ABCMdb

ABCA1 p.Lys776Asn

Predicted by SNAP2:	A: D (71%), C: D (66%), D: D (85%), E: D (85%), F: D (80%), G: D (80%), H: D (66%), I: D (59%), L: D (59%), M: D (63%), N: D (91%), P: D (95%), Q: D (85%), R: N (66%), S: D (66%), T: D (66%), V: D (71%), W: D (85%), Y: D (71%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, L: D, M: D, N: D, P: D, Q: D, R: N, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Exome sequencing identifies 2 rare variants for lo... Circ Cardiovasc Genet. 2012 Oct 1;5(5):538-46. doi: 10.1161/CIRCGENETICS.112.963264. Epub 2012 Aug 25. Reddy MV, Iatan I, Weissglas-Volkov D, Nikkola E, Haas BE, Ruel MJ, Sinsheimer JS, Genest J, Pajukanta P
Exome sequencing identifies 2 rare variants for low high-density lipoprotein cholesterol in an extended family.
Circ Cardiovasc Genet. 2012 Oct 1;5(5):538-46. doi: 10.1161/CIRCGENETICS.112.963264. Epub 2012 Aug 25., [PMID:22923419]

Abstract [show]
Background- Exome sequencing is a recently implemented method to discover rare mutations for Mendelian disorders. Less is known about its feasibility to identify genes for complex traits. We used exome sequencing to search for rare variants responsible for a complex trait, low levels of serum high-density lipoprotein cholesterol (HDL-C). Methods and Results- We conducted exome sequencing in a large French-Canadian family with 75 subjects available for study, of which 27 had HDL-C values less than the fifth age-sex-specific population percentile. We captured approximately 50 Mb of exonic and transcribed sequences of 3 closely related family members with HDL-C levels less than the fifth age-sex percentile and sequenced the captured DNA. Approximately 82 000 variants were detected in each individual, of which 41 rare nonsynonymous variants were shared by the sequenced affected individuals after filtering steps. Two rare nonsynonymous variants in the ATP-binding cassette, subfamily A (ABC1), member 1 (ABCA1), and lipoprotein lipase genes predicted to be damaging were investigated for cosegregation with the low HDL-C trait in the entire extended family. The carriers of either variant had low HDL-C levels, and the individuals carrying both variants had the lowest HDL-C values. Interestingly, the ABCA1 variant exhibited a sex effect which was first functionally identified, and, subsequently, statistically demonstrated using additional French-Canadian families with ABCA1 mutations. Conclusions- This complex combination of 2 rare variants causing low HDL-C in the extended family would not have been identified using traditional linkage analysis, emphasizing the need for exome sequencing of complex lipid traits in unexplained familial cases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Genotype by sex interaction We included the extended family together with 10 additional families with previously identified mutations in ABCA16-8 in a gene-sex interaction analysis, comprising 200 individuals and 9 different mutations in ABCA1 (DelED1893, G616V, K776N, N1800H, Q2210H, R1851X, R2084X, R909X and S1731C). Login to comment
41 Genotype by Sex Interaction We included the extended family together with 10 additional families with previously identified mutations in ABCA16 -8 in a gene-sex interaction analysis, comprising 200 individuals and 9 different mutations in ABCA1 (DelED1893, G616V, K776N, N1800H, Q2210H, R1851X, R2084X, R909X, and S1731C). Login to comment
158 Figure 3 shows the age-sex specific population HDL-C percentiles by ABCA1 genotypes and sex in 200 French-Canadian family members from 11 French-Canadian families with different ABCA1 mutations (DelED1893, G616V, K776N, N1800H, Q2210H, R1851X, R2084X, R909X, and S1731C). Login to comment

[hide] Increased risk of coronary artery disease in Cauca... Biochim Biophys Acta. 2012 Mar;1821(3):416-24. doi: 10.1016/j.bbalip.2011.08.006. Epub 2011 Aug 19. Tietjen I, Hovingh GK, Singaraja R, Radomski C, McEwen J, Chan E, Mattice M, Legendre A, Kastelein JJ, Hayden MR
Increased risk of coronary artery disease in Caucasians with extremely low HDL cholesterol due to mutations in ABCA1, APOA1, and LCAT.
Biochim Biophys Acta. 2012 Mar;1821(3):416-24. doi: 10.1016/j.bbalip.2011.08.006. Epub 2011 Aug 19., [PMID:21875686]

