ABCMdb

ABCC7 p.Gly1244Glu

[switch to full view]
Comments [show]

III (gating defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications

PMID: 16006996 [PubMed] Conseil G et al: "Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters."

No. Sentence Comment

56 In the kidney, glomeruli and distal collecting tubules express MRP1, and, in the brain, MRP1 appears to form part of the drug permeability barrier Fig. 1 CF (CFTR/ABCC7) Q1291R E1228G Q1238R G1244E/V G1247R G1249R S1251N S1255P/L W1282G/R/C R1283K/M N1303K Y1307C E1321Q K1351E Q1352H R1268Q V1298F T1301I G1302R A1303P R1314W/Q G1321S R1339C Q1347H I1350L G1354R D1361N Q1382R A1450T R1347E R1351P V1359G/M S1368A G1377R G1382S R1392H R1419C R1435Q G1477R G1479R R1492W E1505K DJS (MRP2/ABCC2) NBD1 NBD2 COOH MEMBRANE MSD MSD MSD 12131415161710116 7 8 91 23 4 5TM H2 N Extracellular Intracellular PXE (ABCC6) PHHI (SUR1/ABCC8) Two-dimensional structure of MRP-related proteins. Login to comment

PMID: 10021451 [PubMed] Zeitlin PL et al: "Novel pharmacologic therapies for cystic fibrosis."

No. Sentence Comment

125 These mutants sustain a reduced response to ATP-examples include S1255P, G551S, G1244E, and G1349D. Login to comment

PMID: 10388469 [PubMed] Castaldo G et al: "Detection of five rare cystic fibrosis mutations peculiar to Southern Italy: implications in screening for the disease and phenotype characterization for patients with homozygote mutations."

No. Sentence Comment

46 aso dot-blot procedure for the analysis of the five "rare" cf mutations To analyze routinely the five mutations (i.e., L1065P, 711ϩ1G3T, R1158X, 4016insT, and G1244E) we set up a procedure based on a single multiplex PCR amplification followed by ASO dot-blot hybridization. Login to comment
49 Mutation Forward primer (5؅) Reverse primer (3؅) Wild-type oligo for ASO dot blota Mutated oligo for ASO dot blota L1065P (exon 17b) 5ЈTTCAAAGAATGGCACCAGTGT 3ЈATAACCTATAGAATGCAGCA 5ЈATGGACACTTCGTGCCT (52 °C) 5ЈTGGACACCTCGTGCCT (52 °C) 4016insT (exon 21) 5ЈAATGTTCACAAGGGACTCCA 3ЈCAAAAGTACCTGTTGCTCCA 5ЈAGTATTTATTTTTTCTGGAAC (52 °C) 5ЈGTATTTATTTTTTTCTGGAAC (52 °C) 711ϩ1G3T (intron 5) 5ЈATTTCTGCCTAGATGCTGGG 3ЈAACTCCGCCTTTCCAGTTGT 5ЈTTGATGAAGTATGTACCTAT (52 °C) 5ЈTTTGATGAATTATGTACCTAT (52 °C) R1158X (exon 19) 5ЈGCCCGACAAATAACCAAGTGA 3ЈGCTAACATTGCTTCAGGCT 5ЈTTCAGATGCGATCTGTGA (52 °C) 5ЈTTTCAGATGTGATCTGTGA (52 °C) G1244E (exon 20) 5ЈGGTCAGGATTGAAAGTGTGCA 3ЈCTATGAGAAAACTGCACTGGA 5ЈCCTCTTGGGAAGAACTGGA (53 °C) 5ЈCCTCTTGGAAAGAACTGGA (51 °C) a For each oligonucleotide, the optimal washing temperature of the filter is reported. Login to comment
53 Results The DGGE screening allowed us to identify 20 different mutations; five of these, i.e., R1158X, G1244E, 4016insT, 711ϩ1G3T, and L1065P, were observed with a frequency Ͼ1.0% among 396 CF alleles from Southern Italy. Login to comment
137 For 711ϩ1G3T (D) and G1244E (E), 1 and 2 are healthy controls, and 3 and 4 are heterozygotes for the mutation. Login to comment

PMID: 10636451 [PubMed] Schaedel C et al: "Three common CFTR mutations should be included in a neonatal screening programme for cystic fibrosis in Sweden."

No. Sentence Comment

54 patients 1 S549I/S549I Lebanon I148T/unknown1 Turkey 1 711+3GA/ Italy G1244E R553X/G551D1 France 2 R553X/unknown Sweden, Germany 175insT/175insT Sweden2 R117H/unknown2 Sweden 3 Unknown/unknown Sweden, Syria, Turkey early intervention (1, 3). Login to comment

PMID: 10720936 [PubMed] Zeitlin PL et al: "Pharmacologic restoration of delta F508 CFTR-mediated chloride current."

No. Sentence Comment

98 These mutants sus- ment of CF cells with 4-phenylbutyrate or low tempera- tain a reduced response to adenosine 5Ј-triphosphate ture to induce ⌬F508 trafficking to the plasma mem- (ATP); examples include S1255P, G551S, G1244E, and brane, allowed genistein to activate chloride transport G1349D. Login to comment

PMID: 10777364 [PubMed] Wang J et al: "A novel mutation in the CFTR gene correlates with severe clinical phenotype in seven Hispanic patients."

No. Sentence Comment

320 Since ATP hydrolysis at NBD2 terminates a burst of activities associated with opening the channel, loss of NBD2 would confer a loss of the gating control.21 A recent study shows that the Walker A motif in NBD2 is more solvent accessible than that in NBD1, suggesting a diVerence in structure and function for the two NBDs.22 In addition to 3876delA, a few other mutations in NBD2, including G1244E, S1255P, S1255X, 3905insT, W1282X, N1303K, and G1349D, all result in a PI phenotype.5 23 It should be noted that S1255P, S1255X, 3905insT, and 3876delA are all clustered around the Walker A motif. Login to comment

PMID: 10777368 [PubMed] Rivard SR et al: "Correlation between mutations and age in cystic fibrosis in a French Canadian population."

No. Sentence Comment

320 Since ATP hydrolysis at NBD2 terminates a burst of activities associated with opening the channel, loss of NBD2 would confer a loss of the gating control.21 A recent study shows that the Walker A motif in NBD2 is more solvent accessible than that in NBD1, suggesting a diVerence in structure and function for the two NBDs.22 In addition to 3876delA, a few other mutations in NBD2, including G1244E, S1255P, S1255X, 3905insT, W1282X, N1303K, and G1349D, all result in a PI phenotype.5 23 It should be noted that S1255P, S1255X, 3905insT, and 3876delA are all clustered around the Walker A motif. Login to comment

PMID: 10819640 [PubMed] Kilinc MO et al: "Genotype-phenotype correlation in three homozygotes for the cystic fibrosis mutation 2183AA-->G shows a severe phenotype."

No. Sentence Comment

446 The clinical data presented for three patients homozygous for the mutation and eight compound heterozygous patients who carry a severe mutation ( F508, G542X, and G1244E) on the other CFTR chromosome indicate that the mutation causes a severe CF phenotype. Login to comment

PMID: 11100963 [PubMed] Choo-Kang LR et al: "Type I, II, III, IV, and V cystic fibrosis transmembrane conductance regulator defects and opportunities for therapy."

No. Sentence Comment

92 These mutants, including S1255P, G551S, G1244E, and G1349D, sustain a reduced response to ATP. Login to comment

PMID: 11242048 [PubMed] Choi JY et al: "Aberrant CFTR-dependent HCO3- transport in mutations associated with cystic fibrosis."

No. Sentence Comment

36 Similar rates were measured for the I148T, G178R, A1067T, G1244E, S1255P and G1349D mutants (see Fig. 3 for location of these mutations in CFTR), all of which are associated with CF with pancreatic insuf®- ciency. Login to comment
186 letters to nature 96 NATURE |VOL 410 |1 MARCH 2001 |www.nature.com HCO3 -/Cl- transportratio 0 0.25 0.50 0.75 1.00 WT I148T G178R R297Q G551D H620Q G970R A1067T G1244E S1255P G1349D E193K G551S A800G H949Y R1070Q Pancreatic insufficient Pancreatic sufficientD648V N CI148T G178R E193K R297Q R117H A1067T R1070Q G1244E S1255P G1349D NBD2 RD H949Y G970R CL4CL3CL2CL1 NBD1 G551D G551S H620Q D648V A800G Figure 3 The HCO3:Cl-transport ratio of CFTR mutants associated with CF. Login to comment

PMID: 11574497 [PubMed] Josserand RN et al: "Cystic fibrosis phenotype evaluation and paternity outcome in 50 males with congenital bilateral absence of vas deferens."

No. Sentence Comment

30 Leukocytes samples were analysed for a series of 22 CF mutations including the five most frequently encountered in our region (The CF Genotype Consortium, 1994): ∆F508, G542X, N1303K, 1717-G-A, 885E; and 17 others: R117H, R334W, R347H, R347P, 556delA, S549N, S549I, S549R, G551D, R553X, R560T, G1244E, S1255X, W1282X, R1283K, 3898ins C, D1270N. Login to comment

PMID: 11668613 [PubMed] Wong LJ et al: "Improved detection of CFTR mutations in Southern California Hispanic CF patients."

No. Sentence Comment

86 In addition, rare mutations including1949del84, Q98R, R75X, and G1244E, were also detected. Login to comment
117 Summary of Mutations Found in This Group of Hispanic Patients Exon or Number of Mutation intron chromosomes Frequency % Mutations detected before full gene analysis 91 73.38% 1 F508 10 64 51.6 2 G542X 11 5 4 3 3849+10kb C>T Intron 19 5 4 4 S549N 11 3 2.4 5 I148T 4 2 1.6 6 3120+1G>A 16 2 1.6 7 R334W 7 2 1.6 8 G551D 11 1 0.8 9 N1303K 21 1 0.8 10 W1282X 20 1 0.8 11 R1162X 19 1 0.8 12 G85E 3 1 0.8 13 W1089X 17b 1 0.8 14 Y1092X 17b 1 0.8 15 P205S 6a 1 0.8 Mutations detected by full gene screening 26 20.97% 16 R1066Ca 17b 2 1.6 17 1949del84 13 1 0.8 18 2184delA 13 1 0.8 19 Q98R 4 1 0.8 20 R75X 3 1 0.8 21 G1244E 20 1 0.8 22 3876delA 20 7 5.65 23 935delA 6b 2 1.6 24 406-1G>A Intron 2 2 1.6 25 3271delGG 17a 1 0.8 26 2105-2117del13insAGAAA 13 1 0.8 27 663delT 5 1 0.8 28 3171delC 17a 1 0.8 29 2108delA 13 1 0.8 30 Q179K 5 1 0.8 31 3199del6 17a 1 0.8 32 3500-2 A->T Intron 17b 1 0.8 Total identified 117 (177)b 94.35 (97.5)b Unidentified 7 (3)b 5.65 (2.5)b Total 124 (120)b 100 (100)b a This mutation was also detected by SSCP. Login to comment

PMID: 11788089 [PubMed] Bombieri C et al: "Cystic fibrosis mutation testing in Italy."

No. Sentence Comment

44 CF GENE MUTATIONS IN ITALY Number of alleles Frequency Cumulative Mutation screened (%) frequency (%) DF508 3442 51.07 51.07 N1303K 3056 4.84 55.91 G542X 3082 4.83 60.75 2183 AA ® G 2596 2.66 63.41 R1162X 2580 2.42 65.83 1717-1 G ® A 2892 2.11 67.94 W1282X 2600 1.23 69.17 R553X 2882 1.15 70.31 T338I 2306 0.69 71.01 R347P 2642 0.61 71.61 711 1 5 G ® A 2454 0.57 72.18 G85E 1980 0.40 72.59 621 1 1 G ® T 2594 0.39 72.97 R334W 2366 0.30 73.27 R352Q 2112 0.24 73.50 S549N 2118 0.24 73.74 R347H 2184 0.18 73.92 L1077P 1840 0.16 74.09 R1158X 1878 0.16 74.25 541del C 1884 0.16 74.40 R1066H 1918 0.16 74.56 E585X 1922 0.16 74.72 Q552X 2172 0.14 74.86 D1152H 1824 0.11 74.97 2790-2 A ® G 1862 0.11 75.07 3132 del TG 1862 0.11 75.18 3667ins 4 1876 0.11 75.29 DI507 1914 0.10 75.39 1898 1 3 A ® G 1920 0.10 75.50 G1244E 1960 0.10 75.60 1784 del G 2052 0.10 75.69 From Rendine et al. (1997). Login to comment

PMID: 12001283 [PubMed] Schaedel C et al: "Predictors of deterioration of lung function in cystic fibrosis."

No. Sentence Comment

121 TABLE 3CFTR Mutations Associated With Pancreatic Sufficiency in Swedish CF Population Y109C S549I/S549I Y109N S945L R117C N1088D À R75Q R117H G1244E L206W 711 þ 3A !G T338I 1249 À 5A !G A455E 2789 þ 5G ! Login to comment

PMID: 12007216 [PubMed] Bobadilla JL et al: "Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening."

