide] Connections between genetics and clinical data: Ro... Am J Gastroenterol. 2010 Jan;105(1):199-206. Epub 2009 Oct 20. Cavestro GM, Zuppardo RA, Bertolini S, Sereni G, Frulloni L, Okolicsanyi S, Calzolari C, Singh SK, Sianesi M, Del Rio P, Leandro G, Franze A, Di Mario F
Connections between genetics and clinical data: Role of MCP-1, CFTR, and SPINK-1 in the setting of acute, acute recurrent, and chronic pancreatitis.
Am J Gastroenterol. 2010 Jan;105(1):199-206. Epub 2009 Oct 20., [PMID:19844201]

Abstract [show]
OBJECTIVES: Acute, acute recurrent, and chronic pancreatitis are inflammatory diseases with multifactorial pathogenic mechanisms. Genetic mutations and polymorphisms have been correlated with pancreatitis. The aim of this study was to investigate the association of cystic fibrosis transmembrane conductance regulator (CFTR) and serine protease inhibitor Kazal type 1 (SPINK-1) gene mutations and monocyte chemoattractant protein 1 (MCP-1) -2518A/G polymorphism with acute pancreatitis (AP), acute recurrent pancreatitis (ARP), and chronic pancreatitis (CP), and to associate genetic backgrounds with clinical phenotype in these three conditions. METHODS: One hundred eighteen AP, 64 ARP, 142 CP patients, and 88 normal controls were enrolled consecutively. We analyzed MCP-1 serum levels using enzyme-linked immunosorbent assay. Polymorphism -2518 of MCP-1 and SPINK-1 N34S gene mutations were determined by PCR-restriction-fragment length polymorphism. Sequence analysis was performed when necessary. Thirty-three CFTR mutations were analyzed in CP and ARP patients using multiplex DNA testing. RESULTS: Serum MCP-1 levels were significantly higher in all patients affected by pancreatic inflammatory diseases. Moreover, we found a significant over-representation of the MCP-1G allele in ARP patients. We found a statistically significant association of CFTR gene mutations with ARP, but not with CP. We did not find a statistically significant association of ARP or CP with the N34S SPINK-1 gene mutation. Interestingly, 39 of 64 ARP patients (61%) carried at least one genetic mutation and/or polymorphism. Five of 64 ARP patients had pancreas divisum and four of these five also carried the G allele. CONCLUSIONS: Analysis of a comprehensive range of potential susceptibility variants is needed to support modeling of the effects of genes and environment in pancreatitis. As such, beyond gene mutations, the context within which those mutations exist must be considered. In pancreatitis the context includes the inflammatory response, clinical features, and exogenous factors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
90 Seven patients were heterozygous for the ΔF508 gene mutation; one patient was compound-heterozygous for the I148T and 711+1GtoT gene mutations. Login to comment
114 Endogenous and exogenous factors in ARP patients Sex Age Pancreas divisum SPINK-1 N34S mutation CFTR gene mutations MCP-1 G polymorphism Alcohol ≤10g/day Alcohol 10-40g/day Alcohol >40g/day M 39 Yes wt/wt No G/G (10-40) M 18 No N34S/wt No A/G ≤10 F 20 Yes wt/wt No A/G ≤10 F 27 No wt/wt No A/G ≤10 M 39 No wt/wt delF508/wt A/G (10-40) M 26 No wt/wt No A/G >40 M 30 No wt/wt No A/G ≤10 M 49 No wt/wt No A/G (10-40) F 33 Yes wt/wt No A/G ≤10 F 22 No wt/wt No A/G ≤10 F 31 Yes wt/wt No A/G ≤10 M 74 No wt/wt No A/G ≤10 F 35 No wt/wt No A/G ≤10 M 33 No wt/wt delF508/wt A/G ≤10 M 46 No wt/wt No A/G ≤10 M 40 No wt/wt No A/G ≤10 F 60 No wt/wt No G/G ≤10 M 50 No wt/wt No A/G ≤10 F 43 No wt/wt No A/G ≤10 M 23 No wt/wt No A/G ≤10 M 23 No wt/wt No A/G >40 F 55 No wt/wt No A/G ≤10 M 48 No wt/wt No A/G ≤10 M 50 No wt/wt No A/G >40 M 37 No wt/wt No A/G >40 M 33 No wt/wt delF508/wt A/G >40 F 33 No wt/wt No A/G ≤10 F 36 No wt/wt No G/G ≤10 F 64 No wt/wt delF508/wt A/G ≤10 M 28 No wt/wt No A/G (10-40) M 68 No wt/wt No G/G ≤10 F 46 No wt/wt No G/G ≤10 M 22 No wt/wt No A/G (10-40) F 21 No wt/wt delF508/wt A/G ≤10 M 37 No wt/wt I148T/wt and 711+1GtoT/wt A/G >40 F 34 No wt/wt No A/G ≤10 M 62 No delF508/wt A/G (10-40) F 32 No wt/wt No A/G ≤10 M 31 No wt/wt delF508/wt A/A ≤10 M 34 Yes wt/wt No A/A ≤10 ARP, acute recurrent pancreatitis. Login to comment
125 Furthermore, we found that 18 ARP patients (28.1%) were alcohol consumers with a mean intake of 57.1±48.8g/day. Only five (7.8%) of them had daily alcohol intake≥80g/dayandtheyallpossessedtheGalleleoftheMCP-1 gene. Two of these patients also had the CFTR heterozygous genemutation:onewithΔF508mutationandtheotheronewith compound heterozygosity (I148T; 711+1GtoT). Login to comment

[hide] Is CFTR 621+3 A>G a cystic fibrosis causing mutati... J Hum Genet. 2010 Jan;55(1):23-6. Epub 2009 Nov 6. Forzan M, Salviati L, Pertegato V, Casarin A, Bruson A, Trevisson E, Di Gianantonio E, Clementi M
Is CFTR 621+3 A>G a cystic fibrosis causing mutation?
J Hum Genet. 2010 Jan;55(1):23-6. Epub 2009 Nov 6., [PMID:19893581]

Abstract [show]
The 621+3 A>G variant of the CFTR gene was initially detected in four Greek patients with a severe form of cystic fibrosis, and it is reported to impair CFTR mRNA splicing. We present three lines of evidence that argue against the pathogenicity of this variant. First, its allelic frequency in the Italian population was 0.4%. Even considering the lowest value in the confidence interval we would expect 10% of Italian CF patients to be heterozygotes for this variant, whereas it has been reported only in one patient (0.04% of Italian CF patients). Second, expression of the 621+3 A>G variant in HeLa cells using a hybrid minigene showed that 39.5+/-1.1% of transcripts were correctly spliced, indicating that its effects on mRNA splicing are similar to those of the CFTR intron 8 5T variant, associated with congenital bilateral absence of vas deferens (CBAVD), but not with CF. Third, we have identified an asymptomatic individual who harbored the 621+3 A>G variant in trans with the Q552X mutation. Because 621+3 A>G is often included in population-screening programs, this information is critical to provide adequate counseling to patients. Further work should be aimed at investigating whether this variant may have a role in CBAVD or atypical CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
11 An example is the I148T variant initially reported as a CF mutation, which is now considered a non-pathogenic nucleotide change.3 We have chosen to study the 621+3 A4G nucleotide change because one of us had tested positive for this variant during a CFscreening program. Login to comment
92 However, this technique cannot detect heterozygous deletions of individual exons, that may be present in up to 60% of classic CF patients in whom a single-point mutation is detected.20 This case is similar to that of the I148T variant, which by itself is not a CF disease-causing mutation, but in some patients it is found in cis with the 3199del6 mutation.21 Extensive analysis of CFTR, including gene rearrangements, should be performed in all patients with typical CF symptoms harboring the 621+3 A4G allele, to identify a possible other mutation in cis with this variant, which could account for the severe phenotype. Login to comment
139 21 Monaghan, K. G., Highsmith, W. E., Amos, J., Pratt, V. M., Roa, B., Friez, M. et al. Genotype-phenotype correlation and frequency of the 3199del6 cystic fibrosis mutation among I148T carriers: results from a collaborative study. Login to comment
101 3 Claustres, M., Altieri, J. P., Guittard, C., Templin, C., Chevalier-Porst, F. & Des Georges, M. Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations? Login to comment

[hide] A 10-year large-scale cystic fibrosis carrier scre... J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7. Picci L, Cameran M, Marangon O, Marzenta D, Ferrari S, Frigo AC, Scarpa M
A 10-year large-scale cystic fibrosis carrier screening in the Italian population.
J Cyst Fibros. 2010 Jan;9(1):29-35. Epub 2009 Nov 7., [PMID:19897426]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is one of the most common autosomal recessive genetic disorders, with the majority of patients born to couples unaware of their carrier status. Carrier screenings might help reducing the incidence of CF. METHODS: We used a semi-automated reverse-dot blot assay identifying the 47 most common CFTR gene mutations followed by DGGE/dHPLC analysis. RESULTS: Results of a 10-year (1996-2006) CF carrier screening on 57,999 individuals with no prior family history of CF are reported. Of these, 25,104 were couples and 7791 singles, with 77.9% from the Italian Veneto region. CFTR mutations were found in 1879 carriers (frequency 1/31), with DeltaF508 being the most common (42.6%). Subjects undergoing medically assisted reproduction (MAR) had significantly (p<0.0001) higher CF carrier frequency (1/22 vs 1/32) compared to non-MAR subjects. CONCLUSIONS: If coupled to counselling programmes, CF carrier screening tests might help reducing the CF incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 Differently from previous reports, point mutation I148T was never found in close association with 3199del6 and similarly 3601-111 G→C with 1811+1,2KB A→G. Login to comment
130 Recently, a study of 335,204 patients screened for their CF carrier status revealed 4 individuals with Table 3 Frequency of less common CFTR mutations in the general population. Mutation Frequency Reference S1235R 1/77 [22,23] L997F 1/77 [24] I148T 1/129 [19] F1052V 1/200 [25] 621+3A→G 1/335 [26] 3601-111 G→C 1/690 [27] Table 4 New CFTR mutations found in the general population following 2nd level analysis. Login to comment
137 In North America, for example, missense mutations I148T and D1270N were found N100 and N200 times, respectively, more frequently in CF carriers than in patients. Login to comment
140 Similarly, I148T was shown to be associated with a CF phenotype only when associated with mutation 3199del6 on the same gene [19]. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Reprod Biomed Online. 2009 Nov;19(5):685-94. Gallati S, Hess S, Galie-Wunder D, Berger-Menz E, Bohlen D
Cystic fibrosis transmembrane conductance regulator mutations in azoospermic and oligospermic men and their partners.
Reprod Biomed Online. 2009 Nov;19(5):685-94., [PMID:20021716]

Abstract [show]
The objective of this study was to investigate the contribution of cystic fibrosis transmembrane conductance regulator (CFTR) to human infertility and to define screening and counselling procedures for couples asking for assisted reproduction treatment. Extended CFTR mutation screening was performed in 310 infertile men (25 with congenital absence of the vas deferens (CAVD), 116 with non-CAVD azoospermia, 169 with severe oligospermia), 70 female partners and 96 healthy controls. CFTR mutations were detected in the majority (68%) of CAVD patients and in significant proportions in azoospermic (31%) and oligospermic (22%) men. Carrier frequency among partners of infertile men was 16/70, exceeding that of controls (6/96) significantly (P = 0.0005). Thus, in 23% of infertile couples both partners were carriers, increasing the risk for their offspring to inherit two mutations to 25% or 50%. This study emphasizes the necessity to offer extended CFTR mutation screening and counselling not only to patients with CAVD but also to azoospermic and oligozoospermic men and their partners before undergoing assisted reproduction techniques. The identification of rare and/or mild mutations will not be a reason to abstain from parenthood, but will allow adequate treatment in children at risk for atypical or mild cystic fibrosis as soon as they develop any symptoms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
81 In 70 women whose partners had tested positive for either CFTR mutations or 5T alleles, extended screening of the CFTR gene was also performed revealing a mutation spectrum similar to that of oligospermic men including four 5T alleles, three S1235R, three F508del and one I148T, V754M, V920M, D1152H, 3905insT and Q1352H each (Table 1). Login to comment
99 Couple no. Infertile male CFTR mutation Female partner CFTR mutation Offspring genotype Risk for genotype (%) 01 F508del/wt azoospermia F508del/wt F508del/ F508del 25 F508del/wt 50 wt/wt 25 02 F508del/T5 CAVD F508del/wt F508del/ F508del 25 F508del/T5 25 F508del/wt 25 T5/wt 25 03 F508del/S13Ya azoospermia T5/wt F508del/T5 25 S13Y/T5 25 F508del/wt 25 S13Y/wt 25 04 I148T/wt oligospermia F508del/wt F508del/ I148T 25 I148T/wt 25 F508del/wt 25 wt/wt 25 05 1717À1G>A/wt oligospermia T5/wt 1717À1G>A/ T5 25 1717À1G>A/ wt 25 T5/wt 25 wt/wt 25 06 T5/wt oligospermia 3905insT/wt 3905insT/T5 25 3905insT/wt 25 T5/wt 25 wt/wt 25 07 T5/wt azoospermia D1152H/wt D1152H/T5 25 D1152H/wt 25 T5/wt 25 wt/wt 25 08 T5/F1052V oligospermia S1235R/wt F1052V/ S1235R 25 S1235R/T5 25 F1052V/wt 25 T5/wt 25 09 S1235R/wt oligospermia T5/wt S1235R/T5 25 S1235R/wt 25 T5/wt 25 wt/wt 25 10, 11 T5/wt oligospermia S1235R/wt S1235R/T5 25 S1235R/wt 25 T5/wt 25 wt/wt 25 12 V754M/wt oligospermia T5/wt V754M/T5 25 V754M/wt 25 T5/wt 25 wt/wt 25 13 T5/wt oligospermia Q1352H/wt Q1352H/T5 25 Q1352H/wt 25 T5/wt 25 wt/wt 25 (continued on next page)(continued) female partner is a carrier. Login to comment
117 Based on discriminant analysis, this study predicts a high probability for the presence of CFTR mutations especially in patients with reduced ejaculate volumes (<3 ml) and structural abnormalities such as CAVD, inguinal hernia, hypotrophic testes or cryptorchidism, confirming former findings reported by Casals et al. (2000) and representing symptoms that are also frequently observed in Table 3 (continued) Couple no. Infertile male CFTR mutation Female partner CFTR mutation Offspring genotype Risk for genotype (%) 14 R31C/wt oligospermia V920M/wt R31C/V920M 25 R31C/wt 25 V920M/wt 25 wt/wt 25 15 R31C/wt azoospermia I148T/wt R31C/I148T 25 R31C/wt 25 I148T/wt 25 wt/wt 25 16 V754M/wt oligospermia V754M/wt V754M/V754M 25 V754M/wt 50 wt/wt 25 Bold = mutations associated with classic cystic fibrosis; italic = mutations associated with a mild or uncertain, unpredictable phenotype; CAVD = congenital absence of the vas deferens; wt = wildtype allele. Login to comment

[hide] Do common in silico tools predict the clinical con... Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6. Dorfman R, Nalpathamkalam T, Taylor C, Gonska T, Keenan K, Yuan XW, Corey M, Tsui LC, Zielenski J, Durie P
Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?
Clin Genet. 2010 May;77(5):464-73. Epub 2009 Jan 6., [PMID:20059485]

Abstract [show]
Computational methods are used to predict the molecular consequences of amino-acid substitutions on the basis of evolutionary conservation or protein structure, but their utility in clinical diagnosis or prediction of disease outcome has not been well validated. We evaluated three popular computer programs, namely, PANTHER, SIFT and PolyPhen, by comparing the predicted clinical outcomes for a group of known CFTR missense mutations against the diagnosis of cystic fibrosis (CF) and clinical manifestations in cohorts of subjects with CF-disease and CFTR-related disorders carrying these mutations. Owing to poor specificity, none of tools reliably distinguished between individual mutations that confer CF disease from mutations found in subjects with a CFTR-related disorder or no disease. Prediction scores for CFTR mutations derived from PANTHER showed a significant overall statistical correlation with the spectrum of disease severity associated with mutations in the CFTR gene. In contrast, PolyPhen- and SIFT-derived scores only showed significant differences between CF-causing and non-CF variants. Current computational methods are not recommended for establishing or excluding a CF diagnosis, notably as a newborn screening strategy or in patients with equivocal test results.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment
157 Also, prediction tools will fail to account for missense mutations that are found as complex alleles (29) such as I148T (30), which subsequently was shown to be a neutral mutation, which cosegregates with a bona fide disease-causing deletion 3199del6 in exon 20 (31). Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Am J Respir Crit Care Med. 2010 May 15;181(10):1078-84. Epub 2010 Feb 18. Bienvenu T, Sermet-Gaudelus I, Burgel PR, Hubert D, Crestani B, Bassinet L, Dusser D, Fajac I
Cystic fibrosis transmembrane conductance regulator channel dysfunction in non-cystic fibrosis bronchiectasis.
Am J Respir Crit Care Med. 2010 May 15;181(10):1078-84. Epub 2010 Feb 18., 2010-05-15 [PMID:20167849]

Abstract [show]
RATIONALE: Although in patients with diffuse bronchiectasis (DB) and a normal sweat test the presence of one mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene is frequently observed, its pathogenic role in the development of DB remains unclear. OBJECTIVES: To evaluate the association between CFTR heterozygosity and CFTR protein dysfunction in the airways of patients with DB. METHODS: Nasal potential difference was measured in 122 patients with DB of unknown origin and with a normal sweat test (Cl(-) < 60 mmol/L). They were classified according to the presence of CFTR mutations: zero (85 patients), one (22 patients), or two mutations (15 patients). Control groups comprised 26 healthy subjects, 38 obligate heterozygotes for CFTR, and 92 patients with classic cystic fibrosis (CF) with an abnormal sweat test (Cl(-) > or = 60 mmol/L). Patients classified as mild-CF were carrying at least one mild mutation and patients classified as severe-CF were homozygous for the F508del mutation. MEASUREMENTS AND MAIN RESULTS: There was a continuum of airway CFTR dysfunction in the study population as shown by nasal potential difference measurements, ranging from normal values in healthy subjects, to intermediate values in subjects with DB, to highly abnormal values in subjects classified as severe-CF. This continuum of airway CFTR dysfunction was thus strongly associated with defects in the CFTR gene. Moreover, among patients with DB, a similar continuum in intermediate nasal potential difference was identified that was associated with the bearing of zero, one, or two CFTR mutations. These electrophysiological phenotypes and CFTR genotypes were also associated with the clinical phenotype, as shown by the frequency of Staphylococcus aureus and Pseudomonas aeruginosa bronchial colonization. CONCLUSIONS: Our study supports the hypothesis that a unique CFTR mutation may have pathogenic consequences in patients with DB.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 In DB-1, 12 patients carried a severe loss-of-function mutation: 3 patients carried a class 1 mutation (G542X, 2183AA.G, and W1282X), and 9 patients carried the F508del class 2 mutation; 10 patients carried a mild mutation predicted to retain some residual CFTR function: 7 patients carried the IVS8-5T class 5 mutation, and 3 patients carried a class 4 mutation (S1235R, R347P-I148T, and R117H-7T) (Table 1). Login to comment
79 GENOTYPE AND PHENOTYPE OF PATIENTS WITH DIFFUSE BRONCHIECTASIS BEARING ONE CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR MUTATION Patient No. Age (yr) Sex (M/F) CFTR Mutation Sweat Cl2 (mmol/L) Basal PD (mV) NPD Index Age at Onset (yr) FEV1 (% pred) Bacterial Colonization 1 46 F F508del/2 10 215 0.44 20 124 Pa 2 51 M S1235R/2 8 219 0.56 10 40 Sa/Pa 3 19 F R347P-I148T/2 13 219 0.48 10 91 None 4 31 F F508del/2 35 220 0.20 2 76 None 5 34 M IVS8-5T/2 10 221 0.51 2 27 None 6 49 F IVS8-5T/2 15 222 0.30 40 92 None 7 20 F IVS8-5T/2 13 223 0.42 16 90 None 8 38 M F508del/2 9 224 0.85 20 ND None 9 65 M F508del/2 21 224 0.88 60 99 None 10 52 F F508del/2 20 226 0.37 5 91 Pa 11 72 F G542X/2 15 226 0.37 40 68 None 12 67 F IVS8-5T/2 26 226 0.82 40 97 None 13 51 F W1282X/2 17 228 0.12 29 27 Pa 14 59 M R117H-7T/2 31 229 0.88 49 89 None 15 56 F F508del/2 17 230 0.41 40 75 None 16 49 F F508del/2 21 232 0.58 45 67 None 17 46 F 2183AA.G/2 23 233 0.26 45 132 None 18 19 F IVS8-5T/2 19 234 0.45 5 82 None 19 70 M IVS8-5T/2 20 238 0.34 50 64 None 20 22 F F508del/2 25 241 0.86 20 82 Sa 21 77 M IVS8-5T/2 26 242 1.00 65 86 None 22 73 M F508del/2 21 245 0.91 25 70 Pa Definition of abbreviations: Cl2 5 chloride; F 5 female; M 5 male; ND 5 not determined; NPD index 5 nasal potential difference index 5 e(response to øCl2 and iso/response to amil); a cut off . Login to comment

[hide] Carrier screening for cystic fibrosis. Obstet Gynecol Clin North Am. 2010 Mar;37(1):47-59, Table of Contents. Dungan JS
Carrier screening for cystic fibrosis.
Obstet Gynecol Clin North Am. 2010 Mar;37(1):47-59, Table of Contents., [PMID:20494257]

Abstract [show]
Cystic fibrosis is the first genetic disorder for which universal screening of preconceptional or prenatal patients became a component of standard prenatal care. The molecular genetics and mutation profile of the CFTR gene are complex, with a wide range of phenotypic consequences. Carrier screening can facilitate risk assessment for prospective parents to have an affected offspring, although there remains a small residual risk for carrying a mutation even with a negative screening result. There are ethnic differences with respect to disease incidence and effectiveness of carrier testing, which may complicate counseling.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
150 The Society of Obstetricians and Gynaecologists of Canada has stated routine CF carrier screening ''cannot be recommended at this time.``22 Two mutations were subsequently deleted from the original 2001 recommendation as a result of further epidemiologic data.13 The I148T mutation was subsequently found not to be disease causing (it was originally considered so because of the erroneous perception of its frequent appearance with 3199del6, a rare, but confirmed CF mutation). Login to comment

[hide] An update on cystic fibrosis screening. Clin Lab Med. 2010 Sep;30(3):533-43. Goetzinger KR, Cahill AG
An update on cystic fibrosis screening.
Clin Lab Med. 2010 Sep;30(3):533-43., [PMID:20638569]

Abstract [show]
Cystic fibrosis (CF) is a monogenic, autosomal recessive disorder, which ultimately leads to multisystem organ dysfunction and a subsequent decrease in life expectancy. Because of the sizeable number of disease causing mutations (>1000) and expansive ethnic and racial distribution, CF has presented a challenge for prenatal diagnosis. This article aims to review the genetics of CF, its spectrum of genotypic-phenotypic variations, current prenatal carrier screening and diagnostic recommendations, ultrasonographic markers of CF, and available reproductive options for carrier couples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
47 Based on this review, 2 mutations (1078delT and I148T) were removed from the standard screening panel, narrowing it to include only 23 mutations. Login to comment

[hide] Identification of the second CFTR mutation in pati... Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26. Giuliani R, Antonucci I, Torrente I, Grammatico P, Palka G, Stuppia L
Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols.
Asian J Androl. 2010 Nov;12(6):819-26. Epub 2010 Jul 26., [PMID:20657600]

Abstract [show]
Congenital bilateral absence of vas deferens (CBAVD) is a manifestation of the mildest form of cystic fibrosis (CF) and is characterized by obstructive azoospermia in otherwise healthy patients. Owing to the availability of assisted reproductive technology, CBAVD patients can father children. These fathers are at risk of transmitting a mutated allele of the CF transmembrane conductance regulator (CFTR) gene, responsible for CF, to their offspring. The identification of mutations in both CFTR alleles in CBAVD patients is a crucial requirement for calculating the risk of producing a child with full-blown CF if the female partner is a healthy CF carrier. However, in the majority of CBAVD patients, conventional mutation screening is not able to detect mutations in both CFTR alleles, and this difficulty hampers the execution of correct genetic counselling. To obtain information about the most represented CFTR mutations in CBAVD patients, we analysed 23 CBAVD patients, 15 of whom had a single CFTR mutation after screening for 36 mutations and the 5T allele. The search for the second CFTR mutation in these cases was performed by using a triplex approach: (i) first, a reverse dot-blot analysis was performed to detect mutations with regional impact; (ii) next, multiple ligation-dependent probe amplification assays were conducted to search for large rearrangements; and (iii) finally, denaturing high-performance liquid chromatography was used to search for point mutations in the entire coding region. Using these approaches, the second CFTR mutation was detected in six patients, which increased the final detection rate to 60.8%.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
58 INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] Clinical hallmarks and genetic polymorphisms in th... Clin Invest Med. 2010 Aug 1;33(4):E234-9. Tomaiuolo AC, Alghisi F, Petrocchi S, Surace C, Roberti MC, Bella S, Lucidi V, Angioni A
Clinical hallmarks and genetic polymorphisms in the CFTR gene contribute to the disclosure of the A1006E mutation.
Clin Invest Med. 2010 Aug 1;33(4):E234-9., [PMID:20691141]

Abstract [show]
Since the identification of the Cystic Fibrosis transmembrane conductance regulator (CFTR) gene in 1989, many genetic mutations have been found in cystic fibrosis (CF) patients. Dysfunctions of the CFTR gene are responsible for the highly variable clinical presentation ranging from severe CF, disseminated bronchiectasis, idiopathic chronic pancreatitis and congenital bilateral absence of vas deferens (CBAVD). Linkage disequilibrium studies have shown that some mutations are stringently coupled with polymorphisms in a genetic complex called haplotype. From a familial study of a patient with CBAVD, carrier of the A1006E mutation, we have observed its strict association with the polymorphism 5T-TG11. In order to speed up the genetic diagnosis and to correlate the clinical setting to this genetic feature, we have directly investigated the exon 17a, where the A1006E mutation is located, of five cystic fibrosis patients belonging to two unrelated families. All patients had the 5T-TG11 tract, F508del and one unknown mutation. One more family with two affected individuals carrying the Q220X/A1006E mutations was investigated for the poly-T polymorphism. All the members were found to have the A1006E mutation and the 5T-TG11 in the same DNA strand, demonstrating that this strategy is a reliable and inexpensive method for genotyping the CFTR gene. A detailed description of the clinical presentation and follow-up are provided in order to highlight common phenotypic features useful to improve the management of cystic fibrosis patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
14 Moreover, molecular diagnosis of CF, particularly for non-classical CF or CFTR-related diseases, involves rare mutations and requires extensive gene sequencing, a time consuming and costly approach.2 In order to overcome this problem, many attempts have been ORIGINAL RESEARCH made to use linkage analysis of polymorphic loci to known mutations because intragenic marker haplotype analysis has been shown to facilitate mutation screening.3 In fact, it is well known that F508del mutation is in linkage disequilibrium with the polymorphic tract 9T4 and the I148T sequence variation is frequently associated with the 3199del6 mutation.5,6 The poly T tract, a string of thymidine bases located in intron 8 of the CFTR gene, may be associated with non-classical CF or CFTR-related disorders depending on its size.7 The 5T variant decreases the efficiency of intron 8 splicing when the associated TG sequence is 12 or 13 repeats in length, while 11 repeats seems to be irrelevant.8,9 5T-TG analysis is routinely performed in our lab and we have investigated many patients, including some cases of Congenital Bilateral Absence of Vas Deferent (CBAVD). Login to comment

[hide] p.Ser1235Arg should no longer be considered as a c... Eur J Hum Genet. 2011 Jan;19(1):36-42. Epub 2010 Aug 18. Rene C, Paulet D, Girodon E, Costa C, Lalau G, Leclerc J, Cabet-Bey F, Bienvenu T, Blayau M, Iron A, Mittre H, Feldmann D, Guittard C, Claustres M, Georges M
p.Ser1235Arg should no longer be considered as a cystic fibrosis mutation: results from a large collaborative study.
Eur J Hum Genet. 2011 Jan;19(1):36-42. Epub 2010 Aug 18., [PMID:20717170]

Abstract [show]
Among the 1700 mutations reported in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, a missense mutation, p.Ser1235Arg, is a relatively frequent finding. To clarify its clinical significance, we collected data from 104 subjects heterozygous for the mutation p.Ser1235Arg from the French CF network, addressed for various indications including classical CF, atypical phenotypes or carrier screening in subjects with or without a family history. Among them, 26 patients (5 having CF, 10 CBAVD (congenital bilateral absence of the vas deferens) and 11 with CF-like symptoms) and 14 healthy subjects were compound heterozygous for a second CFTR mutation. An exhaustive CFTR gene analysis identified a second mutation in cis of p.Ser1235Arg in all CF patients and in 81.8% CBAVD patients. Moreover, epidemiological data from >2100 individuals found a higher frequency of p.Ser1235Arg in the general population than in CF or CBAVD patients. These data, added to the fact that in silico analysis and functional assays suggest a benign nature of this substitution, give several lines of evidence against an association of p.Ser1235Arg with CF or CBAVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
169 8 Rohlfs EM, Zhou Z, Sugarman EA et al: The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis. Login to comment
175 11 Claustres M, Altieri JP, Guittard C, Templin C, Chevalier-Porst F, Des Georges M: Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations? Login to comment

[hide] Regulation of endogenous ENaC functional expressio... Am J Physiol Lung Cell Mol Physiol. 2011 Jan;300(1):L88-L101. Epub 2010 Oct 8. Rubenstein RC, Lockwood SR, Lide E, Bauer R, Suaud L, Grumbach Y
Regulation of endogenous ENaC functional expression by CFTR and DeltaF508-CFTR in airway epithelial cells.
Am J Physiol Lung Cell Mol Physiol. 2011 Jan;300(1):L88-L101. Epub 2010 Oct 8., [PMID:20935229]

Abstract [show]
The functional expression of the epithelial sodium channel (ENaC) appears elevated in cystic fibrosis (CF) airway epithelia, but the mechanism by which this occurs is not clear. We tested the hypothesis that the cystic fibrosis transmembrane conductance regulator (CFTR) alters the trafficking of endogenously expressed human ENaC in the CFBE41o model of CF bronchial epithelia. Functional expression of ENaC, as defined by amiloride-inhibited short-circuit current (I(sc)) in Ussing chambers, was absent under control conditions but present in CFBE41o parental and DeltaF508-CFTR-overexpressing cells after treatment with 1 muM dexamethasone (Dex) for 24 h. The effect of Dex was mimicked by incubation with the glucocorticoid hydrocortisone but not with the mineralocorticoid aldosterone. Application of trypsin to the apical surface to activate uncleaved, "near-silent" ENaC caused an additional increase in amiloride-sensitive I(sc) in the Dex-treated cells and was without effect in the control cells, suggesting that Dex increased ENaC cell surface expression. In contrast, Dex treatment did not stimulate amiloride-sensitive I(sc) in CFBE41o cells that stably express wild-type (wt) CFTR. CFBE41o wt cells also had reduced expression of alpha- and gamma-ENaC compared with parental and DeltaF508-CFTR-overexpressing cells. Furthermore, application of trypsin to the apical surface of Dex-treated CFBE41o wt cells did not stimulate amiloride-sensitive I(sc), suggesting that ENaC remained absent from the surface of these cells even after Dex treatment. We also tested the effect of trafficking-corrected DeltaF508-CFTR on ENaC functional expression. Incubation with 1 mM 4-phenylbutyrate synergistically increased Dex-induced ENaC functional expression in DeltaF508-CFTR-overexpressing cells. These data support the hypothesis that wt CFTR can regulate the whole cell, functional, and surface expression of endogenous ENaC in airway epithelial cells and that absence of this regulation may foster ENaC hyperactivity in CF airway epithelia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
305 Coexpression of CFTRs with appropriate intracellular trafficking [wt (67) and I148T (60)] decrease ENaC functional, surface, and/or whole oocyte expression compared with oocytes expressing ENaC alone in the absence of specific treatments to activate CFTR (i.e., without forskolin/IBMX stimulation). Login to comment

[hide] Combined bicarbonate conductance-impairing variant... Gastroenterology. 2011 Jan;140(1):162-71. Epub 2010 Oct 25. Schneider A, Larusch J, Sun X, Aloe A, Lamb J, Hawes R, Cotton P, Brand RE, Anderson MA, Money ME, Banks PA, Lewis MD, Baillie J, Sherman S, Disario J, Burton FR, Gardner TB, Amann ST, Gelrud A, George R, Rockacy MJ, Kassabian S, Martinson J, Slivka A, Yadav D, Oruc N, Barmada MM, Frizzell R, Whitcomb DC
Combined bicarbonate conductance-impairing variants in CFTR and SPINK1 variants are associated with chronic pancreatitis in patients without cystic fibrosis.
Gastroenterology. 2011 Jan;140(1):162-71. Epub 2010 Oct 25., [PMID:20977904]