Abstract [show]
Mutations in ABCA1, APOA1, and LCAT reduce HDL cholesterol (HDLc) in humans. However, the prevalence of these mutations and their relative effects on HDLc reduction and risk of coronary artery disease (CAD) are less clear. Here we searched for ABCA1, APOA1, and LCAT mutations in 178 unrelated probands with HDLc <10th percentile but no other major lipid abnormalities, including 89 with >/=1 first-degree relative with low HDLc (familial probands) and 89 where familial status of low HDLc is uncertain (unknown probands). Mutations were most frequent in LCAT (15.7%), followed by ABCA1 (9.0%) and APOA1 (4.5%), and were found in 42.7% of familial but only 14.6% of unknown probands (p=2.44 *10(-5)). Interestingly, only 16 of 24 (66.7%) mutations assessed in families conferred an average HDLc <10th percentile. Furthermore, only mutation carriers with HDLc <5th percentile had elevated risk of CAD (odds ratio (OR)=2.26 for 34 ABCA1 mutation carriers vs. 149 total first-degree relative controls, p=0.05; OR=2.50 for 26 APOA1 mutation carriers, p=0.04; OR=3.44 for 38 LCAT mutation carriers, p=1.1 *10(-3)). These observations show that mutations in ABCA1, APOA1, and LCAT are sufficient to explain >40% of familial hypoalphalipoproteinemia in this cohort. Moreover, individuals with mutations and large reductions in HDLc have increased risk of CAD. This article is part of a Special Issue entitled Advances in High Density Lipoprotein Formation and Metabolism: A Tribute to John F. Oram (1945-2010).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 COOHA B T929I H2N R587W B A M1091T C1477R K776N N935S S1181F IVS24+1 G>C V2244I R282X D571G M640L S930F M968T R1615WIVS16-5 CA>del ABCA1 Transmembrane domain ATP-binding domain Q597R A) AA 1 AA 267 K130del L202P 74 90 98 112 122 145 167 189 211 215 233 253 APOA1 Negative charge domain Alpha-helix E222K E134DT37M 140 178 206 41127 104 121 165 200 229 360 391 Y135N V246F 127 206 369 401 Catalytic triad R322C L338H V371MV52M Y107X A117T T147I V333M Phe Leu Asp His AA 1 AA 440 R159Q I202T LCAT Alpha helixBeta sheet B) 419I.Tietjenetal./BiochimicaetBiophysicaActa1821(2012)416-424 3.4. Login to comment
169 Effects of some ABCA1 mutations described here are also consistent with previous in vitro cellular efflux studies; for example, the highly expressive ABCA1 mutations R587W, Q597R, N935S, and M1091T cause ~10-25% of wild-type efflux in vitro, while the less expressive mutations K776N and T929I cause 62 and 80% efflux, respectively [35-37]. Login to comment
170 Our data are also consistent with previous observations of K776N conferring average minimal HDLc reduction in mutation carriers [38]. Login to comment

[hide] Genetic variation in the ABCA1 gene, HDL cholester... Atherosclerosis. 2010 Feb;208(2):305-16. Epub 2009 Jun 11. Frikke-Schmidt R
Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population.
Atherosclerosis. 2010 Feb;208(2):305-16. Epub 2009 Jun 11., [PMID:19596329]

Abstract [show]
Epidemiological studies consistently demonstrate a strong inverse association between low levels of high-density lipoprotein (HDL) cholesterol and increased risk of ischemic heart disease (IHD). This review focuses on whether both rare and common genetic variation in ABCA1 contributes to plasma levels of HDL cholesterol and to risk of IHD in the general population, and further seeks to understand whether low levels of HDL cholesterol per se are causally related to IHD. Studies of the ABCA1 gene demonstrate a general strategy for detecting functional genetic variants, and show that both common and rare ABCA1 variants contribute to levels of HDL cholesterol and risk of IHD in the general population. The association between ABCA1 variants and risk of IHD appears, however, to be independent of plasma levels of HDL cholesterol. With the recent identification of the largest number of individuals heterozygous for loss-of-function mutations in ABCA1 worldwide, population studies suggests that genetically low HDL cholesterol per se does not predict an increased risk of IHD, and thus questions the causality of isolated low levels of HDL cholesterol for the development of IHD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2338 The remaining non-synonymous mutations (S364C, T774P, and K776N), ranging in frequency from 0.1 to four per 1000, were not associated with low HDL cholesterol levels [65,66]. Login to comment
2368 Genetically increased IHD risk without low HDL cholesterol Another situation was observed with the identification of 37 heterozygous carriers of the K776N mutation in the CCHS [65]. Login to comment
2370 Several arguments favor the functionality of the K776N mutation, among these that the involved amino acid residue is completely conserved between species, and relatively conserved between 12 human ABCAs with very different transport functions [57]. Login to comment
2371 Furthermore, a mutation (R347P) causing cystic fibrosis has been identified in the CFTR gene (=ABCC7, another full ABC transporter) at a site that corresponds to residue 764 in ABCA1 [73], i.e. in close vicinity to the K776N mutation. Login to comment
2372 Also, the application of a substitution position-specific evolutionary conservation score (subPSEC score) [74], which considers site-specific variation among evolutionarily related proteins, predicted the K776N mutation to be deleterious [75]. Login to comment
2376 Thus, it could be speculated that the membrane associated K776N mutation impairs the apoptotic machinery and consequently induces inflammation and atherogenesis without affecting the lipid efflux capacity and thus the level of HDL cholesterol in plasma. Login to comment
2377 The K776N variant has been reported previously, but no association with IHD was observed [81], probably due to a low number of carriers in that study. Login to comment
2378 Although, heterozygous men for the K776N mutation, had marginally lower levels of HDL cholesterol compared to non-carriers in the general population (Fig. 3, lower panel), the two- to three-fold increase in risk of IHD could not be explained by this effect on HDL cholesterol [65]. Login to comment
2380 K776N heterozygotes, ischemic heart disease (IHD) and high-density lipoprotein (HDL) cholesterol levels. Login to comment
2381 Cumulative incidence of IHD as a function of age and by K776N genotype (upper panel), and exact values of HDL cholesterol for the individual heterozygotes as a function of age (lower panels). Login to comment
2385 Frikke-Schmidt et al. revealed four major findings: (1) approximately 10% of individuals with the lowest percentile of HDL cholesterol in the general population are heterozygous for mutations in ABCA1 [57], (2) the frequency of FHA caused by ABCA1 mutations in the general population is about three in 1000 [66], or considerably higher than previously assumed, (3) heterozygosity for a specific mutation, K776N, predicts a two- to three-fold risk of IHD, independent of HDL cholesterol levels [65], and (4) low plasma levels of HDL cholesterol due to heterozygosity for loss-of-function mutations in ABCA1 are not associated with an increased risk of IHD, supporting that a genetically lifelong reduction in plasma levels of HDL cholesterol per se does not predict an increased risk of IHD [66]. Login to comment
2384 Frikke-Schmidt et al. revealed four major findings: (1) approximately 10% of individuals with the lowest percentile of HDL cholesterol in the general population are heterozygous for mutations in ABCA1 [57], (2) the frequency of FHA caused by ABCA1 mutations in the general population is about three in 1000 [66], or considerably higher than previously assumed, (3) heterozygosity for a specific mutation, K776N, predicts a two- to three-fold risk of IHD, independent of HDL cholesterol levels [65], and (4) low plasma levels of HDL cholesterol due to heterozygosity for loss-of-function mutations in ABCA1 are not associated with an increased risk of IHD, supporting that a genetically lifelong reduction in plasma levels of HDL cholesterol per se does not predict an increased risk of IHD [66]. Login to comment