No. Sentence Comment

109 Mutational Arrays, Detection Rates and Methods by Region* Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference Europe Albania ∆F508 (72.4%) C276X (0.7%) 74.5 55.5 4 270/146 CFGAC [1994]; Macek et al. G85E (0.7%) R1070Q (0.7%) [2002] Austria ∆F508 (62.9%) 457TAT→G (1.2%) 76.6 58.7 11 1516/580 Estiville et al. [1997]; Dörk et al. (total) G542X (3.3%) 2183AA→G (0.7%) [2000]; Macek et al. [2002] CFTRdele2,3 (2.1%) N1303K (0.6%) R1162X (1.9%) I148T (0.5%) R553X (1.7%) R117H (0.5%) G551D (1.2%) Austria ∆F508 (74.6%) 2183AA→G (2.4%) 95.3 90.8 8 126 Stuhrmann et al. [1997] (tyrol) R1162X (8.7%) G551D (1.6%) G542X (2.4%) R347P (1.6%) 2789+5G→A (2.4%) Q39X (1.6%) Belarus ∆F508 (61.2%) R553X (0.5%) 75.2 56.6 9 278/188 Dörk et al. [2000]; Macek et al. G542X (4.5%) R334W (0.5%) [2002] CFTRdele2,3 (3.3%) R347P (0.5%) N1303K (3.2%) S549N (0.5%) W1282X (1.0%) Belgium ∆F508 (75.1%) 622-1A→C (0.5%) 100.0 100.0 27 1504/522 Cuppens et al. [1993]; Mercier et G542X (3.5%) G458V (0.5%) al. [1993]; CFGAC [1994]; N1303K (2.7%) 1898+G→C (0.5%) Estivill et al.[1997] R553X (1.7%) G970R (0.5%) 1717-1G→A (1.6%) 4218insT (0.5%) E60X (1.6%) 394delTT (0.5%) W1282X (1.4%) K830X (0.5%) 2183A→G+2184delA (1.2%) E822K (0.5%) W401X (1.0%) 3272-1G→A (0.5%) A455E (1.0%) S1161R (0.5%) 3272-26A→G (1.0%) R1162X (0.5%) S1251N (1.0%) 3750delAG (0.5%) S1235R (0.8%) S1255P (0.5%) ∆I507 (0.6%) Bulgaria ∆F508 (63.6%) R75Q (1.0%) 93.0 86.5 21 948/432 Angelicheva et al. [1997]; (total) N1303K (5.6%) 2183AA→G (0.9%) Estivill et al. [1997]; Macek G542X (3.9%) G1244V+S912L (0.9%) et al. [2002] R347P (2.2%) G85E (0.9%) 1677delTA (2.1%) 2184insA (0.9%) R1070Q (1.8%) L88X+G1069R (0.8%) Q220X (1.2%) 2789+5G→A (0.8%) 3849+10KbC→T (1.1%) G1244E (0.8%) W1282X (1.0%) 1717-1G→A (0.8%) 2176insC (1.0%) Y919C (0.7%) G1069R (1.0%) WORLDWIDEANALYSISOFCFTRMUTATIONS581 Bulgaria 1) DF508 4) 1677delTA - - 6 13 Angelicheva et al. [1997] (ethnic 2) R347P 5) Q493R Turks) 3) G542X 6) L571S - - 1 30 Angelicheva et al. [1997] Bulgaria 1) DF508 (100.0%) (Gypsy) Croatia ∆F508 (64.5%) G551D (1.1%) 72.5 52.6 5 276 Macek et al. [2002] G542X (3.3%) 3849+10KbC→T (0.7%) N1303K (2.9%) Czech ∆F508 (70.0%) 1898+1G→T (2.0%) 89.6 80.3 10 2196/628 CFGAC [1994]; Estiville et al. Republic CFTRdele2,3 (5.5%) 2143delT (1.2%) [1997]; Dörk et al. [2000]; G551D (3.8%) R347P (0.8%) Macek et al. [2002] N1303K (2.9%) 3849+10KbC→T (0.6%) G542X (2.2%) W1282X (0.6%) Denmark ∆F508 (87.5%) G542X (0.7%) 92.3 85.2 6 1888/678 CFGAC [1994]; Schwartz et al. (excluding 394delTT (1.8%) 621+1G→T (0.6%) [1994]; Estiville et al. [1997] Faroe) N1303K (1.1%) 3659delC (0.6%) Estonia ∆F508 (51.7%) R117C (1.7%) 80.2 64.3 10 165/80 Estivill et al. [1997]; Klaassen et 394delTT (13.3%) E217G (1.7%) al. [1998]; Macek et al. S1235R (3.3%) R1066H (1.7%) [2002] 359insT (1.7%) 3659delC (1.7%) I1005R (1.7%) S1169X (1.7%) Finland ∆F508 (46.2%) G542X (1.9%) 78.8 62.1 4 132/52 CFGAC [1994]; Kere et al. 394delTT (28.8%) 3372delA (1.9%) [1994]; Estivill et al. [1997] France ∆F508 (67.7%) 2789+5G→T (0.79%) 79.7 63.6 12 17854/7420 Chevalier-Porst et al. [1994]; (total) G542X (2.94%) 2184delA+2183A→G (0.77%) Estivill et al. [1997]; Claustres et al. [2000]; Guilloud-Bataille N1303K (1.83%) G551D (0.74%) et al. [2000] 1717-1G→A (1.35%) 1078delT (0.63%) W1282X (0.91%) ∆I507 (0.62%) R553X (0.86%) Y122K (0.59%) France ∆F508 (75.8%) R297Q (0.8%) 98.7 97.4 18 599/365 Férec et al. [1992]; Scotet et al. (Brittany) 1078delT (4.0%) R347H (0.8%) [2000] G551D (3.6%) I1234V (0.8%) N1303K (3.0%) R553X (0.8%) R117H (1.7%) 2789+5G→A (0.8%) 3272-26A→G (1.3%) 4005+1G→A (0.7%) G542X (1.1%) 621+1G→T (0.6%) 1717-1G→A (1.0%) ∆I507 (0.6%) G1249R (0.8%) W846X (0.5%) France ∆F508 (70.0%) N1303K (0.8%) 90.4 81.7 16 250 Claustres et al. [1993] (southern) G542X (6.4%) 3737delA (0.8%) 1717-1G→A (1.6%) R1162X (0.8%) L206W (1.2%) Y1092X (0.8%) R334W (1.2%) S945L (0.8%) ∆I507 (1.2%) K710X (0.8%) 2184delA (1.2%) 1078delT (0.8%) R1158X (1.2%) Y122X (0.8%) (Continued) BOBADILLAETAL. Login to comment
110 Germany ∆F508 (71.8%) 1789+5G→A (0.9%) 87.6 76.7 17 5662/1316 Dörk et al. [1992]; Dörk et al. R553X (2.0%) 3272-26A→G (0.9%) [1994]; Tümmler et al. [1996]; N1303K (1.8%) W1282X (0.7%) Estivill et al. [1997]; Dörk et G542X (1.2%) 2143delT (0.7%) al. [2000] R347P (1.2%) 1078delT (0.6%) CFTRdele2,3 (1.2%) 2183AA→G (0.6%) 3849+10KbC→T (1.0%) 2184insA (0.6%) G551D (0.9% 3659delC (0.6%) 1717-1G→A (0.9%) Greece ∆F508 (52.9%) 3272-26A→G (0.8%) 82.2 67.6 22 2097/718 Kanavakis et al. [1995]; Estivill 621+1G→T (5.0%) R1070Q (0.8%) et al. [1997]; Tzetis et al. G542X (4.1%) W496X (0.7%) [1997]; Macek et al. [2002] N1303K (3.3%) 621+3A→G (0.7%) 2183AA→G (1.8%) ∆I507 (0.7%) 2789+5G→A (1.7%) W1282X (0.7%) E822X (1.6%) 574delA (0.7%) R117H (1.2%) 1677delTA (0.7%) R334W (1.1%) A46D (0.6%) R1158X (1.0%) 3120+1G→A (0.6%) G85E (1.0%) G551D (0.5%) Hungary ∆F508 (54.9%) W1282X (1.8%) 68.3 46.6 9 1133/976 CFGAC [1994]; Estivill et al. 1717-1G→A (1.9%) G542X (1.7%) [1997]; Macek et al. [2002] R553X (2.1%) N1303K (1.3%) Y1092X (1.8%) G551D (1.0%) S1196X (1.8%) Ireland ∆F508 (70.4%) G542X (1.0%) 82.1 67.4 7 801/509 CFGAC [1994]; Estivill et al. G551D (5.7%) 621+1G→T (0.8%) [1994] R117H (2.4%) 1717-1G→A (0.6%) R560T (1.2%) Italy ∆F508 (50.9%) ∆I507 (0.65%) 60.3 36.4 9 3524 Estivill et al. [1997] (total) G542X (3.1%) W1282X (0.62%) 1717-1G→A (1.6%) Y122K (0.59%) N1303K (1.4%) G551D (0.53%) R553X (0.94%) Italy ∆F508 (47.6%) R553X (1.3%) 87.1 75.9 15 225 Bonizzato et al. [1995] (Northeast) R1162X (9.8%) 2789+G→A (1.3%) 2183AA→G (9.3%) Q552X (1.3%) N1303K (4.0%) 621+1G→T (0.9%) G542X (2.7%) W1282X (0.9%) 711+5G→A (2.7%) 3132delTG (0.9%) 1717-1G→A (2.2%) 2790-2A→G (0.9%) G85E (1.3%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS583 Italy ∆F508 (56.4%) 711+1G→T (1.3%) 85.7 73.4 13 660/396 Castaldo et al. [1996]; Castaldo (southern) N1303K (6.8%) G1244E (1.3%) et al. [1999] G542X (5.7%) R1185X (1.3%) W1282X (3.8%) L1065P (1.3%) 1717-1G→A (2.3%) R553X (1.1%) 2183AA→G (1.9%) I148T (0.7%) 4016insT (1.8%) Latvia 1) DF508 (58.3%) 4) CFTRdele2,3 (2.8%) - - 6 36 Dörk et al. [2000]; Macek et al. 2) 3849+10KbC®T (8.3%) 5) W1282X (2.8%) [2002] 3) N1303K (5.6%) 6) 394delTT (2.8%) Lithuania ∆F508 (31.0%) N1303K (2.0%) 39.0 15.2 4 94 Dörk et al. [2000]; Macek et al. R553X (4.0%) CFTRdele2,3 (2.0%) [2002] Macedonia ∆F508 (54.3%) 711+3A→G (1.0%) 69.2 47.9 12 559/226 Petreska et al. [1998]; Dörk et G542X (4.2%) 3849G→A (1.0%) al. [2000]; Macek et al. N1303K (2.0%) 2184insA (0.9%) [2002] CFTRdele2,3 (1.3%) 457TAT→G (0.7%) 621+1G→T (1.3%) V139E (0.7%) 611-1G→T (1.2%) 1811+1G→C (0.6%) Netherlands ∆F508 (74.2%) R1162X (0.9%) 86.8 75.3 9 3167/1442 Gan et al. [1995]; Estiville et al. A455E (4.7%) S1251N (0.9%) [1997]; Collee et al. [1998] G542X (1.8%) N1303K (0.9%) 1717-1G→A (1.5%) W1282X (0.7%) R553X (1.2%) Norway ∆F508 (60.2%) G551D (1.2%) 69.8 48.7 6 410/242 Schwartz et al. [1994]; Estivill 394delTT (4.2%) G542X (0.6%) et al. [1997] R117H (3.0%) N1303K (0.6%) Poland ∆F508 (57.1%) CFTRdele2,3 (1.8%) 73.5 54.0 11 4046/1726 CFGAC [1994]; Estivill et al. 3849+10Kb C→T (2.7%) R560T (1.5%) [1997]; Dörk et al [2000]; G542X (2.6%) W1282X (0.7%) Macek et al. [2002] 1717-1G→A (2.4%) ∆I507 (0.5%) R553X (1.9%) G551D (0.5%) N1303K (1.8%) Portugal ∆F508 (44.7%) R334W (0.7%) 49.7 24.7 5 739/454 CFGAC [1994]; Estivill et al. G542X (1.6%) N1303K (0.7%) [1997] R1066C (2.0%) Romania ∆F508 (36.6%) G542X (1.4%) 51.5 26.5 11 224/74 CFGAC [1994]; Estivill et al. 2043delG (2.0%) R553X (1.4%) [1997]; Popa et al. [1997]; W1282X (1.7%) G576X (1.4%) Macek et al. [2002] 1717-2A→G (1.4%) 1898+1G→A (1.4%) I148T (1.4%) 2183AA→G (1.4%) 621+1G→T (1.4%) Russia ∆F508 (54.4%) 552insA (0.9%) 70.7 50.0 12 5073/2562 CFGAC [1994]; Estivill et al. CFTRdele2,3 (5.0%) G542X (0.9%) [1997]; Dörk et al. [2000]; R553X (3.5%) R334W (0.9%) Macek et al. [2002] 2183AA→G (1.3%) 1677delTA (0.8%) W1282X (1.0%) Y122X (0.5%) 394delTT (1.0%) 1367del5 (0.5%) (Continued) BOBADILLAETAL. Login to comment

PMID: 12151438 [PubMed] Wang Z et al: "Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens."

No. Sentence Comment

20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

PMID: 12544470 [PubMed] Strom CM et al: "Extensive sequencing of the cystic fibrosis transmembrane regulator gene: assay validation and unexpected benefits of developing a comprehensive test."

No. Sentence Comment

90 Table 4 Results of sequencing of patient samples Description Prior genotype Sequencing CommentAllele 1 Allele 2 Confirmed CF wt/delta F508 delta F508 P205S Known mutation Confirmed CF wt/3849 ϩ 10 kb 3849 ϩ 10 kb L1077P Known mutation C 3 T C 3 T Confirmed CF wt/delta F508 delta F508 R1066C Known mutation Confirmed CF wt/delta F508 delta F508 D806G Novel missense Confirmed CF wt/wt 3154delG 3154delG Both parents confirmed carriers Confirmed CF delta F508/wt delta F508 G1244E Known mutation Confirmed CF wt/wt wt F191L Novel missense Borderline sweat test wt/wt wt wt Table 5 Resolution of ambiguities on linear array assay using sequencing Linear array result Resolution Weak mutant A455E line 1508 C 3 T (S459F) polymorphism or novel mutation Weak mutant A455E line 1508 C 3 T (S459F) polymorphism or novel mutation Weak mutant A455E line wt/1496 C 3 T (A455V) polymorphism or novel mutation Weak mutant A455E line wt/1496 C 3 T (A455V) polymorphism or novel mutation Weak mutant A455E line wt/1520 G 3 A (G463D) polymorphism or novel mutation No A455E mutant or wt line Homozygous 1499 T 3 C (V456A) polymorphism or novel mutation No A455E mutant or wt line Homozygous 1497 C 3 A polymorphism (no amino acid change) Weak wt 1898 ϩ 1 G 3 A line wt/E587A novel missense mutation or polymorphism Weak 1898 ϩ 1 G 3 A line wt/1898 ϩ 1 G 3 C-different mutation; G 3 C NOT G 3 A DISCUSSION The ACMG recommended panel of CF mutations has rapidly become the standard of care for US carrier screening. Login to comment

PMID: 12680831 [PubMed] Cimmino M et al: "Clinical characteristics and genotype analysis of patients with cystic fibrosis and nasal polyposis."

No. Sentence Comment

47 Analysis of mutations in the CFTR gene as tested by the multiplex polymerase chain reaction (PCR), followed by the reverse dot-blot technique, which searches for 29 of the most frequent mutations (DF508, N1303K, G542X, W1282X, 1717±1 G-A, R553X, 2183 AA-G, DI507, G551D, R560T, 3849 10kbC > T, R1162X, 3659delC, 3905insT, G85E, 621 1GT, R117H, R347P, R334W, A455E, 2789 5GA, Q552X, S1251N, 3905insT, 394delTT, E60X, 2143delT, 2184delA, 711 5G > A), and by ASO dot-blot for the following mutations: I148T, R1158X, 4016 1T, G1244E G >A.26 Statistical analysis was performed using multivariate analysis, by forward stepwise comparison; it was done to ®nd out which of the examined characteristics could be associated (P < 0.01) to nasal polyposis. Login to comment

PMID: 15614862 [PubMed] D'Apice MR et al: "Segregation analysis in cystic fibrosis at-risk family demonstrates that the M348K CFTR mutation is a rare innocuous polymorphism."

No. Sentence Comment

6 Results The CFTR gene from the healthy father has two mutations, M348K and G1244E. Login to comment
7 The affected son inherited only the G1244E paternal mutation from his father, and hence the two paternal mutations are trans and do not occur in the same CFTR gene. Login to comment
28 Received: 30 April 2004 Revised: 7 October 2004 Accepted: 10 October 2004 M. R. D`APICE ET AL. 1 1 1 1 3 4 1 2 1 1 4 1 1 2 1 1 4 1 1 2 1 1 2 1I:1 II:1 II:2 I:2 G1244E M348K G1244E N1303K N1303K G1244E N1303K IVS8GT IVS17bCA IVS17bTA IVS8GT IVS17bCA IVS17bTA IVS8GT IVS17bCA IVS17bTA IVS8GT IVS17bCA IVS17bTA Figure 1-The reported family pedigree. Login to comment
29 The proband (II:1) and the fetus (II:2) have each inherited G1244E and N1303K. Login to comment
30 Their asymptomatic father (I:1) shows the G1244E CF mutation and the M348K polymorphism; their mother (I:2) shows the N1303K mutation. Login to comment
36 Abnormal DHPLC patterns were observed for exons 7 and 20 (Figure 1), caused by nucleotide changes (T to A at position 1175, missense mutation M348K; G to A in position 3863, missense mutation G1244E). Login to comment
38 Direct analysis of exons 7 and 20 showed that the patient received only the G1244E paternal mutation and the N1303K maternal mutation giving a genotype N1303K/G1244E. Login to comment
39 Analysis using three intragenic microsatellites (IVS8GT, IVS17bTA, IVS17bCA) confirmed that the affected proband inherited the paternal chromosome carrying the G1244E mutation and N1303K from his mother. Login to comment
42 G1244E is a missense mutation in exon 20, peculiar to patients from southern Italy (Castaldo et al., 1999). Login to comment
43 DISCUSSION The mutation G1244E is known to be found in Italian CF patients and causes moderate to severe disease (Castaldo et al., 1999). Login to comment
44 Since the father has no symptoms of CF, and has the genotype M348/G1244E, M348K must be a rare polymorphism in the CFTR gene that is not disease-associated, at least in association with G1244E. Login to comment
51 The fetus (II-2, Figure 1) was compound heterozygous for the N1303K/G1244E mutations and haploidentical to the affected proband. Login to comment

PMID: 15638824 [PubMed] Castaldo G et al: "Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population."