Abstract [show]
BACKGROUND & AIMS: Idiopathic chronic pancreatitis (ICP) is a complex inflammatory disorder associated with multiple genetic and environmental factors. In individuals without cystic fibrosis (CF), variants of CFTR that inhibit bicarbonate conductance but maintain chloride conductance might selectively impair secretion of pancreatic juice, leading to trypsin activation and pancreatitis. We investigated whether sequence variants in the gene encoding the pancreatic secretory trypsin inhibitor SPINK1 further increase the risk of pancreatitis in these patients. METHODS: We screened patients and controls for variants in SPINK1 associated with risk of chronic pancreatitis and in all 27 exons of CFTR. The final study group included 53 patients with sporadic ICP, 27 probands with familial ICP, 150 unrelated controls, 375 additional controls for limited genotyping. CFTR wild-type and p.R75Q were cloned and expressed in HEK293 cells, and relative conductances of HCO(3)(-) and Cl(-) were measured. RESULTS: SPINK1 variants were identified in 36% of subjects and 3% of controls (odds ratio [OR], 18.1). One variant of CFTR not associated with CF, p.R75Q, was found in 16% of subjects and 5.3% of controls (OR, 3.4). Coinheritance of CFTR p.R75Q and SPINK1 variants occurred in 8.75% of patients and 0.38% of controls (OR, 25.1). Patch-clamp recordings of cells that expressed CFTR p.R75Q showed normal chloride currents but significantly reduced bicarbonate currents (P = .0001). CONCLUSIONS: The CFTR variant p.R75Q causes a selective defect in bicarbonate conductance and increases risk of pancreatitis. Coinheritance of p.R75Q or CF causing CFTR variants with SPINK1 variants significantly increases the risk of ICP.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
123 Total CFTR Sequencing Results of Healthy Controls CFTR mutations SPINK1 mutations 1 -/- N34S/- 2 1584GtoA/-a N34S/- 3 F508del/-a -/- 4 F508del/-a -/- 5 G576AϩR668C/- -/- 6 IVS8 T5-TG12/-a -/- 7 IVS8 T5/TG12/- -/- 8 R75Q/-a -/- 9 R75Q/-a -/- 10 R75Q/-a -/- 11 R75Q/-a -/- 12 R75Q/-a -/- 13 R75Q/-a -/- 14 R75Q/-a -/- 15 R75Q/-a -/- 16 R75Q/-a -/- 17 9CtoT/- -/- 18 C76W/-a -/- 19 T1086A/- -/- 20 R668C/- -/- 21 N1432K/- -/- 22 I148T/- -/- 23 2657ϩ22GtoA/- -/- 24-95 -/- -/- NOTE. Login to comment
92 Two peculiar mutations that occurred in both populations, c.1584GtoA (1716GtoA legacy name) and p.R75Q, have been generally regarded as benign sequence variations28 (www.genet.sickkids. on.ca) but repeatedly show association to CF-related diseases, pancreatitis,29-31 and some patients with atypical CF.32 Two individual nonsynonymous sequence changes, p.R668C and p.I148T, were identified with CFTR full sequencing in one control each but without additional mutations found in cis (p.D443Y ϩ p.G576A and c.3067del6 [ie, 3199del6], respectively). Login to comment
136 CFTR Mutation Class Types and Corresponding Disease Severity CFTR mutation Exon CF mutation class Disease association % Carriers, case (n) % Carriers, controls (n) p.R75Q 3 "CP" 16.2 (80) 5.3 (525) c.1584GtoA (p.E528E) 10 "CP" 8.7 (80) 3.3 (150) p.F508del 10 II CF severe 8.7 (80) 2.3 (525) p.R560T 11 II CF severe 3.4 (29) 0 (95) IVS8 T5/TG12or13 i8 V CF mild 5.0 (80) 2.7 (150) p.F508C 10 CF mild 1.2 (80) 0 (150) p.I807M 13 CF mild 3.4 (29) 0 (95) p.D443YϩG576AϩR668Ca 9;12;13 CF mild 3.4 (29) 0 (95) p.G576AϩR668Ca 12;13 CF mild 0 (29) 1 (95) p.M952T 15 CF mild 3.4 (29) 0 (95) p.R668C 13 Other 0 (29) 1 (95) c.3139ϩ42AtoT i17a Other 3.4 (29) 0 (95) p.N1432K 24 Other 0 (29) 1 (95) c.-9CtoT 1 Other 0 (29) 1 (95) p.C76W 3 Other 0 (80) 0.7 (150) p.I148T 4 Other 0 (29) 1 (95) c.2657ϩ22GtoA i14b Other 0 (29) 1 (95) p.T1086A 17b Other 0 (29) 1 (95) NOTE. Login to comment

[hide] Cystic fibrosis carrier testing in an ethnically d... Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7. Rohlfs EM, Zhou Z, Heim RA, Nagan N, Rosenblum LS, Flynn K, Scholl T, Akmaev VR, Sirko-Osadsa DA, Allitto BA, Sugarman EA
Cystic fibrosis carrier testing in an ethnically diverse US population.
Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7., [PMID:21474639]

Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) and the frequency of specific disease-causing mutations vary among populations. Affected individuals experience a range of serious clinical consequences, notably lung and pancreatic disease, which are only partially dependent on genotype. METHODS: An allele-specific primer-extension reaction, liquid-phase hybridization to a bead array, and subsequent fluorescence detection were used in testing for carriers of 98 CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations among 364 890 referred individuals with no family history of CF. RESULTS: One in 38 individuals carried one of the 98 CFTR mutations included in this panel. Of the 87 different mutations detected, 18 were limited to a single ethnic group. African American, Hispanic, and Asian individuals accounted for 33% of the individuals tested. The mutation frequency distribution of Caucasians was significantly different from that of each of these ethnic groups (P < 1 x 10(1)). CONCLUSIONS: Carrier testing using a broad mutation panel detects differences in the distribution of mutations among ethnic groups in the US.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
116 For example, although p.I148T was initially identified in Ͼ0.1% of affected patients, it was subsequently reclassified as a benign allele after a frequency higher than expected was observed in the carrier-screening population (29, 30). Login to comment
118 When the observed Caucasian carrier frequency was corrected with the detection rate of 91.56% [Table 1, Cystic Fibrosis Foundation data excluding p.I148T, in (10)], the carrier frequency in Caucasians increased from 1 in 28 to 1 in 25. Login to comment

[hide] The etiology of acute recurrent pancreatitis in ch... Pancreas. 2011 May;40(4):517-21. Lucidi V, Alghisi F, Dall'Oglio L, D'Apice MR, Monti L, De Angelis P, Gambardella S, Angioni A, Novelli G
The etiology of acute recurrent pancreatitis in children: a challenge for pediatricians.
Pancreas. 2011 May;40(4):517-21., [PMID:21499205]

Abstract [show]
OBJECTIVES: To assess specific etiologies of acute recurrent pancreatitis at a single Italian pediatric cystic fibrosis (CF) center. METHODS: We studied, retrospectively, 78 young patients (39 female subjects; mean age at diagnosis, 8.8 +/- 5.1 years) affected by acute recurrent episodes of pancreatitis, remained etiologically undiagnosed at first-level assessment. All patients were submitted to endoscopic retrograde cholangiopancreatography to exclude biliopancreatic malformations and tested for CF by a sweat chloride test. Most patients also were studied for the research of CFTR, PRSS1, and SPINK1 gene mutations. RESULTS: A high percentage of family history for chronic pancreatitis was observed (20.5%). The sweat test identified 8 subjects (10.3%) with classic CF (2 patients) or at risk for CF (6 patients). Genetic analysis showed mutations in CFTR, SPINK1, and PRSS1 genes in 39.6%, 7.1%, and 4.5% of patients, respectively. A biliopancreatic malformation was diagnosed in 15 patients (19.2%). We also observed biliary lithiasis (5 patients [6.5%]), congenital pancreatic polycystosis (2 patients), a case of dyslipidemia, and 1 patient with a posttransplantation, drug-induced pancreatitis. CONCLUSIONS: Recurrent pancreatitis in children has several etiologies. Genetic testing confirms the high frequency of CFTR mutations. This suggests that it is of some value to identify patients with late-onset CF and CFTR-related disorders.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Genetic Findings Observed in Our Study Population and Related Clinical Features CFTR PRSS1 SPINK1 Clinical CharacteristicsMutations IVS8 F508del/UN 9T/9T S181G/- NEG No respiratory symptoms 3849+10KbC9T/UN 7T/7T NEG NEG No respiratory symptoms UN/UN 7T/7T NEG N34S/- UN/UN 5T/7T NEG NEG No respiratory symptoms 1899-136T/C/UN 5T/7T NEG NEG No respiratory symptoms F508del/UN 5T/9T NEG NEG No respiratory symptoms D1152H/D1152H NEG NEG No respiratory symptoms R75Q/UN 5T/7T NEG NEG No respiratory symptoms L997F/UN 7T/9T NEG NEG No respiratory symptoms UN/UN 7T/7T NEG N34S/- W1282X/I148T 7T/9T NEG NEG No respiratory symptoms NEG N34S/- R75Q/F1052V NEG NEG No respiratory symptoms F508del/D1152H NEG NEG Bronchiectasis-CF 406-6T/C/E528E 7T/7T NEG NEG No respiratory symptoms F508del/UN 7T/9T Mild respiratory symptomsYCF L967S/L997F NEG NEG No respiratory symptoms E528E/UN 5T/7T Crohn disease, food allergy 1716 G/A/UN 7T/7T NEG NEG No respiratory symptoms 1898+1G9A/UN 7T/7T No respiratory symptoms R31C/UN No respiratory symptoms R75Q/UN 7T/7T NEG NEG No respiratory symptoms N29T;V212I; D217Y NEG F508del/UN 7T/9T NEG NEG Pancreas divisum S1235R/UN 7T/9T NEG NEG Duodenal stenosis Entries in bold font undelines the detection of mutations or polymorphisms in the studied genes. Login to comment

[hide] Clinical outcomes in infants with cystic fibrosis ... Pediatr Pulmonol. 2011 Apr 29. doi: 10.1002/ppul.21475. Ren CL, Desai H, Platt M, Dixon M
Clinical outcomes in infants with cystic fibrosis transmembrane conductance regulator (CFTR) related metabolic syndrome.
Pediatr Pulmonol. 2011 Apr 29. doi: 10.1002/ppul.21475., 2011-04-29 [PMID:21538969]

Abstract [show]
An unavoidable outcome of cystic fibrosis newborn screening (CF NBS) programs is the detection of infants with an indeterminate diagnosis. The United States CF Foundation recently proposed the term cystic fibrosis transmembrane conductance regulator related metabolic syndrome (CRMS) to describe infants with elevated immunoreactive trypsinogen (IRT) on NBS who do not meet diagnostic criteria for CF. The objective of this study was to describe the clinical outcomes of infants with CRMS identified through an IRT/DNA algorithm. We reviewed the records of all infants with CRMS diagnosed at our CF Center from 2002 to 2010. We identified 12 infants, and compared them to 27 infants diagnosed with CF by NBS. Compared to CF patients, CRMS patients were more likely to be pancreatic sufficient as assessed by fecal elastase measurement (100% vs. 8%, P < 0.01). Their weight for age percentile was normal from birth. A positive oropharyngeal (OP) culture for Pseudomonas aeruginosa (Pa) was found in 25% of CRMS patients. One patient with the F508del/R117H/7T genotype was reassigned the diagnosis of CF after he had a positive OP culture for Pa, and his follow up sweat Cl at 1 year of life was 73 mmol/L. CF patients were more likely to receive oral antibiotics and be hospitalized for pulmonary symptoms. Our results indicate that CRMS patients can develop signs of CF disease, but have a milder clinical course than CF infants. Close initial monitoring of these patients is warranted. Pediatr. Pulmonol. (c) 2011 Wiley-Liss, Inc.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1-CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected. Login to comment
61 Infants in both groups received treatment with inhaled tobramycin if they had a positive Pa OP culture, and treatment in both groups was associated with eradication of TABLE 1- CFTR Gene Mutation Panel Used by New York CF NBS Program F508del I50e7del G542X G551D W1282X N1303K R553X 621þ1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711þ1G>T 1898þ1G>A 2184delA 1078delT 3849þ10kbC>T 2789þ5G>A 3659delC I148T 3120þ1G>A 3876delA V520F S549R S549N 3849þ4 A-G 3905insT R347H Reflex testing for 5T polymorphism is performed if R117H is detected. Login to comment

[hide] Validation of double gradient denaturing gradient ... Clin Chem. 1999 Jan;45(1):35-40. Cremonesi L, Carrera P, Fumagalli A, Lucchiari S, Cardillo E, Ferrari M, Righetti SC, Zunino F, Righetti PG, Gelfi C
Validation of double gradient denaturing gradient gel electrophoresis through multigenic retrospective analysis.
Clin Chem. 1999 Jan;45(1):35-40., [PMID:9895335]

Abstract [show]
Among established techniques for the identification of either known or new mutations, denaturing gradient gel electrophoresis (DGGE) is one of the most effective. However, conventional DGGE is affected by major drawbacks that limit its routine application: the different denaturant gradient ranges and migration times required for different DNA fragments. We developed a modified version of DGGE for high-throughput mutational analysis, double gradient DGGE (DG-DGGE), by superimposing a porous gradient over the denaturant gradient, which maintains the zone-sharpening effect even during lengthy analyses. Because of this innovation, DG-DGGE achieves the double goals of retaining full effectiveness in the detection of mutations while allowing identical run time conditions for all fragments analyzed. Here we use retrospective analysis of a large number of well-characterized mutations and polymorphisms, spanning all predicted melting domains and the whole genomic sequence of three different genes--the cystic fibrosis transmembrane conductance regulator (CFTR), the beta-globin, and the p53 genes--to demonstrate that DG-DGGE may be applied to the rapid scanning of any sequence variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 Mutations and polymorphisms analyzed in the CFTR gene. Position Denaturant gradient Mutation Exon 1 40-90% 125G/Ca,b M1V (A3G at 133) 175insT 182delT Exon 3 10-60% W57G (T3G at 301) 356G/Aa G85E (G3A at 386) Exon 4 20-70% R117H (G3A at 482) 541delC 621ϩ1G3T I148T (T3C at 575) Exon 5 20-70% E193K (G3A at 709) Intron 5 20-70% 711ϩ3A3G Exon 7 20-70% 1078delT R334W (C3T at 1132) T338I (C3T at 1145) R347P (G3C at 1172)b R347H (G3A at 1172) R352Q (G3A at 1187) Exon 10 20-70% M470V (1540A/G)a ⌬F508 (del 3 bp at 1652) Intron 10 10-60% 1717-1G3A Exon 11 10-60% G542X (G3T at 1756) 1784delG R553X (C3T at 1789) Exon 12 10-60% D579G (A3G at 1868) E585X (G3T at 1885) Intron 12 10-60% 1898ϩ3A3G Exon 13 30-80% 2183AA3G E730X (G3T at 2320) L732X (T3G at 2327) 2347delG Exon 14a 10-60% T854T (2694T/G)a V868V (2736G/A)a Intron 14b 30-80% 2789ϩ5G3A Exon 15 20-70% M952I (G3C at 2988)b Exon 17a 20-70% L997F (G3C at 3123)b Exon 17b 20-70% F1052V (T3G at 3286) R1066C (C3T at 3328) R1066H (G3A at 3329) A1067T (G3A at 3331) Exon 18 20-70% D1152H (G3C at 3586)b Exon 19 30-80% R1158X (C3T at 3604) Exon 20 20-70% S1251N (G3A at 3384) W1282X (G3A at 3978) Exon 21 20-70% N1303K (C3G at 4041)b Exon 22 30-80% G1349D (G3A at 4178) 4382delA Exon 24 30-80% Y1424Y (4404C/T)a a Polymorphism. Login to comment

[hide] Complete mutational screening of the CFTR gene in ... Hum Genet. 1998 Dec;103(6):718-22. Bombieri C, Benetazzo M, Saccomani A, Belpinati F, Gile LS, Luisetti M, Pignatti PF
Complete mutational screening of the CFTR gene in 120 patients with pulmonary disease.
Hum Genet. 1998 Dec;103(6):718-22., [PMID:9921909]

Abstract [show]
In order to determine the possible role of the cystic fibrosis transmembrane regulator (CFTR) gene in pulmonary diseases not due to cystic fibrosis, a complete screening of the CFTR gene was performed in 120 Italian patients with disseminated bronchiectasis of unknown cause (DBE), chronic bronchitis (CB), pulmonary emphysema (E), lung cancer (LC), sarcoidosis (S) and other forms of pulmonary disease. The 27 exons of the CFTR gene and their intronic flanking regions were analyzed by denaturing gradient gel electrophoresis and automatic sequencing. Mutations were detected in 11/23 DBE (P = 0.009), 7/25 E, 5/27 CB, 5/26 LC, 5/8 S (P = 0.013), 1/4 tuberculosis, and 1/5 pneumonia patients, and in 5/33 controls. Moreover, the IVS8-5T allele was detected in 6/25 E patients (P = 0.038). Four new mutations were identified: D651N, 2377C/T, E826K, and P1072L. These results confirm the involvement of the CFTR gene in disseminated bronchiectasis of unknown origin, and suggest a possible role for CFTR gene mutations in sarcoidosis, and for the 5T allele in pulmonary emphysema.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Of these 22 mutations, 14 (R75Q, P111L, R117H, I148T, Y301C, ∆F508, E585X, V754M, L997F, R1066C, M1137V, 3667ins4, D1270N, 4382delA) are listed by the Cystic Fibrosis Genetic Analysis Consortium (CFGAC) as CF mutations (CFGAC website), even if their role in CF disease remains to be proven, as is the case for R75Q, P111L, V754M, L997F, and D1270N. Login to comment
88 of cases CFTR gene PolyTb status tested mutationa DBE 23 1 G576A-R668C/L997F 7/9 1 ∆F508/L997F 9/9 1 ∆F508/- 7/9 1 R1066C/- 5/7 1 3667ins4/- 5/7 1 R75Q/- 7/7 1 M1137V/- 7/7 1 -/- 5/5 3 -/- 5/7 10 -/- 7/7 2 -/- 7/9 CB 27 1 P111L/- 7/7 1 R117H/- 7/7 1 E585X/- 7/7 1 P1072L/- 7/7 1 -/- 5/7 15 -/- 7/7 6 -/- 7/9 1 -/- 9/9 E 25 1 R668C/- 7/7 6 -/- 5/7 16 -/- 7/7 6 -/- 7/9 S 8 1 E826K/- 7/7 1 ∆F508/- 7/9 1 4382delA/- 7/7 1 L997F/- 7/9 1 V754M/- 7/9 3 -/- 7/7 LC 26 1 I148T/- 5/7 1 D1270N-R74W 5/7 1 D651N/- 7/7 1 Y301C/- 7/7 1 -/- 5/7 16 -/- 7/7 5 -/- 7/9 TB 4 1 -/- 5/7 1 -/- 7/7 2 -/- 7/9 Pneumonia 5 4 -/- 7/7 1 -/- 5/7 Pnx 2 2 -/- 7/7 Controls 68 1 L997F/- 7/9 1 R31C/- 7/7 1 I506V/- 5/7 1 -/- 5/7 1 -/- 5/9 23 -/- 7/7 4 -/- 7/9 1 -/- 9/9 2 ? Login to comment

[hide] Structure and function of the CFTR chloride channe... Physiol Rev. 1999 Jan;79(1 Suppl):S23-45. Sheppard DN, Welsh MJ
Structure and function of the CFTR chloride channel.
Physiol Rev. 1999 Jan;79(1 Suppl):S23-45., [PMID:9922375]

Abstract [show]
Structure and Function of the CFTR Chloride Channel. Physiol. Rev. 79, Suppl.: S23-S45, 1999. - The cystic fibrosis transmembrane conductance regulator (CFTR) is a unique member of the ABC transporter family that forms a novel Cl- channel. It is located predominantly in the apical membrane of epithelia where it mediates transepithelial salt and liquid movement. Dysfunction of CFTR causes the genetic disease cystic fibrosis. The CFTR is composed of five domains: two membrane-spanning domains (MSDs), two nucleotide-binding domains (NBDs), and a regulatory (R) domain. Here we review the structure and function of this unique channel, with a focus on how the various domains contribute to channel function. The MSDs form the channel pore, phosphorylation of the R domain determines channel activity, and ATP hydrolysis by the NBDs controls channel gating. Current knowledge of CFTR structure and function may help us understand better its mechanism of action, its role in electrolyte transport, its dysfunction in cystic fibrosis, and its relationship to other ABC transporters.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
176 Furthermore, the mutations I148T and G178R could not be locked open by the nonhydrolyzable ATP analog 5؅- adenylylimidodiphosphate (AMP-PNP) (112), the mutation Information about the CFTR pore has also emerged from studies using Cl0 channel inhibitors. Login to comment

[hide] The role of common single-nucleotide polymorphisms... Hum Mutat. 2004 Aug;24(2):120-9. Steiner B, Truninger K, Sanz J, Schaller A, Gallati S
The role of common single-nucleotide polymorphisms on exon 9 and exon 12 skipping in nonmutated CFTR alleles.
Hum Mutat. 2004 Aug;24(2):120-9., [PMID:15241793]

Abstract [show]
Classic cystic fibrosis (CF) is caused by two loss-of-function mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, whereas patients with nonclassic CF have at least one copy of a mutant gene that retains partial function of the CFTR protein. In addition, there are several other phenotypes associated with CFTR gene mutations, such as idiopathic chronic pancreatitis. In CFTR-associated disorders and in nonclassic CF, often only one CFTR mutation or no CFTR mutations can be detected. In this study, we screened 23 patients with CFTR-associated disorders for CFTR mutations by complete gene testing and quantitative transcript analysis. Mutations were found in 10 patients. In cells from respiratory epithelium, we detected aberrant splicing of CFTR mRNA in all investigated individuals. We observed a highly significant association between the presence of coding single-nucleotide polymorphisms (coding SNPs, or cSNPs) and increased skipping of exon 9 and 12. This association was found both in patients and in normal individuals carrying the same cSNPs. The cSNPs c.1540A>G, c.2694T>G, and c.4521G>A may have affected pre-mRNA splicing by changing regulatory sequence motifs of exonic splice enhancers, leading to lower amounts of normal transcripts. The analysis of CFTR exons indicated that less frequent and weak exonic splicing enhancer (ESE) motifs make exon 12 vulnerable to skipping. The number of splice variants in individuals with cSNPs was similar to previously reported values for the T5 allele, suggesting that cSNPs may enhance susceptibility to CFTR related diseases. In addition, cSNPs may be responsible for variation in the phenotypic expression of CFTR mutations. Quantitative approaches rather than conventional genomic analysis are required to interpret the role of cSNPs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
88 RESULTS Characterization of the CFTR Gene Mutations Mutations (c.575T4C (p.I148T), c.2890G4A (p.V920M), c.3586G4C (p.D1152H), and c.3837T4G (p.S1235R)) were found in 4 out of 66 healthy individuals (6%), a nonsignificant increase compared to the 4% carrier frequency reported in the literature for the Swiss population [Hergersberg et al., 1997]. Login to comment

[hide] Are p.I148T, p.R74W and p.D1270N cystic fibrosis c... BMC Med Genet. 2004 Aug 2;5:19. Claustres M, Altieri JP, Guittard C, Templin C, Chevalier-Porst F, Des Georges M
Are p.I148T, p.R74W and p.D1270N cystic fibrosis causing mutations?
BMC Med Genet. 2004 Aug 2;5:19., 2004-08-02 [PMID:15287992]

Abstract [show]
BACKGROUND: To contribute further to the classification of three CFTR amino acid changes (p.I148T, p.R74W and p.D1270N) either as CF or CBAVD-causing mutations or as neutral variations. METHODS: The CFTR genes from individuals who carried at least one of these changes were extensively scanned by a well established DGGE assay followed by direct sequencing and familial segregation analysis of mutations and polymorphisms. RESULTS: Four CF patients (out of 1238) originally identified as carrying the p.I148T mutation in trans with a CF mutation had a second mutation (c.3199del6 or a novel mutation c.3395insA) on the p.I148T allele. We demonstrate here that the deletion c.3199del6 can also be associated with CF without p.I148T. Three CBAVD patients originally identified with the complex allele p.R74W-p.D1270N were also carrying p.V201M on this allele, by contrast with non CF or asymptomatic individuals including the mother of a CF child, who were carrying p.R74W-p.D1270N alone. CONCLUSION: These findings question p.I148T or p.R74W-p.D1270N as causing by themselves CF or CBAVD and emphazises the necessity to perform a complete scanning of CFTR genes and to assign the parental alleles when novel missense mutations are identified.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 Mireille Claustres*1, Jean-Pierre Altiéri1, Caroline Guittard1, Carine Templin1, Françoise Chevalier-Porst2 and Marie Des Georges1 Address: 1Laboratoire de Génétique Moléculaire, Institut Universitaire de Recherche Clinique et Centre Hospitalier Universitaire, 641 avenue du Doyen Gaston Giraud, 34093 Montpellier, France and 2Laboratoire de Biochimie pédiatrique, Centre Hospitalier Universitaire Paul-Brousse, 69000 Lyon, France Email: Mireille Claustres* - Mireille.Claustres@igh.cnrs.fr; Jean-Pierre Altiéri - Jean-Pierre.Altieri@igh.cnrs.fr; Caroline Guittard - Caroline.Guittard@igh.cnrs.fr; Carine Templin - Carine.Templin@igh.cnrs.fr; Françoise Chevalier-Porst - francoise.chevalier-porst@chu-lyon.fr; Marie Des Georges - Marie.Desgeorges@igh.cnrs.fr * Corresponding author Abstract Background: To contribute further to the classification of three CFTR amino acid changes (p.I148T, p.R74W and p.D1270N) either as CF or CBAVD-causing mutations or as neutral variations. Login to comment
3 Results: Four CF patients (out of 1238) originally identified as carrying the p.I148T mutation in trans with a CF mutation had a second mutation (c.3199del6 or a novel mutation c.3395insA) on the p.I148T allele. Login to comment
4 We demonstrate here that the deletion c.3199del6 can also be associated with CF without p.I148T. Login to comment
6 Conclusion: These findings question p.I148T or p.R74W-p.D1270N as causing by themselves CF or CBAVD and emphazises the necessity to perform a complete scanning of CFTR genes and to assign the parental alleles when novel missense mutations are identified. Login to comment
18 In North American populations, missense mutations p.I148T and p.D1270N were found >100 times and >200 times, respectively, more frequently in carrier screening than in CF patients [8,9]. Login to comment
20 Similarly, p.I148T has been shown to be associated with a CF phenotype only as a complex allele, i.e. when associated with mutation c.3199del6 on the same gene [8]. Login to comment
21 A completely asymptomatic male individual who is a compound heterozygote for p.D1270N and p.I148T has been recently identified [9]. Login to comment
22 These findings provided evidence that these missense changes may not be the true mutations and prompted us to reanalyze all the patients in our CF or CBAVD cohort who had been originally diagnosed as compound heterozygotes for either p.I148T or [p.R74W;p.D1270N] and another mutation on the other allele. Login to comment
23 The result of full scanning of CFTR sequences showed that a second mutation (c.3199del6 or the novel mutation c.3395insA) was associated in cis with p.I148T in all individuals with a CF phenotype, and that a third missense mutation (p.V201M) was associated in cis with complex allele [p.D1270N;p.R74W] in patients with a CBAVD phenotype in this series. Login to comment
24 Methods CFTR scanning for individuals with p.I148T or [p.D1270N;p.R74W] From 1990 to 2003, we have analysed for CFTR mutations genomic DNA from 437 families with CF and 170 with isolated azoospermia caused by CBAVD, using a combination of mutation screening for known and scanning for unknown mutations. Login to comment
29 In this study, we analyzed by DGGE the entire coding and flanking regions of the CFTR gene of individuals who had been previously found to carry p.I148T or the complex allele [p.R74W;p.D1270N] and assayed their relatives for the additional sequence changes identified. Login to comment
32 In addition, we also reanalyzed two additional CF patients previously found to carry p.I148T in the Lyon genetic center. Login to comment
37 Results A CF mutation (c.3199del6 or c.3395insA) is associated in cis with p.I148T in CF patients Two out of 437 CF patients analyzed in Montpellier and two out of 801 CF patients analyzed in Lyon were found to carry p.I148T, which was initially thought to be one of the two mutations responsible for CF in these patients. Login to comment
39 Mutation c.3199del6 can also occur alone as a CF-causing allele Mutation c.3199del6 was found to be carried without p.I148T in a young CF male with 394delTT on the other allele, diagnosed at the age of 7 years on the basis of typical pulmonary disease, pancreatic insufficiency, poor growth and positive sweat test [12]. Login to comment
46 The familial segregation analysis of polymorphisms covering the CFTR gene showed that p.I148T, when present in individuals with a CF phenotype, occurred on a unique haplotype carrying IVS8-9T whatever the mutation in cis, c.3395insA or c.3199del6 (table 1). Login to comment
47 By contrast, c.3199del6 without p.I148T occurred on a different haplotype carrying IVS8-7T. Mutations p.I148T, c.3199del6 and c.3395insA were not found on 600 chromosomes from our general population. Login to comment
52 This woman, who was carrying p.P67L on one CFTR gene and [p.R74W-p.D1270N] on the other (table 1), was completely asymptomatic at age 45 years Table 1: CFTR haplotypes associated with mutations found in CF patients carrying p.I148T in cis with c.3395insA or c.3199del6 and in one CF patient carrying c.3199del6 alone Indiv No. Login to comment
56 Discussion p.I148T is a low penetrance CF mutation or a neutral polymorphism Since its initial description in a CF Canadian patient with pancreatic insufficiency [16], the mutation p.I148T, which changes a conserved amino acid and occurs in the first cytoplasmic loop of the CFTR protein, has been considered as a severe CF allele in many countries. Login to comment
57 It was thought to be the second most common CF mutation in the French Canadian population, accounting for 9.1% of the French Canadian chromosomes [17], whereas in France, p.I148T accounted for only 0.11 % of the CF alleles in a sample of 3,710 patients affected with the disease [5]. Login to comment
58 p.I148T can now be detected by several commercially available kits developed for routine screening of CF carriers and for CF neonatal screening, and recently it has been included in the core panel of 25 CF mutations recommended by the American College of Medical Genetics (ACMG) [18]. Login to comment
60 However there are now several lines of evidence that question the role of p.I148T by itself in causing disease. Login to comment
61 First, compound heterozygosity for p.I148T and a severe CF mutation was recently identified in several healthy individuals [9,19]. Login to comment
62 When affected and unaffected individuals carrying apparently the same mutational genotype were re-analyzed for additional changes that could explain the different phenotypes, p.I148T was found to be associated in cis with another mutation, c.3199del6, in patients with a classic CF phenotype, whereas healthy adults who were compound heterozygous for p.I148T and a severe CF mutation or homozygous for p.I148T did not carry the deletion [8]. Login to comment
63 In a recent study, the p.I148T mutation has been further documented to be linked with the 3199del6 mutation in all 24 CF patients of French Canadian descent originally identified as compound heterozygous for the p.I148T mutation and a second severe CFTR mutation [20]. Login to comment
64 Second, p.I148T was found to be over 100 times more common in two independent U.S. carrier screening programmes than in CF patients: it accounted for 6.4 to 7.7% of chromosomes detected in the screened populations versus 0.06 to 0.068% of CF chromosomes in CF patients [8. Login to comment
66 This discrepancy suggests that p.I148T is either a poorly penetrant mutation or a neutral polymorphism. Login to comment
67 Third, when transiently expressed in epithelial cells, p.I148T mutant protein is normally processed and is able to mediate normal chloride transport with properties identical with those of wild-type cells [21]. Login to comment
68 As the mutant seems to suppress the ability of CFTR to support HCO3-transport, it has been hypothesized that p.I148T may contribute to disease through Cl- coupled HCO3- altered transport; however, the major CFTR functions are retained by the mutant [21]. Login to comment
69 Fourth, we show in this study for the first time that p.I148T can be associated with a frameshift mutation c.3395insA in exon 17b instead of in-frame deletion c.3199del6 in exon 17a. Login to comment
73 Fifth, in contrast with other studies that stated that only the complex allele [p.I148T;9T;c.3199del6] appeared to be associated with a classic CF phenotype [8], we demonstrate that c.3199del6 is associated with a CF phenotype even if the deletion occurs on a chromosome that does not carry p.I148T, which adds further value to the consideration that p.I148T is not a true mutation but simply a polymorphism. Login to comment
75 Our data fully support the recent recommendation that p.I148T should not be included in the mutation panel selected for prenatal screening strategy [22]. Login to comment
84 Recent large scale screening for CF carrier showed that p.D1270N was present 205 times more commonly in the screened population than in the CF patients (frequency of 14% versus 0.068%); in addition, a completely asymptomatic adult compound heterozygote for p.D1270N and p.I148T has been identified [9]. Login to comment
87 Conclusions This report further corroborates the recent hypothesis [9] that p.I148T and p.R74W-p.D1270N may not be true CF/ CBAVD mutations. Login to comment
88 If these observations are further confirmed by a large multicentric study, they will have important implications for genetic counseling of patients and couples found to carry p.I148T or [p.R74W;p.D1270N]. Login to comment

[hide] Detection of CFTR mutations using temporal tempera... Electrophoresis. 2004 Aug;25(15):2593-601. Wong LJ, Alper OM
Detection of CFTR mutations using temporal temperature gradient gel electrophoresis.
Electrophoresis. 2004 Aug;25(15):2593-601., [PMID:15300780]