[hide] ABCA1 gene mutations, HDL cholesterol levels, and ... JAMA. 2008 Nov 5;300(17):1997-8; author reply 1998. Brunham LR, Kastelein JJ, Hayden MR
ABCA1 gene mutations, HDL cholesterol levels, and risk of ischemic heart disease.
JAMA. 2008 Nov 5;300(17):1997-8; author reply 1998., [PMID:18984885]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 In contrast, many of the pathogenic ABCA1 mutations that have been extensively characterized have less than 20% to 30% of normal efflux activity.2 These findings are also in contrast to reports from the same group on the same cohort that showed that genetic variation in ABCA1 influences IHD in the general population and, in the case of the variants K776N (in men)4 and R1587K,5 is associated with low HDL cholesterol levels. Login to comment
28 In contrast, many of the pathogenic ABCA1 mutations that have been extensively characterized have less than 20% to 30% of normal efflux activity.2 These findings are also in contrast to reports from the same group on the same cohort that showed that genetic variation in ABCA1 influences IHD in the general population and, in the case of the variants K776N (in men)4 and R1587K,5 is associated with low HDL cholesterol levels. Login to comment

[hide] Effect of ABCA1 mutations on risk for myocardial i... Curr Atheroscler Rep. 2008 Oct;10(5):413-26. Iatan I, Alrasadi K, Ruel I, Alwaili K, Genest J
Effect of ABCA1 mutations on risk for myocardial infarction.
Curr Atheroscler Rep. 2008 Oct;10(5):413-26., [PMID:18706283]

Abstract [show]
The adenosine triphosphate-binding cassette A1 (ABCA1) gene codes for a cellular phospholipid and cholesterol transporter that mediates the initial and essential step in high-density lipoprotein (HDL) biogenesis: the formation of nascent HDL particles. Mutations at the ABCA1 gene locus cause severe familial HDL deficiency and, in the homozygous form, cause Tangier disease. Several studies have investigated the influence of ABCA1 variation on lipid metabolism and coronary heart disease, but they have resulted in controversial and inconsistent results. Genetic variability at the ABCA1 gene has also been associated with increased risk of myocardial infarction. In one study, this association was independent of HDL cholesterol levels, raising the possibility that the measurement of HDL cholesterol levels may not provide adequate information on the functional roles of HDL particles. Nevertheless, genomic screening for complex diseases, such as coronary heart disease, and HDL deficiency in particular, may not add additional information to that gained from conventional global cardiovascular risk stratification.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
144 CC: 1.29 ± 0.64 CT: 1.28 ± 0.32 TT: 1.26 ± 0.35 Frikke-Schmidt et al. [36] / 2005 Copenhagen City Heart Study: K776N Heterozygosity for the K776N ABCA1 mutation conferred a twofold to threefold increase risk of IHD, independent of plasma HDL-C. Login to comment
145 The K776N polymorphism was a better predictor of IHD as compared with traditional cardiovascular risk factors. Login to comment
146 Noncarriers ( n = 9039) Women: 1.72 ± 0.01 Men: 1.38 ± 0.01 K776N carriers ( n = 37) Women: 1.82 ± 0.11 Men: 1.18 ± 0.09 P = 0.05 Martin et al. [37] / 2006 Cohort of males diagnosed with MI ( n = 170) NA C-477T † , R219K, I883M In long-term MI prognosis, the C-477T ABCA1 variant was associated with an unfavorable clinical evolution Controls: valvular patients with normal coronariography controls ( n = 100) *Studies reporting the initial molecular and biochemical characterization of fewer than 5 probands with an ABCA1 gene defect and their families were not included in Table 2. Login to comment
165 Indeed, it was documented that a completely conserved ABCA1 common mutation, K776N (frequency, 0.4%), was found to confer a twofold to threefold increase in risk of IHD in 37 heterozygous participants in the Copenhagen City Heart Study (Table 2). Login to comment

[hide] Association of loss-of-function mutations in the A... JAMA. 2008 Jun 4;299(21):2524-32. Frikke-Schmidt R, Nordestgaard BG, Stene MC, Sethi AA, Remaley AT, Schnohr P, Grande P, Tybjaerg-Hansen A
Association of loss-of-function mutations in the ABCA1 gene with high-density lipoprotein cholesterol levels and risk of ischemic heart disease.
JAMA. 2008 Jun 4;299(21):2524-32., [PMID:18523221]