No. Sentence Comment

2 Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711+1G>T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Login to comment
33 The 13 mutations in this panel are: F508del, N1303K, G542X, W1282X, 2183AA>G, 1717-1G>A, R553X, I148T, R1158X, 711+1G>T, 4016insT, L1065P and G1244E. Login to comment
49 In particular, 4016insT, R1158X, 711+1 G>T and L1065P had a cumulative frequency of 6.3% in CF chromosomes from Campania; G1244E and 852del22 a cumulative frequency of 9.6% in CF chromosomes from Basilicata; and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D a cumulative frequency of 19.6% in CF chromosomes from Puglia. Login to comment
62 A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n. Login to comment
86 However, 12 mutations (4016insT, R1158X, 711+1G>T, L1065P, G1244E, 4382delA, 1259insA, I502T, 852del22, D579G, L1077P and G1349D) have not been found (or have a low incidence) in populations from the British Isles (Cheadle et al. 1993; Ferec et al. 1992), Spain (Chillon et al. 1994; Casals et al. Login to comment
97 Due to the presence of 'local` mutations, the detection rate with commercial kits for CF chromosomes in Table 3 Mutations linked to different haplotypes possibly due to slippage events, characteryzed at the level of three CFTR intragenic loci (IVS8CA, IVS17bTA, IVS17bCA) by the indication of the repeats number Present study Other studies Cases Haplotype cases (n) (n. of repeats) (n) Haplotype references* (n. of repeats) R347P 4/4 16-32-13 3 16-32-13 1,2,3 1 16-31-13 3 2 17-28-13 1 1 16-45-13 1 L1077P 3/3 17-7-17 1 17-7-17 1 1 17-7-16 1 G85E 2/2 16-24-13 9 16-24-13 2,3 1 16-25-13 2 2183AA>G 14/14 16-31-13 1 16-31-13 3 4 16-30-13 1 R553X 6/11 17-55-13 3 17-58-13 3 3/11 18-55-13 1 17-57-11 1 1/11 16-55-13 2 17-55-13 1,3 1/11 16-55-11 6 17-55-11 1 1 17-52-11 1 1 17-54-11 1 1 17-56-13 3 G1244E 5/6 16-32-13 1 17-34-13 1 1/6 16-34-13 711 +1 G>T 5/5 16-25-13 7 16-25-13 1,2,3 1 16-26-13 1 G1349D 5/6 16-30-13 1/6 16-32-13 G178R 1/2 16-32-13 1 16-30-13 3 1/2 16-32-13 2 16-32-13 1 * References 1: Morral et al. 1996. Login to comment

PMID: 15738290 [PubMed] Dugueperoux I et al: "The CFTR 3849+10kbC->T and 2789+5G->A alleles are associated with a mild CF phenotype."

No. Sentence Comment

51 Two genotypes accounted for almost 80% of the patients, 3849+10kbC-.T/DF508 (n527, 69.2%) and 3849+10kbC-.T/ G542X (n54, 10.3%), and two siblings shared the G1244E allele (5.2%). Login to comment
63 Although only borderline significant, lung function was definitely better in the 3849+10kbC-.T/DF508 group (FEV1 83.0% and FVC 91.6% pred) than in the DF508 homozygote group (FEV1 59.9% TABLE 1 Genotypes identified among cystic fibrosis patients sharing the 3849+10kbC-.T or the 2789+5G-.A mutation Genotypes 3849+10kbC-.T 2789+5G-.A DI507 2 DF508 27 61 1525-1G-.A 1 1717-1G.A 1 2183AA.G 3 3129del4 1 3659delC 1 G542X 4 6 G551D 1 G970R 2 G1244E 2 L558S 1 M1V 1 N1303K 1 R347P 1 R553X 1 1 R1066C 1 S1251N 1 Unknown 1 6 Total 39 88 I. DUGUE´PE´ROUX AND M. DE BRAEKELEER MILD PHENOTYPE ASSOCIATED WITH TWO CFTR MUTATIONS c and FVC 76.9% pred). Login to comment

PMID: 15948195 [PubMed] Quint A et al: "Mutation spectrum in Jewish cystic fibrosis patients in Israel: implication to carrier screening."

No. Sentence Comment

42 The L997F and G1244E mutations were identified following SSCP analysis, each on a single chromosome, and three alleles (9%) remain unidentified. The mutation L997F was described in patients with atypical CF [Castellani et al., 2001a,b] and patients with congenital absence of vas deferens [Dork et al., 1997] and it is debatable as to whether this is a CF-causing mutation or just a sequence variant. Login to comment
58 Mutations in the CF Bearing Alleles in the Jewish Patients According to the Ethnic Origin Country of origin Ashkenazi Morocco Tunisia Balkan Iraq Iran/ Kurdistan Georgia Yemen Total Number of alleles (%) 193 (69.0) 34 (12.1) 12 (4.3) 21 (7.5) 8 (2.8) 3 (0.7) 8 (2.8) 2 (0.7) 281 W1282X (%) 83 (42.8) 1 (8.3) 4 (19.0) 88 (31.3) DF508 (%) 65 (33.5) 24 (70.6) 3 (25.0) 7 (33.3) 1 100 (35.6) N1303K (%) 10 (5.2) 10 (3.6) G542X (%) 19 (10.3) 4 (19.0) 24 (8.5) 3849-10 kbC!T (%) 10 (5.1) 1 (2.9) 2 (9.5) 13 (4.6) 1717-1G!A (%) 2 (1.0) 2 (0.7) D1152H (%) 1 (0.5) 1 (0.4) S549R (T!G) (%) 4 (11.8) 4 (1.4) G85E (%) 2 (9.5) 2 (0.7) 405 þ 1G!A (%) 8 (66.7) 8 (2.8) Y1092X (%) 3 (37.5) 3 (1.1) W1089X (%) 2 (9.5) 2 (0.7) Q359K/T360K (%) 8 (100) 8 (2.8) I1234V (%) 2 (100) 2 (0.7) 2751 þ 1insT (%) 2 (25.0) 2 (0.7) 3121-1G > A (%) 1 1 (0.4) M952I (%) 1 (12.5) 1 (0.4) L165S (%) 1 (0.5) 1 (0.4) A455E (%) 1 (0.5) 1 (0.4) L997F (%) 1 (2.9) 1 (0.4) G1244E (%) 1 (2.9) 1 (0.4) Unkown (%) 1 (0.5) 3 (8.8) 2 (25.0) 1 7 (2.5) Mutation Spectrum in Jewish CF Patients [Wahab, 2003]. Login to comment

PMID: 16126774 [PubMed] Morea A et al: "Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility."

No. Sentence Comment

47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T. Login to comment

PMID: 18178635 [PubMed] Stanke F et al: "Diversity of the basic defect of homozygous CFTR mutation genotypes in humans."

No. Sentence Comment

89 Several well characterised severe mutations occur in the evolutionarily conserved Walker (G1244E, G1249E) or dodecapeptide motifs (G551D, G1349D) of the ABC transporter CFTR.1 The missense mutants G622D23 in the regulatory domain and G314E in the fifth transmembrane region led to no clinical symptoms of CF. Login to comment

PMID: 19318346 [PubMed] Goubau C et al: "Phenotypic characterisation of patients with intermediate sweat chloride values: towards validation of the European diagnostic algorithm for cystic fibrosis."

No. Sentence Comment

60 Table 2 CFTR mutations in the patient subgroups CF-PS CFTR dysfunction CF unlikely Genotype Subjects (n) Genotype Subjects (n) Genotype Subjects (n) F508del*/Not found 12 F508del*/3849+10 kb(C.T){ 11 Not found/Not found 39 Not found/Not found 10 F508del*/R117H{ 7 F508del*/Not found 4 F508del*/3849+10 kb(C.T){ 7 F508del*/Not found 7 IVS8-5T{/Not found 1 F508del*/R347P{ 5 Not found/Not found 5 S1235E/E528E 1 F508del*/R117H{ 4 F508del*/D1152H{ 4 No mutation analysis 1 F508del*/2789+5G.A{ 4 F508del*/IVS8-5T{ 4 Total 46 F508del*/S945L* 3 F508del*/S945L* 2 2789+5G.A{/Not found 3 W1282X*/IVS8-5T{ 2 F508del*/3272-26 A.G{ 2 F508del*/R1070W{ 1 F508del*/A455E{ 2 F508del*/L159S 1 F508del*/711+5G.A 2 F508del*/T1246I 1 F508del*/2789+5G.A 2 F508del*/L165S 1 G542X*/R334W{ 2 W1282X*/D1152H{ 1 F508del*/R334W{ 2 R1162X*/D1152H{ 1 R347P{/Not found 2 R347Hu/D1152H{ 1 F508del*/2116delCTAA 1 R553X*/R117H{ 1 F508del*/IVS8-5T{ 1 3659delC*/R117H{ 1 F508del*/D1152H{ 1 3849+10kb(C.T){/G551R 1 F508del*/711+3A.G 1 R1162X*/3849+10 kb(C.T){ 1 F508del*/L206W{ 1 2789+5G.A{/Not found 1 F508del*/I336K{ 1 G542X*/T854A 1 F508del*/G970D 1 R553X*/Q1463H 1 F508del*/L159S 1 S1235R/R668C 1 F508del*/R751L 1 2789+5G.A{/S977F 1 F508del*/E656X 1 No mutation analysis 1 F508del*/4015delA 1 Total 59 F508del*/Y913S 1 F508del*/L165S 1 F508del*/2143delT 1 G551D*/I336K{ 1 G551D*/3272-26A.G{ 1 G551D*/711+3A.G 1 R553X*/4005+2T.C 1 R553X*/E92K{ 1 G542X*/L206W{ 1 W1282X*/I336K 1 R1162X*/3849+10 kb(C.T){ 1 R1162X*/2789+5G.A{ 1 574delA*/3141del9 1 9890X/I105N 1 R334W{/R1070Q{ 1 3272-26A.G{/4218insT 1 3272-26A.G{/L165S 1 711+3A.G/G1244E 1 R352Q/1812-1G.A 1 F1052V/IVS8-5T{ 1 R74W/D1270N 1 1898-3G.A/1898-3G.A 1 1717-1G.A*/R334W{ 1 3659delC*/Not found 1 394delTT/Not found 1 R1162X*/Not found 1 R553X*/Not found 1 R117H{/Not found 1 G85E*/Not found 1 3849+10k(C.T){/Not found 1 Total 103 *Mutation class I, II or III. Login to comment

PMID: 19897426 [PubMed] Picci L et al: "A 10-year large-scale cystic fibrosis carrier screening in the Italian population."

No. Sentence Comment

48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT. Login to comment

PMID: 20657600 [PubMed] Giuliani R et al: "Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols."

No. Sentence Comment

58 INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator. Login to comment

PMID: 20932301 [PubMed] Green DM et al: "Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients."

No. Sentence Comment

74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

PMID: 21429822 [PubMed] Coiana A et al: "Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program."

No. Sentence Comment

88 Mutation nomenclaturea Alleles (%) T338I (p.Thr338Ile) 26 (65.0) F508del (p.Phe508del) 9 (22.5) N1303K (p.Asn1303Lys) 1 (2.5) 2183AANG (c.2051_2052delAAinsG) 1 (2.5) 621+1GNT (c.489+1GNT) 1 (2.5) exon 2 del (c.54-5811_164+2187del8108ins182) 1 (2.5) R347P (p.Arg347Pro) 1 (2.5) The 3849+10kbCNT (c.3717+12191CNT), G85E (p.Gly85Glu), 2789+5GNA (c.2657+5GNA), W1282X (p.Trp1282X), G1244E (p.Gly1244Glu), 711+5GNA (c.579+5GNA), 711+1GNT (c.579+1GNA), 4016insT (p.Ser1297PhefsX5), G542X (p.Gly542X), 1717-1GNA (c.1585-1GNA), R553X (p.Arg553X), Q552X (p.Gln552X), G551D (p.Gly551Asp), S549R (ANC) (p.Ser549Arg), I507del (p.Ile507del), F508C (p.Phe508Cys), I502T (p.Ile502Thr), 1706del17 (p.Gln525LeufsX37), 1677delTA (p.Tyr515X), R117H (p.Arg117His), D1152H (p.Asp1152His), L1065P (p.Leu1065Pro), R1066H (p.Arg1066His), L1077P (p.Leu1077Pro), 4382delA (p.Glu1418ArgfsX14), R1162X (p.Arg1162X), R1158X (p.Arg1158X), 1259 insA (p.Gln378AlafsX4), 852del22 (p.Gly241GlufsX13), S912X (p.Ser912X), and 991del5bp (p.Asn287LysfsX19) mutations included in the CF panel were not detected in the population tested. Login to comment

PMID: 15300780 [PubMed] Wong LJ et al: "Detection of CFTR mutations using temporal temperature gradient gel electrophoresis."

No. Sentence Comment

133 Identification of rare and novel mutations and polymorphisms Base substitution Mutation Exon or intron Homozygote or heterozygote Polymorphism or mutation # Alleles identified 1 c.124_146del23bp Frameshift 1 Heterozygote Mutation 1 2 c.296+2T>A Splice Int 2 Heterozygote Mutation 1 3 c.296+28A/G Int 2 Homozygote Polymorphism 2 4 c.355CT p.R75X 3 Heterozygote Mutation 2 5 c.360_365insT Frameshift 3 Heterozygote Mutation 1 6 c.379_381insT Frameshift 3 Heterozygote Mutation 1 7 c.406-1G>A Splice Int 4 Heterozygote Mutation 2 8 c.424C.T p.Q98X 4 Heterozygote Mutation 1 9 c.425A.G p.Q98R 4 Heterozygote Mutation 3 10 c.586A.G p.M152V 4 Homozygote Mutation 2 11 c.663delT Frameshift 5 Heterozygote Mutation 3 12 c.667C>A p.Q179K 5 Heterozygote Mutation, 1 13 c.745C.T p.P205S 6a Heterozygote Mutation 5 14 c.875140A/G 6a Heterozygote Polymorphism 11 15 c.935delA Frameshift 6b Heterozygote Mutation 2 16 c.124811G.A Splice Int 7 Heterozygote Mutation 2 17 c.1285ins TA Frameshift 8 Heterozygote Mutation 4 Homozygote Mutation 2 18 c.1342+196C/T Int 8 Heterozygote Polymorphism 4 Homozygote 2 19 c.1461insAGAT Frameshift 9 Heterozygote Mutation 1 20 c.1525-61A/G 10 Heterozygote Polymorphism 22 21 c.1529C.A/G p.S466X 10 Heterozygote Mutation 1 22 c.1607C.T p.S492F 10 Heterozygote Mutation 3 23 c.1814C.T p.A561E 12 Heterozygote Mutation 1 24 c.189813A.G Splice Int 12 Heterozygote Mutation 1 25 c.18981152T/A Int 12 Heterozygote Polymorphism 5 26 c.1924del 7bp Frameshift 13 Heterozygote Mutation 1 27 c.1949del84 Frameshift 13 Heterozygote Mutation 1 28 c.2055del9toA Frameshift 13 Homozygote Mutation 2 29 c.2105_2117 Frameshift 13 Heterozygote Mutation 4 del13insAGAAA 30 c.2108delA Frameshift 13 Heterozygote Mutation 1 31 c.2184insA Frameshift 13 Heterozygote Mutation 2 32 c.2184delA Frameshift 13 Heterozygote Mutation 1 33 c.2289_2295 Frameshift 13 Heterozygote Mutation 1 del7insGT 34 c.2694T.G p.T854T 14a Heterozygote Polymorphism 10 35 c.2752+12G/C Int 14a Heterozygote Polymorphism 2 36 c.2800C.T p.Q890X 15 Homozygote Mutation 2 37 c.3171delC Frameshift 17a Heterozygote Mutation 1 38 c.3179T>C p.F1016S 17a Heterozygote Mutation 1 39 c.3199del 6bp Frameshift 17a Heterozygote Mutation 1 40 c.3212T.C p.I1027T 17a Heterozygote Mutation 1 41 c.3272-26A.G Splice Int17a Heterozygote Mutation 4 42 c.3271delGG Frameshift 17a Heterozygote Mutation 1 43 c.3313G.C p.G1061R 17b Heterozygote Mutation 1 44 c.3328C.T p.R1066C 17b Heterozygote Mutation 2 45 c.3362T.C p.L1077P 17b Heterozygote Mutation 1 46 c.3431A.C p.Q1100P 17b Heterozygote Mutation 1 47 c.3500-2A>T Splice Int 17b Heterozygote Mutation 1 48 c.3743G.A p.W1204X 19 Heterozygote Mutation 1 Homozygote Mutation 2 49 c.3601-65C/A Int 19 Heterozygote Polymorphism 14 50 c.3863G.A p.G1244E 20 Heterozygote Mutation 3 Table 3. Login to comment

PMID: 15744523 [PubMed] Clain J et al: "A neutral variant involved in a complex CFTR allele contributes to a severe cystic fibrosis phenotype."