Abstract [show]
Cystic fibrosis (CF), caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, is one of the most common autosomal recessive diseases with variable incidences and mutation spectra among different ethnic groups. Current commercially available mutation panels designed for the analysis of known recurrent mutations have a detection rate between 38 to 95%, depending upon the ethnic background of the patient. We describe the application of a novel mutation detection method, temporal temperature gradient gel electrophoresis (TTGE), to the study of the molecular genetics of Hispanic CF patients. TTGE effectively identified numerous rare and novel mutations and polymorphisms. One interesting observation is that the majority of the novel mutations are splice site, frame shift, or nonsense mutations that cause severe clinical phenotypes. Our data demonstrate that screening of the 27 exons and intron/exon junctions of the CFTR gene by TTGE greatly improves the molecular diagnosis of Hispanic CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
96 Detection of known mutations and polymorphisms by TTGE Base substitution Mutation Exon or intron Homozygote or heterozygote Polymorphism or mutation # Alleles detected 1 c.386G.A p.G85E 3 Heterozygote Mutation 2 2 c.575T.C p.I148T 4 Heterozygote Mutation 2 3 c.406-1G.A Splice Int 4 Heterozygote Mutation 9 4 c.71111G.T Splice Int 5 Heterozygote Mutation 1 5 c.1059_1069del 3bp p.F311del 7 Heterozygote Mutation 2 6 c.1132C.T p.R334W 7 Heterozygote Mutation 2 7 c.1652_1655del 3bp p.F508del 10 Heterozygote Mutation 94 8 Homozygote Mutation 12 c.1540A/G p.M470V 10 Heterozygote Polymorphism 15 9 Homozygote Polymorphism 4 c.1756G.T p.G542X 11 Heterozygote Mutation 13 10 c.1784G.A p.G551D 11 Heterozygote Mutation 1 11 c.1778G.A p.S549N 11 Heterozygote Mutation 4 12 c.1789C.T p.R553X 11 Homozygote Mutation 2 13 c.1807G.A p.A559T 11 Heterozygote Mutation 2 14 c.189811G.A Splice Int 12 Heterozygote Mutation 1 15 c.1949del84bp Frameshift 13 Heterozygote Mutation 3 16 c.278915G.A Splice Int 14b Heterozygote Mutation 2 17 c.312011G.A Splice Int 16 Heterozygote Mutation 9 18 c.3171delC Frameshift 17a Heterozygote Mutation 1 19 c.3398G.A p.W1089X 17b Heterozygote Mutation 1 20 c.3425G.A p.W1098X 17b Heterozygote Mutation 1 21 c.3616C.T p.R1162X 19 Heterozygote Mutation 2 22 c.3791delC Frameshift 19 Heterozygote Mutation 1 23 c.3821delT Frameshift 19 Heterozygote Mutation 1 24 c.3876delA Frameshift 20 Heterozygote Mutation 4 25 c.3905insT Frameshift 20 Heterozygote Mutation 1 26 c.4041C.G p.N1303K 21 Heterozygote Mutation 2 Total 194 The translation starts at c.133 of CFTR CDNA sequence in GenBank Acc. Login to comment

[hide] Molecular evaluation of CFTR sequence variants in ... Int J Androl. 2005 Oct;28(5):284-90. Larriba S, Bonache S, Sarquella J, Ramos MD, Gimenez J, Bassas L, Casals T
Molecular evaluation of CFTR sequence variants in male infertility of testicular origin.
Int J Androl. 2005 Oct;28(5):284-90., [PMID:16128988]

Abstract [show]
Although the involvement of the CFTR gene has been well established in congenital agenesia of vas deferens, its role in non-obstructive (NOb) infertility is still a matter of debate. In order to definitively define the involvement of the CFTR gene in spermatogenic impairment and a potential synergistic contribution to known genetic and clinical factors, genetic variants in the entire coding sequence and the immediately flanking regions of the CFTR gene, along with a thorough clinical evaluation, were analysed in 83 NOb infertile patients and 87 clinically well-defined fertile individuals as controls. The results of our study showed no statistical difference between CFTR carrier frequency in the infertile and fertile population. Specifically, the IVS8-6(5T) allele carrier frequency was similar in NOb infertile patients when compared with fertile men, but it is noteworthy that, when fertile men were classified into having optimal and suboptimal fertility, no 5T allele was found among the 35 men with optimal fertility parameters. In conclusion, extensive CFTR analysis in infertile individuals and fertile population as adequate control definitively excludes the involvement of the CFTR gene variants in sperm production and stresses the importance of carefully identifying those individuals with obstructive defects, in whom CFTR screening will be beneficial.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 CFTR analysis We identified 14 different, potential disease-causing CFTR sequence variants, 11 of them are translated into missense amino acid changes (p.R75Q, p.P111L, p.R117H, p.I148T, p.R334W, p.M348K, p.G576A, p.R668C, p.D1270N, p.S1235R and p.S1426F), one deletion (p.F508del) and two alleles affecting exon splicing [IVS8-6(5T), c.1716G>A] in 30 of 83 infertile patients (Table 1) giving a frequency of 36.1%. Login to comment
53 Thirteen CFTR gene sequence variants [p.R75Q, p.I148T, p.T351S, p.F508del, p.G576A, p.R668C, p.E725K, p.V754M, p.D836Y, p.L997F, p.S1235R, IVS8-6(5T) and c.1716G>A] were determined in 11 F1 and 15 F2 individuals (Table 1) giving a frequency of 29.9%. Login to comment
54 One individual presented both p.R75Q and p.I148T. Login to comment
72 Description of genetic abnormalities and other risk factors of infertile and fertile CFTR carrier individuals No. Phenotype CFTR genotype Associated factors Testicular histologya b c Infertile individuals 1 NOb (SO) p.R75Q No Severe hypospermatogenesis 2 NOb (SO) p.R75Q No nd 3 NOb (A) p.P111L AZFb,c del Sertoli cell only 4 NOb (A) p.R117H AZFc del Severe hypospermatogenesis 5 NOb (SO) p.I148T No Severe hypospermatogenesis 6 NOb (A) p.R334W No Primary spermatocyte arrest 7 NOb (SO) p.M348K UV grade III Primary spermatocyte arrest 8 NOb (A) p.F508del No Sertoli cell only 9 NOb (A) p.F508del No Primary spermatocyte arrest 10 NOb (A) p.G576A, p.R668C No Severe hypospermatogenesis, Leydig cell hyperplasia 11 NOb (SO) p.G576A, p.R668C No Primary spermatocyte arrest (unilateral) 12 NOb (SO) p.G576A, p.R668C No Severe hypospermatogenesis 13 NOb (A) p.R668C UC Sertoli cell-only (incomplete) 14 NOb (SO) p.D1270N No nd 15 NOb (SO) p.S1235R No Severe hypospermatogenesis 16 NOb (SO) p.S1426F* UC Sertoli cell only 17 NOb (A) (T)5-(TG)12 No Severe hypospermatogenesis, Sertoli cell only (80%) 18 NOb (A) (T)5-(TG)12 No Sertoli cell only 19 NOb (SO) (T)5-(TG)11 UV grade III Bilateral moderate hypospermatogenesis 20 NOb (SO) (T)5-(TG)11 UV grade II Severe hypospermatogenesis 21 NOb (A) (T)5-(TG)11 No nd 22 NOb (SO) c.1716 G>A Dysplasia SV Severe hypospermatogenesis, Sertoli cell only (95%) 23 NOb (A) c.1716 G>A No nd 24 NOb (A) c.1716 G>A No Primary spermatocyte arrest (bilateral) 25 NOb (SO) c.1716 G>A No Sertoli cell only (95%) 26 NOb (SO) c.1716 G>A No Severe hypospermatogenesis 27 NOb (SO) c.1716 G>A UV grade III Severe hypospermatogenesis 28 NOb (SO) c.1716 G>A No nd 29 NOb (SO) c.1716 G>A No nd 30 NOb (SO) c.1716 G>A AZFc del Severe hypospermatogenesis Fertile individuals 1 F1 p.R75Q No nd 2 F1 p.F508del No nd 3 F1 p.F508del No nd 4 F1 p.G576A, p.R668C/ c.1716 G>A No nd 5 F1 p.D836Y No nd 6 F1 p.S1235R/c.1716 G>A No nd 7 F1 c.1716 G>A No nd 8 F1 c.1716 G>A No nd 9 F1 c.1716 G>A No nd 10 F1 c.1716 G>A No nd 11 F1 c.1716 G>A No nd 12 F2 p.R75Q No nd the expected CF carrier frequency in the local population (Van der Ven et al., 1996; Larriba et al., 2001; Dohle et al., 2002) or with the general population (Jakubiczka et al., 1999; Pallares-Ruiz et al., 1999; Ravnik-Glavac et al., 2001) and not normospermic fertile individuals, the latter considered as adequate controls. Login to comment
77 Most of the changes identified, except p.F508del, p.R117H, p.I148T and p.R334W, are known to behave as benign mutations being present in milder phenotypes of CFTR-related pathologies (http:// www.genet.sickkids.on.ca) and/or because of the results of the performance of functional studies. Login to comment
85 Continued No. Phenotype CFTR genotype Associated factors Testicular histologya b c 13 F2 p.I148T p.R75Q No nd 14 F2 p.T351S No nd 15 F2 p.F508del No nd 16 F2 p.E725K No nd 17 F2 p.V754M No nd 18 F2 p.L997F No nd 19 F2 (T)5-(TG)12 No nd 20 F2 (T)5-(TG)12 No nd 21 F2 (T)5-(TG)11 No nd 22 F2 (T)5-(TG)11 No nd 23 F2 c.1716 G>A No nd 24 F2 c.1716 G>A No nd 25 F2 c.1716 G>A No nd 26 F2 c.1716 G>A No nd Phenotype: NOb (SO), non-obstructive severe oligozoospermia; NOb (A), non-obstructive azoospermia; F1, optimal fertility; F2, suboptimal fertility. Login to comment

[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]

Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Seven other complex alleles were observed: [c.296 + 3insT; p.V754M], [p.F508del; p.I1027T], [p.S549R; -102T > A], [p.G576A; p.R668C], [p.R1070W; p.R668C], [p.D1270N; p.R74W] and [p.T1299I; p.I148T]. Login to comment

[hide] Outcomes of a cystic fibrosis carrier testing clin... Med J Aust. 2009 Nov 2;191(9):499-501. Christie LM, Ingrey AJ, Turner GM, Proos AL, Watts GE
Outcomes of a cystic fibrosis carrier testing clinic for couples.
Med J Aust. 2009 Nov 2;191(9):499-501., 2009-11-02 [PMID:19883345]

Abstract [show]
OBJECTIVE: To review the outcomes of offering carrier testing for cystic fibrosis (CF) to couples considering pregnancy, and to women in early pregnancy and their partners. METHODS: An after-hours clinic was established in Newcastle for discussion of issues related to prenatal testing. Couples were offered CF carrier testing by extracting DNA from a mouthwash sample. An expanded one-step model was used with both partners being tested initially for the p.F508del cystic fibrosis transmembrane conductance regulator gene (CFTR) mutation. If one partner was a p.F508del carrier, the other partner was tested for an additional 28 CFTR mutations. RESULTS: Of 1000 individuals who were offered CF carrier testing, none declined. No re-collections of mouthwash samples were required, and results were available within 14 days. There were 730 individuals who had no family history of CF (73%); 27 were carriers (4%; 95% CI, 2.4%-5.3%), and there were two high-risk couples where both partners were carriers of p.F508del. There were 270 individuals who had an affected family member with CF or a child identified as a CF carrier through newborn screening; 126 were carriers (46%; 95% CI, 40.6%-52.8%), and there were two high-risk couples - one couple where both partners were carriers of p.F508del, and another couple where the woman was homozygous for p.F508del and the man was a p.F508del carrier. The information on carrier status led the four high-risk couples to change their reproductive decisions to avoid having a child with CF. CONCLUSION: CF carrier testing for couples using an expanded one-step model will detect about 80% of high-risk couples and enables various reproductive choices. We believe that all couples considering pregnancy, and women in early pregnancy and their partners, should be offered CF carrier testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 This provides each individual with information on their carrier status, and accurate residual risks of 1 CFTR mutations tested for in individuals whose partner was a carrier of p.F508del* p.F508del p.F316leufsX p.I507del p.R347P p.G542X p.S1251N p.G551D p.E60X p.N1303K p.W1282X c.1585-1G>A p.D1152H p.R553X c.2988+1G>A c.489+G>T c.2657+5G>A p.R117H c.1766+1G>A p.R1162X c.579+1G>A c.3717+10kbC>T p.G85E p.R334W p.K684fs p.A455E p.I148T p.K684fs p.R560T p.T1176fs CFTR = gene encoding cystic fibrosis transmembrane conductance regulator. Login to comment

[hide] UMD-CFTR: a database dedicated to CF and CFTR-rela... Hum Mutat. 2010 Sep;31(9):1011-9. Bareil C, Theze C, Beroud C, Hamroun D, Guittard C, Rene C, Paulet D, Georges M, Claustres M
UMD-CFTR: a database dedicated to CF and CFTR-related disorders.
Hum Mutat. 2010 Sep;31(9):1011-9., [PMID:20607857]

Abstract [show]
With the increasing knowledge of cystic fibrosis (CF) and CFTR-related diseases (CFTR-RD), the number of sequence variations in the CFTR gene is constantly raising. CF and particularly CFTR-RD provide a particular challenge because of many unclassified variants and identical genotypes associated with different phenotypes. Using the Universal Mutation Database (UMD) software we have constructed UMD-CFTR (freely available at the URL: http://www.umd.be/CFTR/), the first comprehensive relational CFTR database that allows an in-depth analysis and annotation of all variations identified in individuals whose CFTR genes have been analyzed extensively. The system has been tested on the molecular data from 757 patients (540 CF and 217 CBAVD) including disease-causing, unclassified, and nonpathogenic alterations (301 different sequence variations) representing 3,973 entries. Tools are provided to assess the pathogenicity of mutations. UMD-CFTR also offers a number of query tools and graphical views providing instant access to the list of mutations, their frequencies, positions and predicted consequences, or correlations between genotypes, haplotypes, and phenotypes. UMD-CFTR offers a way to compile not only disease-causing genotypes but also haplotypes. It will help the CFTR scientific and medical communities to improve sequence variation interpretation, evaluate the putative influence of haplotypes on mutations, and correlate molecular data with phenotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
15 Several sequence changes initially reported as causing disease have subsequently been reported to be neutral sequence variants (a typical illustration is the variant p.Ile148Thr) [Claustres et al., 2004; Rohlfs et al., 2004] or mutations with reduced penetrance (only some patients will develop CF or CFTR-related disorder; example: p.Arg117His) [Kiesewetter et al., 1993; Rosenstein and Cutting, 1998; Thauvin-Robinet et al., 2009] or mutations with variable expressivity (some patients develop mild rather than severe symptoms; examples include p.Leu206Trp [Desgeorges et al., 1995; Rozen et al., 1995] or p.Asp1152His [Burgel et al., 2010; Mussaffi et al., 2006]). Login to comment

[hide] Cystic fibrosis in Chilean patients: Analysis of 3... J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30. Lay-Son G, Puga A, Astudillo P, Repetto GM
Cystic fibrosis in Chilean patients: Analysis of 36 common CFTR gene mutations.
J Cyst Fibros. 2011 Jan;10(1):66-70. Epub 2010 Oct 30., [PMID:21036675]

Abstract [show]
BACKGROUND: CFTR gene mutations have worldwide differences in prevalence and data on Chilean patients is scarce. METHODS: We studied 36 of the most common CFTR mutations in Chilean patients from the CF National Program [Programa Nacional de Fibrosis Quistica (PNFQ)] of the Ministry of Health of Chile. RESULTS: Two hundred and eighty-nine patients were studied. Fourteen different mutations were identified with an overall allele detection rate of 42.0%. Mutations with frequencies greater than 1% were p.F508del (30.3% of alleles), p.R334W (3.3%), p.G542X (2.4%), c.3849+10Kb C>T (1.7%), and p.R553X (1.2%). A north to south geographical gradient was observed in the overall rate of detection. CONCLUSIONS: Southern European CFTR mutations predominate in the Chilean population, but a high percentage of alleles remain unknown. Geographical heterogeneity could be explained in part by admixture. Complementary analyses are necessary to allow for effective genetic counselling and improve cost-effectiveness of screening and diagnostic tests.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Seven mutations had not been previously reported in the Chilean population (p.1078delT, pG85E, c.3120+1 GNA, c.711+1 GNT, p.R117H, p.A455E, and p.I148T). Login to comment
81 Mutation This study Rios et al. [4] Molina et al. [5] Repetto et al. [6] Perez et al. [13] CFGAC [2] (n=578) (%) (n=72) (%) (n=36) (%) (n=100) (%) (n=4102) (%) (n=43,849) (%) Chile Chile Chile Chile Latin-Americaa Worldwide Unknown 58.0 66.6 61.1 34.0 36.7 22.7 p.F508del 30.6 29.2 30.6 45.0 47.1 66.0 p.R334W 3.1 - - 2.0 0.8 0.1 p.G542X 2.4 0 8.3 7.0 5.0 2.4 c.3849+10Kb CNT 1.7 - - 3.0 0.3 0.2 p.R553X 1.2 4.2 0 1.0 0.4 0.7 p.R1162X 0.9 - - 2.0 1.0 0.3 p.1078delT 0.5 - - 0 b0.1 0.1 p.G85E 0.5 - - - 0.8 0.2 p.W1282X 0.2 - - 5.0 1.0 1.2 c.3120+1 GNA 0.2 - - - 0.3 - c.711+1 GNT 0.2 - - - 0.1 0.1 p.R117H 0.2 - - 0 b0.1 0.3 p.A455E 0.2 - - 0 0 0.1 p.I148T 0.2 - - - - - p.G551D 0 0 0 1.0 0.1 1.6 p.N1303K 0 0 0 0 1.8 1.3 c.621+1 GNT 0 - - 0 0.2 0.7 c.1717-1 GNA 0 - - 0 0.3 0.6 p.I507del 0 - - 0 0.2 0.2 p.R347P 0 - - 0 0 0.2 c.2789+5 GNA 0 - - - 0.2 0.1 c.1898+1 GNA 0 - - - 0.1 0.1 c.2184delA 0 - - - b0.1 0.1 p.S549N 0 - 0 - 0.1 0.1 c.3659delC 0 - - 0 0.1 0.1 p.R560T 0 - - - 0 0.1 c.1811+1.6Kb ANG 0 - - - 0.4 - c.2183AANG 0 - - 0 0.1 - p.S549R 0 - - - 0.1 - c.3272-26 ANG 0 - - - 0.1 - c.3199del6 0 - - - b0.1 - p.E60X 0 - - 0 0 - c.3905insT 0 - - - 0 - p.S1251N 0 - - 0 - - CFTRdele2,3 0 - - - - - p.R347H 0 - - - - - p.V520F 0 - - - - - p.Q552X 0 - - - - - c.394delTT 0 - - - - - c.711+1 GNA 0 - - - - - c.2143delT 0 - - - - - c.3876delA 0 - - - - - a Data from Chilean patients published in Rios et al., Molina et al., and Repetto et al. [4-6] included in this publication were excluded in this table to avoid repetition. Login to comment

[hide] Mutation distribution in expanded screening for cy... Clin Chem. 2011 Jun;57(6):799-801. Epub 2011 Apr 7. Schrijver I
Mutation distribution in expanded screening for cystic fibrosis: making up the balance in a context of ethnic diversity.
Clin Chem. 2011 Jun;57(6):799-801. Epub 2011 Apr 7., [PMID:21474640]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 The decision in 2004 to reduce the original panel of 25 mutations to 23 (13) was based on a lower actual frequency of 1 mutation (c.948delT; legacy name, c.1078delT in exon 7) and the lack of pathogenicity of another (p.I148T). Login to comment

[hide] Evaluation of the disease liability of CFTR varian... Methods Mol Biol. 2011;742:355-72. Sosnay PR, Castellani C, Corey M, Dorfman R, Zielenski J, Karchin R, Penland CM, Cutting GR
Evaluation of the disease liability of CFTR variants.
Methods Mol Biol. 2011;742:355-72., [PMID:21547743]

Abstract [show]
Over 1600 novel sequence variants in the CFTR gene have been reported to the CF Mutation Database (http://www.genet.sickkids.on.ca/cftr/Home.html). While about 25 mutations are well characterized by clinical studies and functional assays, the disease liability of most of the remaining mutations is either unclear or unknown. This gap in knowledge has implications for diagnosis, therapy selection, and counseling for patients and families carrying an uncharacterized CFTR mutation. This chapter will describe a critical approach to assessing the disease implications of CFTR mutations utilizing clinical data, literature review, functional testing, and bioinformatic in silico methods.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
77 For example, the variant p.Ile148Thr was initially felt to be disease causing, but further examination found that the mutation occurred at a higher rate in healthy individuals undergoing carrier screening than in CF patients (26). Login to comment
78 Subsequent studies revealed that most CF patients with p.Ile148Thr also carry the two amino acid deletion c.3067_3072del (27). Login to comment
79 The latter mutation in isolation causes CF whereas p.Ile148Thr in isolation does not. Login to comment
140 The bioinformatic tools PolyPhen and SIFT have been employed to evaluate amino acid changes in CFTR, but made significant errors incorrectly identifying "known" neutral polymorphisms p.Phe508Cys and p.Ile148Thr as likely to be deleterious (58, 59). Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]

Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

[hide] Newborn screening for cystic fibrosis: Polish 4 ye... Eur J Hum Genet. 2012 Aug 15. doi: 10.1038/ejhg.2012.180. Sobczynska-Tomaszewska A, Oltarzewski M, Czerska K, Wertheim-Tysarowska K, Sands D, Walkowiak J, Bal J, Mazurczak T
Newborn screening for cystic fibrosis: Polish 4 years' experience with CFTR sequencing strategy.
Eur J Hum Genet. 2012 Aug 15. doi: 10.1038/ejhg.2012.180., [PMID:22892530]

Abstract [show]
Newborn screening for cystic fibrosis (NBS CF) in Poland was started in September 2006. Summary from 4 years' experience is presented in this study. The immunoreactive trypsin/DNA sequencing strategy was implemented. The group of 1 212 487 newborns were screened for cystic fibrosis during the programme. We identified a total of 221 CF cases during this period, including, 4 CF cases were reported to be omitted by NBS CF. Disease incidence in Poland based on the programme results was estimated as 1/4394 and carrier frequency as 1/33. The frequency of the F508del was similar (62%) to population data previously reported. This strategy allowed us to identify 29 affected infants with rare genotypes. The frequency of some mutations (eg, 2184insA, K710X) was assessed in Poland for the first time. Thus, sequencing assay seems to be accurate method for screening programme using blood spots in the Polish population.European Journal of Human Genetics advance online publication, 15 August 2012; doi:10.1038/ejhg.2012.180.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Mutations D537N and P731L have not been Period of NBS CF Method The most frequent mutations in Polish population under analysis September 2006 - December 2007 Estonia Asper Biotech assay E60X, G85E, 394delTT, R117H, R117P, R117L, I148T, 621G>A, 711+1G>T, 711+5G>A, 1078delT, R334W, R347H, R347P, R347L, IVS8-T, A455E, I507del, F508del, 1717-1G>A, G542X, p.G551D, Q552X, R553X, R553G, R560T, R560K, 1898+1G>A, 1898+1G>T, 1898+1G>C, 2143delT, 2184delA, 2183AA>G, 2789+5G>A, 3120+1G>A, 3199del6, 3272-26A>G, R1162X, 3659delC, 3849+10kbC>T, 3905insT, S1235R, S1251N, W1282X, W1282C, N1303K, CFTRdele2,3 January 2007 - June 2009 Sanger sequencing of exons: 4, 7, 10, 11, 13, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R117H+IVS8-T*, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K July 2009 - currently Sanger sequencing of exons: 7, 10, 11, 13, 17b, 20, 21, fragment of intron 19 F508del, CFTRdele2,3, 3849+10kbC>T, R334W, R347P, 1717-1G>A, G542X, R553X, K710X, 2184insA, 2143delT, 2183AA>G, N1303K, 3272-26A>G**, W1282X** * removed from DNA analysis since July 2009 , **added into DNA analysis since July 2009 Figure 1 NBS CF in Poland. Login to comment
117 For example, the I148T variant no longer has the qualification of a pathogenic mutation but is still included in the commercial kits (eg, InnoLipa, Innogenetics).33 Prudence is therefore always essential in molecular genetics. Login to comment
116 For example, the I148T variant no longer has the qualification of a pathogenic mutation but is still included in the commercial kits (eg, InnoLipa, Innogenetics).33 Prudence is therefore always essential in molecular genetics. Login to comment

[hide] Improving test properties for neonatal cystic fibr... J Inherit Metab Dis. 2012 Jul;35(4):635-40. Cornel MC, Gille JJ, Loeber JG, Vernooij-van Langen AM, Dankert-Roelse J, Bolhuis PA
Improving test properties for neonatal cystic fibrosis screening in the Netherlands before the nationwide start by May 1st 2011.
J Inherit Metab Dis. 2012 Jul;35(4):635-40., [PMID:22302635]

Abstract [show]
When new technical possibilities arise in health care, often attunement is needed between different actors from the perspectives of research, health care providers, patients, ethics and policy. For cystic fibrosis (CF) such a process of attunement in the Netherlands started in a committee of the Health Council on neonatal screening in 2005. In the balancing of pros and cons according to Wilson and Jungner criteria, the advantages for the CF patient were considered clear, even though CF remains a severe health problem with treatment. Nevertheless, screening was not started then, mainly since the specificity of the tests available at that time was considered too low. Many healthy infants would have been referred for sweat testing and much uncertainty would arise in their parents. Also the limited sensitivity for immigrants and the detection of less severe phenotypes and carriers were considered problematic. The Health Council recommended a pilot screening project which was subsequently performed in some provinces, leading to a 4-step protocol: IRT, PAP, screening for a CFTR mutation panel, and sequencing of the CFTR gene. This would lead to the identification of 23 cases of classical CF, two infants with less severe forms and 12 carriers per year in the Netherlands. Thus many CF patients can be diagnosed early, while limiting the number of referrals, the number of infants with less severe forms diagnosed and the number of carriers identified. Technical solutions were found to limit the ethical problems. A nationwide program using this four step protocol started by 1 May 2011.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Mutation I148T, which is still part of this test, was ignored since this mutation is not considered disease-causing anymore. Login to comment
72 Mutation I148T, which is still part of this test, was ignored since this mutation is not considered disease-causing anymore. Login to comment

[hide] Analysis of cystic fibrosis transmembrane regulato... Andrologia. 2012 May;44 Suppl 1:848-50. doi: 10.1111/j.1439-0272.2011.01250.x. Epub 2011 Dec 22. Lobna HL, Ali B, Hammadi A
Analysis of cystic fibrosis transmembrane regulator and azoospermia factor polymorphisms in infertile men in relation to other abnormalities.
Andrologia. 2012 May;44 Suppl 1:848-50. doi: 10.1111/j.1439-0272.2011.01250.x. Epub 2011 Dec 22., [PMID:22191729]

Abstract [show]
The aim was to determine the prevalence of compound genetic abnormalities in patients who are carriers of cystic fibrosis transmembrane regulator (CFTR) gene polymorphism and to compare our results with similar patients reported in the literature. One hundred and nine patients were identified to be carriers of CFTR gene polymorphism. Additional genetic testing for karyotype abnormalities or Y chromosome microdeletions (YMD) was performed. Three patients (2.75%) of 109 were identified to have compound genetic abnormalities. One patient had 5T/5T while the other had 6T/6T and the third had 9T/9T. The three patients had deletions of azoospermia factor regions (AZFa+b or AZFa+b+c). There were no karyotype abnormalities identified in our database. In the literature, four patients with compound CFTR mutations and YMD were identified, in three patients had karyotype abnormalities. In conclusion, compound genetic abnormalities in CFTR mutation patients can be a contributing factor when abnormal spermatogenesis is encountered.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 Table 1 Summary of reported compound genetic abnormalities in CFTR patients References CFTR Karyotype Y-del SA Exam FSH Testis histology Current study (2011) )/), 5T/5T 46,XY AZFa+b Azoo Bil Vas NA NA Current study (2011) )/), 6T/6T 46,XY AZFa+b Azoo Bil Vas NA NA Current study (2011) )/), 5T/5T 46,XY AZFa+b+c Azoo Bil Vas NA NA Karpman et al. (2007) W1282X/), WT/WT 46,XY AZFb+c Azoo Bil Vas 4 Late, incomplete maturation Karpman et al. (2007) I148T/), WT/WT 46,XY AZFb+c OAT Bil Vas 19 NA Schulz et al. (2006) F508/), WT/WT 45,XY, der(14;22) None OAT Bil Vas NA NA Dohle et al. (2002) F508/), 7T/9T 46,XY AZFc OAT Hpogonadism 7.3 NA Dohle et al. (2002) R117/H/) 47,XXY None Azoo Hpogonadism 11 NA Meng et al. (2001) F508/), 7T/9T 46,XY AZFb Azoo CBAVD NA Sertoli cell only Black et al. (2000) )/), 5T/9T 46,XY, inv(6)(p12q21) None Azoo CBAVD 8.8 Late, incomplete maturation Azoo, azoospermia; Bill Vas, bilateral vas deferens present; CBAVD, congenital bilateral absence of the vas deferens; CFTR, cystic fibrosis transmembrane receptor; FSH, follicle stimulating hormone, NA, not available; OAT, oligoasthenoteratozoospermia; SA, semen analysis; WT, wild type; AZF, Azoospermia factor. Login to comment

[hide] Genetic prevalence and characteristics in children... J Pediatr Gastroenterol Nutr. 2012 May;54(5):645-50. Sultan M, Werlin S, Venkatasubramani N
Genetic prevalence and characteristics in children with recurrent pancreatitis.
J Pediatr Gastroenterol Nutr. 2012 May;54(5):645-50., [PMID:22094894]

Abstract [show]
AIMS: The causes of chronic (CP) and recurrent acute pancreatitis (RAP) in children include anatomic abnormalities and hereditary, metabolic, and autoimmune disorders, with a significant proportion of cases being labeled as idiopathic. Genetic pancreatitis (GP) is associated with mutations of cystic fibrosis transmembrane conductor regulator gene (CFTR), cationic trypsinogen (PRSS1) gene, and serine protease inhibitor Kazal type 1 (SPINK1). There literature is sparse regarding the clinical profile of GP in children. The aim of the present study was to estimate the prevalence and describe the clinical characteristics and outcome of genetic pancreatitis. METHODS: We reviewed the charts of children ages 18 years or younger with RAP or CP diagnosed from 2000 to 2009 at the Children's Hospital of Wisconsin, Milwaukee. Twenty-nine patients with RAP or CP were identified, of whom 23 (79%) were positive for mutations in >/=1 of the above-mentioned genes, and were included for review. RESULTS: The median age of symptom onset was 5 years (range 9 months-15 years) with diagnosis at 6.5 years (range 1-16 years). Twenty-one were white; 14 were girls. The most common presenting symptoms were abdominal pain and vomiting. Patients with RAP had 2 to 8 episodes of pancreatitis during 3.6-year average follow-up. Family history was positive in 5 of 29 of gene-tested patients. CFTR, SPINK1, or PRSS1 mutations were seen in 14 (48%), 8 (27%), and 7 (24%) patients, respectively. Two patients were homozygous for CFTR mutations, 6 heterozygote and 4 patients had 5 T variants. Two other patients had double heterozygous mutations in F508 del/2789 + 5G > A and F508 del/5T variant. Six patients with CP had a combination of CFTR and SPINK1 or PRSS1 mutations. Eleven of 29 (38%) patients met radiological criteria for CP. All of the heterozygote patients with a combination of CFTR and SPINK1 or PRSS1 mutations had CP. Eight patients developed a chronic pain syndrome and 2 developed exocrine pancreatic insufficiency during follow-up. CONCLUSIONS: We found a high prevalence of genetic mutations in patients without anatomic or metabolic abnormalities known to be associated with pancreatitis. Studies are needed to ascertain the genetic causes of RAP and CP and examine the relation between single CFTR mutations and single mutations in the PRSS1 and SPINK1 genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Six patients were heterozygous for the CFTR mutation (F508del, R297W, D1152H, R297Q, and I148T). Login to comment
92 This patient was diagnosed as having RAP and was found to have a combined mutation in PRSS1 (p.R116C) and CFTR genes (I148T variant on exon 4). Login to comment
93 Hereditary pancreatitis has been described in carriers of the p.R116C mutation, and I148T variant was originally reported to be a disease-causing mutation (10). Login to comment
137 Other mutations (R297Q, D1152H, R297Q, and I148T) may be present in CF and CFTR-related disorders such as pancreatitis and obstructive azoospermia (25). Login to comment

[hide] CFTR, SPINK1, CTRC and PRSS1 variants in chronic p... Gut. 2012 Mar 17. Rosendahl J, Landt O, Bernadova J, Kovacs P, Teich N, Bodeker H, Keim V, Ruffert C, Mossner J, Kage A, Stumvoll M, Groneberg D, Kruger R, Luck W, Treiber M, Becker M, Witt H
CFTR, SPINK1, CTRC and PRSS1 variants in chronic pancreatitis: is the role of mutated CFTR overestimated?
Gut. 2012 Mar 17., [PMID:22427236]