Abstract [show]
CONTEXT: Low levels of high-density lipoprotein (HDL) cholesterol are inversely related to cardiovascular risk. Whether this is a causal effect is unclear. OBJECTIVE: To determine whether genetically reduced HDL cholesterol due to heterozygosity for 4 loss-of-function mutations in ABCA1 cause increased risk of ischemic heart disease (IHD). DESIGN, SETTING, AND PARTICIPANTS: Three studies of white individuals from Copenhagen, Denmark, were used: the Copenhagen City Heart Study (CCHS), a 31-year prospective general population study (n = 9022; 28 heterozygotes); the Copenhagen General Population Study (CGPS), a cross-sectional general population study (n = 31,241; 76 heterozygotes); and the Copenhagen Ischemic Heart Disease Study (CIHDS), a case-control study (n = 16,623; 44 heterozygotes). End points in all 3 studies were recorded during the period of January 1, 1976, through July 9, 2007. MAIN OUTCOME MEASURES: Levels of HDL cholesterol in the general population, cellular cholesterol efflux, and the association between IHD and HDL cholesterol and genotype. RESULTS: Heterozygotes vs noncarriers for 4 ABCA1 mutations (P1065S, G1216V, N1800H, R2144X) had HDL cholesterol levels of 41 mg/dL (interquartile range, 31-50 mg/dL) vs 58 mg/dL (interquartile range, 46-73 mg/dL), corresponding to a reduction in HDL cholesterol of 17 mg/dL (P < .001). A 17-mg/dL lower HDL cholesterol level in the CCHS was associated with a multifactorially adjusted hazard ratio for IHD of 1.70 (95% confidence interval [CI], 1.57-1.85). However, for IHD in heterozygotes vs noncarriers, the multifactorially adjusted hazard ratio was 0.67 (95% CI, 0.28-1.61; 1741 IHD events) in the CCHS, the multifactorially adjusted odds ratio was 0.82 (95% CI, 0.34-1.96; 2427 IHD events) in the CGPS, and the multifactorially adjusted odds ratio was 0.86 (95% CI, 0.32-2.32; 2498 IHD cases) in the CIHDS. The corresponding odds ratio for IHD in heterozygotes vs noncarriers for the combined studies (n = 41,961; 6666 cases; 109 heterozygotes) was 0.93 (95% CI, 0.53-1.62). CONCLUSION: Lower plasma levels of HDL cholesterol due to heterozygosity for loss-of-function mutations in ABCA1 were not associated with an increased risk of IHD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 The 9022 individuals were genotyped for all non-synonymous mutations (S364C, T774P, K776N, P1065S, G1216V, N1800H, R2144X [http://www.hgmd.cf.ac.uk/ac /index.php; http://www.mutdb.org]), which were previously identified by resequencing the promoter, coding region,andconsensussplicesitesofABCA1 in 190 individuals of Danish ancestry with high and low HDL cholesterol levels.13 All end points and data collection were recorded in the follow-up period of January 1, 1976, through July 9, 2007. Login to comment
70 reductions in levels of HDL cholesterol in plasma in heterozygotes vs noncarriers in the CCHS as well as in the CGPS, while 3 were not (S364C, T774P, K776N). Login to comment
25 The 9022 individuals were genotyped for all nonsynonymous mutations (S364C, T774P, K776N, P1065S, G1216V, N1800H, R2144X [http://www.hgmd.cf.ac.uk/ac /index.php; http://www.mutdb.org]), which were previously identified by resequencing the promoter, coding region,andconsensussplicesitesofABCA1 in 190 individuals of Danish ancestry with high and low HDL cholesterol levels.13 All end points and data collection were recorded in the follow-up period of January 1, 1976, through July 9, 2007. Login to comment
54 LOSS-OF-FUNCTION MUTATIONS IN THE ABCA1 GENE AND RISK OF ISCHEMIC HEART DISEASE 2528 reductions in levels of HDL cholesterol in plasma in heterozygotes vs noncarriers in the CCHS as well as in the CGPS, while were not (S364C, T774P, K776N). Login to comment

[hide] Genetic variation in ABCA1 predicts ischemic heart... Arterioscler Thromb Vasc Biol. 2008 Jan;28(1):180-6. Epub 2007 Oct 19. Frikke-Schmidt R, Nordestgaard BG, Jensen GB, Steffensen R, Tybjaerg-Hansen A
Genetic variation in ABCA1 predicts ischemic heart disease in the general population.
Arterioscler Thromb Vasc Biol. 2008 Jan;28(1):180-6. Epub 2007 Oct 19., [PMID:17951323]

Abstract [show]
OBJECTIVE: We tested the hypothesis that 6 nonsynonymous single nucleotide polymorphisms (SNPs) in ATP-Binding-Cassette transporter A1 (ABCA1) affect risk of ischemic heart disease (IHD) in the general population. METHODS AND RESULTS: We genotyped 9259 individuals from the Danish general population followed for 25 years. Two SNPs (V771M and V825I) were previously associated with increases in HDL-C, 1 (R1587K) with decreased HDL-C, whereas 3 (R219K, I883M and E1172D) did not affect HDL-C levels. Despite this, 5 out of 6 SNPs (V771M, V825I, I883M, E1172D, R1587K) predicted increased risk of IHD. Similar results were obtained in a verification sample with 932 IHD cases versus 7999 controls. A stepwise regression approach identified V771M, I883M, and E1172D as the most important predictors of IHD and additive effects on IHD risk were present for V771M/I883M and I883M/E1172D pairs. CONCLUSIONS: We show that 3 of 6 nonsynonymous SNPs in ABCA1 predict risk of IHD in the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
110 (6) We have recently shown that a common mutation (frequency 0.4%) in ABCA1, K776N, predicted a 2-to 3-fold increase in risk in the general population independent of HDL-C levels.33 (7) Finally, in the present study adjustments for HDL-C levels did not substantially alter the risk estimates, supporting that ABCA1 has effects on risk of IHD independent of HDL-C levels. Login to comment
104 (6) We have recently shown that a common mutation (frequency 0.4%) in ABCA1, K776N, predicted a 2-to 3-fold increase in risk in the general population independent of HDL-C levels.33 (7) Finally, in the present study adjustments for HDL-C levels did not substantially alter the risk estimates, supporting that ABCA1 has effects on risk of IHD independent of HDL-C levels. Login to comment