No. Sentence Comment

94 At the same location, the severe CF-associated p.G1244E mutation (Devoto et al. 1991) exhibits a defect in the open state probability of the CFTR protein (Anderson and Welsh 1992). Login to comment

PMID: 17331079 [PubMed] Alonso MJ et al: "Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry."

No. Sentence Comment

52 Mutation 0.46-0.35 9 c.1078delT #, p.R347P # 8 p.G85V, c.621 + 1G > T #, p.S549R (T > G) #, p.R553X #, c.3849 + 10kbC > T # 7 p.R347H #, c.1812-1G > A, p.R709X 0.30-0.10 6 p.H199Y, p.P205S, 5 p.R117H #, p.G551D #, p.W1089X, p.Y1092X, CFTR50kbdel 4 c.296 + 3insT, c.1717-1G > A #, c.1949del84, c.3849 + 1G > A 3 p.E92K, c.936delTA, c.1717-8G > A, c.1341G > A, p.A561E, c.2603delT, p.G1244E, [p.D1270N; p.R74W] 2 p.Q2X, p.P5L, CFTRdele2,3, p.S50P, p.E60K, c.405 + 1G > A, c.1677delTA, p.L558S, p.G673X, p.R851X, p.Y1014C, p.Q1100P, p.M1101K, p.D1152H, CFTRdele19, p.G1244V, p.Q1281X, p.Y1381X <0,1 1 c.124del23bp, p.Q30X, p.W57X, c.406-1G > A, p.Q98R, p.E115del, c.519delT, p.L159S, c.711 + 3A > T, p.W202X, c.875 + 1G > A, p.E278del, p.W361R, c.1215delG, p.L365P, p.A399D, c.1548delG, p.K536X, p.R560G, c.1782delA, p.L571S, [p.G576A; p.R668C], p.T582R, p.E585X, c.1898 + 1G > A, c.1898 + 3A > G, c.2051delTT, p.E692X, p.R851L, c.2711delT, c.2751 + 3A > G, c.2752-26A > G, p.D924N, p.S945L, c.3121-1G > A, p.V1008D, p.L1065R, [p.R1070W; p.R668C], [p.F1074L; 5T], p.H1085R, p.R1158X, c.3659delC #, c.3667del4, c.3737delA, c.3860ins31, c.3905insT #, c.4005 + 1G > A, p.T1299I, p.E1308X, p.Q1313X, c.4095 + 2T > A, rearrangements study (n = 4) Mutations identified in CF families with mixed European origin: c.182delT, p.L1254X, c.4010del4. Login to comment

PMID: 22274833 [PubMed] Hentschel J et al: "Homozygous CFTR mutation M348K in a boy with respiratory symptoms and failure to thrive. Disease-causing mutation or benign alteration?"

No. Sentence Comment

27 Previously, a clinically affected individual was described carrying G1244E and N1303K [5]. Login to comment
28 The healthy father was found to be compound heterozygous for M348K and G1244E. Login to comment

PMID: 22300503 [PubMed] Barben J et al: "Retrospective analysis of stored dried blood spots from children with cystic fibrosis and matched controls to assess the performance of a proposed newborn screening protocol in Switzerland."

No. Sentence Comment

80 CFTR mutations Alleles found Percentage of total Homozygous (n) F508del a 86 68.2 30 3905insT a 4 3.2 1 G542X a 3 2.4 - R553X a 3 2.4 1 W1282X a 2 1.6 - 1717-1 GNA a 2 1.6 - N1303K a 0 0.0 - S549R 3 2.4 1 Q525X 3 2.4 - Y1092X 2 1.6 - 3120+1 GNA b 2 1.6 1 2347delG 2 1.6 - 2176insC 1 0.8 - 3659delC 1 0.8 - 3359delCTCTG 1 0.8 - W1089X 1 0.8 - 711+1 GNT 1 0.8 - D1152H 1 0.8 - G1244E 1 0.8 - R1066C 1 0.8 - R31C 1 0.8 - R347P 1 0.8 - R74W 1 0.8 - S945L 1 0.8 - T501I 1 0.8 - K68X 1 0.8 - Total 126 100.0% 34 a Seven most common CF-gene mutations in Switzerland ("Swiss panel")=79.4% (100/126) of alleles. Login to comment

PMID: 22293084 [PubMed] Yu H et al: "Ivacaftor potentiation of multiple CFTR channels with gating mutations."

No. Sentence Comment

4 These included the G551D, G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P and G1349D CFTR gating mutations. Login to comment
23 Other known CFTR gating mutations include G178R, G551S, G970R, G1244E, S1255P, and G1349D [9-11]. Login to comment
39 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11]. Login to comment
46 This analysis showed that, as expected for known CFTR gating mutations (G551D, G178R, G551S, G970R, G1244E, S1255P, and G1349D) [5,9-11], the amount of CFTR delivered to the cell surface was generally similar between CFTR with gating defects and normal CFTR. Login to comment
50 Ivacaftor increased the channel gating of mutant CFTR with defective channel gating The effect of ivacaftor on CFTR channel gating was monitored by quantifying the channel open probability by patch-clamp electrophysiology using membrane patches excised from FRT cells expressing the known CFTR gating mutations, G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, or G1349D-CFTR. Login to comment
52 Under these conditions, the baseline CFTR channel open probability of G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, and G1349D-CFTR was ≤5% of normal CFTR (Fig. 2, B; Table 1). Login to comment
53 For most mutant CFTR forms, the single channel current amplitude, a measure of channel conductance, was similar to normal CFTR (between 77% and 122% of normal CFTR), although a small but statistically significant difference in single channel current amplitude was observed for S1255P-CFTR (Table 1). Login to comment
58 Ivacaftor enhanced chloride transport through mutant CFTR with defective channel gating The impact of the increase in CFTR channel gating by ivacaftor on total chloride transport was assessed in Ussing chamber studies using FRT cells expressing the known CFTR gating mutations, G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, and G1349D-CFTR. Login to comment
71 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTRmRNA (%NormalCFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTRMaturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations MatureCFTR (%NormalCFTR) A B D C Mature Immature Fig. 1. Login to comment
96 Taken together, these in vitro results provide a rationale for testing the potential benefit of ivacaftor in individuals with CF who have a CFTR gating mutation other than G551D, including the G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P, and G1349D CFTR gating mutations. Login to comment
97 Evaluation of CF-associated CFTR mutations that were expected to cause protein alterations in the ATP-binding sites formed by the NBDs indicated that S549N- and S1251N-CFTR also shared similar in vitro functional characteristics with G551D-CFTR and could be classified as CFTR gating mutations. Login to comment
99 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 µM Ivacaftor * * * * * * * * * * * CFTR Mutation ChannelOpenProbability ChannelOpenProbability (%NormalCFTR) B 1pA 3sec + 10 µM Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2. Login to comment
127 Like G551D, the G551S, G1244E, S1255P, and G1349D CFTR gating mutations, as well as the S549N, S549R, and S1251N CFTR gating mutations identified in the Table 1 Effect of ivacaftor on the channel gating activity of CFTR with gating mutations. Login to comment
128 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 μM ivacaftor Baseline With 10 μM ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57±0.03 100 0.63±0.02 111 0.400±0.04 100 0.800±0.04 a 200 G551D 0.46±0.06 81 0.46±0.03 81 0.019±0.01 b 5 0.121±0.035 a 30 G178R 0.59±0.11 103 0.66±0.08 116 0.005±0.001 b 1 0.228±0.022 a 57 S549N 0.55±0.02 97 0.61±0.02 108 0.003±0.010 b 1 0.396±0.119 a 99 S549R 0.45±0.01 b 79 0.55±0.02 a 96 0.004±0.010 b 1 0.143±0.031 a 36 G551S 0.57±0.13 100 0.64±0.02 113 0.010±0.001 b 3 0.337±0.110 a 84 G970R 0.55±0.03 96 0.55±0.03 97 0.001±0.001 b 0 0.245±0.042 a 61 G1244E 0.44±0.11 77 0.54±0.08 94 0.011±0.010 b 3 0.470±0.122 a 118 S1251N 0.54±0.07 95 0.63±0.04 111 0.003±0.010 b 1 0.350±0.03 a 88 S1255P 0.70±0.03 b 122 0.71±0.02 125 0.018±0.016 b 5 0.468±0.168 a 117 G1349D 0.49±0.08 85 0.63±0.06 111 0.019±0.015 b 5 0.315±0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation. Login to comment
130 0 100 200 300 400 -9 -8 -7 -6 -5 -4 G178R G551D G551S 0 S549N S549R Ivacaftor [Log M] 0 100 200 300 400 0 50 100 150 200 -9 -8 -7 -6 -5 -4 G970R G1244E S1255P G1349D 0 S1251N Ivacaftor [Log M] ChlorideTransport (%NormalCFTR) Normal Forskolin G178R G551S G970R G1244E 50 2 1 min S1255P Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 0 50 100 150 200 * * * * * * * * * * * * * CFTR Mutation ChlorideTransport(µA/cm2)ChlorideTransport(µA/cm2) ChlorideTransport(A/cm2) ChlorideTransport (%NormalCFTR) B G1349D G551D A F508del C S549N S549R S1251N Baseline Baseline present study, cause protein alterations in the ATP binding pockets formed by the two NBDs required for normal CFTR channel gating (Fig. 4) [2]. Login to comment
131 The G178R and G970R CFTR gating mutations alter the intracellular cytoplasmic loops that are believed to link the ATP-driven conformational changes in the NBDs to the opening of the CFTR channel pore formed by the membrane spanning domains [27]. Login to comment
144 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D. Login to comment
24 Other known CFTR gating mutations include G178R, G551S, G970R, G1244E, S1255P, and G1349D [9-11]. Login to comment
40 These included G551D-, G178R-, S549N-, S549R-, G551S-, G970R-, G1244E-, S1251N-, S1255P-, and G1349D-CFTR [4,7,9-11]. Login to comment
47 This analysis showed that, as expected for known CFTR gating mutations (G551D, G178R, G551S, G970R, G1244E, S1255P, and G1349D) [5,9-11], the amount of CFTR delivered to the cell surface was generally similar between CFTR with gating defects and normal CFTR. Login to comment
51 Ivacaftor increased the channel gating of mutant CFTR with defective channel gating The effect of ivacaftor on CFTR channel gating was monitored by quantifying the channel open probability by patch-clamp electrophysiology using membrane patches excised from FRT cells expressing the known CFTR gating mutations, G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, or G1349D-CFTR. Login to comment
59 Ivacaftor enhanced chloride transport through mutant CFTR with defective channel gating The impact of the increase in CFTR channel gating by ivacaftor on total chloride transport was assessed in Ussing chamber studies using FRT cells expressing the known CFTR gating mutations, G551D-, G178R-, G551S-, G970R-, G1244E-, S1255P-, and G1349D-CFTR. Login to comment
72 Patch-clamp studies confirmed that the channel open probability of S549N-, S549R-, and S1251N-CFTR was b5% of normal CFTR, whereas the single channel current amplitude Normal F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 50 100 150 200 CFTR mRNA (% Normal CFTR) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 ** * CFTR Maturation (Mature/Total) None F508del G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0 100 200 300 400 ** * * * CFTR Mutations Mature CFTR (% Normal CFTR) A B D C Mature Immature Fig. 1. Login to comment
100 The partial reduction in S549R-CFTR maturation was ~27% of A Normal G551D G178R S549N S549R G551S G970R G1244E S1251N S1255P G1349D 0.0 0.2 0.4 0.6 0.8 1.0 0 50 100 150 200 250 Baseline With 10 &#b5;M Ivacaftor * * * * * * * * * * * CFTR Mutation Channel Open Probability Channel Open Probability (% Normal CFTR) B 1pA 3sec + 10 &#b5;M Ivacaftor G1349D S1255P G970R G551S G178R G1244E Baseline Normal G551D S1251N S549N S549R Fig. 2. Login to comment
129 Single channel current amplitude at 80 mV CFTR channel open probability Baseline With 10 bc;M ivacaftor Baseline With 10 bc;M ivacaftor Mutation pA % Normal pA % Normal Po % Normal Po % Normal Normal 0.57&#b1;0.03 100 0.63&#b1;0.02 111 0.400&#b1;0.04 100 0.800&#b1;0.04 a 200 G551D 0.46&#b1;0.06 81 0.46&#b1;0.03 81 0.019&#b1;0.01 b 5 0.121&#b1;0.035 a 30 G178R 0.59&#b1;0.11 103 0.66&#b1;0.08 116 0.005&#b1;0.001 b 1 0.228&#b1;0.022 a 57 S549N 0.55&#b1;0.02 97 0.61&#b1;0.02 108 0.003&#b1;0.010 b 1 0.396&#b1;0.119 a 99 S549R 0.45&#b1;0.01 b 79 0.55&#b1;0.02 a 96 0.004&#b1;0.010 b 1 0.143&#b1;0.031 a 36 G551S 0.57&#b1;0.13 100 0.64&#b1;0.02 113 0.010&#b1;0.001 b 3 0.337&#b1;0.110 a 84 G970R 0.55&#b1;0.03 96 0.55&#b1;0.03 97 0.001&#b1;0.001 b 0 0.245&#b1;0.042 a 61 G1244E 0.44&#b1;0.11 77 0.54&#b1;0.08 94 0.011&#b1;0.010 b 3 0.470&#b1;0.122 a 118 S1251N 0.54&#b1;0.07 95 0.63&#b1;0.04 111 0.003&#b1;0.010 b 1 0.350&#b1;0.03 a 88 S1255P 0.70&#b1;0.03 b 122 0.71&#b1;0.02 125 0.018&#b1;0.016 b 5 0.468&#b1;0.168 a 117 G1349D 0.49&#b1;0.08 85 0.63&#b1;0.06 111 0.019&#b1;0.015 b 5 0.315&#b1;0.110 a 79 a Significantly different (Pb0.05; paired t-test, n=3-5) compared to baseline levels for each CFTR mutation. Login to comment
145 The in vitro data presented here suggest that ivacaftor has a similar effect on all CFTR forms with gating defects and support the investigation of ivacaftor in patients with CF who have CFTR gating mutations beyond G551D, including G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D. Login to comment

PMID: 22020151 [PubMed] Amato F et al: "Extensive molecular analysis of patients bearing CFTR-related disorders."