Abstract [show]
OBJECTIVE: In chronic pancreatitis (CP), alterations in several genes have so far been described, but only small cohorts have been extensively investigated for all predisposing genes. DESIGN: 660 patients with idiopathic or hereditary CP and up to 1758 controls were enrolled. PRSS1, SPINK1 and CTRC were analysed by DNA sequencing, and cystic fibrosis transmembrane conductance regulator (CFTR) by melting curve analysis. RESULTS: Frequencies of CFTR variants p.R75Q, p.I148T, 5T-allele and p.E528E were comparable in patients and controls. We identified 103 CFTR variants, which represents a 2.7-fold risk increase (p<0.0001). Severe cystic fibrosis (CF)-causing variants increased the risk of developing CP 2.9-fold, and mild CF-causing variants 4.5-fold (p<0.0001 for both). Combined CF-causing variants increased CP risk 3.4-fold (p<0.0001), while non-CF-causing variants displayed a 1.5-fold over-representation in patients (p=0.14). CFTR compound heterozygous status with variant classes CF-causing severe and mild represented an OR of 16.1 (p<0.0001). Notably, only 9/660 (1.4%) patients were compound heterozygotes in this category. Trans-heterozygosity increased CP risk, with an OR of 38.7, with 43/660 (6.5%) patients and 3/1667 (0.2%) controls being trans-heterozygous (p<0.0001). CONCLUSIONS: Accumulation of CFTR variants in CP is less pronounced than reported previously, with ORs between 2.7 and 4.5. Only CF-causing variants reached statistical significance. Compound and trans-heterozygosity is an overt risk factor for the development of CP, but the number of CFTR compound heterozygotes in particular is rather low. In summary, the study demonstrates the complexity of genetic interactions in CP and a minor influence of CFTR alterations in CP development.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
4 Results Frequencies of CFTR variants p.R75Q, p.I148T, 5T-allele and p.E528E were comparable in patients and controls. Login to comment
72 The following CFTR variants were analysed with specific FRET probes: p.E60X, p.R75Q, p.G85E, p.R117H, p.I148T, c.621 +1G>T (IVS4+1G>T), c.711+1G>T (IVS5+1G>T), c.1078delT, p.R334W, p.R347P, 9-13TG, 5-9T, p.A455E, p.M470V, p.F508del, c.1716G>A (p.E528E), c.1717-1G>A (IVS10-1G>A), p.G542X, p.S549N, p.R553X, p.R560T, c.1898+1G>A (IVS12 +1G>A), c.2143delT, c.2183AA>G, c.2562T>G, c.2657+5G>A (IVS14B+5G>A), p.L997F, p.I1005R, p.Y1092X, p.D1152H, p.R1162X, c.3659delC, p.S1235R, p.S1251N, p.W1282X, p.N1303K, and c.4389G>A. Login to comment
80 We excluded CFTR variants p.R75Q, p.I148T, the poly-T tract and p.E528E, PRSS1 variant p.S124F, SPINK1 variants c.1-52G>T and p.P55S, and CTRC variants p.R37Q, p.K151N and p.K172E from all calculations, because of missing functional data or a missing genetic association. Login to comment
94 Notably, p.I148T was never found in cis with c.3199del6, and p.S1235R was always associated with p.G628 (wild-type). Login to comment
111 Except one (p.R117H (7T/7T)/p. S1235), these compound heterozygotes were excluded in the overall computations, because CFTR variant p.R75Q, p.I148T, 5T or p.E528E was present in at least one allele. Login to comment
116 In addition, 24/660 (3.6%) patients and 2/1700 (0.1%) controls were trans-heterozygotes in that CFTR variants p.R75Q, p.I148T, 5T and p.E528E were essential for trans-heterozygous status (p<0.0001, OR 30.8, 95% CI 7.3 to 131). Login to comment
142 *Variants p.R75Q, p.I148T and p.E528E were excluded from calculations because of their similar frequencies in patients and controls. Login to comment
153 *Compound heterozygotes in that variants p.R75Q, p.I148T, 5T-allele, and p.E528E were essential for compound heterozygous status were excluded from calculations. Login to comment
166 (1-215G>A; 194+2T>C) p.E528E 1/660 (0.2%) 0/1758 NS e c.1-53C>T p.R75Q 1/660 (0.2%) 0/1758 NS e p.N34S (hom) p.R75Q (hom) 1/660 (0.2%) 0/1758 NS e p.N34S (hom) 5T/7T 1/660 (0.2%) 0/1758 NS e p.N34S (hom) p.E528E 2/660 (0.3%) 0/1758 NS e Continued Rosendahl J, Landt O, Bernadova J, et al. Gut (2012). Login to comment
167 doi:10.1136/gutjnl-2011-300645 of 11 Pancreas Table 5 Continued PRSS1 SPINK1 CTRC CFTR Patients Controls p Value OR (95% CI) p.N34S (het) p.R75Q 4/660 (0.6%) 1/1758 (0.06%) 0.03* 10.7 (1.2 to 96.1) p.N34S (het) p.I148T 1/660 (0.2%) 0/1758 NS e p.N34S (het) 5T/7T 5/660 (0.8%) 0/1758 0.002 29.5 (1.6 to 534.8) p.R65Q p.R75Q 1/660 (0.2%) 0/1758 NS e p.R67C p.E528E 1/660 (0.2%) 0/1758 NS e p.G217S p.E528E 0/546 1/1700 (0.06%) NS e To obtain stringent results, the total number of patients (n¼660) was used for calculations of p values, although some of the patients were not completely analysed. Login to comment
174 In the lower section, trans-heterozygotes with non-CF-causing variants, p.R75Q, p.I148T, 5T-allele and p.E528E, are displayed, which were excluded from calculations because their over-representation is due to accumulation of the concomitant variant (eg, p.N34S) in patients (see Results section) or the CFTR variant displayed similar frequencies in patients and controls (p.R75Q, p.I148T, 5T-allel, and p.E528E). Login to comment
179 CFTR variants, p.R75Q, p.I148T and p.E528E, were excluded from computations as explained before. Login to comment
183 yCompound and trans-heterozygous carriers with p.R75Q, p.I148T, 5T-allele and p.E528E were excluded as explained before. Login to comment
192 In contrast with other authors, we excluded CFTR variants p. R75Q, p.I148T, 5T and p.E528E from our calculations, because they were distributed similarly in patients and controls.30 31 Thereby, overall, CFTR variants displayed a 2.7-fold risk increase for CP development. Login to comment
69 The following CFTR variants were analysed with specific FRET probes: p.E60X, p.R75Q, p.G85E, p.R117H, p.I148T, c.621 +1G>T (IVS4+1G>T), c.711+1G>T (IVS5+1G>T), c.1078delT, p.R334W, p.R347P, 9-13TG, 5-9T, p.A455E, p.M470V, p.F508del, c.1716G>A (p.E528E), c.1717-1G>A (IVS10-1G>A), p.G542X, p.S549N, p.R553X, p.R560T, c.1898+1G>A (IVS12 +1G>A), c.2143delT, c.2183AA>G, c.2562T>G, c.2657+5G>A (IVS14B+5G>A), p.L997F, p.I1005R, p.Y1092X, p.D1152H, p.R1162X, c.3659delC, p.S1235R, p.S1251N, p.W1282X, p.N1303K, and c.4389G>A. Login to comment
77 We excluded CFTR variants p.R75Q, p.I148T, the poly-T tract and p.E528E, PRSS1 variant p.S124F, SPINK1 variants c.1-52G>T and p.P55S, and CTRC variants p.R37Q, p.K151N and p.K172E from all calculations, because of missing functional data or a missing genetic association. Login to comment
91 Notably, p.I148T was never found in cis with c.3199del6, and p.S1235R was always associated with p.G628 (wild-type). Login to comment
107 Except one (p.R117H (7T/7T)/p. S1235), these compound heterozygotes were excluded in the overall computations, because CFTR variant p.R75Q, p.I148T, 5T or p.E528E was present in at least one allele. Login to comment
112 In addition, 24/660 (3.6%) patients and 2/1700 (0.1%) controls were trans-heterozygotes in that CFTR variants p.R75Q, p.I148T, 5T and p.E528E were essential for trans-heterozygous status (p<0.0001, OR 30.8, 95% CI 7.3 to 131). Login to comment
137 *Variants p.R75Q, p.I148T and p.E528E were excluded from calculations because of their similar frequencies in patients and controls. Login to comment
147 *Compound heterozygotes in that variants p.R75Q, p.I148T, 5T-allele, and p.E528E were essential for compound heterozygous status were excluded from calculations. Login to comment
159 (1-215G>A; 194+2T>C) p.E528E 1/660 (0.2%) 0/1758 NS e c.1-53C>T p.R75Q 1/660 (0.2%) 0/1758 NS e p.N34S (hom) p.R75Q (hom) 1/660 (0.2%) 0/1758 NS e p.N34S (hom) 5T/7T 1/660 (0.2%) 0/1758 NS e p.N34S (hom) p.E528E 2/660 (0.3%) 0/1758 NS e Continued Table 5 Continued PRSS1 SPINK1 CTRC CFTR Patients Controls p Value OR (95% CI) p.N34S (het) p.R75Q 4/660 (0.6%) 1/1758 (0.06%) 0.03* 10.7 (1.2 to 96.1) p.N34S (het) p.I148T 1/660 (0.2%) 0/1758 NS e p.N34S (het) 5T/7T 5/660 (0.8%) 0/1758 0.002 29.5 (1.6 to 534.8) p.R65Q p.R75Q 1/660 (0.2%) 0/1758 NS e p.R67C p.E528E 1/660 (0.2%) 0/1758 NS e p.G217S p.E528E 0/546 1/1700 (0.06%) NS e To obtain stringent results, the total number of patients (n&#bc;660) was used for calculations of p values, although some of the patients were not completely analysed. Login to comment
171 CFTR variants, p.R75Q, p.I148T and p.E528E, were excluded from computations as explained before. Login to comment
175 yCompound and trans-heterozygous carriers with p.R75Q, p.I148T, 5T-allele and p.E528E were excluded as explained before. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Hepatol. 2009 Jan;50(1):150-7. Epub 2008 Oct 7. Henckaerts L, Jaspers M, Van Steenbergen W, Vliegen L, Fevery J, Nuytten H, Roskams T, Rutgeerts P, Cassiman JJ, Vermeire S, Cuppens H
Cystic fibrosis transmembrane conductance regulator gene polymorphisms in patients with primary sclerosing cholangitis.
J Hepatol. 2009 Jan;50(1):150-7. Epub 2008 Oct 7., [PMID:18992954]

Abstract [show]
BACKGROUND/AIMS: Primary sclerosing cholangitis (PSC) is a progressive cholestatic disease commonly associated with inflammatory bowel disease (IBD) and characterized by fibrosing inflammatory destruction of bile ducts. The histological features in the liver of PSC patients are similar to those observed in cystic fibrosis (CF). Our aim was to study whether variants in the CFTR gene are associated with the occurrence and/or evolution of PSC. METHODS: PSC patients (n=140) were genotyped for F508del, the TGmTn variants, and four additional polymorphic loci (1001+11 C>T, M470V, T854T and Q1463Q), and compared to 136 matched healthy controls. RESULTS: The 1540G-allele, encoding V470, was less frequent in PSC (52%) than in controls (64%, p=0.003), and was associated with protection against PSC in individuals without IBD (OR 0.25, 95% CI 0.12-0.52, p=0.0002). Also TG11-T7 was less frequent in PSC (53%) than in controls (61%, p=0.04), this haplotype was associated with reduced risk for PSC (OR 0.34, 95% CI 0.17-0.70, p=0.003) in individuals without IBD. CONCLUSIONS: In this cohort of PSC patients, several CFTR-variants affecting the functional properties of the CFTR protein seem to offer protection against the development of PSC, confirming our hypothesis that CFTR might be implicated in the pathogenesis of PSC.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
91 There was Table 4 Summary of the 37 CFTR variants studied in the exploratory phase INNO-LiPA CFTR 19 INNO-LiPA CFTR17+Tn Update F508del 621+1GfiT G542X 3849+10kbCfiT N1303K 2183AAfiG W1282X 394delTT G551D 2789+5GfiA 1717-1GfiA R1162X R553X 3659delC CFTRdele2,3(21kb) R117H I507del R334W 711+1GfiT R347P 3272-26AfiG G85E 3905insT 1078delT R560T A455E 1898+1GfiA 2143delT S1251N E60X I148T 2184delA 3199del6 711+5GfiA 3120+1GfiA Tn Q552X Fig. 1. Login to comment

[hide] Validation of high-resolution DNA melting analysis... J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7. Audrezet MP, Dabricot A, Le Marechal C, Ferec C
Validation of high-resolution DNA melting analysis for mutation scanning of the cystic fibrosis transmembrane conductance regulator (CFTR) gene.
J Mol Diagn. 2008 Sep;10(5):424-34. Epub 2008 Aug 7., [PMID:18687795]

Abstract [show]
High-resolution melting analysis of polymerase chain reaction products for mutation scanning, which began in the early 2000s, is based on monitoring of the fluorescence released during the melting of double-stranded DNA labeled with specifically developed saturation dye, such as LC-Green. We report here the validation of this method to scan 98% of the coding sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. We designed 32 pairs of primers to amplify and analyze the 27 exons of the gene. Thanks to the addition of a small GC-clamp at the 5' ends of the primers, one single melting domain and one identical annealing temperature were obtained to co-amplify all of the fragments. A total of 307 DNA samples, extracted by the salt precipitation method, carrying 221 mutations and 21 polymorphisms, plus 20 control samples free from variations (confirmed by denaturing high-performance liquid chromatography analysis), was used. With the conditions described in this study, 100% of samples that carry heterozygous mutations and 60% of those with homozygous mutations were identified. The study of a cohort of 136 idiopathic chronic pancreatitis patients enabled us to prospectively evaluate this technique. Thus, high-resolution melting analysis is a robust and sensitive single-tube technique for screening mutations in a gene and promises to become the gold standard over denaturing high-performance liquid chromatography, particularly for highly mutated genes such as CFTR, and appears suitable for use in reference diagnostic laboratories.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
171 Results of CFTR Analysis by HRM on 136 Samples of Patients with Idiopathic Chronic Pancreatitis (ICP) Exon Number of positive samples Mutations identified Variants identified New positive controls 1 14 14 125GϾC 2 1 1 R31C 3 9 1 G85E 7 R75Q 1 R74W 4 4 1 R117G 1 I148T R117G 1 R117H 1 A120T 5 1 1 L188P L188P 6a 5 1 V201M 1 A221A A221A 3 875ϩ40 AϾG 6b 27 1 M284T 26 1001ϩ11CϾT M284T 7 1 1 L320V L320V 8 0 0 9 1 1 D443Y 10 16 8 F508del 8 E528E 11 1 1 G542X 12 6 4 G576A 1 Y577Y L568F 1 L568F 13 7 1 S737F 4 R668C S737F 1 V754M L644L 1 L644L 14a 53 52 T854T T854TϩI853I 1 T854TϩI853I 14b 0 0 15 3 1 L967S T908S 1 T908S 1 S945L 16 0 0 17a 10 7 L997F 1 3271ϩ18CϾT 3271 ϩ 3AϾG 1 3271 ϩ 3 AϾG 1 Y1014C 17b 3 1 L1096L L1096L 1 H1054DϩG1069R 1 3272-33AϾG H1054DϩG1069R 3272-33AϾG 18 2 1 D1152H E1124del 1 E1124del 19 5 5 S1235R poly 20 7 1 W1282X 5 P1290P 1 D1270N 21 2 1 N1303K 1 T1299T 22 0 0 23 1 0 4374ϩ13 AϾG 24 43 40 Q1463Q 2 Y1424Y 1 Q1463QϩY1024Y ing domain of a gene brings an excellent sensitivity for heterozygote detection that is very close to 100%. Login to comment

[hide] Analysis of the CFTR gene in Iranian cystic fibros... J Cyst Fibros. 2008 Mar;7(2):102-9. Epub 2007 Jul 27. Alibakhshi R, Kianishirazi R, Cassiman JJ, Zamani M, Cuppens H
Analysis of the CFTR gene in Iranian cystic fibrosis patients: identification of eight novel mutations.
J Cyst Fibros. 2008 Mar;7(2):102-9. Epub 2007 Jul 27., [PMID:17662673]

Abstract [show]
BACKGROUND: Cystic fibrosis (CF) is the most common inherited disorder in Caucasian populations, with over 1400 mutations identified in the Cystic Fibrosis Transmembrane conductance Regulator (CFTR) gene. Mutations in the CFTR gene may be also causative for CBAVD (Congenital Bilateral Absence of the Vas Deferens). The type and distribution of mutations varies widely between different countries and/or ethnic groups, and is relatively unknown in Iran. We therefore performed a comprehensive analysis of the CFTR gene in Iranian CF patients. METHODS: 69 Iranian CF patients, and 1 CBAVD patient, were analysed for mutations in the complete coding region, and its exon/intron junctions, of their CFTR genes, using different methods, such as ARMS (amplification refractory mutation system)-PCR, SSCP (single stranded conformation polymorphism) analysis, restriction enzyme digestion analysis, direct sequencing, and MLPA (Multiplex Ligation-mediated Probe Amplification). RESULTS: CFTR mutation analysis revealed the identification of 37 mutations in 69 Iranian CF patients. Overall, 81.9% (113/138) CFTR genes derived from Iranian CF patients could be characterized for a disease-causing mutation. The CBAVD patient was found to be homozygous for the p.W1145R mutation. The most common mutations were p.F508del (DeltaF508) (18.1%), c.2183_2184delAAinsG (2183AA>G) (6.5%), p.S466X (5.8%), p.N1303K (4.3%), c.2789+5G>A (4.3%), p.G542X (3.6%), c.3120+1G>A (3.6%), p.R334W (2.9%) and c.3130delA (2.9%). These 9 types of mutant CFTR genes totaled for 52% of all CFTR genes derived from the 69 Iranian CF patients. Eight mutations, c.406-8T>C, p.A566D, c.2576delA, c.2752-1_2756delGGTGGCinsTTG, p.T1036I, p.W1145R, c.3850-24G>A, c.1342-?_1524+?del, were found for the first time in this study. CONCLUSIONS: We identified 37 CFTR mutations in 69 well characterized Iranian CF patients, obtaining a CFTR mutation detection rate of 81.9%, the highest detection rate obtained in the Iranian population so far. These findings will assist in genetic counseling, prenatal diagnosis and future screening of CF in Iran.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 In the five patients with a broad spectrum of respiratory diseases or undefined pancreatic disease and borderline (40-60 mmol/l) sweat chloride values, the heterozygous state for 1 mutation was found, i.e. the c.3499+37GNA, c.2789+5GNA, c.406-8TNC, c.3850-24GNA, and the p.I148T polymorphism. Login to comment
92 In the five patients with a broad spectrum of respiratory diseases or undefined pancreatic disease and borderline (40-60 mmol/l) sweat chloride values, the heterozygous state for 1 mutation was found, i.e. the c.3499+37GNA, c.2789+5GNA, c.406-8TNC, c.3850-24GNA, and the p.I148T polymorphism. Login to comment

[hide] Mutational spectrum of cystic fibrosis patients fr... Mol Genet Metab. 2006 Apr;87(4):370-5. Epub 2006 Jan 19. Ramirez AM, Ramos MD, Jimenez J, Ghio A, de Botelli MM, Rezzonico CA, Marques I, Pereyro S, Casals T, de Kremer RD
Mutational spectrum of cystic fibrosis patients from Cordoba province and its zone of influence: implications of molecular diagnosis in Argentina.
Mol Genet Metab. 2006 Apr;87(4):370-5. Epub 2006 Jan 19., [PMID:16423550]

Abstract [show]
Cystic Fibrosis (CF) is an autosomal recessive disorder affecting 1/2000-4000 newborns in Caucasian populations. This lethal disease mainly affects respiratory and digestive organs as well as fertility in man. So far, the CF prevalence and mutational spectrum have showed specificity among populations and regions, making it necessary to establish them in each one. In this study, we present the spectrum and frequency of CFTR gene mutations in CF patients from Cordoba (a province with 3.1 millions inhabitants in the middle of Argentina) and its zone of influence, to offer an accurate genetic testing. The study includes 78 families in which 98 patients fulfilled clinical criteria to CF diagnosis. The strategy for the molecular diagnosis comprised analysis of 21 common mutations, microsatellite haplotypes and the complete CFTR gene analysis using scanning techniques followed by sequencing of the abnormal migration patterns. Our first step led us to the identification of 10 mutations that represented 76% of alleles. Another four mutations (p.R1066C, c.1811 + 1.6 kbA > G, c.711 + 1G > T, and p.G85E) were found based on the microsatellite haplotype-mutation association. Finally, 14 mutations were characterized after the CFTR gene scanning, three of them are not previously described (p.G27R, c.622-2A > G, and p.W277R). In summary, we have identified 27 mutations accounting for 94.23% of CF alleles. This characteristic mutational spectrum highlights the 14 most frequent mutations (>1%) in the Cordoba region.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 The mutation c.3199_3204delATAGTG has been found in the same allele that the p.I148T, a complex allele previously described. Login to comment
75 More recently, it has been proposed that the p.I148T is a benign polymorphism. Login to comment
85 Haplotype (n D 20) No. of chromosomes (n D 64)a Mutations associated (No. of chromosomes) 23-31 14 p.F508del 17-31 7 p.F508del 17-7 7 p.R1066C (3), p.W277R, c.2789 + 5G > A, c.3120 + 1G > A, c.3849 + 10KbC > T 16-7 6 c.3272-26A > G (2), p.G27R, c.622-2A > G, unknown (2) 16-32 5 p.S589I (2), unknown (3) 16-30 3 IVS8-5T (2), unknown 23-33 2 p.G542X, p.R1283M 23-32 2 p.G542X 23-30 2 p.F508del, p.N1303K 24-31 2 p.N1303K 16-24 2 p.G85E 16-31 3 c.1898 + 1G > A, p.W1089X, unknown 16-46 2 c.1811 + 1.6KbA > G 16-25 1 c.711 + 1G > T 16-33 1 Unknown 16-44 1 c.1898 + 1G > A 16-45 1 p.Y913C 16-47 1 c.4005 + 1G > A 17-30 1 Unknown 23-7 1 [c.3199_3204delATAGTG; p.I148T] Table 2 Frequency of the mutations in the 78 CF Argentinean patients of Córdoba region a IdentiWed novel mutations. Login to comment
86 Mutation Exon/Intron CF alleles % p.F508del Exon 10 94 60.26 p.N1303K Exon 21 8 5.13 p.G542X Exon 11 7 4.49 p.R334W Exon 7 3 1.93 p.R1066C Exon 17b 3 1.93 c.2789 + 5G > A Intron 14b 3 1.93 p.G85E Exon 3 2 1.28 c.3659del C Exon 19 2 1.28 c.1811 + 1.6kbA > G Intron 11 2 1.28 c.1898 + 1G > A Intron 12 2 1.28 c.3272-26A > G Intron 17a 2 1.28 p.S589I Exon 12 2 1.28 p.R553X Exon 11 2 1.28 IVS8-5T Intron 8 2 1.28 c.3849 + 10kb C > T Intron 19 1 0.64 c.621 + 1G > T Intron 4 1 0.64 p.R1162X Exon 19 1 0.64 c.711 + 1G > T Intron 5 1 0.64 c.3120 + 1G > A Intron 16 1 0.64 p.Y913C Exon 15 1 0.64 c.4005 + 1G > A Intron 20 1 0.64 p.W1089X Exon 17b 1 0.64 p.R1283M Exon 20 1 0.64 [p.I148T;c.3199_3204del ATAGTG] Exon 4, Exon 17a 1 0.64 p.G27Ra Exon 2 1 0.64 p.W277Ra Exon 6b 1 0.64 c.622-2A > Ga Intron4 1 0.64 Unknown allele - 9 5.77 Wrst year of life he required several internments, for hydroelectric desequilibrium and persistent pulmonary infections causing failure to thrive. Login to comment

[hide] Detection of an apparent homozygous 3120G>A cystic... J Mol Diagn. 2006 Feb;8(1):137-40. Heaney DL, Flume P, Hamilton L, Lyon E, Wolff DJ
Detection of an apparent homozygous 3120G>A cystic fibrosis mutation on a routine carrier screen.
J Mol Diagn. 2006 Feb;8(1):137-40., [PMID:16436646]

Abstract [show]
A 28-year-old Caucasian female with no personal or family history of cystic fibrosis (CF) presented for preconception counseling and screening. Cystic fibrosis transmembrane conductance regulator (CFTR) mutation analysis using the Inno-LiPa CFTR assay revealed lack of hybridization for both the wild-type and mutant oligonucleotides for 3120+1G>A. This region was sequenced, and an apparent homozygous 3120G>A mutation was detected. Additional testing revealed an abnormal sweat chloride (77 mmol/L). Review of systems was essentially unremarkable with an absence of sinus symptoms, occasional nonproductive cough, and no features of malabsorption. Physical examination, chest X-ray, and pulmonary function tests were within normal limits. Only two other patients (siblings) with homozygous 3120G>A mutations have been reported (http://www.genet.sickkids.on.ca/cftr/). Both siblings had pancreatic insufficiency, mild pulmonary symptoms, and abnormal sweat chloride levels. Our findings suggest that a homozygous mutation of a G>A conversion at 3120 is associated with abnormal CFTR function and either a mild form of CF or no overt symptoms of disease, emphasizing the difficulties in assigning genotype/phenotype correlation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 Similar to I148T influencing 3199del6 in cis18,19 or R117H being influenced by the 5T variant,20 there could be an additional mutation on the same chromosome causing different phenotypes for those who have the same apparent genotype. Login to comment

[hide] A haplotype framework for cystic fibrosis mutation... J Mol Diagn. 2006 Feb;8(1):119-27. Elahi E, Khodadad A, Kupershmidt I, Ghasemi F, Alinasab B, Naghizadeh R, Eason RG, Amini M, Esmaili M, Esmaeili Dooki MR, Sanati MH, Davis RW, Ronaghi M, Thorstenson YR
A haplotype framework for cystic fibrosis mutations in Iran.
J Mol Diagn. 2006 Feb;8(1):119-27., [PMID:16436643]

Abstract [show]
This is the first comprehensive profile of cystic fibrosis transmembrane conductance regulator (CFTR) mutations and their corresponding haplotypes in the Iranian population. All of the 27 CFTR exons of 60 unrelated Iranian CF patients were sequenced to identify disease-causing mutations. Eleven core haplotypes of CFTR were identified by genotyping six high-frequency simple nucleotide polymorphisms. The carrier frequency of 2.5 in 100 (1 in 40) was estimated from the frequency of heterozygous patients and suggests that contrary to popular belief, cystic fibrosis may be a common, under-diagnosed disease in Iran. A heterogeneous mutation spectrum was observed at the CFTR locus in 60 cystic fibrosis (CF) patients from Iran. Twenty putative disease-causing mutations were identified on 64 (53%) of the 120 chromosomes. The five most common Iranian mutations together represented 37% of the expected mutated alleles. The most frequent mutation, DeltaF508 (p.F508del), represented only 16% of the expected mutated alleles. The next most frequent mutations were c.1677del2 (p.515fs) at 7.5%, c.4041C>G (p.N1303K) at 5.6%, c.2183AA>G (p.684fs) at 5%, and c.3661A>T (p.K1177X) at 2.5%. Three of the five most frequent Iranian mutations are not included in a commonly used panel of CF mutations, underscoring the importance of identifying geographic-specific mutations in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 Six were exonic polymorphisms that were either silent for an amino acid change or demonstrated to have little or no effect on protein function (p.E92E, p.I148T, p.M470V, p.E1194A, p.P1290P, and p.Q1463Q). Login to comment
109 A third variant (p.I148T) was confirmed as a neutral polymorphism by a recent report.34 However, p.M470V may not be strictly neutral.21,35 It was found that the M470 protein matured more slowly and had increased intrinsic chloride channel activity compared with the V470 protein.35 In addition, the V470 allele was shown to reduce CFTR protein activity when present in combination with H1352.21 M470V may also affect exon 9 skipping during splicing processes.35,36 Its incidence in non-cystic fibrosis CFTR-related diseases also suggests that M470V has a role in those diseases.36,37 M470V in phase with the T5 allele of the polymorphic Tn locus was suggested to be a disease-causing allele in a Korean cystic fibrosis patient.38 The extent to which this allele may have contributed to the disease Table 1. Login to comment
128 Putative Polymorphism in the CFTR Gene of Iranian CF Patients Genomic position* Polymorphism designation Location in gene Effect on protein Minor allele frequency DB-SNP number 42296936 c.185ϩ45AϾG Intron 1 1% 42325703 c.297-75CϾA Intron 2 6% 42347645 c.408AϾG Exon 4 E92E 1% 42347812 c.575TϾC Exon 4 I148T 2% 42352195 c.875ϩ40AϾG Intron 6a 2% 42353259 c.876-33delTTGA Intron 6a 45% rs4148700 42353428 c.1001ϩ11CϾT Intron 6b 30% rs1800503 42376147 c.1525-61AϾG Intron 9 35% 42376223 c.1540AϾG Exon 10 M470V 45% rs213950 42376407 c.1716ϩ8AϾG Intron 10 1% 42423325 c.3041-92GϾA Intron 15 15% 42423346 c.3041-71GϾC Intron 15 1% 42423539 c.3271ϩ42AϾT Intron 16b 1% 42427170 c.3272-93TϾC Intron 16b 3% 42444201 c.3601-65CϾA Intron 18 14% rs213989 42444378 c.3713AϾC Exon 19 E1194A 1% 42459334 c.4002AϾG Exon 20 P1290P 3% rs1800130 42459458 c.4005ϩ121delTT Intron 20 2% 42469386 c.4006-200GϾA Intron 20 16% rs214164 42469496 c.4006-90delC Intron 20 2% 42483798 c.4521GϾA Exon 24 Q1463Q 19% rs1800136 *Genomic reference sequence NT_007933. Login to comment

[hide] Spectrum of mutations in CFTR in Finland: 18 years... J Cyst Fibros. 2005 Dec;4(4):233-7. Epub 2005 Jul 26. Kinnunen S, Bonache S, Casals T, Monto S, Savilahti E, Kere J, Jarvela I
Spectrum of mutations in CFTR in Finland: 18 years follow-up study and identification of two novel mutations.
J Cyst Fibros. 2005 Dec;4(4):233-7. Epub 2005 Jul 26., [PMID:16051530]

Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) is low in the isolated Finnish population and the Finnish CF mutation spectrum has differed from many European countries. METHODS: We have analyzed the mutation spectrum and the geographical distribution of CF mutations in Finland covering the last 18 years (1987-2004). RESULTS: A total of 14 mutations were identified; two of them new, 774insT and S589T (G>C at 1,898). The overall coverage of mutations was 97% (99/102 chromosomes). The most frequent mutations were F508del and 394delTT, found in 36% (37/102) and 35% (36/102) of the CF chromosomes respectively. Of the rare mutations, a mutation of presumable Slavic origin, CFTRdele2.3 (21 kb), was enriched in a rural isolate with a frequency of 5,9% (6/102), and a mutation that possibly indicates Swedish influence, 3659delC, was scattered throughout the country with a similar frequency of 5,9% (6/102). G542X, R1162X, R117H, 3732delA, 1,898 + 3A >C, S1196X, S945L, W57R, 774insT and S589T were each identified in a number of chromosomes from one to three. CONCLUSIONS: Our observations of the Finnish CF mutation spectrum fit well with the characteristics of Finland as a population of multiple local founder effects.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
36 The InnoLipa assay recognizes 36 mutations: E60X (c.178G>T, p.Glu60X), G85E (c.254G>A, p.Gly85- Glu), 394delTT, R117H (c.350G>A, p.Arg117His), I148T (c.443T>C, p.Ile148Thr), 621+1G>T (c.489+1G>T), 711+1G>T (c.579+1G>T), 711+5G>A (c.579+5G>A), 1078delT (c.948delT, p.Phe316fs), R334W (c.1000C>T, p.Arg334Trp), R347P (c.1040G>C, p.Arg347Pro), A455E (c.1364C>A, p.Ala455Glu), I507del (c.1519_1521delATC, p.Ile507del), F508del, 1717À1G>A (c.1585À1G>A), G542X, G551D (c.1652G >A, p.Gly551Asp), Q552X (c.1654C > T, p.Gln552X), R553X (c.1657C > T, p.Arg553X), R560T (1679G>vC, p.Arg560Thr), 1898+ 1G > A (c.1766 + 1G > A), 2143delT (c.2012delT, p.Leu671fs), 2183AA > G (c.2051_2052delAAinsG, p.Lys684fs), 2184delA (c.2052delA, p.Lys684fs), 2789+ 5G>A (c.2657+5G>A), 3120+1G>A (c.2988+1G>A), 3199del6 (c.3067_3072del, p.Ile1023_Val1024del), 3272À 26A > G (c.3140 À26A > G), R1162X (c.3484C > T, p.Arg1162X), 3849+10kbCYT, 3659delC (c.3528delC, p.Lys1177fs), S1251N (c.3752G > A, p.Ser1251Asn), 3905insT (c.3773dupT, p.Leu1258fs), W1282X (c.3846G> A, p.Trp1282X), N1303K (c.3909C>G, p.Asn1303Lys), CFTRdele2,3(21kb) and Tn-polymorphism on intron 8. Login to comment
37 The InnoLipa assay recognizes 36 mutations: E60X (c.178G>T, p.Glu60X), G85E (c.254G>A, p.Gly85Glu), 394delTT, R117H (c.350G>A, p.Arg117His), I148T (c.443T>C, p.Ile148Thr), 621+1G>T (c.489+1G>T), 711+1G>T (c.579+1G>T), 711+5G>A (c.579+5G>A), 1078delT (c.948delT, p.Phe316fs), R334W (c.1000C>T, p.Arg334Trp), R347P (c.1040G>C, p.Arg347Pro), A455E (c.1364C>A, p.Ala455Glu), I507del (c.1519_1521delATC, p.Ile507del), F508del, 1717 1G>A (c.1585 1G>A), G542X, G551D (c.1652G >A, p.Gly551Asp), Q552X (c.1654C > T, p.Gln552X), R553X (c.1657C > T, p.Arg553X), R560T (1679G>vC, p.Arg560Thr), 1898+ 1G > A (c.1766 + 1G > A), 2143delT (c.2012delT, p.Leu671fs), 2183AA > G (c.2051_2052delAAinsG, p.Lys684fs), 2184delA (c.2052delA, p.Lys684fs), 2789+ 5G>A (c.2657+5G>A), 3120+1G>A (c.2988+1G>A), 3199del6 (c.3067_3072del, p.Ile1023_Val1024del), 3272 26A > G (c.3140 26A > G), R1162X (c.3484C > T, p.Arg1162X), 3849+10kbCYT, 3659delC (c.3528delC, p.Lys1177fs), S1251N (c.3752G > A, p.Ser1251Asn), 3905insT (c.3773dupT, p.Leu1258fs), W1282X (c.3846G> A, p.Trp1282X), N1303K (c.3909C>G, p.Asn1303Lys), CFTRdele2,3(21kb) and Tn-polymorphism on intron 8. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
164 This is lower than the ϳ65% relative mutation frequency in Caucasian individuals.11 In addition, the mutations that were identified in this control group were largely rare, and only 13/61 (including I148T) different mutations are included in the 25 mutation screening panel recommended by ACMG/ACOG. Login to comment
173 Of the 22 mutations present at a relative frequency of 1% or more, only eight are currently included in the standard 25 mutation panel recommended (I148T, R334W, ⌬F508, G542X, R553X, 1717-1GϾA, 3120 ϩ 1GϾA, and 3849 ϩ 10kbCϾT), although a recent ACMG revision will remove variant I148T.13 The California Department of Health Services is also tracking Hispanic mutations.15 However, these may duplicate some of those described in the other reports and therefore are not included in this analysis. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment
199 The pooled data set demonstrates that the most frequently seen mutations are: ⌬F508, G542X, 406-1GϾA, W1204X, R75X, 2055del9ϾA, 3876delA, ⌬I507, S549N, I148T, N1303K, 935delA, and 3849 ϩ 10kbCϾT. Login to comment
201 Comparison of Relative Frequencies of CFTR Sequence Variants in Comprehensive CFTR Studies in US and Mexican Hispanics This study % Orozco 2000 % US/ Mexican % deltaF508 28.96 54.48 43.72 G542X 3.83 8.28 5.19 406 - 1GϾA 3.28 2.07 2.38 W1204X 2.19 Ͻ1 1.08 R74W 1.64 Ͻ1 R75X 1.64 2.07 1.51 H199Y 1.64 Ͻ1 Ͻ1 L206W 1.64 Ͻ1 L997F 1.64 Ͻ1 I1027T 1.64 Ͻ1 2055del9ϾA 1.64 1.38 1.27 D1270N 1.64 Ͻ1 E116K 1.09 Ͻ1 V232D 1.09 Ͻ1 R334W 1.09 Ͻ1 S492F 1.09 Ͻ1 T501A 1.09 Ͻ1 R553X 1.09 Ͻ1 Ͻ1 E588V 1.09 Ͻ1 R668C 1.09 Ͻ1 Q890X 1.09 Ͻ1 W1089X 1.09 Ͻ1 S1235R 1.09 Ͻ1 D1445N 1.09 Ͻ1 3876delA 1.09 3.24 1717 - 8GϾA 1.09 Ͻ1 3272 - 26AϾG 1.09 Ͻ1 A1009T 1.09 Ͻ1 deltaI507 Ͻ1 3.45 1.30 S549N Ͻ1 3.45 1.95 G567A Ͻ1 Ͻ1 I148T 2.07 1.08 I506T 1.38 Ͻ1 N1303K 2.76 1.08 935delA 1.38 1.30 2183AAϾG 1.38 Ͻ1 3199del6 1.38 Ͻ1 3849 ϩ 10kbCϾT Ͻ1 1.30 ACMG/ACOG italicized. Login to comment
202 which occur with a relative frequency above 1% in the pooled data set, only six (⌬F508, G542X, ⌬I507, I148T, N1303K, and 3849 ϩ 10kbCϾT) were included in the ACMG/ACOG 25-mutation screening panel12 and in the recent revision exclusion of I148T has been recommended.13 The most frequently seen mutations in the U.S. and Mexican studies combined (n ϭ 462 identified mutations) include the 10 most frequent mutations observed in the Mexican study.36 They also include all but one mutation (R334W) occurring with a relative frequency above 1% in the five combined studies performed in the U.S. In that group, only ⌬I507, N1303K and I148T were present at a relative frequency below 1%. Login to comment

[hide] Complete gene scanning by temperature gradient cap... J Mol Diagn. 2005 Feb;7(1):111-20. Chou LS, Gedge F, Lyon E
Complete gene scanning by temperature gradient capillary electrophoresis using the cystic fibrosis transmembrane conductance regulator gene as a model.
J Mol Diagn. 2005 Feb;7(1):111-20., [PMID:15681482]

Abstract [show]
Many inherited diseases involve large genes with many different mutations. Identifying a wide spectrum of mutations requires an efficient gene-scanning method. By differentiating thermodynamic stability and mobility of heteroduplexes from heterozygous samples, temperature gradient capillary electrophoresis (TGCE) was used to scan the entire coding region of the cystic fibrosis transmembrane conductance regulator gene. An initial panel (29 different mutations) showed 100% agreement between TGCE scanning and previously genotyped results for heterozygous samples. Different peak patterns were observed for single base substitutions and base insertions/deletions. Subsequently, 12 deidentified clinical samples genotyped as wild type for 32 mutations were scanned for the entire 27 exons. Results were 100% concordance with the bidirectional sequence analysis. Ten samples had nucleotide variations including a reported base insertion in intron 14b (2789 + 2insA) resulting in a possible mRNA splicing defect, and an unreported missense mutation in exon 20 (3991 G/A) with unknown clinical significance. This methodology does not require labeled primers or probes for detection and separation through a temperature gradient eliminates laborious temperature optimization required for other technologies. TGCE automation and high-throughput capability can be implemented in a clinical environment for mutation scanning with high sensitivity, thus reducing sequencing cost and effort.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 Mutation Samples with Known Genotypes Scanned by TGCE* Exon Mutation† Amplicon size (bp) Location of mutation from 5Ј end (bp) Base change Detection‡ 3 G85E 234 124 G to A 1/1 3 394delTT 234 132 del TT 1/1 4 R117H 270 83 G to T 2/2 4 I148T 270 176 T to C 3/3 Intron 4 621 ϩ 1 G/T 270 233 G to T 1/1 5 663delT/663delT 186 75 del T 0/1 Intron 5 711 ϩ 1 G/T 186 124 G to T 1/1 7 R334W 345 208 C to T 1/1 7 R347P 345 248 G to C 1/1 9 A455E 263 155 C to A 2/2 10 I506V 292 168 A to G 1/1 10 ⌬I507 292 171 del ATC 2/2 10 ⌬F508 292 174 del TTT 2/2 10 ⌬F508/⌬F508 292 174 del TTT 0/1 10 F508C 292 175 T to G 1/1 10 V520F 292 210 G to T 1/1 Intron 10 1717-1 G/A 175 50 G to A 1/1 11 G542X 175 90 G to T 2/2 11 G542X/G542X 175 90 G to T 0/1 11 G551D 175 118 G to A 3/3 11 R553X 175 123 C to T 3/3 11 R560T 175 145 G to C 2/2 13 2184delA 834 356 del A 1/1 Intron 14b 2789 ϩ 5G/A 192 102 G to A 1/1 Intron 16 3120 ϩ 1G/A 216 111 G to A 1/1 19 R1162X 322 68 C to T 1/1 19 3659delC 322 111 del C 1/1 20 W1282X 206 154 G to A 1/1 21 N1303K 250 175 C to G 2/2 Total exon/intron Overall accuracy 17 93% *Samples were compared with their respective wild-type control (confirmed by sequencing). Login to comment
113 In this 270-bp fragment, heterozygous R117H (G/T) is located 83 bp from the 5Ј end, heterozygous I148T (T/C) is located in the middle of the fragment, and heterozygous 621 ϩ 1 (G/T) is located at the end of the fragment (37 bp from the 3Ј end) (Figure 4, A to D; Table 1). Login to comment
114 Heterozygous 621 ϩ 1 (G/T) had the least distinct split-peak pattern when compared to heterozygous R117H and I148T (Figure 4; B to D). Login to comment
146 A: Wild-type; B: R117H heterozygous (exon 4); C: I148T heterozygous (exon 4); D: 621 ϩ 1 G/T heterozygous sample 1 (intron 4); E: 621 ϩ 1 G/T heterozygous sample 2 (intron 4, from Coriell Repository); F: 621 ϩ 1 G/T heterozygous sample 3 (intron 4, from Coriell Repository). Login to comment
179 Discussion More than 1000 mutations have been reported since the CFTR gene was cloned and characterized in 1989.23,25 Of these mutations, ⌬F508 (a 3-base deletion) is the most frequent mutation and results in a defective cAMP-regulated chloride transport in epithelial cells.26 Other mutations in the CFTR gene such as G542X, G551D, and N1303K occur in greater than 1% in the CF population and are associated with severe pancreatic insufficiency.23,27 Recently, carriers of the I148T mutation have received more attention because I148T has been found in association with the 3199del6 mutation, which may be necessary for the classic CF phenotype.28 Because of the complexity of both the mutations and the phenotypes, a high-throughput mutation scanning method to screen the entire coding region of the CFTR gene may provide valuable clinical information regarding CF genotypes and respective phenotypes. Login to comment

[hide] Rapid screening for 31 mutations and polymorphisms... Methods Mol Med. 2005;114:147-71. Dunbar SA, Jacobson JW
Rapid screening for 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator gene by Lminex xMAP suspension array.
Methods Mol Med. 2005;114:147-71., [PMID:16156102]

Abstract [show]
A suspension array hybridization assay is described for the detection of 31 mutations and polymorphisms in the cystic fibrosis transmembrane conductance regulator (CFTR) gene using Luminex xMAP technology. The Luminex xMAP system allows simultaneous detection of up to 100 different targets in a single multiplexed reaction. Included in the method are the procedures for design of oligonucleotide capture probes and PCR amplification primers, coupling oligonucleotide capture probes to carboxylated microspheres, hybridization of coupled microspheres to oligonucleotide targets, production of targets from DNA samples by multiplexed PCR amplification, and detection of PCR-amplified targets by direct hybridization to probe-coupled microspheres. Mutation screening with the system is rapid, requires relatively few sample manipulations, and provides adequate resolution to reliably genotype the 25 CFTR mutations and 6 CFTR polymorphisms contained in the ACMG/ACOG/NIH-recommended core mutation panel for general population CF carrier screening.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
94 Methods The methods described below include: (1) design of oligonucleotide capture probes, (2) design of PCR amplification primers and multiplexed PCR reactions, (3) preparation of the probe-conjugated microsphere sets, (4) verification 150 Dunbar and Jacobson xMAPTM Table 2 Oligonucleotide Capture Probesa Target Microsphere Probe sequence Modificationb Sequence 5' → 3' set Standard mutation panel 1c I507 & F508 5'-AmMC12 AACACCAAAGATGATATTTT 006 2B DI507 5'-AmMC12 ACACCAAAGATATTTTCTT 008 3B DF508 5'-AmMC12 AAACACCAATGATATTTTC 015 4B W1282 5'-AmMC12 CAACAGTGGAGGAAAGCC 012 5B W1282X 5'-AmMC12 CAACAGTGAAGGAAAGCC 020 6 1717-1G 5'-AmMC12 TTGGTAATAGGACATCTCCA 017 7 1717-1GÆA 5'-AmMC12 TTGGTAATAAGACATCTCCA 019 8B G542 5'-AmMC12 TATAGTTCTTGGAGAAGGTGGA 026 9B G542X 5'-AmMC12 TATAGTTCTTTGAGAAGGTGGA 028 10C G551 & R553 5'-AmMC12 AGTGGAGGTCAACGAGCAA 038 11B G551D 5'-AmMC12 GTGGAGATCAACGAGCAA 030 12C R553X 5'-AmMC12 GTGGAGGTCAATGAGCAA 032 13 R560 5'-AmMC12 CTTTAGCAAGGTGAATAACT 035 14 R560T 5'-AmMC12 CTTTAGCAACGTGAATAACT 039 15 R117 5'-AmMC12 AGGAGGAACGCTCTATCGCG 042 16 R117H 5'-AmMC12 AGGAGGAACACTCTATCGCG 025 17B I148 5'-AmMC12 CTTCATCACATTGGAATGCAGA 034 18B I148T 5'-AmMC12 CTTCATCACACTGGAATGCAGA 045 19C 621+1G 5'-AmMC12 TTTATAAGAAGGTAATACTTCCT 046 20E 621+1G→T 5'-AmMC12 ATTTATAAGAAGTTAATACTTCCTT 048 21 N1303 5'-AmMC12 GGGATCCAAGTTTTTTCTAA 051 22 N1303K 5'-AmMC12 GGGATCCAACTTTTTTCTAA 052 23B 1078T 5'-AmMC12 CACCACAAAGAACCCTGA 054 24C 1078delT 5'-AmMC12 ACACCACAAGAACCCTGA 061 25 R334 5'-AmMC12 ATATTTTCCGGAGGATGATT 063 26 R334W 5'-AmMC12 ATATTTTCCAGAGGATGATT 064 27B R347 5'-AmMC12 ACCGCCATGCGCAGAACAA 067 28B R347P 5'-AmMC12 ACCGCCATGGGCAGAACAA 053 29C 711+1G 5'-AmMC12 ATTTGATGAAGTATGTACCTAT 059 30C 711+1G→T 5'-AmMC12 ATTTGATGAATTATGTACCTAT 071 31 G85 5'-AmMC12 TGTTCTATGGAATCTTTTTA 066 32B G85E 5'-AmMC12 ATGTTCTATGAAATCTTTTTA 073 33 3849+10kbC 5'-AmMC12 GTCTTACTCGCCATTTTAAT 077 34 3849+10kbC→T 5'-AmMC12 GTCTTACTCACCATTTTAAT 075 35 A455 5'-AmMC12 CCAGCAACCGCCAACAACTG 011 36D A455E 5'-AmMC12 TCCAGCAACCTCCAACAACTG 036 37 R1162 5'-AmMC12 TAAAGACTCGGCTCACAGAT 060 38 R1162X 5'-AmMC12 TAAAGACTCAGCTCACAGAT 068 39B 3659C 5'-AmMC12 TTGACTTGGTAGGTTTAC 022 40C 3659delC 5'-AmMC12 TTGACTTGTAGGTTTACC 079 41B 2789+5G 5'-AmMC12 TGGAAAGTGAGTATTCCATGTC 074 42D 2789+5G→A 5'-AmMC12 TTGGAAAGTGAATATTCCATGTC 014 43E 2184A 5'-AmMC12 GAAACAAAAAAACAATC 007 44E 2184delA 5'-AmMC12 AGAAACAAAAAACAATC 018 45B 1898+1G 5'-AmMC12 TATTTGAAAGGTATGTTCTTTG 013 (Continued) of microsphere coupling, (5) direct hybridization of biotinylated PCR amplification products to the multiplexed probe-coupled microsphere sets, and (6) results and data analysis. Login to comment
106 Table 3 Reverse Complementary Oligonucleotide Targetsa Target Target sequence Modification Sequence 5' → 3' Standard mutation panel C1b I507 & F508 5'-Biotin AAAATATCATCTTTGGTGTT C2 ΔI507 5'-Biotin AAAGAAAATATCTTTGGTGT C3 ΔF508 5'-Biotin AGAAAATATCATTGGTGTTT C4 W1282 5'-Biotin GGCTTTCCTCCACTGTTGC C5 W1282X 5'-Biotin GGCTTTCCTTCACTGTTGC C6 1717-1G 5'-Biotin TGGAGATGTCCTATTACCAA C7 1717-1G→A 5'-Biotin TGGAGATGTCTTATTACCAA C8 G542 5'-Biotin CCACCTTCTCCAAGAACTAT C9 G542X 5'-Biotin CCACCTTCTCAAAGAACTAT C10 G551 & R553 5'-Biotin CTTGCTCGTTGACCTCCACT C11 G551D 5'-Biotin CTTGCTCGTTGATCTCCACT C12 R553X 5'-Biotin CTTGCTCATTGACCTCCACT C13 R560 5'-Biotin AGTTATTCACCTTGATAAAG C14 R560T 5'-Biotin AGTTATTCACGTTGCTAAAG C15 R117 5'-Biotin CGCGATAGAGCGTTCCTCCT C16 R117H 5'-Biotin CGCGATAGAGTGTTCCTCCT C17 I148 5'-Biotin CTGCATTCCAATGTGATGAA C18 I148T 5'-Biotin CTGCATTCCAGTGTGATGAA C19 621+1G 5'-Biotin GGAAGTATTACCTTCTTATA C20 621+1G→T 5'-Biotin GGAAGTATTAACTTCTTATA C21 N1303 5'-Biotin TTAGAAAAAACTTGGATCCC C22 N1303K 5'-Biotin TTAGAAAAAAGTTGGATCCC C23 1078T 5'-Biotin CTCAGGGTTCTTTGTGGTGT C24 1078delT 5'-Biotin TCTCAGGGTTCTTGTGGTGT C25 R334 5'-Biotin AATCATCCTCCGGAAAATAT C26 R334W 5'-Biotin AATCATCCTCTGGAAAATAT C27 R347 5'-Biotin ATTGTTCTGCGCATGGCGGT C28 R347P 5'-Biotin ATTGTTCTGCCCATGGCGGT C29 711+1G 5'-Biotin TAGGTACATACTTCATCAAA C30 711+1G→T 5'-Biotin TAGGTACATAATTCATCAAA C31 G85 5'-Biotin TAAAAAGATTCCATAGAACA C32 G85E 5'-Biotin TAAAAAGATTTCATAGAACA C33 3849+10kbC 5'-Biotin ATTAAAATGGCGAGTAAGAC C34 3849+10kbC→T 5'-Biotin ATTAAAATGGTGAGTAAGAC C35 A455 5'-Biotin CAGTTGTTGGCGGTTGCTGG C36 A455E 5'-Biotin CAGTTGTTGGAGGTTGCTGG C37 R1162 5'-Biotin ATCTGTGAGCCGAGTCTTTA C38 R1162X 5'-Biotin ATCTGTGAGCTGAGTCTTTA (Continued) Rapid CF Screening by xMAPTM 153 Table 3 (Continued) Target Target sequence Modification Sequence 5' → 3' C39 3659C 5'-Biotin GGTAAACCTACCAAGTCAAC C40 3659delC 5'-Biotin AGGTAAACCTACAAGTCAAC C41 2789+5G 5'-Biotin ACATGGAATACTCACTTTCC C42 2789+5G→A 5'-Biotin ACATGGAATATTCACTTTCC C43 2184A 5'-Biotin AAGATTGTTTTTTTGTTTCT C44 2184delA 5'-Biotin AAGATTGTTTTTTGTTTCTG C45 1898+1G 5'-Biotin AAAGAACATACCTTTCAAAT C46 1898+1G→A 5'-Biotin AAAGAACATATCTTTCAAAT C47 3120+1G 5'-Biotin TTTTTACATACCTGGATGAA C48 3120+1G→A 5'-Biotin TTTTTACATATCTGGATGAA Reflex panel CR2 I506V 5'-Biotin GAAAATGTCATCTTTGGTGT CR3 I507V 5'-Biotin GAAAATATCGTCTTTGGTGT CR4 F508C 5'-Biotin AAAATATCATCTGTGGTGTT CR5 5T 5'-Biotin TCCCTGTTAAAAACACACAC CR6 7T 5'-Biotin CCCTGTTAAAAAAACACACA CR7 9T 5'-Biotin CCTGTTAAAAAAAAACACAC a The position and sequence of the mutation or variation is indicated in bold type. b Target C1 (I507 & F508) is also used in the reflex panel. Login to comment
114 Using a small target DNA (approx 100-300 bp) minimizes the potential for steric hindrance to affect the xMAPTM Table 4 PCR Amplification Primers Size CFTR target Mutation(s) Primer 5' Modification Sequence 5' → 3' (bp) Exon 10 ΔI507, ΔF508, BE10U 5'-Biotin TTCTGTTCTCAGTTTTCCTGG 107 I506V, I507V, E10D None TTGGCATGCTTTGATGACG F508C Exon 20 W1282X E20U None TTGAGACTACTGAACACTGAAGG 126 BE20D 5'-Biotin TTCTGGCTAAGTCCTTTTGC Intron 10 1717-1G→A E11U None TCAGATTGAGCATACTAAAAGTGAC 89 BE11D2 5'-Biotin GAACTATATTGTCTTTCTCTGCAAAC Exon 11 G542X, G551D, E11U2 None AAGTTTGCAGAGAAAGACAATATAG 135 R553X, R560T BE11D 5'-Biotin GAATGACATTTACAGCAAATGC Exon 4 R117H E4U None TTTGTAGGAAGTCACCAAAGC 145 BE4D2 5'-Biotin GAGCAGTGTCCTCACAATAAAGAG Exon 4/intron 4 I148T, E4U2 None CTTCTCTTTATTGTGAGGACACTGC 169 621+1G→T BE4D 5'-Biotin ATGACATTAAAACATGTACGATACAG Exon 21 N1303K BE21U 5'-Biotin TGCTATAGAAAGTATTTATTTTTTCTGG 106 E21D None AGCCTTACCTCATCTGCAAC Exon 7 1078delT, BE7U 5'-Biotin GAACAGAACTGAAACTGACTCG 199 R334W, R347P E7D3 None CAGGGAAATTGCCGAGTG Intron 5 711+1G→T I5U None CAACTTGTTAGTCTCCTTTCC 99 BI5D2 5'-Biotin AGTTGTATAATTTATAACAATAGTGC Exon 3 G85E E3U None CTGGCTTCAAAGAAAAATCC 117 BE3D2 5'-Biotin TGAATGTACAAATGAGATCCTTACC Chromosome 7 3849+10kbC→T BC7U 5'-Biotin GACTTGTCATCTTGATTTCTGG 148 C7D None TTTGGTGCTAGCTGTAATTGC Exon 9 A455E BE9U 5'-Biotin TCACTTCTTGGTACTCCTGTCC 105 E9D None CAAAAGAACTACCTTGCCTGC Exon 19-I R1162X BE19U 5'-Biotin ATTGTGAAATTGTCTGCCATTC 167 E19Da None CAATAATCATAACTTTCGAGAGTTG Exon 19-II 3659delC BE19U2 5'-Biotin TTTAAGTTCATTGACATGCCAAC 91 E19Da None CAATAATCATAACTTTCGAGAGTTG Intron 14B 2789+5G→A I14BU None GTGTCTTGTTCCATTCCAGG 147 BI14BD 5'-Biotin TGGATTACAATACATACAAACATAGTGG Exon 13 2184delA E13U None AGATGCTCCTGTCTCCTGG 126 BE13D 5'-Biotin TGCACAATGGAAAATTTTCGTATAG Intron 12 1898+1G→A I12U None TTAGACTCTCCTTTTGGATACC 110 BI12D 5'-Biotin GTCTTTCTTTTATTTTAGCATGAGC Intron 16 3120+1G→A I16U None ATGACCTTCTGCCTCTTACC 118 BI16D 5'-Biotin ATGAAAACAAAATCACATTTGC Intron 8 5T/7T/9T I8U None TAATGGATCATGGGCCATGTGC 212 BI8D 5'-Biotin ACTGAAGAAGAGGCTGTCATCACC CFTR, cystic fibrosis transmembrane conductance regulator gene. Login to comment
118 Table 5 Genomic DNA Samples CFTR genotype Sourcea Normal/normal Sigma, D6537 ΔF508/normal Patient sample ΔF508/ΔF508 Coriell Cell Repositories, NA04540 ΔI507/normal Coriell Cell Repositories, NA11277 W1282/normal Coriell Cell Repositories, NA11723 1717-1G→A/normal Coriell Cell Repositories, NA12444 G542X/G542X Coriell Cell Repositories, NA11496B G542X/normal Coriell Cell Repositories, NA11497B ΔF508/G551D Coriell Cell Repositories, NA11274 ΔF508/R553X Coriell Cell Repositories, NA07469 G551D/R553X Coriell Cell Repositories, NA11761 ΔF508/R560T Coriell Cell Repositories, NA11284 ΔF508/R117H Coriell Cell Repositories, NA13591 I148T/normal Patient sample ΔF508/621+1G→T Coriell Cell Repositories, NA11281 N1303K/G1349D Coriell Cell Repositories, NA11472A ΔF508/1078delT Patient sample R334W/? Login to comment

[hide] Long-range (17.7 kb) allele-specific polymerase ch... J Mol Diagn. 2004 Aug;6(3):264-70. Pont-Kingdon G, Jama M, Miller C, Millson A, Lyon E
Long-range (17.7 kb) allele-specific polymerase chain reaction method for direct haplotyping of R117H and IVS-8 mutations of the cystic fibrosis transmembrane regulator gene.
J Mol Diagn. 2004 Aug;6(3):264-70., [PMID:15269305]

Abstract [show]
Genotyping of genetic polymorphisms is widely used in clinical molecular laboratories to confirm or predict diseases due to single locus mutations. In contrast, very few molecular methods determine the phase or haplotype of two or more mutations that are kilobases apart. In this report, we describe a new method for haplotyping based on long-range allele-specific PCR. Reaction conditions were established to circumvent the incompatibility of using allele-specific primers and a polymerase with proofreading activity. Haplotypes are determined by post-PCR analysis using different detection methods. The clinical application presented here directly determines the phase of two mutations separated by 17.7 kilobases in the cystic fibrosis transmembrane conductance regulator gene. Each mutation, the missense mutation R117H in exon 4 and the 5T polymorphism in intron 8 (IVS-8), have mild phenotypic effect unless they are present on the same chromosome (in cis). If an individual is heterozygous for both R117H and the IVS-8 5T variant, cis/trans testing is required to completely interpret results. The molecular method presented here bypasses the need to perform family studies to establish haplotypes. We propose use of this assay as a reflex clinical test for R117H- 5T-positive samples.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
110 Mutations at these positions (621 ϩ 1G Ͼ T, 711 ϩ 1G Ͼ T, R347P, I148T, R334W, and 1078delT) could be detected and associated with one of the haplotypes. Login to comment

[hide] Pancreatitis in hispanic patients with cystic fibr... Clin Gastroenterol Hepatol. 2004 Jun;2(6):504-9. Maisonneuve P, Campbell P 3rd, Durie P, Lowenfels AB
Pancreatitis in hispanic patients with cystic fibrosis carrying the R334W mutation.
Clin Gastroenterol Hepatol. 2004 Jun;2(6):504-9., [PMID:15181620]

Abstract [show]
BACKGROUND & AIMS: Cystic fibrosis (CF) results from abnormal production of sticky mucus, which obstructs many organs. In most cases, the pancreas is severely compromised, but 10%-15% of patients with CF have pancreas sufficiency (PS) and are subject to develop pancreatitis. The aim of this study is to determine which specific genotypes lead to the development of pancreatitis in patients with CF. METHODS: We used prospective data collected by the Cystic Fibrosis Foundation and performed a nested case-control study with all patients who reported at least 1 episode of pancreatitis constituting the cases. We used logistic regression to assess the association between pancreatitis and genotype and the Kaplan-Meier method to estimate the cumulative incidence of pancreatitis for selected genotypes. RESULTS: Three hundred sixty-four of 17,871 genotyped patients with CF (2.0%) reported at least 1 episode of pancreatitis. Only 0.9% of 12,997 patients with genotypes generally associated with pancreas insufficiency reported pancreatitis against 11.9% of 868 patients carrying at least 1 mild CF mutation generally associated with PS. The greatest rate of pancreatitis (19.0%) was observed for patients carrying an R334W mutation: 48% of these 79 patients were Hispanic and 13 patients were living in Puerto Rico. CONCLUSIONS: Of all patients with CF, those carrying an R334W mutation have the greatest risk for developing pancreatitis. This mutation is found mostly in Hispanic patients with CF living in Puerto Rico. There are no current data to determine whether asymptomatic carriers of the R334W mutation are at greater risk for developing pancreatitis or whether this mutation is frequent in Hispanics with idiopathic pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Of Ͼ1000 identified mutations in the CFTR gene, only 25 proven disease-causing mutant alleles (⌬F508, G551D, G542X, R553X, W1282X, R347P, NI303K, R560T, ⌬I507, 1717-1GϾA, A455E, 3120ϩ1GϾA, 621ϩ1GϾT, R117H, 711ϩ1GϾT, R1162X, 3849ϩ10kbCϾT, 2789ϩ5GϾT, R334W, G85E, 1078delT, 1898ϩ1GϾT, 2184delA, 3659delC, and I148T) are recommended by the American College of Medical Genetics for routine diagnostic and carrier testing.16 Most of these are routinely recorded in the CFF registry, but rarer mutations can be recorded if identified by more comprehensive testing. Login to comment

[hide] Cystic fibrosis and related diseases of the pancre... Best Pract Res Clin Gastroenterol. 2002 Jun;16(3):511-26. Naruse S, Kitagawa M, Ishiguro H, Fujiki K, Hayakawa T
Cystic fibrosis and related diseases of the pancreas.
Best Pract Res Clin Gastroenterol. 2002 Jun;16(3):511-26., [PMID:12079272]

Abstract [show]
The discovery of the gene for cystic fibrosis (CF), the cystic fibrosis transmembrane conductance regulator (CFTR), brought about a new era in the study of this disease. Identification of the molecular target has yielded a flood of data that add to our understanding of the pathogenesis, diagnosis and treatment of CF. The CFTR protein is a cAMP-regulated Cl(-) channel with multiple functions in epithelial cells. In the exocrine pancreas the CFTR plays a key role in the apical Cl(-), HCO(3)(-), and water transport in duct cells. The severe loss of functions, caused by mutations of the CFTR gene, leads to pathological lesions of the pancreas. Over 1200 CFTR mutations and polymorphisms have been identified and their diversity may explain the high level of heterogeneity in the CF phenotype. Mutation analyses of the CFTR gene have revealed a spectrum of CFTR-related diseases that do not fit the classical CF picture but are associated with dysfunction of CFTR, such as chronic pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
62 is observed only when normal CFTR function is less than 1%.13 In general, patients with pancreatic insuciency are homozygous or compound heterozygous for two severe mutations (class I, II or III in Figure 3), such as DF508, DI507, Q493X, G542X, R553X, W1282X, 621 1G 4 T, 1717-1G 4 A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T, whereas the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H (class IV or V).5,20 EXOCRINE PANCREAS IN CYSTIC FIBROSIS Pathology of the pancreas in CF There is a spectrum of pancreatic abnormalities in CF irrespective of age.21,22 Pancreatic lesions may be absent in an individual case, but in long-standing CF the pancreas is small, hard and nodular with increased fat and multiple cysts; hence the name `cystic ®brosis of the pancreas'. Login to comment
64 is observed only when normal CFTR function is less than 1%.13 In general, patients with pancreatic insuQciency are homozygous or compound heterozygous for two severe mutations (class I, II or III in Figure 3), such as DF508, DI507, Q493X, G542X, R553X, W1282X, 621 W 1G 4 T, 1717-1G 4 A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T, whereas the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H (class IV or V).5,20 EXOCRINE PANCREAS IN CYSTIC FIBROSIS Pathology of the pancreas in CF There is a spectrum of pancreatic abnormalities in CF irrespective of age.21,22 Pancreatic lesions may be absent in an individual case, but in long-standing CF the pancreas is small, hard and nodular with increased fat and multiple cysts; hence the name `cystic &#ae;brosis of the pancreas'. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 b 3905insT, 1811+1.6kbA>G, S945L, S1251N, Y122X, 2711delT, R117H, E60X, 2184insA, E585X, L558S, S1235R, D1152H, K710X, Q493X, A455E, G178R, I148T, 574delA. Login to comment

[hide] A comparison of fluorescent SSCP and denaturing HP... Hum Mutat. 2000;15(6):556-64. Ellis LA, Taylor CF, Taylor GR
A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning.
Hum Mutat. 2000;15(6):556-64., [PMID:10862085]

Abstract [show]
We examined 67 different mutations in 16 different amplicons in a comparison of mutation detection by fluorescent single strand conformation polymorphism (F-SSCP) and by denaturing HPLC (DHPLC). F-SSCP was used to analyze fluorescent amplicons with internal size standards and automated fragment analysis (GeneScan, PE Applied Biosystems, Foster City, CA). In DHPLC, unlabelled amplicons were analyzed by reverse phase HPLC with fragment detection by absorbance at 260nm. Both methods had high sensitivity (95-100%) and specificity (100%). Overall, F-SSCP with external temperature control was the more sensitive method, but DHPLC was particularly useful for the rapid analysis of novel fragments.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE. Login to comment

[hide] Missense mutations in the cystic fibrosis gene in ... Hum Mutat. 1999;14(6):510-9. Lazaro C, de Cid R, Sunyer J, Soriano J, Gimenez J, Alvarez M, Casals T, Anto JM, Estivill X
Missense mutations in the cystic fibrosis gene in adult patients with asthma.
Hum Mutat. 1999;14(6):510-9., [PMID:10571949]