[hide] Functional mutations of the ABCA1 gene in subjects... Atherosclerosis. 2006 Oct;188(2):281-91. Epub 2005 Dec 15. Alrasadi K, Ruel IL, Marcil M, Genest J
Functional mutations of the ABCA1 gene in subjects of French-Canadian descent with HDL deficiency.
Atherosclerosis. 2006 Oct;188(2):281-91. Epub 2005 Dec 15., [PMID:16343503]

Abstract [show]
Mutations in the ABCA1 gene cause defective cellular lipid efflux and severe familial HDL deficiency. We examined the prevalence of mutations at the ABCA1 gene in 58 unrelated probands of French-Canadian descent with HDL deficiency (HDL-C<5th percentile). A defective cellular cholesterol or phospholipid efflux (<75% and <70% of normal controls, respectively) was identified in 14/58 (24%) of subjects. Using direct sequencing of the ABCA1 gene, we found mutations in 12/58 ( approximately 20%) of subjects. Four probands were previously identified with diverse ABCA1 gene defects. However, we identified a novel frameshift mutation (F1840L, L1869X); a proband was heteroallelic for the N1800H mutation, previously reported in a case of Tangier disease, and a novel missense mutation (Q2210H); a novel variant (G616V), predicted to impart a functional defect in the protein, was also found in another proband. Three probands had the S1731C mutation, while two others had the R1851X and K776N documented mutations, respectively. Taken together, these data suggest that approximately 20% of French-Canadian patients with severe HDL deficiency are associated with a defective ABCA1. Interestingly, in two families studied, mutations in the ABCA1 gene did not segregate with the lipid efflux defect, suggesting that other proteins are involved in the ABCA1-mediated cellular lipid efflux.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Three probands had the S1731C mutation, while two others had the R1851X and K776N documented mutations, respectively. Login to comment
124 Lastly, in proband PCH, we found the previously reported K776N, which did not show an unequivocal segregation within the family members (Fig. 2G). Login to comment
146 Proband PCH (Fig. 2G) was bearing the previously reported K776N mutation [5], predicted to be possibly damaging. Login to comment

[hide] Variations on a gene: rare and common variants in ... Annu Rev Nutr. 2006;26:105-29. Brunham LR, Singaraja RR, Hayden MR
Variations on a gene: rare and common variants in ABCA1 and their impact on HDL cholesterol levels and atherosclerosis.
Annu Rev Nutr. 2006;26:105-29., [PMID:16704350]

Abstract [show]
Cholesterol and its metabolites play a variety of essential roles in living systems. Virtually all animal cells require cholesterol, which they acquire through synthesis or uptake, but only the liver can degrade cholesterol. The ABCA1 gene product regulates the rate-controlling step in the removal of cellular cholesterol: the efflux of cellular cholesterol and phospholipids to an apolipoprotein acceptor. Mutations in ABCA1, as seen in Tangier disease, result in accumulation of cellular cholesterol, reduced plasma high-density lipoprotein cholesterol, and increased risk for coronary artery disease. To date, more than 100 coding variants have been identified in ABCA1, and these variants result in a broad spectrum of biochemical and clinical phenotypes. Here we review genetic variation in ABCA1 and its critical role in cholesterol metabolism and atherosclerosis in the general population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
522 A small number of mutations have been reported in more than one unrelated individual, such as N1800H (16, 28, 43), and the K776N variant that was recently reported to occur in a Danish population at a frequency of 0.4% and to be associated with a two- to threefold increased risk for ischemic heart disease (44). Login to comment
523 The K776N variant was initially described as a SNP (27); however, the Danish study reporting that it occurs at a frequency less than 1% and is associated with a strong phenotypic effect would suggest that this is a relatively "common" ABCA1 mutation, at least in the Danish population, influencing atherosclerosis susceptibility. Login to comment
555 Since a complete loss of function allele would be expected to result in a 50% reduction in HDL levels, a greater than 50% reduction in HDL is most likely explained by a dominant negative allele, in which TABLE 3 Patient phenotypes associated with heterozygous ABCA1 mutations Mutation HDL (mmol/L) HDL (% of control) Number of patients M1091T 0.48 ± 0.5 30 ± 30 4 G1216V 0.50 40 1 R2144X 0.56 ± 0.2 41 ± 18 12 R282X 0.52 41 1 R909X 0.59 ± 0.3 42 ± 19 5 K776N 0.55 ± 0.1 47 ± 5 2 R587W 0.61 ± 0.1 47 ± 8 7 S364C 0.60 48 1 P1065S 0.80 51 1 c-ter deletion 0.75 53 1 N1800H - 56.5 33 P85L 0.72 ± 0.4 57 ± 33 5 Del693L 0.79 ± 0.2 57 ± 15 8 D1289N 0.80 ± 0.1 59 ± 12 4 R2081W 0.80 ± 0.1 59 ± 12 4 2203X 0.80 ± 0.2 59 ± 20 4 DelED1893,4 0.77 ± 0.2 59 ± 18 8 2145X 0.82 ± 0.1 59 ± 9 4 A1046D 0.70 ± 0.1 60 ± 8 2 Q597R 0.82 ± 0.1 60 ± 5 5 C1477R 0.82 ± 0.2 61 ± 15 9 IVS25 + 1G > C 0.78 ± 0.1 62 ± 12 4 D1099Y 0.83 ± 0.3 63 ± 21 5 1552X 1.00 64 1 F2009S 0.82 ± 0.2 64 ± 19 6 R587W 0.86 ± 0.1 65 ± 17 2 R1068H 0.90 ± 0.3 67 ± 26 9 N935S 1.00 ± 0.3 74 ± 16 7 T929I 1.01 ± 0.2 76 ± 7 8 1284X 1.11 ± 0.2 83 ± 14 5 A937V 1.15 ± 0.6 85 ± 28 2 R1680W 1.22 ± 0.2 87 ± 17 3 635X 1.24 ± 0.5 90 ± 32 7 W590S 1.32 ± 0.6 103 ± 46 15 the mutant protein actually interferes with the activity of the remaining wild-type protein. Login to comment