No. Sentence Comment

69 Allele Frequency and CFTR Mutations in Patients Bearing CFTR-RDs Mutation (traditional name) HGVS nomenclature15 CBAVD (118 alleles)* RP (42 alleles)* DB (38 alleles)* Total (198 alleles)* TG12-T5-470V 34 (28.8) 2 (4.8) 10 (26.3) 46 (23.2) F508del c.1521_1523del 19 (16.1) 7 (16.7) 4 (10.5) 30 (15.2) 3195del6 c.3063_3069del 9 (7.6) 0 0 9 (4.5) N1303K c.3909CϾG 3 (2.5) 1 (2.4) 4 (10.5) 8 (4.0) G542X c.1624GϾT 4 (3.4) 1 (2.4) 1 (2.6) 6 (3.0) D1152H c.3454GϾC 1 (0.8) 2 (4.8) 2 (5.3) 5 (2.5) G85E c.254GϾA 2 (1.7) 3 (7.1) 0 5 (2.5) 1525-1delG c.1394de 3 (2.5) 1 (2.4) 0 4 (3.0) 4016insT c.3885insT 2 (1.7) 1 (2.4) 0 3 (1.5) 2789ϩ5GϾA c.2657ϩ5GϾA 0 3 (7.1) 0 3 (1.5) Q1476X c.4426CϾT 3 (2.5) 0 0 3 (1.5) 2183AAϾG c.2051_2052delinsG 1 (0.8) 1 (2.4) 0 2 (1.0) R553X c.1657CϾT 1 (0.8) 1 (2.4) 0 2 (1.0) L568F c.1704GϾT 2 (1.7) 0 0 2 (1.0) R1158X c.3472CϾT 2 (1.7) 0 0 2 (1.0) V920M c.2758GϾA 1 (0.8) 0 1 (2.6) 2 (1.0) 711ϩ1GϾT c.579ϩ1GϾT 0 1 (2.4) 0 1 (0.5) D614G c.1841AϾG 1 (0.8) 0 0 1 (0.5) 2184insA c.2052del 0 1 (2.4) 0 1 (0.5) 621ϩ1GϾT c.489ϩ1GϾT 1 (0.8) 0 0 1 (0.5) R1438W c.4312CϾT 0 1 (2.4) 0 1 (0.5) E193X c.577GϾT 0 1 (2.4) 0 1 (0.5) G1244E c.3731GϾA 1 (0.8) 0 0 1 (0.5) K68E c.202AϾG 1 (0.8) 0 0 1 (0.5) R347P c.1040GϾC 1 (0.8) 0 0 1 (0.5) 621ϩ3AϾG c.489ϩ3AϾG 1 (0.8) 0 0 1 (0.5) L997F c.2991GϾC 0 1 (2.4) 0 1 (0.5) F508C c.1523TϾG 1 (0.8) 0 0 1 (0.5) Total 94 (79.7) 28 (66.7) 22 (57.9) 144 (72.7) Undetected 24 (20.3) 14 (33.3) 16 (42.1) 54 (27.3) *Data are given as number (percentage). Login to comment
89 In one CBAVD patient, 1525-1delG was in cis with the R74W variant and the other chromosome carried the G1244E mutation. Login to comment
156 On the other hand, the known 1525-1GϾA mutation that involves the same nucleotide also causes the activation of novel splicing sites within exon 10.18 A CBAVD patient had a complex genotype (ie, G1244E, R74W, and 1525-1delG), the latter in cis with R74W. Login to comment
158 The patient had the severe G1244E mutation37 on the other chromosome, and he was affected only by CBAVD without any other sign of CF. Login to comment

PMID: 18499536 [PubMed] Visca A et al: "Improvement in clinical markers in CF patients using a reduced glutathione regimen: an uncontrolled, observational study."

No. Sentence Comment

43 65 64 71 28.5 28 30 9 5 6 PA PA none 3, F, 19 DF508/G1244E 47 48 55 43 43 48 3 3 9 PA b PAb PA 4, M, 5 DF508/R347P NA NA NA 17 17.5 19 33 33 40 SA SA none 5, M, 24 W1282G/G542X 60 58 70 51 51.5 57 3 3 7 BC BC BC 6, F, 14 3659delC/? Login to comment
44 70 71 72 42 42 49 20 17 41 none SA none 7, F, 8 DF508/DF508 66 66 69 21 20.5 23 12 6 14 SA SA,H none 8, F, 7 Y1182X/G1244E 73 72 75 21 20.5 21.5 35 23 21 none none none 9, M, 27 DF508/2183delAA 38 38 44 53 53 58.5 3 3 10 PA b PAb SA 10, M, 22 2183delAA/? Login to comment
64 15.1 15.3 1 0 36 30 3, F, 19 DF508/G1244E 16.3 18.3 0 0 9 18 4, M, 5 DF508/R347P 14.7 15.4 0 1 11 11 5, M, 24 W1282G/G542X 17.8 19.7 1 0 16 20 6, F, 14 3659delC/? Login to comment
65 16.6 19.3 0 0 22 22 7, F, 8 DF508/DF508 14.0 15.0 2 1 34 14 8, F, 7 Y1182X/G1244E 15.5 15.7 0 0 28 20 9, M, 27 DF508/2183delAA 18.1 20.0 3 1 48 31 10, M, 22 2183delAA/? Login to comment

PMID: 16049310 [PubMed] Schrijver I et al: "Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations."

No. Sentence Comment

53 Table 1. Continued CFTR location Amino acid change Nucleotide change 141 IVS 16 Splicing defect 3120 ϩ 1GϾA 142 IVS 16 Splicing defect 3121 - 2AϾG 143 IVS 16 Splicing defect 3121 - 2AϾT 144 E 17a Frameshift 3132delTG 145 E 17a I1005R 3146TϾG 146 E 17a Frameshift 3171delC 147 E 17a Frameshift 3171insC 148 E 17a del V1022 and I1023 3199del6 149 E 17a Splicing defect 3271delGG 150 IVS 17a Possible splicing defect 3272 - 26AϾG 151 E 17b G1061R 3313GϾC 152 E 17b R1066C 3328CϾT 153 E 17b R1066S 3328CϾA 154 E 17b R1066H 3329GϾA 155 E 17b R1066L 3329GϾT 156 E 17b G1069R 3337GϾA 157 E 17b R1070Q 3341GϾA 158 E 17b R1070P 3341GϾC 159 E 17b L1077P 3362TϾC 160 E 17b W1089X 3398GϾA 161 E 17b Y1092X (TAA) 3408CϾA 162 E 17b Y1092X (TAG) 3408CϾG 163 E 17b L1093P 3410TϾC 164 E 17b W1098R 3424TϾC 165 E 17b Q1100P 3431AϾC 166 E 17b M1101K 3434TϾA 167 E 17b M1101R 3434TϾG 168 IVS 17b 3500 - 2AϾT 3500 - 2AϾT 169 IVS 17b Splicing defect 3500 - 2AϾG 170 E 18 D1152H 3586GϾC 171 E 19 R1158X 3604CϾT 172 E 19 R1162X 3616CϾT 173 E 19 Frameshift 3659delC 174 E 19 S1196X 3719CϾG 175 E 19 S1196T 3719TϾC 176 E 19 Frameshift and K1200E 3732delA and 3730AϾG 177 E 19 Frameshift 3791delC 178 E 19 Frameshift 3821delT 179 E 19 S1235R 3837TϾG 180 E 19 Q1238X 3844CϾT 181 IVS 19 Possible splicing defect 3849 ϩ 4AϾG 182 IVS 19 Splicing defect 3849 ϩ 10 kb CϾT 183 IVS 19 Splicing defect 3850 - 1GϾA 184 E 20 G1244E 3863GϾA 185 E 20 G1244V 3863GϾT 186 E 20 Frameshift 3876delA 187 E 20 G1249E 3878GϾA 188 E 20 S1251N 3884GϾA 189 E 20 T1252P 3886AϾC 190 E 20 S1255X 3896CϾA and 3739AϾG in E19 191 E 20 S1255L 3896CϾT 192 E 20 Frameshift 3905insT 193 E 20 D1270N 3940GϾA 194 E 20 W1282R 3976TϾC 195 E 20 W1282X 3978GϾA 196 E 20 W1282C 3978GϾT 197 E 20 R1283M 3980GϾT 198 E 20 R1283K 3980GϾA 199 IVS 20 Splicing defect 4005 ϩ 1GϾA 200 E 21 Frameshift 4010del4 201 E 21 Frameshift 4016insT 202 E 22 Inframe del E21 del E21 203 E 21 N1303K 4041CϾG 204 E 24 Frameshift 4382delA Genomic and Synthetic Template Samples Where possible, native genomic DNA was collected. Login to comment

PMID: 15858154 [PubMed] Schrijver I et al: "Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum."

No. Sentence Comment

98 Spectrum of CFTR Sequence Variants in 257 Hispanic Patients Who Underwent Diagnostic DNA Testing for CF Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) ACMG/ACOG recommended 25 mutation panel* DeltaF508 53 28.96 10.31 G542X 7 3.83 1.36 R334W 2 1.09 0.39 R553X 2 1.09 0.39 DeltaI507 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 3120 ϩ 1 GϾA 1 0.55 0.19 7 different mutations 67 36.61 13.04 All mutations included ACMG/ACOG 1248 ϩ 1 GϾA 1 0.55 0.19 1249 - 29delAT 1 0.55 0.19 1288insTA1288insTA 1 0.55 0.19 1341 ϩ 80 GϾA1341 ϩ 80 GϾA 1 0.55 0.19 1429del71429del7 1 0.55 0.19 1525 - 42 GϾA1525 - 42 GϾA 1 0.55 0.19 1717 - 1 GϾA 1 0.55 0.19 1717 - 8 GϾA 2 1.09 0.39 1811 ϩ 1 GϾA1811 ϩ 1 GϾA 1 0.55 0.19 2055del9-ϾA 3 1.64 0.58 2105-2117del13insAGAAA 1 0.55 0.19 2215insG 1 0.55 0.19 2585delT2585delT 1 0.55 0.19 2752 - 6 TϾC 1 0.55 0.19 296 ϩ 28 AϾG 1 0.55 0.19 3120 ϩ 1 GϾ A 1 0.55 0.19 3271 ϩ 8 AϾG3271 ϩ 8 AϾG 1 0.55 0.19 3271delGG 1 0.55 0.19 3272 - 26 AϾG 2 1.09 0.39 3876delA 2 1.09 0.39 4016insT 1 0.55 0.19 406 - 1 GϾA 6 3.28 1.17 406 - 6 TϾC 1 0.55 0.19 4374 ϩ 13 A ϾG 1 0.55 0.19 663delT 1 0.55 0.19 874insTACA874insTACA 1 0.55 0.19 A1009T 2 1.09 0.39 A559T 1 0.55 0.19 D1152H 1 0.55 0.19 D1270N 3 1.64 0.58 D1445N 2 1.09 0.39 D836Y 1 0.55 0.19 DeltaF311 1 0.55 0.19 DeltaF508 53 28.96 10.31 DeltaI507 1 0.55 0.19 E116K 2 1.09 0.39 E585X 1 0.55 0.19 E588VE588V 2 1.09 0.39 E831X 1 0.55 0.19 F311L 1 0.55 0.19 F693L 1 0.55 0.19 G1244E 1 0.55 0.19 G542X 7 3.83 1.36 G576A 1 0.55 0.19 H199Y 3 1.64 0.58 I1027T 3 1.64 0.58 I285FI285F 1 0.55 0.19 L206W 3 1.64 0.58 L320V 1 0.55 0.19 L967S 1 0.55 0.19 L997F 3 1.64 0.58 P1372LP1372L 1 0.55 0.19 P205S 1 0.55 0.19 P439SP439S 1 0.55 0.19 Q1313X 1 0.55 0.19 Q890X 2 1.09 0.39 Q98R 1 0.55 0.19 R1066C 1 0.55 0.19 R1066H 1 0.55 0.19 (Table continues) missense variant, I1027T (3212TϾC), in exon 17a.25 Family studies have not been performed to identify which allele carries two mutations. Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment

PMID: 15698946 [PubMed] des Georges M et al: "High heterogeneity of CFTR mutations and unexpected low incidence of cystic fibrosis in the Mediterranean France."

No. Sentence Comment

69 of chromosomes (frequency %) p.E1104X 17b 2 (0.47) p.R1158X 19 3 (0.70) p.R1162X 19 2 (0.47) c.3659delC 19 1 (0.23) c.3737delA 19 2 (0.47) p.I1234V 19 1 (0.23) c.3849+10kbCNT intron 19 4 (0.93) c.3850-1GNA intron 19 1 (0.23) p.G1244E 20 1 (0.23) p.W1282X 20 2 (0.47) p.N1303H 21 1 (0.23) p.N1303K 21 13 (3.02) p.Q1313X 21 1 (0.23) c.4382delA 24 1 (023) Mutations described for the first time by our laboratory appear in bold. Login to comment

PMID: 12454843 [PubMed] Durno C et al: "Genotype and phenotype correlations in patients with cystic fibrosis and pancreatitis."

No. Sentence Comment

105 CFTR Genotypes Among CF Patients With PS With and Without Pancreatitis Two mutations (n) ⌬F508/R117H (9) ⌬F508/(5T) (6) ⌬F508/3272-26A 3 G (4) ⌬F508/R347H (2) ⌬F508/P574H (2) ⌬F508/875 ϩ 1G Ͼ C (2) ⌬F508/3849 ϩ 10kb C 3 T (1) ⌬F508/A455E (1) ⌬F508/D614G (1) ⌬F508/G85E (1) ⌬F508/R347P (1) ⌬F508/S1251N (1) ⌬F508/⌬F508a (1) ⌬F508/3120G Ͼ A (1) ⌬F508/G551Da (1) G542X/R117H (1) R560T/L206W (1) R117H/R117H (1) R31L/P67L (1) 1461ins4 (AGAT)/G85E (1) G551D/(5T) (1) R1066C/3849 ϩ 10kb C Ͼ T (1) G551D/3849 ϩ 10kb C Ͼ T (1) R334W/R334W (1) R334W/681delC (1) W1282X/3489 ϩ 10kb C Ͼ T (1) One mutation (n) ⌬F508/- (18) L1077P/- (1) W1282X/- (1) M1137V/- (1) G551D/- (1) R347H/- (1) Q30X1/- (1) G1244E/- (1) R117H/- (1) 621 ϩ 2G621 ϩ 1G 3 T/- (1) NOTE. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

104 c 4016insT, G1244E, R1158X, 3120+1G>A, 1677delTA, I1234V, E831X, 5T, Q220X, E92K, G91R. Login to comment

PMID: 9674722 [PubMed] Schwiebert EM et al: "Cystic fibrosis: a multiple exocrinopathy caused by dysfunctions in a multifunctional transport protein."

No. Sentence Comment

224 In NBD2, a few key mutations have been found that include missense mutations (G1349D, D1370N, K1250M, K1250Q, G1244E, S1255P) and several nonsense mutations (W1282X, S1255X, W1316X). Login to comment

PMID: 10200050 [PubMed] de Meeus A et al: "Genetic findings in congenital bilateral aplasia of vas deferens patients and identification of six novel mutatations. Mutations in brief no. 138. Online."