Abstract [show]
Asthma is a complex genetic disorder that affects 5% of adults and 10% of children worldwide. The complete characterization of the cystic fibrosis transmembrane conductance regulator (CFTR) gene identified missense mutations in 15% of 144 unrelated adult patients with asthma, but in none of 41 subjects from the general population. The four more common mutations were analyzed in an extended sample consisting of 184 individuals from the general population and did not show a significant difference in frequency. The hyperfunctional CFTR M470 allele was detected in 90% of patients with CFTR missense mutations, but in 63% of subjects from the general population and 63% of asthma patients without CFTR mutations. None of the patients with missense mutations had the 5T allele of intron 8 of CFTR, responsible for low CFTR levels, while it was detected in 8% of asthma patients without CFTR mutations and in 9% of subjects from the general population. These findings suggest a putative role for a combination of CFTR missense mutations, including the M470 allele, in the genetic variability of asthma.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 Characteristics of Asthmatic Patients With CFTR Mutations CFTR Age IgE Skin Patients genotype1 M470V2 PolyT3 Sex Years BHR4 IU/ml5 test6 SB221 R74W,V8551 M/V 7/7 M 67 - 329 + SB36 R75Q / - M/V 7/7 F 61 + 59 + SB47 R75Q / - M/V 7/9 M 67 NA 42 NA SB131 R75Q / - M/V 7/7 F 69 + 41 - SB296 R75Q / - M/V 7/9 F 45 + 96 - SB251 I148T / - M/V 7/9 F 70 - 25 - SB212 A534Q / - M/M 7/7 F 46 + 69 + SB125 R668C,G576A N/V 7/7 M 62 + 21 - SB154 R668C,G576A M/V 7/7 M 65 + 93 + SB231 R668C,G576A M/V 7/7 F 45 + 158 + SB112 R668C / - M/V 7/7 M 64 + 1350 + SB304 R668C,T582R M/V 7/7 F 78 - 7 - SB56 T896I / - M/V 7/7 M 72 + 77 - SB117 L997F / - V/V 7/9 F 81 NA 6 NA SB143 L997F/L997F V/V 7/7 F 39 NA 129 NA SB173 L997F / - M/V 7/9 F 67 + 127 - SB148 M1028R / - M/V 7/7 F 48 + 23 - SB32 R1066C / - M/V 7/7 F 69 - 9 - SB69 T1142I / - M/M 7/9 M 65 - 158 + SB92 R116L / - M/V 7/7 M 78 NA 64 NA SB53 T1220I / - M/M 7/9 F 60 + 62 + SB40 ∆F508 / - M/M 79 F 62 + 34 + SB9 - / - M/M 5/9 F 61 - 169 - SB20 - / - M/V 5/5 F 57 - 245 + SB116 - / - V/V 5/7 F 33 NA 41 NA SB118 - / - M/V 5/9 M 83 + 63 - SB140 - / - V/V 5/7 F 72 NA 35 NA SB142 - / - M/V 5/7 F 59 + 108 + SB201 - / - M/V 5/7 M 27 - 297 + SB205 - / - M/V 5/7 F 56 - 20 - SB284 - / - M/V 5/7 F 71 - 40 NA SB316 - / - M/V 5/7 F 78 NA 20 - 1 The CFTR genotype was studied by DGGE/SSCP analysis of all CFTR exons and intronic flanking sequences. Login to comment
93 Characteristics of 15 Amino Acid Variants/Mutants in the CFTR Gene Detected in 21 Patients With Asthma Other Evolutive Conservative Other mutations Mutation1 Reference2 Exon Domain3 Patients4 phenotypes5 conservation6 change7 at same position R74W Claustres et al., 1993 3 IC1 1 CF-PS/CBAVD b, m, r, s NC - R75Q Zielenski et al., 1991 3 IC2 4 CF-PS/DB/CBAVD/ b, d, m, r, s, x NC R75X (CF) CF Parents R75L (CBAVD) I148T Bozon et al., 1994 4 IC2 1 CF-PS b, d, m, r, s, x NC I148N (CF) A534Q This report 11 NBF1 1 - b, m NC A534E (CF) G576A Fanen et al., 1992 12 NBF1 3 CF-PS/CBAVD b, m, r, s NC G576X (CF) T582R Casals et al., 1997 12 NBF1 1 CF-PS b, d, m, r, s, x NC T582I (CF) R668C Fanen et al., 1992 13 R 5 DB/CF-PS/CBAVD/ b, d, m, r, s, x NC - CF Parents V855I This report 14a IC6 1 - b, r, s C - T896I This report 15 EC4 1 - b, d, m, r, s NC - L997F Fanen et al., 1992 17a TM9 3 DB/CF-PS/CBAVD/ b, d, m, r, s, x C - non-CF M1028R This report 17a TM10 1 - d NC M1028I (CF) T2066C Fanen et al., 1992 17b IC8 1 DB/CF-PI b, d, m, r, s, x NC R1066S (CF) R1066L (CF) R1066H (CF/CBAVD) T1142I This report 18 TM12 1 - b, d, m, r, s, x NC - R1162L Fanen et al., 1992 19 IC9 1 non-CF b, d, m, r, s, x NC R1162X (CF) T1220I Ghanem et al., 1994 19 NBF2 1 DB/non-CF b, d NC - 1 Mutation name according to the Cystic Fibrosis Genetic Analysis Consortium. Login to comment

[hide] Is meconium ileus genetically determined or associ... J Med Genet. 1998 Mar;35(3):262-3. De Braekeleer M, Allard C, Leblanc JP, Aubin G, Simard F
Is meconium ileus genetically determined or associated with a more severe evolution of cystic fibrosis?
J Med Genet. 1998 Mar;35(3):262-3., [PMID:9541118]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 Although the A455E mutation is Table 1 Distribution of meconium ileus among CFTR genotypes in Saguenay Lac-Saint-Jean No of CF Proportion No of CFpatients Proportion Proportion ofMI Genotypes patients (%) with meconium ileus (%) among genotypes AF508/AF508 52 39.4 5 26.3 9.6 AF508/621+G-*T 34 25.8 9 47.4 26.5 AF508/A455E 14 10.6 0 0.0 0.0 621+1G-*T/A455E 8 6.1 0 0.0 0.0 621+1G-*T/G85E 2 1.5 1 5.3 50.0 621+1G-*T/Y1092X 1 0.8 0 0.0 0.0 AF508/Y1092X 4 3.0 1 5.3 25.0 A455E/R117C 1 0.8 0 0.0 0.0 AF508/I148T 2 1.5 0 0.0 0.0 621+1G-*T/ 4 3.0 0 0.0 0.0 711 +1G-*T 621+1G-4T/S489X 1 0.8 0 0.0 0.0 AF508/Q890X 1 0.8 1 5.3 100.0 621+1G->T/ 6 4.5 2 10.5 33.3 621+1G-sT AF508/unknown 1 0.8 1 5.3 100.0 Unknown/unknown 1 0.8 0 0.0 0.0 Table 2 Main clinicalfindings in patients with meconium ileus With MI Without MI p value No of patients 18 18 Sex (M/IF) 6/12 6/12 No of patients alive 16 17 Mean age (SD) 16.75 (9.7) 16.70 (7.9) p=0.99 Mean birth weight (SD) 3.24 (0.40) 3.02 (0.47) p=O.18 Mean birth height (SD) 50.0 (2.27) 50.0 (2.58) p=0.86 Currentweightcentile (SD) 26.7 (24.5) 14.1 (18.0) p=0.06 Current height centile (SD) 29.9 (25.1) 20.6 (25.6) p=0.33 Sweat chloride concentration (mEq/l) 105.9 (6.5) 101.1 (9.8) p=O.12 Mean FVC (SD) 89.7 (24.4) 93.0 (17.0) p=0.75 Mean FEV (SD) 73.1 (23.9) 75.4 (18.7) p=0.81 Mean Shwachman score (SD) 82.8 (11.8) 79.2 (12.6) p=0.36 Colonisation with Pseudomonas aeruginosa 13 14 p=0.70 Staphyloccoccus aureus 16 17 p=0.55 Haemophilus influenzae 13 14 p=0.70 Pseudomonas maltophilia 4 6 p=0.46 Pseudomonas cepacia 0 1 Pancreatic insufficiency 18 18 DIOS 7 1 p=0.016 Rectal prolapse 1 2 p=0.55 Recurrent abdominal pain 6 1 p=0.035 Diabetes mellitus 5 0 p=0.016 Liver complications 3* 0 p=0.07 Nasal polyposis 6 6 p=1.00 DIOS=distal intestinal obstruction syndrome. Login to comment

[hide] Complete identification of cystic fibrosis transme... Clin Genet. 1998 Jan;53(1):44-6. De Braekeleer M, Mari C, Verlingue C, Allard C, Leblanc JP, Simard F, Aubin G, Ferec C
Complete identification of cystic fibrosis transmembrane conductance regulator mutations in the CF population of Saguenay Lac-Saint-Jean (Quebec, Canada).
Clin Genet. 1998 Jan;53(1):44-6., [PMID:9550360]

Abstract [show]
Over the past few years, we have conducted a systematic study of 230 cystic fibrosis (CF) chromosomes in the Saguenay Lac-Saint-Jean (SLSJ) population which has a high CF incidence (1/936 live births). We identified 11 mutations accounting for 100% of the CF chromosomes found in patients born in SLSJ. Our results indicate that denaturing gradient gel electrophoresis (DGGE) is a powerful method of identifying CF mutations. They have also considerable implications for genetic counselling and molecular characterization of doubtful patients. They make carrier screening technically feasible in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
31 There were 11 patients with a AF508/AF508 genotype, two with AF508/621 +l G + T and one with AF508/A455E and N1303K/I148T genotype each. Login to comment

[hide] High heterogeneity for cystic fibrosis in Spanish ... Hum Genet. 1997 Dec;101(3):365-70. Casals T, Ramos MD, Gimenez J, Larriba S, Nunes V, Estivill X
High heterogeneity for cystic fibrosis in Spanish families: 75 mutations account for 90% of chromosomes.
Hum Genet. 1997 Dec;101(3):365-70., [PMID:9439669]

Abstract [show]
We have analyzed 640 Spanish cystic fibrosis (CF) families for mutations in the CFTR gene by direct mutation analysis, microsatellite haplotypes, denaturing gradient gel electrophoresis, single-strand conformation analysis and direct sequencing. Seventy-five mutations account for 90.2% of CF chromosomes. Among these we have detected seven novel CFTR mutations, including four missense (G85V, T582R, R851L and F1074L), two nonsense (E692X and Q1281X) and one splice site mutation (711+3A-->T). Three variants, two in intronic regions (406-112A/T and 3850-129T/C) and one in the coding region (741C/T) were also identified. Mutations G85V, T582R, R851L, E692X and Q1281X are severe, with lung and pancreatic involvement; 711+3A-->T could be responsible for a pancreatic sufficiency/insufficiency variable phenotype; and F1074L was associated with a mild phenotype. These data demonstrate the highest molecular heterogeneity reported so far in CF, indicating that a wide mutation screening is necessary to characterize 90% of the Spanish CF alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 Eight mutations have frequencies 366 Table 1 Seventy-five CFTR mutations identified in 640 Spanish families with cystic fibrosis (CF) Mutation Exon/intron CF alleles % ∆F508 E.10 681 53.20 G542X E.11 108 8.43 N1303K E.21 34 2.65 1811+1.6kbA→Ga I.11 24 1.87 711+1G→T I.5 22 1.71 R1162Xa E.19 21 1.64 R334Wa E.7 21 1.64 R1066C E.17b 14 1.09 1609delCAa E.10 13 1.01 Q890X E.15 13 1.01 G85E E.3 12 0.94 712-1G→Ta I.5 11 0.86 2789+5G→A I.14b 11 0.86 ∆I507 E.10 10 0.78 W1282X E.20 10 0.78 2869insGa E.15 9 0.70 L206W E.6a 7 0.54 R709X E.13 7 0.54 621+1G→T I.4 6 0.47 3272-26A→G I.17a 6 0.47 R347H E.7 5 0.39 2183AA→G E.13 5 0.39 K710X E.13 5 0.39 2176insC E.13 5 0.39 3849+10kbC→T I.19 5 0.39 P205Sa E.6a 4 0.31 1078delT E.7 4 0.31 R553X E.11 4 0.31 G551D E.11 4 0.31 1812-1G→Aa I.11 4 0.31 CFdel#1a E.4-7/11-18 4 0.31 V232D E.6a 3 0.23 936delTAa E.6b 3 0.23 1717-8G→A I.10 3 0.23 1949del84 E.13 3 0.23 W1089X E.17b 3 0.23 R347P E.7 3 0.23 del E.3a E.3 2 0.16 R117H E.4 2 0.16 L558S E.11 2 0.16 A561E E.12 2 0.16 2603delT E.13 2 0.16 Y1092X E.17b 2 0.16 Q1100Pa E.17b 2 0.16 M1101K E.17b 2 0.16 delE.19a E.19 2 0.16 G1244E E.20 2 0.16 P5La E.1 1 0.08 Q30Xa E.2 1 0.08 G85Va E.3 1 0.08 E92Ka E.4 1 0.08 A120Ta E.4 1 0.08 I148T E.4 1 0.08 711+3A→Ta I.5 1 0.08 H199Y E.6a 1 0.08 875+1G→A I.6a 1 0.08 Table 1 (continued) Mutation Exon/intron CF alleles % 1717-1G→A I.10 1 0.08 L571S E.12 1 0.08 T582Ra E.12 1 0.08 E585X E.12 1 0.08 1898+3A→G I.12 1 0.08 G673X E.13 1 0.08 E692Xa E.13 1 0.08 R851X E.14a 1 0.08 R851La E.14a 1 0.08 A1006E E.17a 1 0.08 L1065Ra E.17b 1 0.08 F1074La E.17b 1 0.08 R1158X E.19 1 0.08 3667del4a E.19 1 0.08 3860ins31a E.20 1 0.08 3905insT E.20 1 0.08 4005+1G→A I.20 1 0.08 Q1281Xa E.20 1 0.08 Q1313X E.21 1 0.08 Known mutations (75) 1155 90.23 Unknown mutations 125 9.77 a Mutations discovered by the CF group of the Medical and Molecular Genetics Centre - IRO, Barcelona, Spain that range between 0.5% and 0.9%, representing 6.0% of the CF chromosomes. Login to comment

[hide] Disease-associated mutations in cytoplasmic loops ... Biochemistry. 1997 Sep 30;36(39):11966-74. Seibert FS, Jia Y, Mathews CJ, Hanrahan JW, Riordan JR, Loo TW, Clarke DM
Disease-associated mutations in cytoplasmic loops 1 and 2 of cystic fibrosis transmembrane conductance regulator impede processing or opening of the channel.
Biochemistry. 1997 Sep 30;36(39):11966-74., [PMID:9305991]

Abstract [show]
Since little is known about the contribution to function of the N-terminal cytoplasmic loops (CL1, residues 139-194; CL2, residues 242-307) of cystic fibrosis transmembrane conductance regulator (CFTR), all nine point mutations identified in CLs 1 and 2 from patients with cystic fibrosis were reconstructed in the expression vector pcDNA3-CFTR and expressed transiently in COS-1 and HEK-293 cells and stably in Chinese hamster ovary (CHO) cells. Four amino acid substitutions retarded production of mature, fully glycosylated CFTR, suggesting that misprocessing of the channel causes the disease symptoms in the affected patients. Protein maturation could not be promoted by cell culture conditions of reduced temperature (26 degrees C). When properly processed mutants were evaluated for functional defects by the iodide efflux method, the G178R- and E193K-CFTR-expressing cell lines showed impaired anion translocation activities. Patch-clamp studies of single channels revealed that E193K variants had a significantly decreased open probability, which resulted from an increase in the mean closed time of the channels. This contrasted with a previous study of disease-associated point mutations in CL3 that mainly affected the mean open time. None of the maturation-competent CL 1 and 2 mutants had altered conductance. Thus, the N-terminal CLs appear not to contribute to the anion translocation pathway of CFTR; rather, mutations in CL1 can impede transition to the open state. Interestingly, the ability of the non-hydrolyzable ATP analogue adenylyl imidodiphosphate (AMP-PNP) to lock the channel into open bursts was abolished by the I148T and G178R amino acid substitutions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Thus, the N-terminal CLs appear not to contribute to the anion translocation pathway of CFTR; rather, mutations in CL1 can impede transition to the open state. Interestingly, the ability of the non-hydrolyzable ATP analogue adenylyl imidodiphosphate (AMP-PNP) to lock the channel into open bursts was abolished by the I148T and G178R amino acid substitutions. Login to comment
106 However, only the mutations I148T, I175V, G178R, E193K, and R297Q allowed wild-type-like maturation of the protein to the fully glycosylated 170 kDa species (band C). Login to comment
120 In accordance with reduced levels of processing, the H139R, G149R, D192G, and R258G mutations significantly decreased the anion translocation capability of CFTR, whereas the properly processed I148T, I175V, and R297Q variants allowed iodide movement comparable to that of wild type. Login to comment
147 This discrepancy may originate from the additional observation that G178R-CFTR (as well as I148T-CFTR) could not be locked open by the nonhydrolyzable ATP analogue AMP-PNP. Login to comment
149 Thus, the number of channels per patch may have been underestimated for I148T-CFTR- and G178R-CFTR-expressing cells, resulting in a systematic overestimation of the Po. Login to comment
190 I148T, I175V, and R297Q did not adversely affect the processing, gating, or conductance of CFTR. Login to comment
199 The entire CFTR gene was not sequenced in patients with mutations I148T, I175V, or R297Q when these mutations were published. Login to comment
208 (B) Mean single-channel current-voltage relationship of wild-type CFTR and I148T-CFTR as a representative CL 1 and 2 mutant. Login to comment
209 Each point represents the mean ( SE (where this is larger than the size of the symbol) of data from four (I148T) or five (WT) patches. Login to comment
217 Note that the I148T- and G178R-CFTR variants could not be locked open with AMP-PNP, so that for these mutants the number of channels in each patch may have been underestimated. Login to comment

[hide] SSCP analysis: a blind sensitivity trial. Hum Mutat. 1997;10(1):65-70. Jordanova A, Kalaydjieva L, Savov A, Claustres M, Schwarz M, Estivill X, Angelicheva D, Haworth A, Casals T, Kremensky I
SSCP analysis: a blind sensitivity trial.
Hum Mutat. 1997;10(1):65-70., [PMID:9222762]

Abstract [show]
Studies of the sensitivity of SSCP analysis usually have been performed under conditions contrary to the rules of quality control trials and have produced widely different results. We have performed a blind trial of the sensitivity of SSCP analysis for the detection of mutations in fragments up to 500 bp in length under a fixed single set of electrophoretic conditions. The mutation detection rate was 84%. In addition, we have identified a second mutation in nine samples. All these mutations are polymorphisms, including a novel polymorphism 1248 + 52T/C first reported in the present work.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment

[hide] Haplotype analysis of 94 cystic fibrosis mutations... Hum Mutat. 1996;8(2):149-59. Morral N, Dork T, Llevadot R, Dziadek V, Mercier B, Ferec C, Costes B, Girodon E, Zielenski J, Tsui LC, Tummler B, Estivill X
Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers.
Hum Mutat. 1996;8(2):149-59., [PMID:8844213]

Abstract [show]
We have analyzed 416 normal and 467 chromosomes carrying 94 different cystic fibrosis (CF) mutations with polymorphic genetic markers J44, IVS6aGATT, IVS8CA, T854, IVS17BTA, IVS17BCA, and TUB20. The number of mutations found with each haplotype is proportional to its frequency among normal chromosomes, suggesting that there is no preferential haplotype in which mutations arise and thus excluding possible selection for specific haplotypes. While many common mutations in the worldwide CF population showed absence of haplotype variation, indicating their recent origins, some mutations were associated with more than one haplotype. The most common CF mutations, delta F508, G542X, and N1303K, showed the highest number of slippage events at microsatellites, suggesting that they are the most ancient CF mutations. Recurrence was probably the case for 9 CF mutations (R117H, H199Y, R347YH, R347P, L558S, 2184insA, 3272-26A-->G, R1162X, and 3849 + 10kbC-->T). This analysis of 94 CF mutations should facilitate mutation screening and provides useful data for studies on population genetics of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
108 (1992) (continued) TABLE2. CFTR Haplotypesfor Diallelic and MultiallelicDNA Markersfor 94 CF Mutations' (Continued) J44-GATT- 8CA-17BTA- No. of T854-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 1-6-2-1 17-7-17 Q30X 1 - b ChillBn et al. (1994b) (0.7%) 23-7-17 I148T 1 0.48 b Bozon et al. (1994) 17-7-17 AF508 1 - fb fp1-6-1-1 20-7-17 AF508 1 fph17-7-17 AF508 2(-) 1-8-2-1 15-7-17 L558S 1 (-) 2- - -2 16- - CFBOkbdel#l 3 b Morral et al. (1993b) (-1 - - fb- "Allele1 denotesthe absence of the restriction site, whereas allele 2 denotes its presence.Numbers for microsatellites GAIT, IVSSCA, RIS17BTA. Login to comment

[hide] Cystic fibrosis mutation detection by hybridizatio... Hum Mutat. 1996;7(3):244-55. Cronin MT, Fucini RV, Kim SM, Masino RS, Wespi RM, Miyada CG
Cystic fibrosis mutation detection by hybridization to light-generated DNA probe arrays.
Hum Mutat. 1996;7(3):244-55., [PMID:8829658]

Abstract [show]
We have combined photochemistry and photolithography with solid-phase DNA synthesis chemistry to form a new technology that makes high density oligonucleotide probe array synthesis possible. Hybridization to these two-dimensional arrays containing hundreds or thousands of oligonucleotide probes provides a powerful DNA sequence analysis tool. Two types of light-generated DNA probe arrays have been used to test for a variety of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. One array, made up of 428 probes, was designed to scan through the length of CFTR exon 11 and identify differences from the wild type reference sequence. The second type of array contained 1480 probes chosen to detect known deletions, insertions, or base substitution mutations. The validity of the probe arrays was established by hybridizing them with fluorescently labeled control oligonucleotide targets. Characterized mutant CFTR genomic DNA samples were then used to further test probe array hybridization specificity. Finally, ten unknown patient samples were genotyped using the CFTR probe array assay. The genotype assignments were identical to those obtained by PCR product restriction fragment analysis. Our results show that light-generated DNA probe arrays are highly effective in analyzing complex mutation and polymorphism patterns in a relatively large gene such as CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
238 Cystic Fibrosis Mutation-Specific DNA Probe Array" Mutation Exon and column Tested Subarrayhow G85E R117H I148T 621 -+ l(G+T) 711 + 1(G+T) R334W R347H R347P 1078 delT A455E G480C Q493X A1507 F508C AF508 V520F G542X S549R(T-+ G) G551D Q552X R553X A559T R560T 1898 + l(G-,A) 2184 del A 2789 + 5(G+ A) R1066C L1077P Y1092X R1162X 3659 del C 1717-1(& A) 3272 - 26(A+ G) 3 4 4 in 4 in 5 7 7 7 7 9 10 10 10 10 10 10 in 10 11 11 11 11 11 11 11 in 12 13 in 14b in 17a 17b 17b 17b 19 19 * * * * * * * * * * * * * * * * * * * * * * * * * * * * 3849 + lOkb C-, T in 19 9,3 W1282X 20 994 3905insT 20 10.1 * N1303K 21 10,2 * * * "Row and column locations for each of the mutation specific,40 probe sets included in the specialized probe array design. Login to comment

[hide] Correlation of sweat chloride concentration with c... J Pediatr. 1995 Nov;127(5):705-10. Wilschanski M, Zielenski J, Markiewicz D, Tsui LC, Corey M, Levison H, Durie PR
Correlation of sweat chloride concentration with classes of the cystic fibrosis transmembrane conductance regulator gene mutations.
J Pediatr. 1995 Nov;127(5):705-10., [PMID:7472820]

Abstract [show]
OBJECTIVE: To compare differences in epithelial chloride conductance according to class of mutation of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. METHODS: We evaluated the relationship between the functional classes of CFTR mutations and chloride conductance using the first diagnostic sweat chloride concentration in a large cystic fibrosis (CF) population. RESULTS: There was no difference in sweat chloride value value between classes of CFTR mutations that produce no protein (class I), fail to reach the apical membrane because of defective processing (class II), or produce protein that fails to respond to cyclic adenosine monophosphate (class III). Those mutations that produce a cyclic adenosine monophosphate-responsive channel with reduced conductance (class IV) were associated with a significantly lower, intermediate sweat chloride value. However, patients with the mutations that cause reduced synthesis or partially defective processing of normal CFTR (class V) had sweat chloride concentrations similar to those in classes I to III. CONCLUSION: Studies of differences in chloride conductance between functional classes of CFTR mutations provide insight into phenotypic expression of the disease.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 Defined mutations (each mutation cited in references 8, 23, and 24; numerals in parentheses indicate number of patients): Nonsense mutations-----class I: Frameshift mutations---class I: Splice site mutations-class I: Missense mutations---class HI: Missense mutations---class IV: Partially defective processing---class V: Alternative spficing-----classV: R1162X (3), Y1092X (3), G542X (21), Q552X (2), Q493X (2), w1282x (2), E1104X (1), R553X (6), E585X (l), (all PI) 3659delC (5), 2184delA (4), 4010de14 (1), 556delA (1), 3002delG (1) 3905insT (1), 4016insT (3), 1154insTC (l), 441delA (1), 2184insA (2), 1078delT (1), 4326delTC (3) (all PI) I717-1G--~A (4), 621+lG--*T (10), 711+IG--~T (3), 875+1G-+C (2), 3120+IG-~A (1) (18 PI, 2 PS) G551D (25), N1303K (7), R560T (8), I148T (1), G85E (3), A559T (1), L1077P (2), T1234V (1), (47 PI, 1 PS) R117H (10), R347H (3), R347P (1), D614G (1), S1251N (2), (all PS) P574H (2), A455E (2), (all PS) 3272-26A-+G (4), 3849+10KbC---~T (2), 3120G-+A (1), (all PS) analysis, we further grouped the patients according to the molecular consequences conferred by the CFTR alleles. Login to comment

[hide] Three novel sequence variations in the 5' upstream... Hum Genet. 1995 Jun;95(6):698-702. Bienvenu T, Lacronique V, Raymondjean M, Cazeneuve C, Hubert D, Kaplan JC, Beldjord C
Three novel sequence variations in the 5' upstream region of the cystic fibrosis transmembrane conductance regulator (CFTR) gene: two polymorphisms and one putative molecular defect.
Hum Genet. 1995 Jun;95(6):698-702., [PMID:7540587]

Abstract [show]
More than 400 sequence alterations have been identified in the whole coding sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene corresponding to the 27 exons and their exon-intron boundaries. However, in some CF chromosomes, no mutation has yet been detected. In such cases, we have explored the promoter and the sequence up to position -1000 from the cap site, by using denaturing gradient gel electrophoresis. This study concerning 35 CF chromosomes has allowed us to identify three novel sequence variations located in the 5' upstream region of the gene. The T to G substitution located at position -895 from the cap site could be considered as a polymorphic variation. The second substitution (C to T at position -816) has been detected on only one CF chromosome, but does not concern a regulatory DNA element previously described. Conversely, the third substitution (a T to G substitution at position -741 from the cap site) is located at a potential AP-1 binding site. We have investigated, by electrophoretic mobility shift assay, the ability of this region to bind nuclear factors. We have found that the normal sequence between -740/-745 does not bind either the AP-1 transcription factor or AP-1 related proteins, and that the T to G-741 mutated sequence exhibits an abnormal binding pattern suggesting the possible deleterious effect of still unknown negative trans-acting factors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Materials and methods Patients Some 29 CF patients (19 AF508/X, 1 1717-1G->A/X, 1 GI061R/X, 1 R553X/X, 1 R334W/X and 6 X/X; X = unidentified mutation), 10 men with congenital bilateral absence of the vas deferens (3 AF508/X, 1 N1303K/X, 1 SI235R/X, 1Q1291R/X and4 X/X) and I6 subjects with chronic pulmonary disease suggestive of CF (1 AF508/X, 1 I148T/X and 14 X/X) were included in this study. Login to comment

[hide] Identification of three novel mutations (457 TAT--... Hum Genet. 1994 Jun;93(6):659-62. Audrezet MP, Canki-Klain N, Mercier B, Bracar D, Verlingue C, Ferec C
Identification of three novel mutations (457 TAT-->G, D192G, Q685X) in the Slovenian CF patients.
Hum Genet. 1994 Jun;93(6):659-62., [PMID:7516305]

Abstract [show]
Chromosomes from a cohort of 60 Slovenian families, corresponding to the 121 cystic fibrosis (CF) chromosomes available, were fully scanned for mutations in the coding sequence of the cystic fibrosis transmembrane conductance regulator (CFTR) gene (The 60 families yielded 121 CF alleles because the mother of one patient was also affected). This corresponds to the 27 exons and intron/exon boundaries that have been studied in chromosomes carrying unidentified alleles. As a result of this survey 84% of the alleles are now clearly identified and we describe in this paper three novel mutations (457 TAT-->G, D192G, and Q685X).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Mutations identified in the population of Slovenia Number of chromosomes Mutations 661 83 AF508 4 G542X 5 R1162X 2 3905 ins T 2 I148T 1 Q552X 1 Q685X 1 S4X 1 457 TAT---~G 1 D192G 1 R1066H 19 Unidentified 121 Exons Frequencies References 10 68.60% Kerem et al. (1989) 11 3.30% Kerem et al. (1990) 19 4.10% Gasparini et al. (1991) 20 1.65% Personal Communication 4 1.65% Personal Communication 11 0.85% Devoto et al. (1991) 13 0.85% This study 1 0.85% Glavac et al. (1993) 4 0.85% This study and Glavac et al. (1993) 5 0.85% This study 17b 0.85% Ftrec et al. (1992) 15.70% by 11 mutations, occurring in 9 exons of the gene (1, 4, 5, 10, 11, 13, 17b, 19, and 20). Login to comment

[hide] Sensitivity of single-strand conformation polymorp... Hum Mol Genet. 1994 May;3(5):801-7. Ravnik-Glavac M, Glavac D, Dean M
Sensitivity of single-strand conformation polymorphism and heteroduplex method for mutation detection in the cystic fibrosis gene.
Hum Mol Genet. 1994 May;3(5):801-7., [PMID:7521710]

Abstract [show]
The gene responsible for cystic fibrosis (CF) contains 27 coding exons and more than 300 independent mutations have been identified. An efficient and optimized strategy is required to identify additional mutations and/or to screen patient samples for the presence of known mutations. We have tested several different conditions for performing single-stranded conformation polymorphism (SSCP) analysis in order to determine the efficiency of the method and to identify the optimum conditions for mutation detection. Each exon and corresponding exon boundaries were amplified. A panel of 134 known CF mutations were used to test the efficiency of detection of mutations. The SSCP conditions were varied by altering the percentage and cross-linking of the acrylamide, employing MDE (an acrylamide substitute), and by adding sucrose and glycerol. The presence of heteroduplexes could be detected on most gels and in some cases contributed to the ability to distinguish certain mutations. Each analysis condition detected 75-98% of the mutations, and all of the mutations could be detected by at least one condition. Therefore, an optimized SSCP analysis can be used to efficiently screen for mutations in a large gene.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 Exon 1: S4X (24), 186-13C-G (F£rec et al., pers. comm.); Exon 2: G27X (Shacldeton and Harris, pers. comm.), Q30X (Chilldn aal., pers. comm.), R31L (Zielenski et al., pers. comm.), Q39X (25); Exon 3: 300delA (Malone et al., pers. comm.), W57G (Ferrari et al., pers. comm.), W57X (26), E60X (Malone et al., pers. comm.), R74W (Claustres et al., pers. comm.), R75Q (27), G85E (28), 394delTT (Claustres et al., pers. comm.), L88X (Maceketal., pers. comm.), L88S (Malone et al., pers. comm.), 405 + 1G-A (Dork and Tummler, pers. comm.); Exon 4: E92K (Chillon et al., pers. comm.), E92X (D6rk a al., pers. comm.), P99L (Schwartz and Holmberg, pers. comm.), 441delA (Zielenski et al., pers. comm.), 444delA (29), 457TAT-C- (F£rec et al., pers. comm., (21), Dl 10H (14), Rl 17C (D6rk et al., pers. comm.), Rl 17H (14), A120T (Chillon et al., pers. comm.), 541delC (30), 556delA (28), I148T (Rininsland et al., pers. comm.), Q151X (Shacldeton et al., pers. comm.), 621 + 1C-T (28), 622-2A-C (31); Exon5:G178R (28), 681delC (Zielenski a al., pers. comm.), 711 + 1G-T (28); Exon 6a: H199Y (Dork and Tummler, pers. comm.), H199Q (Dean etal., pers. comm.), L206W (Claustres et al., pers. comm.), Q220X (Shacldeton and Harris, pers. comm., Schwartz and Holmberg, pers. comm.), 852del22 (32); Exon 6b: 977insA (33); Exon7:F311L(34). Login to comment

[hide] Analysis of the CFTR gene confirms the high geneti... Hum Genet. 1994 Apr;93(4):447-51. Chillon M, Casals T, Gimenez J, Ramos MD, Palacio A, Morral N, Estivill X, Nunes V
Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes.
Hum Genet. 1994 Apr;93(4):447-51., [PMID:7513293]