[hide] Accurate prediction of the functional significance... PLoS Genet. 2005 Dec;1(6):e83. Epub 2005 Dec 30. Brunham LR, Singaraja RR, Pape TD, Kejariwal A, Thomas PD, Hayden MR
Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene.
PLoS Genet. 2005 Dec;1(6):e83. Epub 2005 Dec 30., [PMID:16429166]

Abstract [show]
The human genome contains an estimated 100,000 to 300,000 DNA variants that alter an amino acid in an encoded protein. However, our ability to predict which of these variants are functionally significant is limited. We used a bioinformatics approach to define the functional significance of genetic variation in the ABCA1 gene, a cholesterol transporter crucial for the metabolism of high density lipoprotein cholesterol. To predict the functional consequence of each coding single nucleotide polymorphism and mutation in this gene, we calculated a substitution position-specific evolutionary conservation score for each variant, which considers site-specific variation among evolutionarily related proteins. To test the bioinformatics predictions experimentally, we evaluated the biochemical consequence of these sequence variants by examining the ability of cell lines stably transfected with the ABCA1 alleles to elicit cholesterol efflux. Our bioinformatics approach correctly predicted the functional impact of greater than 94% of the naturally occurring variants we assessed. The bioinformatics predictions were significantly correlated with the degree of functional impairment of ABCA1 mutations (r2 = 0.62, p = 0.0008). These results have allowed us to define the impact of genetic variation on ABCA1 function and to suggest that the in silico evolutionary approach we used may be a useful tool in general for predicting the effects of DNA variation on gene function. In addition, our data suggest that considering patterns of positive selection, along with patterns of negative selection such as evolutionary conservation, may improve our ability to predict the functional effects of amino acid variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 This SNP has been reported to be associated with decreased HDL cholesterol and increased severity of atherosclerosis in Table 1. subPSEC Scores and Probability of Functional Impairment (Pdeleterious) for ABCA1 Mutations and SNPs Mutations SNPs Variant SubPSEC Pdeleterious Variant subPSEC Pdeleterious P85L À4.62 0.83 R219K À0.57 0.08 H160F À2.79 0.45 V399A À2.26 0.32 R230C À4.27 0.78 V771M À2.86 0.46 A255T À1.81 0.23 T774P À1.99 0.27 E284K À2.34 0.34 K776N À3.53 0.63 Y482C À4.21 0.77 V825I À1.06 0.13 R587W À6.04 0.95 I883M À1.38 0.17 W590S À5.19 0.9 E1172D À1.96 0.26 W590L À4.48 0.82 R1587K À0.58 0.08 Q597R À7.15 0.98 S1731C À4.21 0.77 T929I À4.29 0.78 N935H À8.54 1 N935S À7.53 0.99 A937V À6.6 0.97 A1046D À7.52 0.99 M1091T À3.56 0.64 D1099Y À6.09 0.96 D1289N À2.48 0.37 L1379F À3.81 0.69 C1477R À5.44 0.92 S1506L À5.17 0.9 N1611D À5.69 0.94 R1680W À6.02 0.95 V1704D À3.21 0.55 N1800H À4.23 0.77 R1901S À5.06 0.89 F2009S À2.73 0.43 R2081W À8.08 0.99 P2150L À2.88 0.47 Q2196H À2.74 0.43 DOI: 10.1371/journal.pgen.0010083.t001 PLoS Genetics | www.plosgenetics.org December 2005 | Volume 1 | Issue 6 | e83 0740 Accurate Prediction of ABCA1 Variants Synopsis A major goal of human genetics research is to understand how genetic variation leads to differences in the function of genes. Login to comment

[hide] Mutation in ABCA1 predicted risk of ischemic heart... J Am Coll Cardiol. 2005 Oct 18;46(8):1516-20. Epub 2005 Sep 23. Frikke-Schmidt R, Nordestgaard BG, Schnohr P, Steffensen R, Tybjaerg-Hansen A
Mutation in ABCA1 predicted risk of ischemic heart disease in the Copenhagen City Heart Study Population.
J Am Coll Cardiol. 2005 Oct 18;46(8):1516-20. Epub 2005 Sep 23., [PMID:16226177]