No. Sentence Comment

83 Phenotype CFTRamutations Intron 8, Poly(T) tract 1 3 crisis of acute pancreatitis F508 / L206W 9/7 2 F508 / L206W 9/9 3 frequent bronchitis F508 / R347H 9/9 4 F508 / R347H 9/9 5 F508 / M244K 9/7 6 F508 / A1364V 9/7 7 F508 / D1152H 9/7 8 chronic sinusitis and bronchitis F508 / D1152H 9/7 9 F508 / R117H 9/7 10 F508 / R117H 9/7 11 F508 / M952I 9/7 12 D443Y / G542X 7/9 13 D443Y / G542X 7/9 14 2184delA / D443Y 7/7 15 2184delA / D443Y 7/7 16 R347H / D443Y 9/7 17 seminal vesicles agenesia R117H / G1349D 7/7 18 R117H / G1244E 7/7 19 N1303K / P111L 9/7 20 chronic sinusitis, nasal polyps W1282X / D1152H 7/7 21 chronic sinusitis R347H / Y1092X 7/7 22 seminal vesicles agnesia 297-3C-GTT / 4279insA 7/7 23 G544V / F508C 7/7 24 D1152H / 2896insAG 7-9 25 F508 / - 9/5 26 F508 / - 9/5 27 F508 / - 9/5 28 F508 / - 9/5 29 F508 / - 9/5 30 chronic sinusitis, bronchitis F508 / - 9/5 31 sinusitis and allergy F508 / - 9/5 32 allergy F508 / - 9/5 33 F508 / - 9/5 34 F508 / - 9/5 35 F508 / - 9/5 36 F508 / - 9/5 37 bronchitis, asthma F508 / - 9/5 38 chronic sinusitis F508+A1067T / - 9/5 39 chronic sinusitis D1152H / - 7/5 40 2184delA / - 7/5 41 R764X / - 7/5 42 711+1G-GTT / - 7/5 43 F508 / - 9/7 44 F508 / - 9/7 45 F508 / - 9/7 46 F508 / - 9/9 47 R553X / - 7/7 48 -33G-GTA / - 7/7 49 K710X / - 7/7 50 - / - 5/5 51 - / - 5/7 52 - / - 5/7 53 - / - 7/7 54 - / - 7/7 55 - / - 7/7 56 - / - 7/7 57 - / - 7/7 58 - / - 7/7 59 - / - 7/7 60 - / - 7/7 61 - / - 7/9 62 - / - 7/9 63 NIDDb - / - 7/9 64 - / - 7/9 a : Cystic Fibrosis Transmembrane Regulator gene b : Non Insulino-Dependant Diabetis References Anguiano A, Oates RD, Amos JA, Dean M, Gerrard B, Stewart C, Maher TA, White MB, Milunsky A (1992) Congenital absence of the vas deferens: a primarily genital form of cystic fibrosis. Login to comment

PMID: 9439669 [PubMed] Casals T et al: "High heterogeneity for cystic fibrosis in Spanish families: 75 mutations account for 90% of chromosomes."

No. Sentence Comment

33 Eight mutations have frequencies 366 Table 1 Seventy-five CFTR mutations identified in 640 Spanish families with cystic fibrosis (CF) Mutation Exon/intron CF alleles % ∆F508 E.10 681 53.20 G542X E.11 108 8.43 N1303K E.21 34 2.65 1811+1.6kbA→Ga I.11 24 1.87 711+1G→T I.5 22 1.71 R1162Xa E.19 21 1.64 R334Wa E.7 21 1.64 R1066C E.17b 14 1.09 1609delCAa E.10 13 1.01 Q890X E.15 13 1.01 G85E E.3 12 0.94 712-1G→Ta I.5 11 0.86 2789+5G→A I.14b 11 0.86 ∆I507 E.10 10 0.78 W1282X E.20 10 0.78 2869insGa E.15 9 0.70 L206W E.6a 7 0.54 R709X E.13 7 0.54 621+1G→T I.4 6 0.47 3272-26A→G I.17a 6 0.47 R347H E.7 5 0.39 2183AA→G E.13 5 0.39 K710X E.13 5 0.39 2176insC E.13 5 0.39 3849+10kbC→T I.19 5 0.39 P205Sa E.6a 4 0.31 1078delT E.7 4 0.31 R553X E.11 4 0.31 G551D E.11 4 0.31 1812-1G→Aa I.11 4 0.31 CFdel#1a E.4-7/11-18 4 0.31 V232D E.6a 3 0.23 936delTAa E.6b 3 0.23 1717-8G→A I.10 3 0.23 1949del84 E.13 3 0.23 W1089X E.17b 3 0.23 R347P E.7 3 0.23 del E.3a E.3 2 0.16 R117H E.4 2 0.16 L558S E.11 2 0.16 A561E E.12 2 0.16 2603delT E.13 2 0.16 Y1092X E.17b 2 0.16 Q1100Pa E.17b 2 0.16 M1101K E.17b 2 0.16 delE.19a E.19 2 0.16 G1244E E.20 2 0.16 P5La E.1 1 0.08 Q30Xa E.2 1 0.08 G85Va E.3 1 0.08 E92Ka E.4 1 0.08 A120Ta E.4 1 0.08 I148T E.4 1 0.08 711+3A→Ta I.5 1 0.08 H199Y E.6a 1 0.08 875+1G→A I.6a 1 0.08 Table 1 (continued) Mutation Exon/intron CF alleles % 1717-1G→A I.10 1 0.08 L571S E.12 1 0.08 T582Ra E.12 1 0.08 E585X E.12 1 0.08 1898+3A→G I.12 1 0.08 G673X E.13 1 0.08 E692Xa E.13 1 0.08 R851X E.14a 1 0.08 R851La E.14a 1 0.08 A1006E E.17a 1 0.08 L1065Ra E.17b 1 0.08 F1074La E.17b 1 0.08 R1158X E.19 1 0.08 3667del4a E.19 1 0.08 3860ins31a E.20 1 0.08 3905insT E.20 1 0.08 4005+1G→A I.20 1 0.08 Q1281Xa E.20 1 0.08 Q1313X E.21 1 0.08 Known mutations (75) 1155 90.23 Unknown mutations 125 9.77 a Mutations discovered by the CF group of the Medical and Molecular Genetics Centre - IRO, Barcelona, Spain that range between 0.5% and 0.9%, representing 6.0% of the CF chromosomes. Login to comment

PMID: 8702904 [PubMed] Cotten JF et al: "Effect of cystic fibrosis-associated mutations in the fourth intracellular loop of cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

139 This pattern of response for A1067T is similar to what we have found with the NBD mutants G551D, G1244E, and G1349D (8). Login to comment
138 This pattern of response for A1067T is similar to what we have found with the NBD mutants G551D, G1244E, and G1349D (8). Login to comment

PMID: 8662892 [PubMed] Seibert FS et al: "Disease-associated mutations in the fourth cytoplasmic loop of cystic fibrosis transmembrane conductance regulator compromise biosynthetic processing and chloride channel activity."

No. Sentence Comment

88 Other disease-causing CFTR mutants, which are appropriately processed and trafficked to the plasma membrane, show defective ion conduction properties (e.g. R334W, R347H, and R347P; Sheppard et al., 1993; Tabcharani et al., 1993) or defective regulation of channel activity (e.g. G551S, G1244E, S1255P, and G1349D; Anderson and Welsh, 1992). Login to comment
95 Other disease-causing CFTR mutants, which are appropriately processed and trafficked to the plasma membrane, show defective ion conduction properties (e.g. R334W, R347H, and R347P; Sheppard et al., 1993; Tabcharani et al., 1993) or defective regulation of channel activity (e.g. G551S, G1244E, S1255P, and G1349D; Anderson and Welsh, 1992). Login to comment

PMID: 8844213 [PubMed] Morral N et al: "Haplotype analysis of 94 cystic fibrosis mutations with seven polymorphic CFTR DNA markers."

No. Sentence Comment

105 CFTR Haplotypes for Diallelic and Multiallelic DNA Markers for 94 CF Mutations" J44-GATT- 8CA-17BTA- No. of T854-TUB20 17BCA Mutation chromosomes % Normal Laboratory Reference 2-7-1-2 17-47-13 (55.4%) 17-46-13 17-45-13 17-34-13 17-32-13 17-31-14 17-31-13 17-29-14 17-28-13 16-48-13 16-46-14 16-46-13 16-45-13 16-44-13 16-35-13 16-33-13 16-32-13 16-31-14 16-31-13 16-30-13 16-29-13 16-26-13 16-25-13 16-24-13 14-31-13 1-7-2-1 17-7-17 (16.8%) R334W R334W 3860ins31 G1244E R1162X R1162X R1162X G91R MllOlK R347P R334W R117C E92K 3849+lOkbC+T 3293delA 1811+1.6kb A-tG 1811+1.6kb A-tG 2184insA P205S 3659delC G673X 11005R I336K W58S R347P W846X 405+1-A G178R 3905insT R1162X R347H 3100insA E60X 1078delT 4005+1-A K710X 1677delTA H199Y 3601-2AjG 3850-3T+G 3272-26A-tG 3850-1-A 1812-1-A R117H L1059X S492F Y1092X Y569H 3732delA C866Y 711+1G+T 711+1-T G85E 1949del84 2789+5-A H1085R W1282X R1066C 2043delG V456F 2 1 1 1 2 1 6 2 2 1 2 1 1 2 1 1 4 1 1 1 3 2 1 1 1 1 1 1 2 7 1 1 1 1 2 1 1 3 19 3 3 1 1 2 1 1 5 1 1 1 1 3 6 3 5 1 13 2 1 1 - 0.48 0.48 - - - 0.24 - - - 2.65 2.40 1.93 2.65 1.68 2.65 0.72 13.94 13.46 1.93 - 0.72 0.24 3.37 - b b fP fP fP t b,fb.fP h fb t h t h h fP fP b.h b h h b h h h h h fb fb,fP.t fP fP fP9t fP b t fPh b h fb b.fb,h fb*fP b,fP h h t h fb fb,fp,h.t fP fP fb t b.fP,t b,fb,h,t b f b h h fb b,fb.fP,h fP h h Gasparini et al. (1991b) Chilldn et al. (1993a) Devoto et al. (1991) Gasparini et al. (1991b) Dork et al. (1993a) Guillermit et al. (1993) Zielenski et al. (1993) Dean et al. (1990) Dork et al. (1994a) Nunes et al. (1993) Highsmith et al. (1994) Ghanem et al. (1994) Chilldn et al. (1995) Dork et al. (1994a) Dork et al. (1993a) Chilldn et al. (1993b) Kerem et al. (1990) Dork et al. (1994a) Dork et al. (1994a) Cuppenset al. (1993) Fanen et al. (1992) Maggio et al. (personal communication) Audrezet et al. (1993) Vidaud et al. (1990) Dork et al. (1993b) Zielenski et al. (1991a) Chilldn et al. (1994b) Malik et al. (personal communication) Cremonesi et at. Login to comment

PMID: 8528204 [PubMed] Savov A et al: "Double mutant alleles: are they rare?"

No. Sentence Comment

56 Another mutation (G1244E), has been found to result from a different substitution at the same nucleotide position, namely G->A at nt 3863 in codon 1244 where glycine is replaced by glutamic acid. Login to comment
57 G1244E was initially described in an Italian patient with a mild CF phenotype (12) and has been detected in two pancreatic sufficient patients in our study. Login to comment

PMID: 7534226 [PubMed] Sheppard DN et al: "Mechanism of dysfunction of two nucleotide binding domain mutations in cystic fibrosis transmembrane conductance regulator that are associated with pancreatic sufficiency."

No. Sentence Comment

126 For example, G551S, G1244E, S1255P and G1349D had a markedly reduced PO at all concentrations of MgATP tested, and S1255P was less potently stimulated by MgATP (Anderson and Welsh, 1992; Smit et al., 1993). Login to comment
127 Therefore, we tested the hypothesis that ATP-dependent regulation of A455E and P574H was altered. Login to comment

PMID: 8825494 [PubMed] Zielenski J et al: "Cystic fibrosis: genotypic and phenotypic variations."

No. Sentence Comment

631 The range of effects of dysregulation of the channel includes those with a severe lack of function (such as that for G551D), reduced response to ATP stimulation (S1255P), and slight reduction of absolute activity (G551S, G1244E, and G1349D) (7, 63). Login to comment

PMID: 7526685 [PubMed] Morral N et al: "Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene."

No. Sentence Comment

112 CT................... 3863: G--oA .................. G-.T ................... 3980: G-jA .................. G--)T.................... 4374+1: G-A .................. G--oT.................... L88S L88X L88X G. Malone, personal communication Savov et al. 1994b Macek et al. 1992 406-1G--.C Bonizzato et al. 1992 406-1G- T T. Bienvenu, personal communication E92K Nunes et al. 1993 E92X Will et al. 1994 S549N Cutting et al. 1990 S5491 Kerem et al. 1990 R560K Ferec et al. 1992 R560T Kerem et al. 1990 Y563D A. Hamosh, personal communication Y563N Kerem et al. 1990 1898+1CG-.A Strong et al. 1992 1898+1GC-.C Cuppens et al. 1993 1898+3A-)C W. Lissens, personal communication 1898+3A--4G Cremonesi et al. 1992 G628R G628R 2183AA- G 2184delA 2184insA M1101K M1101R 3667del4 3667ins4 3791delC T12201 G1244E G1244V R1283K R1283M Fanen et al. 1992 Cuppens et al. 1993 Bozon et al. 1994 Dork et al., in press N. Kilin, personal communication Zielenski et al. 1993 Mercier et al. 1993 Chillon et al. 1994a Sangiuolo et al. 1993 M. Macek, Jr., personal communication Ghanem et al. 1994 Devoto et al. 1991 Savov et al. 1994a Chevalier et al., in press Cheadle et al. 1992 4374+1G-*A Fanen et al. 1992 4374+1G--iT Dork et al. 1993 of the most common allele. Login to comment

PMID: 7525963 [PubMed] Chevalier-Porst F et al: "Mutation analysis in 600 French cystic fibrosis patients."

No. Sentence Comment

21 Among the 104 other CFTR mutations tested on the 373 non-AF508 CF chromosomes, none of the following 58 mutations were found: G91R, 435 insA, 444delA, D11OH, 556delA, 557delT, R297Q, 1154insTC, R347L, R352Q, Q359K/T360K, 1221delCT, G480C, Q493R, V520F, C524X, 1706dell7, S549R (A-C), S549N, S549I, G551S, 1784delG, Q552X, L558S, A559T, R560T, R560K, Y563N, P574H, 2307insA, 2522insC, 2556insAT, E827X, Q890X, Y913C, 2991de132 (Dork et al, personal communication), L967S, 3320ins5, 3359delCT, H1085R, R1158X, 3662delA, 3667del4, 3667ins4, 3732delA, 3737delA, W1204X, 3750delAG, I 1234V, Q1238X, 3850- 3T-+G, 3860ins31, S1255X, 3898insC, D1270N, R1283M, F1286S, 4005 + I G-A. Forty-six other mutations were found on at Distribution of CFTR mutations found in our sample ofpopulation (1200 CF chromosomes) Mutations tested No of CF chromosomes Haplotypes Method with the mutation XV2C-KM19 (% of total CF alleles) Exon 3: G85E 4 (033) 3C HinfI/ASO394delTT 2 2B PAGEExon 4: R117H 1 B ASOY122X 2 2C MseI/sequenceI148T 1 B ASO621+IG-J* 1 B MseIIASOExon 5: 711+1G--T 8(07) 8A ASOExon 7: AF311 1 C PAGE/sequencelO78delT 5 (0-42) 5C PAGE/ASOR334W 5 (0-42) 2A,2C,ID MspIlASOR347P 5 (042) 5A CfoI/NcoIR347H 1 Cfol/sequenceExon 9: A455E 1 B ASOExon 10: S492F I C DdeI/sequenceQ493X 1 D ASOl609deICA 1 C PAGE/Ddel/sequenceA1507 3 (025) 3D PAGE/ASOAF508 827 (69) 794B,30D,2C,IA PAGEl677delTA 1 A PAGE/sequenceExon I11: 1717-IG--.A 16(1-3) 14B Modified primers + AvaIIG542X 40 (3-3) 29B,5D,2A Modified primers + BstNiS549R(T--*G) 2 2B ASOG551D 3 (025) 3B HincII/Sau3AR553X 10(0-8) 6A,1B,2C,ID Hincll/sequenceExon 12: 1898+IG--A 1 C ASO1898+ IG-C 2 IC ASOExon 13: l9l8deIGC 1 A PAGE/sequence1949de184 I C PAGE/sequenceG628R(G-+A) 2 2A Sequence2118de14 I c PAGE/sequence2143de1T 1 B PAGE/modified primers2184de1A+2183A--*G 11 (0-9) lIB PAGE/ASO2184de1A 1 ASOK710X 3 (025) IC XmnI2372de18 1 B PAGE/sequenceExon 15: S945L 1 C TaqlExon 17b:L1065P I MnlIL1077P 1 A ASOY1092X 3 (025) 2C,IA Rsal/ASOExon 19: RI1162X 6 (0-5) 5C,IA DdeI/ASO3659delC 3 (025) 3C ASOExon 20: G1244E 2 2A MboIIS1251N 2 2C RsaI3905insT 4 (0-33) 4C PAGE/ASOW1282X 18 (105) 15B,1D MnlI/ASOR1283K 1 C Mnll/sequenceExon 21: N1303K 22 (1-8) 18B,lA,ID Modified primers+BstNI 47 mutations 1031 (85 9) least one CF chromosome (table): 21 of them are very rare as they were found on only one CF chromosome in our population. Login to comment
40 R1283K can be detected by two different restriction enzyme digestions: abolition of the MnlI site or creation of an MboII site giving a pattern similar to G1244E on agarose gel electrophoresis.2' The presence of this new mutation highlights the necessity of verification by ASO hybridisation for mutations detected by abolition of a restriction enzyme site. Login to comment

PMID: 7514174 [PubMed] Ko YH et al: "The cystic fibrosis transmembrane conductance regulator. Nucleotide binding to a synthetic peptide segment from the second predicted nucleotide binding fold."