Abstract [show]
We have analysed 972 unrelated Spanish cystic fibrosis patients for 70 known mutations. Analysis was performed on exons 1, 2, 3, 4, 5, 6a, 6b, 7, 10, 11, 12, 13, 14a, 14b, 15, 16, 17b, 18, 19, 20 and 21 of the cystic fibrosis transmembrane regulator gene using single strand conformation polymorphism analysis and denaturing gradient gel electrophoresis. The major mutation delta F508 accounts for 50.6% of CF chromosomes, whereas another 42 mutations account for 27.6% of CF chromosomes, with 21.8% of Spanish CF chromosomes remaining uncharacterized. At present, we have identified 36 mutations that have frequency of less than 1% and that are spread over 15 different exons. This indicates that, in the Spanish population, with the exception of delta F508 (50.6%) and G542X (8%), the mutations are not concentrated in a few exons of the gene nor are there any predominating mutations. This high degree of genetic heterogeneity is mainly a result of the different ethnic groups that have populated Spain and of the maintenance of separated population sets (Basques, Arab-Andalusian, Mediterranean, Canarian and Gallician). The high proportion of CF chromosomes still unidentified (21.8%) together with association analysis with intragenic markers suggest that at least 100 different mutations causing CF are present in our population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 A Exon 13 4 0.41 621-1 G--~T Intron 4 3 0.31 P205S Exon 6a 3 0.31 936 del TA Exon 6b 3 0.31 1949 del 84 Exon 13 3 0.31 K710X Exon 13 3 0.31 CF del #1 Exon 4-7/11-18 3 0.31 L206W Exon 6a 2 0.20 R347H Exon 7 2 0.20 Y1092X Exon 17b 2 0.20 Q1100P Exon 17b 2 0.20 Q30X Exon 2 1 0.10 E92K Exon 4 1 0.10 A120T Exon 4 1 0.10 I148T Exon 4 1 0.10 H199Y Exon 6a 1 0.10 1078 del T Exon 7 1 0.10 1717-1 G--+A Intron 10 1 0.10 T582R Exon 12 1 0.10 E585X Exon 12 1 0.10 1898+3 A~---G Intron 12 1 0.10 W1098X Exon 17b 1 0.10 R1158X Exon 19 1 0.10 3667 del 4 Exon 19 1 0.10 3860 ins 31 Exon 20 1 0.10 3905 ins T Exon 20 1 0.10 Unknown 212 21.81 The Basque subset The Basques have a different genetic background with respect to other ethnic groups (Pancorbo et al. 1989) as they are the only pre-Indoeuropean group in Spain. Login to comment

[hide] Retrospective study of the cystic fibrosis transme... Hum Genet. 1994 Apr;93(4):429-34. Verlingue C, Mercier B, Lecoq I, Audrezet MP, Laroche D, Travert G, Ferec C
Retrospective study of the cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in Guthrie cards from a large cohort of neonatal screening for cystic fibrosis.
Hum Genet. 1994 Apr;93(4):429-34., [PMID:7513292]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) gene encodes a cAMP-activated chloride channel, and in individuals with both alleles of the gene mutated, symptoms of CF disease are manifest. With more than 300 mutations so far described in the gene the profile of mutant alleles in a population is specific to its ethnic origin. For an analysis with an unbiased recruitment of the CF alleles in neonates of similar origin (Normandy, France), we have retrospectively analyzed the Guthrie cards of affected newborns, diagnosed by the immunoreactive trypsinogen (IRT) assay. Analysis of the 27 exons of the CFTR gene using a GC clamp denaturing gradient gel electrophoresis (DGGE) assay has enabled us to identify over 96% of the mutated alleles. Two of these were novel mutations. We would like to propose this strategy as an efficient method of retrospective molecular genetic diagnosis that can be performed wherever Guthrie cards can be obtained. Knowledge of rare alleles could be a prerequisite for CF therapy in the future.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 CFI'R mutations characterized by denaturing gradient gel electrophoresis and DNA sequencing from Guthrie cards of 98 children with cystic fibrosis 431 Number of Mutations Exons Fre- References chromo- quencies somes 129 AF508 10 65.8 Kerem et al. 1989 5 G551D 11 2.8 Cutting et al. 1990 3 2183 AA---~G 13 1.7 unpublished data 3 N1303K 21 1.7 Osborne et al. 1991 3 G542X 11 1.7 Kerem et ai.1990 2 E92K 4 1.1 Nunes et al. 1993 2 I148T 4 1.1 unpublished data 2 574 del A 4 1.1 Fanen et a1.1992 2 1078 del T 7 1.1 Claustres et a1.1992 2 E585X 12 1.1 Cremonesi et al. 1992 2 2789 + 5 G--->A intron 14b 1.1 unpublisheddata 2 3659 del C 19 l. Login to comment

[hide] Analysis of the 27 exons and flanking regions of t... Hum Mol Genet. 1993 Aug;2(8):1209-13. Claustres M, Laussel M, Desgeorges M, Giansily M, Culard JF, Razakatsara G, Demaille J
Analysis of the 27 exons and flanking regions of the cystic fibrosis gene: 40 different mutations account for 91.2% of the mutant alleles in southern France.
Hum Mol Genet. 1993 Aug;2(8):1209-13., [PMID:7691344]

Abstract [show]
In order to characterize the non-delta F508 mutations that account for 36% of cystic fibrosis (CF) chromosomes in Southern France in a sample of 137 patients, we have systematically screened the entire coding region and adjacent sequences of the cystic fibrosis transmembrane conductance regulator (CFTR) gene by the single strand conformation polymorphism (SSCP) technique followed by direct sequencing of the mutant DNAs. We identified 13 novel mutations (9 reported in this paper) and 4 novel rare nucleotide sequence variations. Forty different mutations including delta F508, located in 15 exons, account for only 91.2% of mutants in a population originating from Southern France, in contrast with a recent report on the Celtic population of Brittany demonstrating that 90% of mutations can be detected with only three mutations. We present a very large spectrum of different CF mutations identified in a small geographical area.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Mutations identified in a Southern french population mutation AF5O8 M1K 300delA P67L R74W G85E 394detTT 406-6 (T-C) Y122X I148T 621 + 1G-T 62/+2T-G L206W 1078deIT R334W R347H R347P AI507 1717-1G-A G542X R553X S549N G551D E585X 2184delA K710X R792X S945L Y1092X 3272-26A-G R1158X R1162X 3737delA 3659delC 11234V D1270N W1282X N13O3H N13O3K 4382delA Exon 10 1 3 3 3 3 3 intron 3 4 4 intron 4 intron 4 6a 7 7 7 7 10 intron 10 11 11 11 11 , 12 13 13 13 15 17b intron 17a 19 19 19 19 19 20 20 21 21 24 Amino acid change 3 bp deletion start-Lys at 1 frameshift Pro-Leu at67 Arg-Trp at 74 Gly-Glu at 85 frameshift splice mutation? Login to comment

[hide] Microsatellite haplotypes for cystic fibrosis: mut... Hum Mol Genet. 1993 Jul;2(7):1015-22. Morral N, Nunes V, Casals T, Chillon M, Gimenez J, Bertranpetit J, Estivill X
Microsatellite haplotypes for cystic fibrosis: mutation frameworks and evolutionary tracers.
Hum Mol Genet. 1993 Jul;2(7):1015-22., [PMID:7689896]

Abstract [show]
Highly informative intragenic microsatellite markers within the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene allow the analysis of associations between specific mutations and haplotypes. We have analysed 440 Spanish CF families carrying 22 different CF mutations and have established haplotypes in 1,036 chromosomes for microsatellites IVS8CA, IVS17BTA and IVS17BCA. No new alleles were detected at the three CFTR microsatellites, in more than 3,000 meiosis analysed (estimated mutation rate of less than 3.3 x 10(-4)). The evolution of 16 haplotypes associated with the most common CF mutation, delta F508, and the low mutation rate at these microsatellite loci suggest that delta F508 originated within the 23-31-13 haplotype at least 53,000 years ago, very early in the history of the European population. The number of haplotype changes seen for two other common mutations, G542X (haplotype 23-33-13) and N1303K (23-31-13), suggests that they originated at least 35,000 years ago. Microsatellite allele variability associated with delta F508, G542X and N1303K demonstrates that slippage and mispairing is the main mechanism generating microsatellite alleles. In spite of the haplotype variability detected for these 3 common mutations, the association between haplotype and mutations is very strong. Mutations 1609delCA, 3667del4, delta I507 and G551D are all associated with haplotype 16-7-17, which has a frequency of 14.5% in normal chromosomes. 5 haplotypes bearing specific CF mutations were not found in normal chromosomes. Haplotype 16-46-13 is strongly associated with CF mutations E92K and 3601-111G-->C. About 23% of CF chromosomes with unknown mutations show significant linkage disequilibrium for microsatellite haplotypes.(ABSTRACT TRUNCATED AT 250 WORDS)

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
49 Mutations I148T A120T E92K 621+1G->T R334W 1078delT CFSOKBdeUM G551D G54 AJ507 lDuIKJt AF5O8 2X If*A Iv 1OA 28691m '10X }f)a\OA (G 3601-111G->C R1162X 3860)ns31 R1158X 3€€7deM I W1282X 141303K | | 1 2 3 Exons Markers 6 7 8 8 • b 10 11 12 13 14 15 • t> 16 17 18 19 20 21 22 23 24 IVS8CA IVS17BTA / IVS17BCA Figure 1. Login to comment
58 CF mutations identified in the Spanish population Mutation AF5O8 G542X N13O3K 36O1-111G-C R1162X 1609delCA 2869insG W1282X AI507 G551D 1949del84 CF50KBdel tt 1 K710X 621 + 1G-T R334W 1078delT E92K 3667deM R1158X A120T I148T 386Oins31 Unknown Total N 437 73 18 18 14 8 6 6 5 4 3 3 3 2 2 1 1 1 1 1 1 1 271 880 % 49.7 8.3 2.1 2.1 1.6 0.9 0.7 0.7 0.6 0.5 0.3 0.3 0.3 0.2 0.2 0. Login to comment
138 CFTR mjcrosatellhe haplotypes for 19 CF mutations Haplotypes 8CA 16 17 23 14 16 17 16 16 16 17 17 16 21 22 17BTA 7 7 7 31 31 31 44 43 46 45 46 - 31 30 17BCA 17 17 17 13 13 13 13 13 13 13 13 - 13 13 Mutation 1609delCA (0.9) AI507 (0.6) G551D (0.5) 3667del4 (0.1) W1282X (0.7) R1158X(0.1) I148T (0.1) 1949del84 (0.3) K710X (0.3) 1078ddT (0.1) R1162X (1.6) 2869insG (0.7) 3601-111G-C (2.1) E92K (0.1) 3860ins31 (0.1) R334W (0.2) CF50KBdel#l (0.3) Chromosomes CF Number 8 5 4 1 5 1 1 3 2 1 7 5 1 18 1 1 2 3 621 + 1G-T (0.2)1 A120T (0.1) 1 % Normal 14.5 2.9 0.6 - 10.0 1.1 1.9 - 3.0 - 0.2 - 0.4 - CF cystic fibrosis; ( ) frequency of mutation in the population. Login to comment
202 Mutations I148T, A120T, and 1078deIT were analysed by SSCP analysis. Login to comment

[hide] Genetic determination of exocrine pancreatic funct... Am J Hum Genet. 1992 Jun;50(6):1178-84. Kristidis P, Bozon D, Corey M, Markiewicz D, Rommens J, Tsui LC, Durie P
Genetic determination of exocrine pancreatic function in cystic fibrosis.
Am J Hum Genet. 1992 Jun;50(6):1178-84., [PMID:1376016]

Abstract [show]
We showed elsewhere that the pancreatic function status of cystic fibrosis (CF) patients could be correlated to mutations in the CF transmembrane conductance regulator (CFTR) gene. Although the majority of CF mutations--including the most common, delta F508--strongly correlated with pancreatic insufficiency (PI), approximately 10% of the mutant alleles may confer pancreatic sufficiency (PS). To extend this observation, genomic DNA of 538 CF patients with well-documented pancreatic function status were analyzed for a series of known mutations in their CFTR genes. Only 20 of the 25 mutations tested were found in this population. They accounted for 84% of the CF chromosomes, with delta F508 being the most frequent (71%), and the other mutations accounted for less than 5% each. A total of 30 different, complete genotypes could be determined in 394 (73%) of the patients. The data showed that each genotype was associated only with PI or only with PS, but not with both. This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as delta F508, delta I507, Q493X, G542X, R553X, W1282X, 621 + 1G----T, 1717-1G----A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
10 This result is thus consistent with the hypothesis that PI and PS in CF are predisposed by the genotype at the CFTR locus; the PS phenotype occurs in patients who have one or two mild CFTR mutations, such as R117H, R334W, R347P, A455E, and P574H, whereas the PI phenotype occurs in patients with two severe alleles, such as AF508, A1507, Q493X, G542X, R553X, W1282X, 621 + 1G-PT, 1717-1G--'A, 556delA, 3659delC, I148T, G480C, V520F, G551D, and R560T. Login to comment
58 Intron 10: 1717-1G-'A Exon 11: G542X .......... S549R ........... G551D .......... R553X .......... R560T .......... Exon 12: Y563N .......... P574H .......... Exon 19: 3659delC ....... Exon 20: W1282X ....... Exon 21: N1303K ..... G460-C A deletion G482-'A A deletion T575-C 621 + 1G-T C1132-T C1172- G C1496-A G1505-'T G1570-T C1609-T 3-bp deletion 3-bp deletion G1690-T G1717-1-A G1756-T T1779-G G1784- A C1789-T G1811-C T1819- A C1853- A C deletion G3978-A C4041-G Asp 110-His Frameshift Arg 117-His Frameshift Ile 148-Thr Splice mutation Arg 334-Trp Arg 347-Pro Ala 455- Glu Gly 458-'Val Gly480-Cys Gln 493- stop del of Ile 507 del of Phe 508 Val 520-Phe Splice mutation Gly 542- stop Ser 549-'Arg Gly 551-WAsp Arg 553- stop Arg 560- Thr Tyr 563- Asn Pro 574-His Frameshift Trp 1282-stop Asn 1303-Lys Dean et al. 1990 White et al. 1991 Dean et al. 1990 Zielenski et al. 1991a F. Rininsland, D. Bozon, and L.-C. Tsui, unpublished data Zielenski et al. 1991a Gasparini et al. 1991 Dean et al. 1990 Kerem et al. 1990b Cuppens et al. 1990 Strong et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1989b Jones et al. 1991 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Cutting et al. 1990 Cutting et al. 1990 Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Kerem et al. 1990b Vidaud et al. 1990 Osborne et al. 1990 PI or PS, but not with both. Login to comment
66 As shown in table 3, meconium ileus Table 2 1181 Table 3 Frequency of 25 CF Mutations in Chromosomes of the Toronto Study Population Mutation AF508 ...... G551D...... G542X...... 621 +1G-'T N1303K..... W1282X..... R1 17H...... 1717-1G-~A R560T...... A1507 ...... R553X...... V52OF ...... R334W ..... A455E...... I148T ...... Q493X...... P574H...... R347P ...... SS6delA ..... 3659delC .... G480C...... 444delA ..... D110H...... G458V...... S549R ...... Y563N...... Login to comment

[hide] Prenatal diagnosis of cystic fibrosis: a case of t... Clin Chim Acta. 2000 Aug;298(1-2):121-33. Castaldo G, Martinelli P, Massa C, Fuccio A, Grosso M, Rippa E, Paladini D, Salvatore F
Prenatal diagnosis of cystic fibrosis: a case of twin pregnancy diagnosis and a review of 5 years' experience.
Clin Chim Acta. 2000 Aug;298(1-2):121-33., [PMID:10876009]

Abstract [show]
We performed prenatal diagnoses for cystic fibrosis in 32 high risk (1:4) couples (including a dizygotic pregnancy). Chorionic villi sampling did not cause abortion or fetal malformation in any case. The preliminary analysis of 9 short tandem repeats always excluded maternal contamination of the DNA extracted from chorionic villi and confirmed paternity. Twenty-two prenatal diagnoses were made by direct analysis of the mutations. In seven cases diagnosis was made by the analysis of intragenic polymorphisms; in three cases, we analyzed two extragenic polymorphisms. The prenatal diagnosis (including genetic counselling) was completed within 24 h from the sampling. Seven prenatal diagnoses revealed an affected fetus; all couples opted for therapeutic abortion. In 17 cases the fetus was heterozygote, and in seven cases it was non carrier of mutated alleles. In the twin pregnancy, mutations were DeltaF508/N1303K. Direct analysis of the DNA extracted from the two independent samples of chorionic villi revealed one fetus non carrier of mutated alleles and the other a carrier of the N1303K mutation. Analysis of the HPRT locus predicted both the fetuses as males. Furthermore, the genotype of each fetus was defined after birth. The prenatal diagnosis with chorionic villi sampling plays a key role in the prevention of cystic fibrosis. The laboratories must be equipped for both the direct analysis of mutations and for the analysis of a large number of polymorphisms. The preliminary analysis of short tandem repeats is recommended both to exclude maternal contamination and to confirm parentage.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 of cases IVS8 17bCA 17bTA XV2c KM19 and (%) DF508/DF508 13 - - - - - b DF508/N1303K 4 - - - - - DF508/I148T 1 - - - - - DF508/W1282X 1 - - - - - DF508/R553X 1 - - - - - W1282X/N1303K 1 - - - - - N1303K/71111G . Login to comment
101 In the second case, the female had been identified as carrier a of DF508, being the sister of a DF508 carrier, and the partner had been sequentially characterized as carrying I148T, even if the family anamnesis was negative for cystic fibrosis. Login to comment
102 The fetus had only the I148T mutation. Login to comment

[hide] The neglected ion: HCO3-. Nat Med. 2001 Mar;7(3):292-3. Quinton PM
The neglected ion: HCO3-.
Nat Med. 2001 Mar;7(3):292-3., [PMID:11231624]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 However, mutations in CFTR that result in pancreatic insufficiency and more severe forms of the disease (bottom) do not support HC03 - transport but, surprisingly, may support normal Cl-transport (I148T). Login to comment

[hide] Cystic fibrosis: the 'bicarbonate before chloride'... Curr Biol. 2001 Jun 26;11(12):R463-6. Wine JJ
Cystic fibrosis: the 'bicarbonate before chloride' hypothesis.
Curr Biol. 2001 Jun 26;11(12):R463-6., [PMID:11448786]

Abstract [show]
The specific effects of some mutations that cause cystic fibrosis suggest that reduced HCO(3)(-) transport is the key to understanding cystic fibrosis pathology. But there is a puzzling discrepancy between measures of CFTR-mediated chloride conductance in expression systems and the sweat chloride values of patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 That is true even for subjects who are homozygous for mutations I148T [13] and G551D (R. Moss, personal communication). Login to comment
52 Ion transport (% WT) 42 41 69 75 >100 >100 98 + 103 100 + + 120 Pancreatic sufficient Pancreatic insufficient Bicarbonate Chloride - intermediate Chloride - high Unknown WT D648V R117H R1070Q H949Y G551S H620Q I148T A1067T G178R G970R S1255P G1244E G551D G1349D 0 0.5 1 1.5 2 2.5 Current Biology ࢞F508 Dispatch R absence of the vas deferens [16]. Login to comment
77 Published values were found for H949Y [22] and G551S [17] and I148T [13]. Login to comment

[hide] Cystic fibrosis. Am J Clin Pathol. 2003 Dec;120 Suppl:S3-13. Lewis MJ, Lewis EH 3rd, Amos JA, Tsongalis GJ
Cystic fibrosis.
Am J Clin Pathol. 2003 Dec;120 Suppl:S3-13., [PMID:15298139]

Abstract [show]
On a daily basis, pathologists examine the fundamental basis of human diseases using morphologic, immunologic, and molecular techniques. Cystic fibrosis (CF), as a clinically heterogeneous disease, exemplifies the complex challenges of genetic diseases for the pathologist who attempts to explain the mechanisms of disease and provide rationale for clinical management. This review includes an overview of CF and a discussion of pathophysiologic features and practical components of clinical and anatomic pathology, and concludes with a review of molecular diagnostics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 ēa; ēa;Table 3ēa; ēa; Recommended Mutation Panel for Cystic Fibrosis Carrier Screening ࢞F508 ࢞I507 G542X G551D W1282X N1303K R553X 621+1G>T R117H 1717-1G>A A455E R560T R1162X G85E R334W R347P 711+1G>T 1898+1G>A 2184delA 1078delT 3849+10kbC>T 2789+5G>A 3659delC I148T 3120+1G>A I506V* I507V* F508C* 5T/7T/9T* * Reflex tests. Login to comment

[hide] Compound genetic abnormalities in patients with cy... Fertil Steril. 2007 Jun;87(6):1468.e5-8. Epub 2007 Jan 24. Karpman E, Williams DH 4th, Wilberforce S, Lipshultz LI
Compound genetic abnormalities in patients with cystic fibrosis transmembrane regulator gene mutation.
Fertil Steril. 2007 Jun;87(6):1468.e5-8. Epub 2007 Jan 24., [PMID:17254580]

Abstract [show]
OBJECTIVE: To determine the prevalence of compound genetic abnormalities in patients who are carriers of cystic fibrosis mutations. DESIGN: Case report. SETTING: Tertiary referral center for male infertility. PATIENT(S): Between 2000 and 2005, 65 patients were identified to be carriers of cystic fibrosis transmembrane regulator gene (CFTR) mutations or have a polymorphism of the polythymidine tract of intron 8. INTERVENTION(S): Patients were evaluated for male factor infertility. Additional genetic testing for karyotype abnormalities or Y chromosome microdeletions was performed when indicated because of evidence of impaired spermatogenesis during surgical sperm retrieval or on semen analysis. A comparison of similar patients is in the published literature. MAIN OUTCOME MEASURE(S): Characteristics of patients with compound genetic abnormalities presenting to an academic male fertility practice. Comparison to similar patients reported in the literature. RESULT(S): Two patients (3.1%) out of 65 were identified in our database to have compound genetic abnormalities. One patient had a W1282X mutation while the other had an I148T mutation. Both patients had deletions of AZF b + c regions. There were no karyotype abnormalities identified in our database. An additional two patients with compound CFTR mutations and Y chromosome microdeletions were identified in the literature. Three patients in the literature had compound CFTR mutations and karyotype abnormalities. CONCLUSION: Compound genetic abnormalities in CFTR mutation patients can be a contributing factor when abnormal spermatogenesis is encountered. A secondary genetic etiology should be considered in these types of patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
9 Result(s): Two patients (3.1%) out of 65 were identified in our database to have compound genetic abnormalities. One patient had a W1282X mutation while the other had an I148T mutation. Login to comment
71 This revealed that the patient was a heterozygous carrier of the I148T mutation for cystic fibrosis and had a wild-type poly T tract. Login to comment
100 Study Year CFTR,IVS8-T Kayotype Y-del SA Exam FSH Testis histology Current study 2006 W1282X/afa;,WT/WT 46,XY AZF baf9;c Azo Bil Vas 4 Late, incomplete maturation arrest Current study 2006 I148T/afa;, WT/WT 46, XY AZF baf9;c OAT Bil Vas 19 NA Shulz et al. (11) 2006 F508/afa; , WT/WT 45,XY, der(14;22) None OAT Bil Vas NA NA Dohle et al. (9) 2002 F508/afa;, 7T/9T 46,XY AZFc OAT Hypogonadism 7.3 NA Dohle et al. (9) 2002 R117H/afa; 47,XXY None Azo Hypogonadism 11 NA Meng et al. (10) 2001 F508/afa;, 7T/9T 46,XY AZFb Azo CBAVD NA Sertoli cell only Black et al. (8) 2000 afa;/afa;, 5T/9T 46,XY,inv (6)(p12q21) None Azo CBAVD 8.8 Late, incomplete maturation arrest Note: Azo afd; azoospermia; Bil Vas afd; bilateral vas deferens present; CBAVD afd; congenital bilateral absence of the vas deferens; CFTR afd; cystic fibrosis transmembrane receptor; FSH afd; follicle stimulating hormone; NA afd; not available; OAT afd; oligoasthenoteratozoospermia; SA afd; semen analysis; WT afd; wild type. Login to comment
104 1468.e Fertility and Sterility;de; cases had èc;F508 mutations, whereas these new patients were carriers of the W1282X and I148T mutations. Login to comment
106 Our second patient had an I148T mutation, which has a reported frequency of 0.09% in the cystic fibrosis population. Login to comment

[hide] Hereditary chronic pancreatitis. Best Pract Res Clin Gastroenterol. 2008;22(1):115-30. doi: 10.1016/j.bpg.2007.10.019. Teich N, Mossner J
Hereditary chronic pancreatitis.
Best Pract Res Clin Gastroenterol. 2008;22(1):115-30. doi: 10.1016/j.bpg.2007.10.019., [PMID:18206817]

Abstract [show]
Hereditary chronic pancreatitis (HCP) is a very rare form of early-onset chronic pancreatitis. Apart from young age at diagnosis and a slower progression, the clinical course, morphological features and laboratory findings of HCP do not differ from those of patients with alcoholic chronic pancreatitis. Diagnostic criteria and treatment of HCP also resemble those of chronic pancreatitis of other causes. The clinical presentation is highly variable and includes chronic abdominal pain, impairment of endocrine and exocrine pancreatic function, nausea and vomiting, maldigestion, diabetes, pseudocysts, bile-duct and duodenal obstruction, and rarely pancreatic cancer. Fortunately, the disease is mild in most patients. Mutations in the PRSS1 gene, encoding cationic trypsinogen, play a causative role in chronic pancreatitis. It has been shown that the PRSS1 mutations increase autocatalytic conversion of trypsinogen to active trypsin, and thus probably cause premature, intrapancreatic trypsinogen activation, disturbing the intrapancreatic balance of proteases and their inhibitors. Other genes--such as the anionic trypsinogen (PRSS2), the serine protease inhibitor Kazal type 1 (SPINK1), and the cystic fibrosis transmembrane conductance regulator (CFTR)--have also been found to be associated with chronic pancreatitis (idiopathic and hereditary). Genetic testing should only be performed in carefully selected patients by direct DNA sequencing, and antenatal diagnosis should not be encouraged. Treatment focuses on enzyme and nutritional supplementation, pain management, pancreatic diabetes, and local organ complications such as pseudocysts and bile-duct or duodenal obstruction. The disease course and prognosis of patients with HCP is unpredictable. The risk of pancreatic cancer is elevated. Therefore, HCP patients should strongly avoid environmental risk factors for pancreatic cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
75 Some authors state that compound heterozygous CFTR carriers have a distinct elevated risk for the development of chronic pancreatitis, which is even higher when an additional SPINK1 mutation is present.51,54 However, the role of some CFTR mutations has to be reconsidered since Rohlfs et al demonstrated that the mutation I148T in exon 4, which was classified as a severe cystic-fibrosis-causing mutation, is not associated with cystic fibrosis. Login to comment
76 According to their data the complex allele 3199del6 and I148T seem to be the relevant factor.55 In summary, CFTR mutations alone are not sufficient for the pathogenesis of chronic pancreatitis in most patients, and further studies are needed to elucidate the role of CFTR in the pathogenesis of chronic pancreatitis. Login to comment

[hide] Symmetric snapback primers for scanning and genoty... Clin Chem. 2013 Jul;59(7):1052-61. doi: 10.1373/clinchem.2013.202689. Epub 2013 Mar 15. Zhou L, Palais RA, Ye F, Chen J, Montgomery JL, Wittwer CT
Symmetric snapback primers for scanning and genotyping of the cystic fibrosis transmembrane conductance regulator gene.
Clin Chem. 2013 Jul;59(7):1052-61. doi: 10.1373/clinchem.2013.202689. Epub 2013 Mar 15., [PMID:23503723]

Abstract [show]
BACKGROUND: High-resolution melting of PCR products is an efficient and analytically sensitive method to scan for sequence variation, but detected variants must still be identified. Snapback primer genotyping uses a 5' primer tail complementary to its own extension product to genotype the resulting hairpin via melting. If the 2 methods were combined to analyze the same PCR product, the residual sequencing burden could be reduced or even eliminated. METHODS: The 27 exons and neighboring splice sites of the CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] gene were amplified by the PCR in 39 fragments. Primers included snapback tails for genotyping 7 common variants and the 23 CFTR mutations recommended for screening by the American College of Medical Genetics. After symmetric PCR, the amplicons were analyzed by high-resolution melting to scan for variants. Then, a 5-fold excess of H2O was added to each reaction to produce intramolecular hairpins for snapback genotyping by melting. Each melting step required <10 min. Of the 133 DNA samples analyzed, 51 were from CFTR patient samples or cell lines. RESULTS: As expected, the analytical sensitivity of heterozygote detection in blinded studies was 100%. Snapback genotyping reduced the need for sequencing from 7.9% to 0.5% of PCR products; only 1 amplicon every 5 patients required sequencing to identify nonanticipated rare variants. We identified 2 previously unreported variants: c.3945A>G and c.4243-5C>T. CONCLUSIONS: CFTR analysis by sequential scanning and genotyping with snapback primers is a good match for targeted clinical genetics, for which high analytical accuracy and rapid turnaround times are important.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 PRIMERS AND NOMENCLATURE Previously described CFTR primers (8) were modified with 5b18; tails to enable snapback genotyping of the 23 ACMG mutations (17), p.I148T, and 7 common benign variants. Login to comment

[hide] PGD for cystic fibrosis patients and couples at ri... Reprod Biomed Online. 2013 May;26(5):420-30. doi: 10.1016/j.rbmo.2013.01.006. Epub 2013 Jan 29. Rechitsky S, Verlinsky O, Kuliev A
PGD for cystic fibrosis patients and couples at risk of an additional genetic disorder combined with 24-chromosome aneuploidy testing.
Reprod Biomed Online. 2013 May;26(5):420-30. doi: 10.1016/j.rbmo.2013.01.006. Epub 2013 Jan 29., [PMID:23523379]

Abstract [show]
Preimplantation genetic diagnosis (PGD) for inherited disorders is presently applied for more than 300 different conditions. The most frequent PGD indication is cystic fibrosis (CF), the largest series of which is reviewed here, totalling 404 PGD cycles. This involved testing for 52 different CFTR mutations with almost half of the cases (195/404 cycles) performed for DeltaF508 mutation, one-quarter (103/404 cycles) for six other frequent mutations and only a few for the remaining 45 CFTR mutations. There were 44 PGD cycles performed for 25 CF-affected homozygous or double-heterozygous CF patients (18 male and seven female partners), which involved testing simultaneously for three mutations, resulting in birth of 13 healthy CF-free children and no misdiagnosis. PGD was also performed for six couples at a combined risk of producing offspring with CF and another genetic disorder. Concomitant testing for CFTR and other mutations resulted in birth of six healthy children, free of both CF and another genetic disorder in all but one cycle. A total of 96 PGD cycles for CF were performed with simultaneous aneuploidy testing, including microarray-based 24-chromosome analysis, as a comprehensive PGD for two or more conditions in the same biopsy material.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
56 (CA)n EXON 4 (GATT)n Intron 4 Poly T tract Intron 10 R117H G--A R75XH C--T A120T G--A I148T T--C A349V C--T 1259 Ins A 621+1 G--T EXON 3 EXON 7 EXON 8 Delta I 507 EXON 10 Delta F 508 EXON 11 1717-1 G--A G542X G--T G550X G--T G551D G--A R553X C--T R560T G--C EXON 19 EXON 20 EXON 21 R1162X C--T W1282X G--A N1303K C--G IVS 1 Mutations in CFTR gene (PGD PERFORMED FOR 52 MUTATIONS) IVS 6 a IVS 8 (CA)n (CA)n IVS 17b (TA)n (CA)n D7S486 D7S522 D7S633 D7S677 D7S2847 D7S655 115,89 116.07 117.01 117.13 117.19 117.20 118.6 118.81 Mb IVS8-1 IVS8-2 Figure 1 Mutations (above) and linked markers (below) in CFTR that were used in multiplex PCR. Login to comment

[hide] Defining the disease liability of variants in the ... Nat Genet. 2013 Oct;45(10):1160-7. doi: 10.1038/ng.2745. Epub 2013 Aug 25. Sosnay PR, Siklosi KR, Van Goor F, Kaniecki K, Yu H, Sharma N, Ramalho AS, Amaral MD, Dorfman R, Zielenski J, Masica DL, Karchin R, Millen L, Thomas PJ, Patrinos GP, Corey M, Lewis MH, Rommens JM, Castellani C, Penland CM, Cutting GR
Defining the disease liability of variants in the cystic fibrosis transmembrane conductance regulator gene.
Nat Genet. 2013 Oct;45(10):1160-7. doi: 10.1038/ng.2745. Epub 2013 Aug 25., [PMID:23974870]

Abstract [show]
Allelic heterogeneity in disease-causing genes presents a substantial challenge to the translation of genomic variation into clinical practice. Few of the almost 2,000 variants in the cystic fibrosis transmembrane conductance regulator gene CFTR have empirical evidence that they cause cystic fibrosis. To address this gap, we collected both genotype and phenotype data for 39,696 individuals with cystic fibrosis in registries and clinics in North America and Europe. In these individuals, 159 CFTR variants had an allele frequency of l0.01%. These variants were evaluated for both clinical severity and functional consequence, with 127 (80%) meeting both clinical and functional criteria consistent with disease. Assessment of disease penetrance in 2,188 fathers of individuals with cystic fibrosis enabled assignment of 12 of the remaining 32 variants as neutral, whereas the other 20 variants remained of indeterminate effect. This study illustrates that sourcing data directly from well-phenotyped subjects can address the gap in our ability to interpret clinically relevant genomic variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
468 Rohlfs, E.M. et al. The I148T CFTR allele occurs on multiple haplotypes: a complex allele is associated with cystic fibrosis. Login to comment