Abstract [show]
OBJECTIVES: We tested whether heterozygosity for the K776N mutation (frequency: 0.4%) in ATP-binding cassette transporter A1 (ABCA1) predicted ischemic heart disease (IHD) in the Copenhagen City Heart Study population. BACKGROUND: In a complex trait like IHD, genetic variation is considered to be conferred by common DNA polymorphisms, although rare mutations may have a larger impact. Tangier disease, a rare high-density lipoprotein cholesterol (HDL-C) deficiency syndrome with IHD, is caused by homozygous ABCA1 mutations. METHODS: We analyzed blood samples from a large cohort study of 9,076 Danish individuals followed for 24 years (167,287 person-years), during which 1,033 incident IHD events occurred. The hypothesis was retested in an independent case-control study comparing 562 IHD patients with 3,103 controls. RESULTS: The cumulative incidence of IHD as a function of age was increased in K776N heterozygotes compared with non-carriers (log-rank test: p = 0.005). At the age of 80 years, 48% of heterozygotes and 23% of non-carriers had IHD. Incidence rates in non-carriers and K776N heterozygotes were 61 and 157 per 10,000 person-years. The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5). Adjusting for HDL-C, or for smoking, diabetes, and hypertension did not change the result, suggesting that genotype predicted risk of IHD beyond that offered by HDL-C, and by other conventional risk factors. Similar trends were obtained in an independent case-control study. CONCLUSIONS: Heterozygosity for an ABCA1 mutation (K776N) conferred two- to three-fold risk of IHD in 37 participants in the Copenhagen City Heart study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Mutation in ABCA1 Predicted Risk of Ischemic Heart Disease in the Copenhagen City Heart Study Population Ruth Frikke-Schmidt, MD, PHD,* Børge G. Nordestgaard, MD, DMSC,†‡ Peter Schnohr, MD,‡ Rolf Steffensen, MD,§ Anne Tybjærg-Hansen, MD, DMSC,‡ Copenhagen, Herlev, Bispebjerg, and Hillerød, Denmark OBJECTIVES We tested whether heterozygosity for the K776N mutation (frequency: 0.4%) in ATP-binding cassette transporter A1 (ABCA1) predicted ischemic heart disease (IHD) in the Copenhagen City Heart Study population. Login to comment
5 RESULTS The cumulative incidence of IHD as a function of age was increased in K776N heterozygotes compared with non-carriers (log-rank test: p ϭ 0.005). Login to comment
6 At the age of 80 years, 48% of heterozygotes and 23% of non-carriers had IHD. Incidence rates in non-carriers and K776N heterozygotes were 61 and 157 per 10,000 person-years. Login to comment
7 The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5). Login to comment
10 CONCLUSIONS Heterozygosity for an ABCA1 mutation (K776N) conferred two- to three-fold risk of IHD in 37 participants in the Copenhagen City Heart study. Login to comment
21 The K776N mutation is of particular interest because: 1) K776 is completely conserved between species; 2) the K Ͼ N amino acid substitution results in a change in side chain charge (basic to uncharged polar); 3) K776N is reported to be relatively frequent in Caucasians (3 per 1,000) (14); 4) disease-causing mutations have been identified in the corresponding region of a closely related gene, the cystic fibrosis transmembrane conductance regulator (CFTR or ABCC7) (15). Login to comment
22 We tested the hypothesis that ABCA1 K776N genotype is associated with risk of IHD in the general population. Login to comment
45 An ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, California) was used to genotype the K776N (nucleotide 2327G Ͼ C) mutation. Login to comment
55 Cox proportional hazards regression models estimated hazard ratios for IHD as a function of K776N genotype, and Kaplan-Meier plots and log-rank tests evaluated the cumulative incidence of IHD as a function of age and K776N genotype. Login to comment
63 RESULTS Among the 9,076 participants in The Copenhagen City Heart Study, 37 (frequency: 0.4%) were heterozygous and none were homozygous for K776N. Login to comment
65 Risk factors for IHD did not differ between non-carriers and K776N heterozygotes, except for levels of HDL-C in men (Table 1). Login to comment
66 The cumulative incidence of IHD as a function of age was increased in K776N heterozygotes compared with non-carriers (log- Abbreviations and Acronyms apoAI ϭ apolipoprotein AI CFTR ϭ cystic fibrosis transmembrane conductance regulator HDL-C ϭ high-density lipoprotein cholesterol IHD ϭ ischemic heart disease rank test: p ϭ 0.005) (Fig. Login to comment
68 At the age of 80 years, about 48% of heterozygotes and 23% of non-carriers had IHD. Incidence rates in non-carriers and K776N heterozygotes were 61 and 157 per 10,000 person-years (Table 2). Login to comment
69 The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5) (Table 2). Login to comment
71 Finally, in an independent case-control study comparing 562 patients with IHD with 3,103 healthy controls within the same age range, the odds ratio for IHD in K776N heterozygotes versus non-carriers was 2.8 (95% confidence interval 0.8 to 9.4) (Table 3). Login to comment
72 Mean plasma HDL-C in non-carriers and K776N heterozygotes was 1.72 mmol/l and 1.82 mmol/l in women (p ϭ 0.42), and 1.38 mmol/l and 1.18 mmol/l in men (p ϭ 0.05). Login to comment
73 Mean plasma apoAI levels in non-carriers and K776N heterozygotes were 151 mg/dl and 150 mg/dl in women (p ϭ 0.93), and 130 mg/dl and 117 mg/dl in men (p ϭ 0.03) (data not shown); HDL-C levels in the 37 individuals heterozygous for K776N ranged from 1.0 to 2.7 mmol/l in women, and from 0.5 to 2.0 mmol/l in men. Login to comment
79 The frequency of IHD in K776N heterozygotes in the present study was 26% to 28% (women: 5 of 19; men: 5 of 18), comparable to the frequency in Tangier disease. Login to comment