No. Sentence Comment

60 TNP Nucleotide Binding-The enhancement of fluorescence of the TMS-1 TMS-2 NBF-2 COO- + % N E P-51 (122B-<278) ENISFSISPGQRVGLL&TGSG~TLLSAFLP.LLNTEGEIQIDGVSWDSIT1/1 51 -ttl).ttttttt"-, CF Mutations within P-51 Q123ESTOP 11234" G1244E S1251N S1255P D1270N S1255STOP FIG.1.Primary sequence of P-51 and its predicted secondary structure. Login to comment

PMID: 7516777 [PubMed] Savov A et al: "G1244V: a novel missense mutation in exon 20 of the CFTR gene in a Bulgarian cystic fibrosis patient."

No. Sentence Comment

10 The cycling parameters were: initial denaturation at 94°C for 5 min. followed by 30 cycles of 94°C 30 sec, 57°C 30 sec, 72°C 1 min. and a final step at 72°C for 7 min. SSCP analysis of exon 20 was performed on 14% acrylamide gels with several different mutations used as heterozygous controls (W1282X, 4005 +1 G - A , 3850 - 1 G - A , G1244E, P1290P) (Fig. 1A). Login to comment
20 A transition (G-A) at the same nucleotide position which results in thereplacementof glycine with glutamic acid (G1244E) has been described previously in an Italian CF patient (6). Login to comment
21 The G1244E mutation was also detected in our study, in a female CF patient of Bulgarian ethnic background who is a G1244E/delF508 compound. Login to comment
24 Lane 1, normal individual N/N; lane 2, W1282X/N; lane 3, 3850-1 G-A/N; lane 4, 4005 + 1 G-A/N; lane 5, P1290P/N; lane 10, G1244V/N; lane 11, G1244E/N; lanes 6, 7, 8, 9, 12 investigated patients without mutations in exon 20. Login to comment

PMID: 7686820 [PubMed] Welsh MJ et al: "Molecular mechanisms of CFTR chloride channel dysfunction in cystic fibrosis."

No. Sentence Comment

17 Classes of CFTR Mutations That Cause CF Class Defect Examples Do- Fre- Clin- main quency ical Protein production Nonsense mutations Frameshift Splice Processing Conduction 6542X NBDI 3.4 3905 insT NBD2 2.1 621 + G-T MSDl 1.3 Al507 NBDl AF506 NBDl s5491 NBDl S549R NED1 A559T NED1 N1303K NBDP G551 D NBDl G551S NBDl G1244E NBDP S1255P NBDP G1349D NBDP RI 17H MSDI R334W MSDl R347P MSDl 0.5 67.2 Rare 0.3 Rare 1.a 2.4 Rare Rare Rare Rare 0.6 0.4 0.5 PI PI PI PI PI PI PI PI PS PI PI PI PS PS PS NED, nucleotide-binding domain; MSD, membrane-spanning domain; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment
56 Some nucleotide-binding domain mutants (such as G551D) have very little function, in some (such as S1255P) ATP is less potent at stimulating activity, and the absolute activity of others (such as G551S, G1244E, and G1349D) is reduced (Anderson and Welsh, 1992; Drumm et al., 1991). Login to comment

PMID: 7680027 [PubMed] Thomas PJ et al: "Effects of the delta F508 mutation on the structure, function, and folding of the first nucleotide-binding domain of CFTR."

No. Sentence Comment

107 For example, the G458V (Cuppens et al., 1990) and G1244E (Devoto et al., 1991) mutations which change the first glycine residue in the Gx 4GKT sequence of the A homology region and the R560T (Kerem et al., 1990) mutation in the Rx6.sh4D sequence of the B homology region are known to cause CF. Login to comment

PMID: 1279852 [PubMed] Tsui LC et al: "The spectrum of cystic fibrosis mutations."

No. Sentence Comment

99 Most notable are the mutations identified at the glycine residues in the Walker motifs (regions highly conserved among ATP-binding proteins), namely, G458V and G551D in NBF1 (Refs 16, 10), and G1244E and G1349D at the corresponding residues in NBF2 (Refs 17, 18), suggesting that ATP binding is essential for CFTR function. Login to comment
123 8 NO. 11 m []~EVIEWS G551D R553Q G551S I L558S aI~7 S5491 I I 1&559T A455F E5040 I&F508 V520F SS49NII IIR560T PS74H I G458V G480C $492F /" • ss,9 II III* oa. / III / NBF1 ~t ~t NBF2 I I I I I III I I I 11234V G1244E IS1255P D1270N II I Q1291H N1303K G1349D S1251N W1282R] F1286S N1303H Q1283M, FIG[] Cystic fibrosis (missense) mutations located within the two presumptive ATP-binding domains (NBF1 and NBF2) of CFTR. Login to comment

PMID: 1709778 [PubMed] Devoto M et al: "Screening for non-delta F508 mutations in five exons of the cystic fibrosis transmembrane conductance regulator (CFTR) gene in Italy."

No. Sentence Comment

49 .. 2 ... ... 2 ... 1 1 ... 2 Unknown PI Lombardia QS52X.. ... 1 1 2 2 1 2 1 2 2 1 Unknown PI Ven~to Exon 15: 2909delT ...1... ...... ... ... 1 1 ... 2 Unknown PI Lombardia Exon 20: G1244E .....1 2 2 1 2 2 1 1 1 1 ... 1 deltaF508 PI Sicily a PI = pancreatic insufficiency. Login to comment
52 The mutation found in exon 20 is a missense mutation due to a G-to-A transition at position 3863 and generates a glycine-to-glutamic-acid substitution in codon 1244 (G1244E). Login to comment
83 As for G1244E, it seems that the substitution of a charged amino acid (glutamic acid) for a neutral one (glycine) may be relevant to the protein functioning. Login to comment

PMID: 10876009 [PubMed] Castaldo G et al: "Prenatal diagnosis of cystic fibrosis: a case of twin pregnancy diagnosis and a review of 5 years' experience."

No. Sentence Comment

68 T, 4016insT, G1244E and R1158X) was analysed on all the CF families with an allele Table 1 Short tandem repeats (STR) used to exclude maternal contamination and to confirm paternity in prenatal diagnosis of cystic fibrosis. Login to comment

PMID: 11448786 [PubMed] Wine JJ et al: "Cystic fibrosis: the 'bicarbonate before chloride' hypothesis."

No. Sentence Comment

52 Ion transport (% WT) 42 41 69 75 >100 >100 98 + 103 100 + + 120 Pancreatic sufficient Pancreatic insufficient Bicarbonate Chloride - intermediate Chloride - high Unknown WT D648V R117H R1070Q H949Y G551S H620Q I148T A1067T G178R G970R S1255P G1244E G551D G1349D 0 0.5 1 1.5 2 2.5 Current Biology ࢞F508 Dispatch R absence of the vas deferens [16]. Login to comment
76 Critical information was provided by Thilo D&#f6;rk (H620Q); R. Moss (R117H & G551D homozygotes); David Kessler, Theresa Grebe and Elizabeth Perkett (D648V); Monica Brooks and contributors to the Cystic Fibrosis Foundation Registry (G178R and G1244E); Aleksey Savov and Luba Kalaydjieva (R1070Q); and Christiane De Boeck and Harry Cuppens (G970R). Login to comment

PMID: 16635477 [PubMed] Lucarelli M et al: "A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene."

No. Sentence Comment

139 In this work, we found a limited subset of 13 mutations (not included in the PCR/OLA/SCS assay) in 7 CFTR exons, significantly improving the sensitivity of standard assays: D110H, R117C, and H139R (exon 4); R334L, T338I, and A349V (exon 7); S549R(A->C) (exon 11); Y849X (exon 14a); L997F (exon 17a); L1065P, R1066C, and L1077P (exon 17b); and G1244E (exon 20). Login to comment
155 The importance of the 1244 codon, which can be classified as a mutational hot spot, is also highlighted by the fact that this same codon can be affected by two other mutations, G1244V [32] and G1244E [33], both of which already have been shown to cause disease. Login to comment
165 The frequency of the G1244R mutation must be calculated on a larger number of CF subjects to ascertain whether it is a rare mutation; however, the frequency of the G1244E mutation, one of the other mutations in the same codon, was found to be approximately 0.3%, which is relatively high. Login to comment

PMID: 19014055 [PubMed] Yalcin E et al: "Cystic fibrosis in a boy with meconium ileus and mild clinical phenotype associated with 2183AA-G/D1152H genotype."

No. Sentence Comment

31 These nine patients carried delF508, G542X, G1244E and 2789+5G-A on the other CF allele. Login to comment

PMID: 23199563 [PubMed] Leonard A et al: "[Mucoviscidosis: CFTR mutation-specific therapy: a ray of sunshine in a cloudy sky]."

No. Sentence Comment

178 De re &#b4;centes donne &#b4;es in vitro sugge `rent que cette me &#b4;dication soit e &#b4;galement efficace sur 9 autres mutations de la me c6;me classe (G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, G1349D) [50,51]. Login to comment

PMID: 23891399 [PubMed] Van Goor F et al: "Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function."

No. Sentence Comment

28 These include the most common CFTR gating mutation, G551D, as well as the G178R, S549N, S549R, G551S, G970R, G1244E, S1251N, S1255P, and G1349D mutations [12]. Login to comment

PMID: 24030637 [PubMed] Deeks ED et al: "Ivacaftor: a review of its use in patients with cystic fibrosis."

No. Sentence Comment

35 For example, in rodent cells expressing G551D/S, G178R, S549N/R, G970R, G1244E, S1251N, S1255P or G1349D CFTR, ivacaftor increased channel open probability from B5 % of normal at baseline to 30-118 % of normal and increased chloride transport C16- fold (EC50 124-594 nmol/L). Login to comment

PMID: 24440181 [PubMed] De Boeck K et al: "The relative frequency of CFTR mutation classes in European patients with cystic fibrosis."

No. Sentence Comment

56 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations Large deletions and insertions 1078delT; 1717-1G࢐A; 3659delC; 621+1G࢐T Class II Defective protein processing G85E, F508del, I507del, R560T, N1303K Class III Defective protein regulation ('gating`) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R117H, R334W, R347P Class V Reduced amount of functioning protein 2789+5G࢐A, 3849+10KbC࢐T, A455E Unclassified All other mutations, including those unknown. Login to comment

PMID: 24832698 [PubMed] Balfour-Lynn IM et al: "Personalised medicine in cystic fibrosis is unaffordable."

No. Sentence Comment

37 It is currently licensed for use only in those with the p.Gly551Asp mutation; but a further license has been recently approved in the USA for use in other rarer gating mutations (G178R, G551S, S549N, S549R, G970R, G1244E, S1251N, S1255P, or G1349D). Login to comment

PMID: 24932877 [PubMed] Bell SC et al: "New pharmacological approaches for cystic fibrosis: promises, progress, pitfalls."

No. Sentence Comment

547 Class Type of defect List of mutations attributed to this class Class I Defective protein production Nonsense mutations: G542X, R1162X, RW1282X Deletions and insertions: CFTRdele2,3; 1078delT; 1717-1G ࢐ A; 3659delC; 621+1G N T Class II Defective protein processing G85E, F508del, I507del, R560T, A561E, R1066C, N1303K Class III Defective protein regulation (gating) G178R, S549N, S549R, G551D, G551S, G970R, G1244E, S1251N, S1255P, G1349D Class IV Defective protein conductance R334W, R347P, R117H Class V Reduced amount of functioning protein 2789+5G ࢐ A, 3272-26ANG, 3849+10KbC ࢐ T, A455E Class VI Reduced cell surface stability Rescued F508del, c.120del23 Unclassified All other mutations, including those unknown a F508del-CFTR pocket (at NBD1:ICL4 interface) (Farinha et al., 2013). Login to comment

PMID: 25033378 [PubMed] LaRusch J et al: "Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis."

No. Sentence Comment

269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

PMID: 25083129 [PubMed] Pettit RS et al: "CFTR Modulators for the Treatment of Cystic Fibrosis."