[hide] Molecular testing for cystic fibrosis carrier stat... J Genet Couns. 2014 Feb;23(1):5-15. doi: 10.1007/s10897-013-9636-9. Epub 2013 Sep 7. Langfelder-Schwind E, Karczeski B, Strecker MN, Redman J, Sugarman EA, Zaleski C, Brown T, Keiles S, Powers A, Ghate S, Darrah R
Molecular testing for cystic fibrosis carrier status practice guidelines: recommendations of the National Society of Genetic Counselors.
J Genet Couns. 2014 Feb;23(1):5-15. doi: 10.1007/s10897-013-9636-9. Epub 2013 Sep 7., [PMID:24014130]

Abstract [show]
PURPOSE: To provide practice recommendations for genetic counselors whose clients are considering cystic fibrosis (CF) carrier testing or seeking information regarding CF molecular test results. The goals of these recommendations are to: 1) Provide updated information about the natural history, diagnosis, and treatment of CF and related conditions. 2) Supplement genetic counselors' knowledge and understanding of the available carrier screening and diagnostic testing options. 3) Describe the current state of genotype/phenotype correlations for CFTR mutations and an approach to interpreting both novel and previously described variants. 4) Provide a framework for genetic counselors to assist clients' decision-making regarding CF carrier testing, prenatal diagnosis, and pregnancy management. Disclaimer The practice guidelines of the National Society of Genetic Counselors (NSGC) are developed by members of the NSGC to assist genetic counselors and other health care providers in making decisions about appropriate management of genetic concerns; including access to and/or delivery of services. Each practice guideline focuses on a clinical or practice-based issue, and is the result of a review and analysis of current professional literature believed to be reliable. As such, information and recommendations within the NSGC practice guidelines reflect the current scientific and clinical knowledge at the time of publication, are only current as of their publication date, and are subject to change without notice as advances emerge.In addition, variations in practice, which take into account the needs of the individual patient and the resources and limitations unique to the institution or type of practice, may warrant approaches, treatments and/or procedures that differ from the recommendations outlined in this guideline. Therefore, these recommendations should not be construed as dictating an exclusive course of management, nor does the use of such recommendations guarantee a particular outcome. Genetic counseling practice guidelines are never intended to displace a health care provider's best medical judgment based on the clinical circumstances of a particular patient or patient population.Practice guidelines are published by NSGC for educational and informational purposes only, and NSGC does not "approve" or "endorse" any specific methods, practices, or sources of information.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
95 Evolution of Test Panels and Their Interpretation: The Example of I148T/3199del6 Large-scale population carrier screening is providing new information regarding the frequency of alleles in healthy and patient populations. Login to comment
96 A key example is the I148T/3199del6 mutation. Login to comment
97 Initially, I148T was included on the ACOG/ACMG standard mutation panel (ACOG and ACMG 2001). Login to comment
98 However, it was later learned that I148T only behaved as a deleterious mutation when in cis with 3199del6. Login to comment
99 Individuals with a known deleterious mutation in trans to an I148T mutation in the absence of a cis 3199del6 were asymptomatic (Monaghan et al. 2004). Login to comment
100 As a result, I148T was removed from the ACMG standard mutation panel (Rohlfs et al. 2002; Buller et al. 2004). Login to comment

[hide] Phenotypic expression of the p.Leu1077Pro CFTR mut... BMC Res Notes. 2013 Nov 13;6:461. doi: 10.1186/1756-0500-6-461. Parisi GF, Cutello S, Di Dio G, Rotolo N, La Rosa M, Leonardi S
Phenotypic expression of the p.Leu1077Pro CFTR mutation in Sicilian cystic fibrosis patients.
BMC Res Notes. 2013 Nov 13;6:461. doi: 10.1186/1756-0500-6-461., [PMID:24225052]

Abstract [show]
BACKGROUND: The p.Leu1077Pro CFTR mutation was firstly described in 1992 as a mild allele that confers a pancreatic sufficiency phenotype but the information collected in database CFTR2 lead to consider p.Leu1077Pro as a severe CF mutation. Although it is typical of Southern Italy, p.Leu1077Pro is not included in the mutation panel firstly tested in individuals originated from this area. The aim of our study was to describe prevalence and clinical features in patients bearing this mutation followed in our Cystic Fibrosis Centre to demonstrate that this mutation should be included in the mutation panel firstly tested in patients originated from Southern Italy. FINDINGS: We reviewed data from a cohort of 111 cystic fibrosis patients. 4 patients who were heterozygous for the p.Leu1077Pro mutation were included in the study.In our Cystic Fibrosis Centre, the prevalence of p.Leu1077Pro is 3.6% among all mutations. All patients had positive sweat test values, pancreatic insufficiency and pulmonary exacerbations. One out of four patients even showed both FEV1 and FVC values significantly below the normal range, the presence of bronchiectasis and chronic Pseudomonas aeruginosa colonization. CONCLUSIONS: We found that the p.Leu1077Pro CFTR mutation is associated with a classic CF phenotype confirming what is reported in CFTR2 database. The relatively high prevalence of p.Leu1077Pro associated with the severe clinical course of the disease in patients bearing this mutation is of interest for genetic counselling purposes, as it should be part of mutation panel to be tested in individuals originated from Southern Italy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
132 Bozon D, Zielenski J, Rininsland F, Tsui LC: Identification of Four New Mutation in the Cystic Fibrosis Transmembrane Conductance Regulator Gene: I148T, L1077P, Y1092X, 2183AA ࢐ G. Login to comment

[hide] CFTR mutations spectrum and the efficiency of mole... PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014. Zietkiewicz E, Rutkiewicz E, Pogorzelski A, Klimek B, Voelkel K, Witt M
CFTR mutations spectrum and the efficiency of molecular diagnostics in Polish cystic fibrosis patients.
PLoS One. 2014 Feb 26;9(2):e89094. doi: 10.1371/journal.pone.0089094. eCollection 2014., [PMID:24586523]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane regulator gene (CFTR). In light of the strong allelic heterogeneity and regional specificity of the mutation spectrum, the strategy of molecular diagnostics and counseling in CF requires genetic tests to reflect the frequency profile characteristic for a given population. The goal of the study was to provide an updated comprehensive estimation of the distribution of CFTR mutations in Polish CF patients and to assess the effectiveness of INNOLiPA_CFTR tests in Polish population. The analyzed cohort consisted of 738 patients with the clinically confirmed CF diagnosis, prescreened for molecular defects using INNOLiPA_CFTR panels from Innogenetics. A combined efficiency of INNOLiPA CFTR_19 and CFTR_17_TnUpdate tests was 75.5%; both mutations were detected in 68.2%, and one mutation in 14.8% of the affected individuals. The group composed of all the patients with only one or with no mutation detected (109 and 126 individuals, respectively) was analyzed further using a mutation screening approach, i.e. SSCP/HD (single strand conformational polymorphism/heteroduplex) analysis of PCR products followed by sequencing of the coding sequence. As a result, 53 more mutations were found in 97 patients. The overall efficiency of the CF allele detection was 82.5% (7.0% increase compared to INNOLiPA tests alone). The distribution of the most frequent mutations in Poland was assessed. Most of the mutations repetitively found in Polish patients had been previously described in other European populations. The most frequent mutated allele, F508del, represented 54.5% of Polish CF chromosomes. Another eight mutations had frequencies over 1%, 24 had frequencies between 1 and 0.1%; c.2052-2053insA and c.3468+2_3468+3insT were the most frequent non-INNOLiPA mutations. Mutation distribution described herein is also relevant to the Polish diaspora. Our study also demonstrates that the reported efficiency of mutation detection strongly depends on the diagnostic experience of referring health centers.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Mutations detected in a patient Number of CF patients Alleles with no mutation identified Alleles with CF mutations detected using INNOLiPA tests Further molecular analysis CFTR_19 CFTR_17TnUpdatea both 503 (68.1%) 0 888 (60.2%) 118 (8.0%) Not necessary one 109 (14.8%) 109 98 (6.6%) 11 (0.7%) Yes none 126 (17.1%) 252 0 0 Yes Legend: a I148T included in CFTR-17TnUpdate was not counted as a mutation if not in cis with c.3067-72del6 (l.n. 3199del6); c.1210(-12)Tn site in intron 9 (l.n.IVS8-Tn) without data on the associated TG repeat was not counted as a mutation. Login to comment
101 The more recent estimates provide much lower values, ranging from 1:5000 [14], 1:6000 cited in WHO 2002 report [15] to 1:7500 for Southeastern Poland estimated for a 1-year period of Table 2. Cont. Exon / intron (legacy) Exon / intron (Ensembl) Protein change SVM value cDNA (HGVS nomenclature) gDNA (cDNA +132 bp) Number of PL CF chromosomes Reference a Mutations in trans 15 17 L967S 0.27 c.2900T.C 3032T.C 1 CFMDB; rs1800110 unknown 18 21 D1152H 0.50 c.3454G.C 3586G.C 1 CFMDB; rs75541969 F508del Sequence changes considered as lacking pathogenic effect 4 4 I148T 2.04 c.443T.U 575T.U 4 IL19e unknown 13 14 I752V 0.35 c.2254A.G 2386A.G 1 Novelf F508 15 17 S912L 2.12 c.2735C.T 2867C.T 1 CFMDBg ; rs121909034 F508 Legend: a IL19 i 17 - mutations included in the INNOLiPA tests (see below); CFMDB - non-INNOLiPA mutations present in the CTFR mutation database; novel - mutations first reported in this study; b in three chromosomes R668C with G576A in trans; c F508del, c.1585-1G.A, G542X, N1303K or c.579+3A.G; d F508del, G542X, R553X or N1303K; e not pathogenic if not in cis with c.3067-72del6 (l.n.3199del6); f not pathogenic - see explanation the text; g not pathogenic if not in cis with G1244V. Login to comment
102 a Mutations detected by two INNOLiPA_CFTR tests (legacy names): IL19 (INNOLiPA_CFTR19): F508del; G542X; N1303K; W1282X; G551D; 1717-1G.A; R553X; CFTRdele2,3(21kb); I507del; 711+1G.T; 3272-26A.G; 3905insT; R560T; 1898+1G.A; S1251N; I148T; 3199del6; 3120+1G.A; Q552X. Login to comment

[hide] Genetics of cystic fibrosis: CFTR mutation classif... Int J Biochem Cell Biol. 2014 Jul;52:94-102. doi: 10.1016/j.biocel.2014.02.023. Epub 2014 Mar 12. Fanen P, Wohlhuter-Haddad A, Hinzpeter A
Genetics of cystic fibrosis: CFTR mutation classifications toward genotype-based CF therapies.
Int J Biochem Cell Biol. 2014 Jul;52:94-102. doi: 10.1016/j.biocel.2014.02.023. Epub 2014 Mar 12., [PMID:24631642]

Abstract [show]
Cystic fibrosis (CF) is an autosomal recessive disease caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes an epithelial anion channel. Since the identification of the disease in 1938 and up until 2012, CF patients have been treated exclusively with medications aimed at bettering their respiratory, digestive, inflammatory and infectious symptoms. The identification of the CFTR gene in 1989 gave hopes of rapidly finding a cure for the disease, for which over 1950 mutations have been identified. Since 2012, recent approaches have enabled the identification of small molecules targeting either the CFTR protein directly or its key processing steps, giving rise to novel promising therapeutic tools. This review presents the current CFTR mutation classifications according to their clinical consequences and to their effect on the structure and function of the CFTR channel. How these classifications are essential in the establishment of mutation-targeted therapeutic strategies is then discussed. The future of CFTR-targeted treatment lies in combinatory therapies that will enable CF patients to receive a customized treatment.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
70 Group A Group B Group C Group D Classic-CF CF-causing mutations Non-classic CF CFTR-related disorder associated mutations No clinical consequence Unknown clinical relevance All mutations in Table 2 and 711 + 3A > G*, R117H-T5*, D1152H*, L206W*, TG13-T5* TG13-T5a , R117H-T5a , D1152Ha , L206Wa , L997F, M952I, D565Ga , TG11-T5b , R117H-T7b , D443Y-G576A-R668C, R74W-D1270N, R75Qb TG11-T5b , R117H-T7b , R75Qb , 875 + 40A/G, M470V, T854T, P1290P, I807M, I521F, R74W, F508C, I506V, I148T All mutations (mostly missense) not yet analyzed or undergoing functional analysis a Mutations that may belong either to Group A or to Group B. b Mutations that may belong either to Group B or to Group C. Login to comment
125 As of today, only a few of such mutants have been identified, namely p.Arg75Gln and p.Ile148Thr (Choi et al., 2001; Schneider et al., 2011). Login to comment
126 While p.Ile148Thr appears not to be deleterious (Claustres et al., 2004), p.Arg75Gln was found in some studies Fig. 3. Classification of CF mutations according to CFTR structure and function assessment. Login to comment

[hide] Mechanisms of CFTR functional variants that impair... PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul. LaRusch J, Jung J, General IJ, Lewis MD, Park HW, Brand RE, Gelrud A, Anderson MA, Banks PA, Conwell D, Lawrence C, Romagnuolo J, Baillie J, Alkaade S, Cote G, Gardner TB, Amann ST, Slivka A, Sandhu B, Aloe A, Kienholz ML, Yadav D, Barmada MM, Bahar I, Lee MG, Whitcomb DC
Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis.
PLoS Genet. 2014 Jul 17;10(7):e1004376. doi: 10.1371/journal.pgen.1004376. eCollection 2014 Jul., [PMID:25033378]

Abstract [show]
CFTR is a dynamically regulated anion channel. Intracellular WNK1-SPAK activation causes CFTR to change permeability and conductance characteristics from a chloride-preferring to bicarbonate-preferring channel through unknown mechanisms. Two severe CFTR mutations (CFTRsev) cause complete loss of CFTR function and result in cystic fibrosis (CF), a severe genetic disorder affecting sweat glands, nasal sinuses, lungs, pancreas, liver, intestines, and male reproductive system. We hypothesize that those CFTR mutations that disrupt the WNK1-SPAK activation mechanisms cause a selective, bicarbonate defect in channel function (CFTRBD) affecting organs that utilize CFTR for bicarbonate secretion (e.g. the pancreas, nasal sinus, vas deferens) but do not cause typical CF. To understand the structural and functional requirements of the CFTR bicarbonate-preferring channel, we (a) screened 984 well-phenotyped pancreatitis cases for candidate CFTRBD mutations from among 81 previously described CFTR variants; (b) conducted electrophysiology studies on clones of variants found in pancreatitis but not CF; (c) computationally constructed a new, complete structural model of CFTR for molecular dynamics simulation of wild-type and mutant variants; and (d) tested the newly defined CFTRBD variants for disease in non-pancreas organs utilizing CFTR for bicarbonate secretion. Nine variants (CFTR R74Q, R75Q, R117H, R170H, L967S, L997F, D1152H, S1235R, and D1270N) not associated with typical CF were associated with pancreatitis (OR 1.5, p = 0.002). Clones expressed in HEK 293T cells had normal chloride but not bicarbonate permeability and conductance with WNK1-SPAK activation. Molecular dynamics simulations suggest physical restriction of the CFTR channel and altered dynamic channel regulation. Comparing pancreatitis patients and controls, CFTRBD increased risk for rhinosinusitis (OR 2.3, p<0.005) and male infertility (OR 395, p<<0.0001). WNK1-SPAK pathway-activated increases in CFTR bicarbonate permeability are altered by CFTRBD variants through multiple mechanisms. CFTRBD variants are associated with clinically significant disorders of the pancreas, sinuses, and male reproductive system.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 Other candidate CFTR variants, including I148T, M470V, T854T, Q1463Q and the ''5T`` allele, were either rare or were not associated with pancreatitis in our cohort (Table 1). Login to comment
71 I148T was seen in three cases and one control, so an effect could not be detected or excluded; the in cis deletion mutation 3199del6 was not detected in any I148T carriers. Login to comment
116 CFTR variant %Cases %Uctrls OR p-value %Cases w/N34S OR w/N34S p-value w/N34S F508C 0.5 0.3 1.58 0.21 0.0 0.00 0.67 R1162L 0.5 0.5 1.13 0.29 1.8 4.03 0.17 I1027T 0.5 0.3 1.99 0.17 0.0 0.00 0.70 R31C 0.3 0.7 0.42 0.088 0.0 0.00 0.52 I148T 0.3 0.4 0.75 0.27 0.0 0.00 0.63 R297Q 0.3 0.2 1.89 0.21 0.0 0.00 0.76 R74W 0.2 0.2 0.85 0.29 0.0 0.00 0.71 F1052V 0.1 0.2 0.63 0.27 0.0 0.00 0.76 I807M 0.1 0.1 1.26 0.30 0.0 0.00 0.83 R258G 0.1 0.1 1.26 0.30 0.0 0.00 0.83 G1069R 0.1 0.0 0.13 0.0 V201M 0.0 0.1 0.17 0.0 0.00 0.83 Of the 81 CFTR mutations tested in the cohort, 43 were observed at least once in cases or controls. Login to comment
224 I148T was seen in three cases and one control, so an effect could not be detected or excluded; the in cis deletion mutation 3199del6 was not detected in any I148T carriers. Login to comment
269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment
270 3199del6 was genotyped via TaqMan on all samples that tested positive for I148T. Login to comment

[hide] Analysis of cystic fibrosis gene mutations in chil... J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339. Dell'Edera D, Benedetto M, Gadaleta G, Carone D, Salvatore D, Angione A, Gallo M, Milo M, Pisaturo ML, Di Pierro G, Mazzone E, Epifania AA
Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study.
J Med Case Rep. 2014 Oct 10;8:339. doi: 10.1186/1752-1947-8-339., [PMID:25304080]

Abstract [show]
INTRODUCTION: Cystic fibrosis is the most common autosomal recessive genetic disease in the Caucasian population. Extending knowledge about the molecular pathology on the one hand allows better delineation of the mutations in the CFTR gene and the other to dramatically increase the predictive power of molecular testing. METHODS: This study reports the results of a molecular screening of cystic fibrosis using DNA samples of patients enrolled from January 2009 to December 2013. Patients were referred to our laboratory for cystic fibrosis screening for infertile couples. In addition, we identified the gene mutations present in 76 patients affected by cystic fibrosis in the pediatric population of Basilicata. RESULTS: In the 964 infertile couples examined, 132 subjects (69 women and 63 men) resulted heterozygous for one of the CFTR mutations, with a recurrence of carriers of 6.85%. The recurrence of carriers in infertile couples is significantly higher from the hypothetical value of the general population (4%). CONCLUSIONS: This study shows that in the Basilicata region of Italy the CFTR phenotype is caused by a small number of mutations. Our aim is to develop a kit able to detect not less than 96% of CTFR gene mutations so that the relative risk for screened couples is superimposable with respect to the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
43 Nevertheless, mutation I148T, at first classified as a mutation, now is considered an 'innocent` polymorphism, able to be pathogenetic only if present in the same gene (on the same chromosome) with another polymorphism (3199del6). Login to comment
44 Hence it is necessary, in presence of polymorphism I148T, to detect the presence of polymorphism 3199del6. Login to comment
45 The polymorphism 3199del6 was not detected in all patients with the I148T variant. Login to comment
47 The molecular analysis of the CFTR gene revealed that the two Table 1 Number of subjects tested who were carriers of the cystic fibrosis transmembrane regulator gene Mutation Men Women Total G551D 1 2 3 R553X 0 1 1 F508del 35 32 67 N1303K 7 8 15 I148T 4 9 13 G542X 3 6 9 DI507 2 0 2 L1077P 0 2 2 D1152H 1 6 7 W1282X 2 0 2 2183 AA>G 3 0 3 1259insA 0 1 1 4016insT 1 0 1 I507del 1 0 1 2789+5G>A 1 0 1 4382delA 0 2 2 G1244E 1 0 1 621+3A>G 1 0 1 Total 63 69 132 Figure 1 76 patients with cystic fibrosis and positive sweat test, all have two genes mutated. Login to comment
59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17]. Login to comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

[hide] Inconclusive diagnosis of cystic fibrosis after ne... Pediatrics. 2015 Jun;135(6):e1377-85. doi: 10.1542/peds.2014-2081. Epub 2015 May 11. Ooi CY, Castellani C, Keenan K, Avolio J, Volpi S, Boland M, Kovesi T, Bjornson C, Chilvers MA, Morgan L, van Wylick R, Kent S, Price A, Solomon M, Tam K, Taylor L, Malitt KA, Ratjen F, Durie PR, Gonska T
Inconclusive diagnosis of cystic fibrosis after newborn screening.
Pediatrics. 2015 Jun;135(6):e1377-85. doi: 10.1542/peds.2014-2081. Epub 2015 May 11., [PMID:25963003]

Abstract [show]
OBJECTIVES: To prospectively study infants with an inconclusive diagnosis of cystic fibrosis (CF) identified by newborn screening (NBS; "CF screen positive, inconclusive diagnosis" [CFSPID]) for disease manifestations. METHODS: Infants with CFSPID and CF based on NBS from 8 CF centers were prospectively evaluated and monitored. Genotype, phenotype, repeat sweat test, serum trypsinogen, and microbiology data were compared between subjects with CF and CFSPID and between subjects with CFSPID who did (CFSPID-->CF) and did not (CFSPID-->CFSPID) fulfill the criteria for CF during the first 3 years of life. RESULTS: Eighty-two subjects with CFSPID and 80 subjects with CF were enrolled. The ratio of CFSPID to CF ranged from 1:1.4 to 1:2.9 in different centers. CFTR mutation rates did not differ between groups; 96% of subjects with CFSPID and 93% of subjects with CF had 2 mutations. Subjects with CFSPID had significantly lower NBS immunoreactive trypsinogen (median [interquartile range]:77 [61-106] vs 144 [105-199] mug/L; P < .0001) than did subjects with CF. Pseudomonas aeruginosa and Stenotrophomonas maltophilia were isolated in 12% and 5%, respectively, of subjects with CFSPID. CF was diagnosed in 9 of 82 (11%) subjects with CFSPID (genotype and abnormal sweat chloride = 3; genotype alone = 4; abnormal sweat chloride only = 2). Sweat chloride was abnormal in CFSPID-->CF patients at a mean (SD) age of 21.3 (13.8) months. CFSPID-->CF patients had significantly higher serial sweat chloride (P < .0001) and serum trypsinogen (P = .009) levels than did CFSPID-->CFSPID patients. CONCLUSIONS: A proportion of infants with CFSPID will be diagnosed with CF within the first 3 years. These findings underscore the need for clinical monitoring, repeat sweat testing at age 2 to 3 years, and extensive genotyping.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 In combination with a disease-causing mutation, R117H-7T has been associated with diagnostic uncertainties in CF, TABLE 2 Genotypes of Subjects With CFSPID According to Initial Sweat Chloride Measurements Sweat Chloride ,30 mmol/L Sweat Chloride 30-59 mmol/L Allele 1 Allele 2 n Allele 1 Allele 2 n F508dela R117H (7T)b 9 F508dela R117Cd 2c F508dela 5Tb 2 F508dela L206Wd 2c F508dela D1152Hb 2 F508dela P67Ld 1c F508dela R117Hb 1 F508dela 5Tb 8 F508dela D1270Nb 1 F508dela R117H (7T)b 3 F508dela L997F 3 F508dela R117Hb 3 F508dela 1716G.A 1 F508dela S1455X 1c F508dela 621+3G.A 1 F508dela R170H 1 F508dela I1328T 1 F508dela I148T 1 F508dela L967S 1 F508dela L997F 1 F508dela M1137T 1 F508dela Q1476X 1 F508dela Y301C 1 F508dela S1235R 1 1717-1G.Aa D1152Hb 1 F508dela T1299I 1 2183AA.Ga 5Tb 1 2183AA.Ga R117Cd 1 2183AA.Ga S431G 1 2789+5G.Aa R117H (7T)b 1 3849+10kbC.Ta 3041-15T.G 1 3849+10kbC.Ta 3041-15T.G 1 621+1G.Ta R117H (7T)b 1 621+1G.Ta G1069Rb 1 711+1G.Ta D1152Hb 1 G542Xa L206Wd 1c G542Xa R117H (7T)b 1 G542Xa C1410T 1 G542Xa D1152Hb 1 G551Da 5Tb 1 G551Da D1152Hb 1 N1303Ka 5Tb 1 N1303Ka D1152Hb 1 R1162Xa R117H (7T)b 1c N1303Ka E527G 1 R553Xa 5Tb 1 R117H (5T)a 5Tb 1 R553Xa L997F 1 R117H (7T)b R117H (7T)b 1 R560Ta G576A 1 R117H (7T)b 3041_71G.C 1 W1282Xa 5Tb 2 R117Hb Q1476X 1 F508dela - 2 R117H (5T)a - 1 -, no mutation identified on the second allele. Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 [Gln359Lys; Thr360Lys] L558S c.1673 T4C p.Leu558Ser Y569D c.1705 T4G p.Tyr569Asp D579G c.1736 A4G p.Asp579Gly D614G c.1841 A4G p.Asp614Gly S977F c.2930C4T p.Ser977Phe F1052V c.3154 T4G p.Phe1052Val G1069R c.3205G4A p.Gly1069Arg R1070Q c.3209G4A p.Arg1070Gln D1152H c.3454G4C p.Asp1152His I1234V c.3700 A4G p.Ile1234Val 5T c.1210 - 12[5] Examples of common not CF-causing variantsc R31C c.91C4T p.Arg31Cys R74W c.220C4T p.Arg74Trp R75Q c.224G4A p.Arg75Gln I148T c.443 T4C p.Ile148Thr M470V c.1408 A4G p.Met470Val G576A c.1727G4C p.Gly576Ala R668C c.2002C4T p.Arg668Cys V754M c.2260G4A p.Val754Met L997F c.2991G4C p.Leu997Phe I1027T c.3080 T4C p.Ile1027Thr R1070W c.3208C4T p.Arg1070Trp R1162L c.3485G4T p.Arg1162Leu Table 1 (Continued) HGVS nomenclature Legacy name cDNA nucleotide name Protein name S1235R c.3705 T4G p.Ser1235Arg D1270N c.3808G4A p.Asp1270Asn 7T c.1210-12[7] Abbreviation: HGVS, Human Genome Variation Society. Login to comment
103 [220C4T;c.3208C4T;3808G4A] I148T is a neutral variant, but can be associated in cis with a severe CF variant c.3067_3072del (legacy 3199del6 or 3195del6) that, in isolation causes CF, whereas I148T in isolation does not.19,20 G576A is found in cis with R668C and R668C can be found alone or in cis with G576A. Login to comment
212 BMC Med Genet 2004; 5: 19. 20 Monaghan KG, Highsmith WE, Amos J et al: Genotype-phenotype correlation and frequency of the 3199del6 cystic fibrosis mutation among I148T carriers: results from a collaborative study. Login to comment

[hide] Prevalence of meconium ileus marks the severity of... Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79. Dupuis A, Keenan K, Ooi CY, Dorfman R, Sontag MK, Naehrlich L, Castellani C, Strug LJ, Rommens JM, Gonska T
Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene.
Genet Med. 2015 Jun 18. doi: 10.1038/gim.2015.79., [PMID:26087176]

Abstract [show]
RATIONALE: Meconium ileus (MI) is a perinatal complication in cystic fibrosis (CF), which is only minimally influenced by environmental factors. We derived and examined MI prevalence (MIP) scores to assess CFTR phenotype-phenotype correlation for severe mutations. METHOD: MIP scores were established using a Canadian CF population (n = 2,492) as estimates of the proportion of patients with MI among all patients carrying the same CFTR mutation, focusing on patients with p.F508del as the second allele. Comparisons were made to the registries from the US CF Foundation (n = 43,432), Italy (Veneto/Trentino/Alto Adige regions) (n = 1,788), and Germany (n = 3,596). RESULTS: The prevalence of MI varied among the different registries (13-21%). MI was predominantly prevalent in patients with pancreatic insufficiency carrying "severe" CFTR mutations. In this severe spectrum MIP scores further distinguished between mutation types, for example, G542X (0.31) with a high, F508del (0.22) with a moderate, and G551D (0.08) with a low MIP score. Higher MIP scores were associated with more severe clinical phenotypes, such as a lower forced expiratory volume in 1 second (P = 0.01) and body mass index z score (P = 0.04). CONCLUSIONS: MIP scores can be used to rank CFTR mutations according to their clinical severity and provide a means to expand delineation of CF phenotypes.Genet Med advance online publication 18 June 2015Genetics in Medicine (2015); doi:10.1038/gim.2015.79.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Canadian studies for CF modfier genes 2,492 3,153 43,432 3,596 1,788 2,230 23,397 16,023 3 716 3,438 860 15% (19%) 1,902 2,576 PIP and MIP derivation FEV1 and zBMI modeling MIP calculation following correction of MI variable 23,301 2,413 510 21% (25%) 20% (23%) 13% (15%) Total F508del/others MI prevalence uncorrected (estimated) Missing or incomplete genotype Available for analysis Canadian CF patient registry, born after 1980 US CF patient registry German CF patient registry CF patient registry, North Italy Table 1ߒ Meconium ileus prevalence scores for the most common cystic fibrosis-causing variants p. F508del/other variants Class PIP Canada, (n) MIP, (n) Canada United States Germany Italy HGVS Legacy name c.262_263delTT 394delTT I 0.38 (50) c.3472C>T R1158X I 0.37 (35) c.1558G>T V520F 0.35 (43) c.3484C>T R1162X I 0.34 (135) 0.17 (14) 0.22 (45) c.2012delT 2143delT I 0.33 (13) c.3276C>A or G Y1092X I 0.92 (13) 0.09 (12) 0.33 (55) c.3846G>A W1282X I 1.00 (13) 0.29 (13) 0.32 (442) 0.17 (20) c.1477C>T Q493X I 1.00 (11) 0.19 (11) 0.32 (102) c.3528delC 3659delC I 0.31 (139) c.579ߙ+ߙ1G>T 711ߙ+ߙ1G>T 0.97 (39) 0.30 (38) 0.31 (54) c.178G>T E60X I 0.30 (66) c.1657C>T R553X I 1.00 (16) 0.28 (16) 0.30 (415) 0.24 (107) c.1585-1G>A 1717-1G>A I 1.00 (12) 0.23 (12) 0.29 (367) 0.22 (38) 0.16 (22) c.1766ߙ+ߙ1G>A 1898ߙ+ߙ1G>A 0.29 (139) c.1624G>T G542X I 0.99 (73) 0.31 (72) 0.29 (976) 0.21 (79) 0.22 (33) c.1521_1523delCTT F508del II 0.99 (1292) 0.22 (1260) 0.27 (15391) 0.21 (1910) 0.20 (230) c.1679G>C R560T II 0.27 (123) c.3744delA 3876delA 0.27 (22) c.2128A>T K710X I 0.26 (12) c.1519_1521delATC I507del II 1.00 (20) 0.21 (19) 0.25 (162) c.3909C>G N1303K II 0.98 (40) 0.13 (39) 0.25 (534) 0.23 (80) 0.14 (62) c.489ߙ+ߙ1G>T 621ߙ+ߙ1G>T I 1.00 (90) 0.24 (88) 0.25 (369) 0.21 (11) c.3266G>A W1089X I 0.25 (17) c.1675G>A A559T 0.24 (21) c.988G>T G330X 0.24 (10) c.3773_3774insT 3905insT 0.23 (78) c.2988ߙ+ߙ1G>A 3120ߙ+ߙ1G>A 0.22 (121) c.443T>C I148T;3199del6 1.00 (15) 0.22 (15) c.2052delA 2184delA I 0.21 (89) 0.22 (10) c.2051_2052delAAinsG 2183AA>G 0.20 (73) 0.20 (42) c.948delT 1078delT 0.19 (20) c.1652G>A G551D III 0.96 (54) 0.08 (53) 0.15 (979) 0.09 (84) c.254G>A G85E 0.50 (24) 0.06 (24) 0.14 (137) 0.00 (10) c.3196C>T R1066C 0.14 (42) c.1466C>A S489X 1.00 (14) 0.14 (14) c.3808G>A D1270N 0.13 (19) c.1055G>A R352Q 0.12 (18) c.579ߙ+ߙ5G>A 711ߙ+ߙ5G>A 0.12 (30) c.2175_2176insA 2307insA 0.11 (24) c.349C>T R117C 0.10 (37) c.1040G>C R347P IV 0.18 (11) 0.19 (11) 0.10 (130) 0.02 (56) c.350G>A R117H IV 0.05 (21) 0.00 (21) 0.07 (666) 0.02 (19) c.2657ߙ+ߙ5G>A 2789ߙ+ߙ5G>A V 0.25 (20) 0.00 (20) 0.06 (271) 0.01 (21) c.1040G>A R347H 0.06 (55) c.2988G>A 3120G->A 0.06 (36) c.328G>C D1152H IV 0.06 (124) c.3717ߙ+ߙ12191C>T 3849ߙ+ߙ10kbC>T V 0.07 (14) 0.00 (14) 0.05 (299) 0.01 (42) 0.00 (15) c.1364C>A A455E V 0.16 (45) 0.01 (41) 0.05 (109) c.1000C>T R334W IV 0.18 (11) 0.00 (10) 0.05 (92) c.617T>G L206W 0.06 (18) 0.05 (17) 0.04 (52) c.3302T>A M1101K 0.04 (17) c.200C>T P67L V 0.07 (14) 0.00 (14) Meconium ileus prevalence (MIP) and pancreas insufficiency prevalence (PIP) scores are presented. Login to comment