No. Sentence Comment

36 At 48 weeks, 67% of patients in the ivacaftor group had not had a pulmonary exacerbation compared with 41% in the Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Ramsey(2011)30 STRIVE: Randomized, double-blind, placebo-controlled G551D Age 12-53 years N = 161 FEV1 40-90% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Percent change in FEV1 from baseline to 24 wks (P < 0.001): IVA, 10.4%; PBO, -0.2% ߦ Percent change in FEV1 from baseline to 48 wks compared with PBO (P < 0.001): IVA, 10.5% ߦ Percent of patients pulmonary exacerbation-free at 48 wks: IVA, 67%; PBO, 41% ߦ Change in body weight from baseline to 48 wks: IVA, 3.1 kg; PBO, 0.4 kg ߦ Sweat chloride change from baseline to 48 wks compared with PBO (P < 0.001): IVA, -48.1 mmol/L ߦ Change in CFQ-R respiratory domain from baseline to 48 wks (P < 0.001): IVA, 5.9 pts; PBO, -2.7 pts Davies (2013)29 ENVISION: Randomized, double-blind, placebo-controlled G551D Age 6-11 years N = 52 FEV1 40-105% IVA 150 mg b.i.d. or PBO b.i.d. 48 wks ߦ Absolute change in FEV1 percentage from baseline at 48 wks compared with PBO (P < 0.001): IVA, 10% ߦ Absolute change in FEV1 percentage from baseline at 24 wks (P < 0.001): IVA, 12.6%; PBO, 0.1% ߦ Mean change in sweat chloride from baseline to 48 wks compared with PBO (P < 0.001): IVA, -54.3 mmol/L ߦ Body weight change from baseline to 48 wks compared with PBO (P < 0.001): IVA, 2.8 kg ߦ Absolute CFQ-R change from baseline to 24 wks compared with PBO (P = 0.109): IVA, 6.1 pts McKone (2013)31 PERSIST: Open-label extension G551D Age ࣙ 6 years Patients had completed 48 wks of either ENVISION or STRIVE IVA 150 mg b.i.d. 96 wks (patients received 96 wks or 144 wks of IVA depending on ENVISION or STRIVE randomization) ߦ Absolute change in percent predicted FEV1: &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 9.4 &#b1; 8.3 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 9.4 &#b1; 10.8 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: -1.2 &#b1; 7.8 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 9.5 &#b1; 11.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 10.2 &#b1; 15.7 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 10.3 &#b1; 12.4 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: -0.6 &#b1; 10.1 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.5 &#b1; 11.5 ߦ Absolute change in weight (kg): &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 3.4 &#b1; 4.9 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 4.1 &#b1; 7.1 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: 0.3 &#b1; 2.2 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 3 &#b1; 4.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 6.1 &#b1; 2.9 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 14.8 &#b1; 5.7 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: 2.9 &#b1; 1.8 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.1 &#b1; 4.1 ߦ Absolute change in CFQ-R respiratory domain: &#b0; &#b0; STRIVE (IVA ࢐ IVA) Study start (48 wks of prior treatment): 6.4 &#b1; 16.8 &#b0; &#b0; STRIVE (IVA ࢐ IVA) 144 wks: 6.8 &#b1; 19.6 &#b0; &#b0; STRIVE (PBO ࢐ IVA) Study start: -3.6 &#b1; 14.1 &#b0; &#b0; STRIVE (PBO ࢐ IVA) 96 wks: 9.8 &#b1; 16.2 &#b0; &#b0; ENVISION (IVA ࢐ IVA) Study start (48 wks of prior treatment): 7.4 &#b1; 17.4 &#b0; &#b0; ENVISION (IVA ࢐ IVA) 144 wks: 10.6 &#b1; 18.9 &#b0; &#b0; ENVISION (PBO ࢐ IVA) Study start: 0.8 &#b1; 18.4 &#b0; &#b0; ENVISION (PBO ࢐ IVA) 96 wks: 10.8 &#b1; 12.8 CFTR Modulators for the Treatment of Cystic Fibrosis Table 2 Ivacaftor Clinical Trials Reference Design CFTR Mutation Population Treatment Duration Results Davies (2013)32 Placebo-controlled, double-blind, crossover study G551D Age > 6 years N = 17 FEV1 > 90% LCI > 7.4 Sequence 1: PBO ࢐ WO ࢐ IVA 150 mg b.i.d. Sequence 2: IVA 150 mg b.i.d. ࢐ WO ࢐ PBO 28-day treatment and WO periods ߦ Average change in LCI from baseline compared with PBO (P < 0.0001): IVA, -2.16 (95% CI, -2.88 to -1.44) ߦ Average change in FEV1 from baseline compared with PBO (P = 0.0103): IVA, 8.67 (95% CI, 2.36 to 14.97) ߦ Average change in FEF25-75 from baseline compared with PBO (P = 0.0237): IVA, 16.56 (95% CI, 2.30 to 27.71) Barry (2013)34 Retrospective review G551D Age 20-31 in IVA group N = 21 FEV1 < 40% IVA 150 mg b.i.d. (n = 21); matched controls (n = 35) Median duration, 237 days ߦ Absolute FEV1 change from baseline (P = 0.0075): IVA, 0.125 L; CON, 0.01 L ߦ Percent predicted FEV1 change from baseline (P = 0.0092): IVA, 12.7%, CON, 2.2% ߦ Median weight increase from baseline: IVA, 1.8 kg; CON, 0.1 kg ߦ Median inpatient days per year decreased from 23 days to 0 days in the IVA group (P = 0.001) ߦ Median total intravenous antibiotic days per year decreased from 74 days to 38 days in the IVA group (P = 0.002) De Boeck (2013)37 KONNECTION: Randomized, double-blind, crossover, placebo-controlled Non-G551D gating mutations G178R, G551S, S549N, S549R, G970R, G1244E, S1251N, S1255P, G1349D Age ࣙ 6 years N = 39 FEV1 ࣙ 40% Treatment sequence 1: IVA 150 mg b.i.d. ࢐ WO ࢐ PBO ࢐ open-label Treatment sequence 2: PBO ࢐ WO ࢐ IVA 150 mg b.i.d. ࢐ open-label 8 wks of IVA or PBO; 4-8 wks WO period; 16 wks open label ߦ Absolute change from baseline percent predicted FEV1 (P < 0.0001): IVA, 7.49%; PBO, -3.19% ߦ Absolute change from baseline BMI (P < 0.0001): IVA, 0.68; PBO, 0.02 ߦ Absolute change from baseline in CFQ-R respiratory domain (P = 0.0004): IVA, 8.94 pts; PBO, -0.67 pts ߦ Absolute change from baseline in sweat chloride (mmol/L): IVA, -52.28; PBO, -3.11 Flume (2011)35 Randomized, double-blind, placebo-controlled, parallel group with open-label extension Homozygous F508del Age ࣙ 12 years Part 1: N = 140 Part 2: N = 33 42 patients were eligible for part 2 if change in FEV1 ࣙ 10% or sweat chloride decreased by at least 15 mmol/L at day 15 and week 8 Part 1: IVA 150 mg b.i.d. or PBO 16 wks Part 2: Open label IVA 150 mg b.i.d. Login to comment
56 These promising results led to an FDA label expansion to include CF patients with the following eight mutations in addition to G551D: G178R, S549R, S549N, G551S, G1244E, S1251N, S1255P, and G1349D.38 Clinical Considerations Ivacaftor was well tolerated in clinical trials. Login to comment

PMID: 25088968 [PubMed] Chen JH et al: "A cocktail drug therapy for patients with cystic fibrosis?"

No. Sentence Comment

6 More recently, VX-770 has been approved by the FDA (NDA 203188, www.fda.gov) and recommended by the EMA (EMA/CHMP/365663/2014) for use with an additional eight CF gating (class III) mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D), although, including G551D, these mutations still just occur in ~5% of CF patients worldwide. Login to comment

PMID: 25287046 [PubMed] Mornon JP et al: "Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics."

No. Sentence Comment

359 Third, at the level of the NBD1:NBD2 heterodimer, CF-causing mutations are concentrated within the canonical ATP-binding site (S549N, S549R, G551D/G551S, G1244E, S1251N, and S1255P) (Fig. 7d). Login to comment
360 The effects of remaining mutations listed in CFTR2 database can also be well understood in light of our structural data: (1) A455E has indeed no room to be well adapted, (2) G1244E (mentioned above) also occurs in a well conserved position (position 23 in Online Resource 2), (3) L467P might disturb the helix in which it is included, (4) G1349D is in the non-canonical ATP-binding site and, alike its corresponding G551D, has no room to be well adapted in presence of ATP, and finally (5) N1303K might disturb the large Q-loop of the NBD2 a-helical subdomain (position 42 in Online Resource 1 and Online Resource 2). Login to comment

PMID: 25304080 [PubMed] Dell'Edera D et al: "Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study."

No. Sentence Comment

47 The molecular analysis of the CFTR gene revealed that the two Table 1 Number of subjects tested who were carriers of the cystic fibrosis transmembrane regulator gene Mutation Men Women Total G551D 1 2 3 R553X 0 1 1 F508del 35 32 67 N1303K 7 8 15 I148T 4 9 13 G542X 3 6 9 DI507 2 0 2 L1077P 0 2 2 D1152H 1 6 7 W1282X 2 0 2 2183 AA>G 3 0 3 1259insA 0 1 1 4016insT 1 0 1 I507del 1 0 1 2789+5G>A 1 0 1 4382delA 0 2 2 G1244E 1 0 1 621+3A>G 1 0 1 Total 63 69 132 Figure 1 76 patients with cystic fibrosis and positive sweat test, all have two genes mutated. Login to comment
59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17]. Login to comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

PMID: 25674778 [PubMed] Baker MW et al: "Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study."

No. Sentence Comment

15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

PMID: 25835118 [PubMed] Sisman G et al: "Mutation analysis of PRSS1, SPINK1 and CFTR gene in patients with alcoholic and idiopathic chronic pancreatitis: A single center study."

No. Sentence Comment

45 DNA samples were multiplied by multiplex PCR with a CF 22Mut and CF 14Mut+Tn strip assay kit which has 36 common mutations of the CFTR gene (DF508, DI507, F508C, I502T, 1706del17, 1677del TA, G542X, 1717-1G>A, R553X, Q552X, G551D, S549R(A>C), N1303K, 4016insT, R1162X, R1158X, W1282X, G1244E, 2789+5G>A, 2183AA>G, 711+5G>A, 711+1G>T, G85E, 3849+10kbC>T, 621+1G>T, R117H, D1152H, L1065P, R1066H, L1077P, 4382delA, 1259insA, 852del22, R347P, T338I, S912X and Allele5T-7T-9T). Login to comment

PMID: 25867140 [PubMed] Eckford PD et al: "Functional reconstitution and channel activity measurements of purified wildtype and mutant CFTR protein."

No. Sentence Comment

30 While the correctors VX-809 and VX-661 (are not yet approved for use in patients, the potentiator Kalydeco (ivacaftor; VX-770) is being used at 150 mg every 12 hr in CF patients >6 years with at least one G551D-CFTR mutation, and more recently for patients with one of G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D. Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

390 L1077P c.3230T>C CF-PI CF-causing p.Leu1077Pro Y1092X(C>A) c.3276C>A CF-PI CF-causing p.Tyr1092* M1137V c.3409A>G CFTR-RD nd p.Met1137Val D1152H c.3454G>C CF-PI,CF-PS,CFTR-RD varying clinical consequence p.Asp1152His R1162X c.3484C>T CF-PI CF-causing p.Arg1162* D1168G c.3503A>G CFTR-RD nd p.Asp1168Gly 3667ins4 c.3535_3536insTCAA CF-PI CF-causing p.Thr1179IlefsX17 S1206X c.3617C>A uncertain: CF-PI and/or CF-PS nd p.Ser1206* I1234V c.3700A>G CF-PI,CF-PS CF-causing p.Ile1234Val S1235R c.3705T>G CFTR-RD non CF-causing p.Ser1235Arg 3849+10kbC>T c.3717+12191C>T CF-PI,CF-PS CF-causing V1240G c.3719T>G CFTR-RD nd p.Val1240Gly G1244R c.3730G>A uncertain: CF-PI and/or CF-PS nd p.Gly1244Arg G1244E c.3731G>A CF-PI,CF-PS CF-causing p.Gly1244Glu G1247R(G>C) c.3739G>C CF-PS nd p.Gly1247Arg W1282X c.3846G>A CF-PI CF-causing p.Trp1282* Q1291R c.3872A>G CF-PI,CF-PS,CFTR-RD nd p.Gln1291Arg 4016insT c.3884_3885insT CF-PI CF-causing p.Ser1297PhefsX5 4040delA c.3908delA CF-PI nd p.Asn1303ThrfsX25 N1303K c.3909C>G CF-PI CF-causing p.Asn1303Lys ex22-24del c.3964-3890_4443+3143del9454ins5 CF-PI nd ex22,23del c.3964-78_4242+577del1532 CF-PI CF-causing 4168delCTAAGCC c.4036_4042del CF-PI nd p.Leu1346MetfsX6 G1349D c.4046G>A CF-PI CF-causing p.Gly1349Asp H1375P c.4124A>C uncertain: CF-PI and/or CF-PS nd p.His1375Pro S1455X c.4364C>G CF-PS,CFTR-RD nd p.Ser1455* Q1476X c.4426C>T CFTR-RD nd p.Gln1476* nd,Not determined.According to the three rules described (see Materials and Methods),each mutated allele was classified according to its clinical outcome.It was impossible to univocally assign 16 of the 125 different mutated alleles to one or more macrocategories.A comparison with the CFTR2 project (11) (http://www.cftr2.org) is shown.The alleles are ordered according to their nucleotidic position. Login to comment

PMID: 25940043 [PubMed] Corvol H et al: "Translating the genetics of cystic fibrosis to personalized medicine."

No. Sentence Comment

155 Furthermore, Kalydeco has been tested in patients carrying other class III mutations, or targeted class IVand V mutations (sharing functional similarities with the class III).58 The new trials led to an extension of the FDA and European Medical Agency approval to 8 additional gating mutations: p.Gly178Arg (p.G178R), p.Ser549Asn (p.S549N), p.Ser549Arg (p.S549R), p.Gly551Ser (p.G551S), p.Gly1244Glu (p.G1244E), p.Ser1251Asn (p.S1251N), p.Ser1255Pro (pS1255P), and p.Gly1349Asp (p.G1349D).59 Recently, ivacaftor has also been shown to benefit patients carrying the c.350G . Login to comment

PMID: 26014425 [PubMed] Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."

No. Sentence Comment

84 G1244E c.3731G4A p.Gly1244Glu 3876delA c.3744delA p.Lys1250Argfs*9 S1251N c.3752G4A p.Ser1251Asn 3905insT c.3773dupT p.Leu1258Phefs*7 4005+1G4A c.3873+1G4A 4016insT c.3889dupT p.Ser1297Phefs*5 Q1313X c.3937C4T p.Gln1313* CFTRdele22,23 c.3964-78_4242+577del p. Login to comment

PMID: 26021452 [PubMed] Corvol H et al: "[Challenges of personalized medicine for cystic fibrosis]."

No. Sentence Comment

135 Compte tenu de l`efficacite &#b4; de KalydecoW chez ces patients, le laboratoire VertexW a ensuite teste &#b4;, puis de &#b4;montre &#b4; son efficacite &#b4; chez des patients porteurs d`autres mutations de classe III, ce qui a permis cette anne &#b4;e une extension d`autorisation de mise sur le marche &#b4; (AMM) pour 8 mutations supple &#b4;mentaires : G1244E, G1349D, G178R, G551S, S1251N, S1255P, S549N et S549R [37]. Login to comment

PMID: 26087176 [PubMed] Dupuis A et al: "Prevalence of meconium ileus marks the severity of mutations of the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) gene."

No. Sentence Comment

76 Using the US and Italian data, we calculated equally low MIP scores for G178R (0.09, n = 22), S549N (0.12, n = 39), S1251N (0.07, n = 14), and G1244E (0.0, n = 3), but not for S549R (0.21, n = 14) (Supplementary Table S1 online). Login to comment
105 MIP scores were significantly different between the mutations F508del and G551D, which is in agreement with early studies of smaller numbers of patients with CF that reported a lower MI incidence in patients carrying F508del/G551D when compared with patients with CF with F508del/ F508del.28,29 We demonstrated equally low MIP scores for other class III CFTR mutations (G178R, S549N, G1244E, S1251N), further supporting the idea that class III CFTR mutations are not as severe as F508del, at least with respect to gastrointestinal development. Login to comment

PMID: 26115565 [PubMed] Mall MA et al: "Targeting ion channels in cystic fibrosis."

No. Sentence Comment

604 When tested in clinical trials, the potentiator ivacaftor (also known as VX-770) showed a marked clinical benefit, with substantial improvement of lung function, reduction of pulmonary exacerbations, and increase in body weight in CF patients with G551D and 8 additional Class III mutations (G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D) [32-35]. Login to comment

PMID: 26526359 [PubMed] Amaral MD et al: "Hallmarks of therapeutic management of the cystic fibrosis functional landscape."

No. Sentence Comment

656 The FDA approval of Ivacaftor for multiple G551D like phenotypic variants including G178R, S549N, S549R, G551S, G1244E, S1251N, S1255P and G1349D [159,160] found at the cell surface with gating defects [161,162], and the FDA-approval of a combination of Lumacaftor and Ivacaftor for treatment of F508del [156] are examples of successful application of these technologies. Login to comment