87 Cumulative incidence of ischemic heart disease (IHD) as a function of age and ABCA1 K776N genotype. Login to comment
89 Characteristics of Individuals in the General Population by ABCA1 K776N Genotype Women Men Non-Carriers (n ‫؍‬ 5,003) K776N Heterozygotes (n ‫؍‬ 19) Non-Carriers (n ‫؍‬ 4,036) K776N Heterozygotes (n ‫؍‬ 18) Age at entry (yrs) 46 Ϯ 0.2 45 Ϯ 3.0 45 Ϯ 0.2 48 Ϯ 2.5 Cholesterol (mmol/l) 6.3 Ϯ 0.02 6.2 Ϯ 0.3 6.0 Ϯ 0.02 5.6 Ϯ 0.3 Apolipoprotein B (mg/dl) 86.4 Ϯ 0.3 83.8 Ϯ 5.3 86.2 Ϯ 0.3 85.1 Ϯ 6.2 HDL-C (mmol/l) 1.72 Ϯ 0.01 1.82 Ϯ 0.11 1.38 Ϯ 0.01 1.18 Ϯ 0.09* Triglycerides (mmol/l) 1.7 Ϯ 0.02 1.4 Ϯ 0.2 2.1 Ϯ 0.03 2.3 Ϯ 0.3 Body mass index (kg/m2 ) 25.2 Ϯ 0.07 25.0 Ϯ 1.0 26.1 Ϯ 0.06 24.7 Ϯ 1.1 Smoking (%) 73 89 84 88 Diabetes mellitus (%) 3 0 6 11 Hypertension (%) 51 37 59 56 Values are mean Ϯ SE, or percentages. Login to comment
98 To our knowledge, no homozygotes for K776N have been described so far, and we also did not identify any. Login to comment
100 It is therefore unlikely that the majority of K776N homozygotes would express an HDL-C deficiency phenotype comparable to Tangier disease, where HDL-C levels are generally below 0.2 mmol/l. Login to comment
101 However, as is the case for K776N in the present study, in Tangier disease there also does not seem to be a clear correlation between the reduction in plasma HDL-C levels and risk of IHD. Login to comment
105 Although K776N is a relatively common mutation, it is not a common cause of IHD. Login to comment
106 The population-attributable fraction of K776N to IHD is about 0.4% in the Copenhagen City Heart Study, or comparable to the risk of IHD attributed to low-density lipoprotein receptor mutations in the same study. Login to comment
107 However, at the individual level, K776N appears to have a marked impact on risk. Login to comment
109 However, several arguments favor a true observation: 1) the involved amino acid residue is completely conserved between species and relatively conserved between 12 ABCAs with very different transport functions; 2) the amino acid substitution changes the charge of the side-chain, potentially leading to structural alterations of the protein, and consequently to altered protein interactions or transport properties; 3) in the CFTR (or ABCC7), a disease-causing mutation (R347P) has been identified at a site that corresponds to residue 764 in ABCA1 (15), and thus in close vicinity to K776N; 4) the present study is of a large cohort, and therefore includes only incident cases, avoiding the normal pitfalls of case reports and case-control studies (30); 5) we observed a similar trend on risk of IHD in a separate case-control study; 6) we have previously determined effects on lipids and lipoproteins of all non-synonymous SNPs identified in ABCA1 (R219K, V771M, V825I, I883M, E1172D, R1587K). Login to comment
110 When taking multiple testing into account, the log-rank test for the cumulative incidence of ischemic heart disease as a function of age and K776N genotype fulfilled a Bonferroni-corrected p value Ͻ0.007 (0.05 of 7) on a two-sided test (seven different genetic variants tested including K776N). Login to comment
112 If mortality rate from ischemic heart disease was higher among K776N heterozygotes and homozygotes than among non-carriers, our study would underestimate the association between ABCA1 K776N and risk of ischemic heart disease. Login to comment
113 However, the fact that K776N was in Hardy-Weinberg equilibrium suggested that no serious selection bias had occurred in the cohort during follow-up. Login to comment
116 Risk of Ischemic Heart Disease as a Function of ABCA1 K776N Genotype in the General Population Events Incidence Rate/10,000 Person-Years (95% CI) Hazard Ratio (95% CI) Observed Expected Age-Adjusted HDL-C-Adjusted Multifactorial-Adjusted Non-carriers 1,023 1,029 61 (58-65) 1 1 1 K776N heterozygotes 10 4 157 (76-290) 2.4 (1.3-4.5) 2.4 (1.3-4.5) 2.4 (1.3-4.5) In the Cox regression model (age-adjusted, HDL-C-adjusted, and multifactorial-adjusted), age is adjusted for by incorporating age in the baseline hazard function (left truncation). Login to comment
121 Risk of Ischemic Heart Disease as a Function of ABCA1 K776N Genotype in the Case-Control Study Frequency Odds Ratio (95% CI) Age-AdjustedIHD Controls All Non-carriers 558 (99.3) 3,095 (99.7) 1 K776N heterozygotes 4 (0.7) 8 (0.3) 2.8 (0.8-9.4) A total of 562 45-to 64-year-old patients with ischemic heart disease (IHD) verified by coronary angiography were compared with 3,103 healthy controls within the same age range. Login to comment
44 An ABI PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, California) was used to genotype the K776N (nucleotide 2327G b0e; C) mutation. Login to comment
54 Cox proportional hazards regression models estimated hazard ratios for IHD as a function of K776N genotype, and Kaplan-Meier plots and log-rank tests evaluated the cumulative incidence of IHD as a function of age and K776N genotype. Login to comment
62 RESULTS Among the 9,076 participants in The Copenhagen City Heart Study, 37 (frequency: 0.4%) were heterozygous and none were homozygous for K776N. Login to comment
64 Risk factors for IHD did not differ between non-carriers and K776N heterozygotes, except for levels of HDL-C in men (Table 1). Login to comment
67 The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5) (Table 2). Login to comment
70 Mean plasma HDL-C in non-carriers and K776N heterozygotes was 1.72 mmol/l and 1.82 mmol/l in women (p afd; 0.42), and 1.38 mmol/l and 1.18 mmol/l in men (p afd; 0.05). Login to comment
77 The frequency of IHD in K776N heterozygotes in the present study was 26% to 28% (women: 5 of 19; men: 5 of 18), comparable to the frequency in Tangier disease. Login to comment
85 Cumulative incidence of ischemic heart disease (IHD) as a function of age and ABCA1 K776N genotype. Login to comment
96 To our knowledge, no homozygotes for K776N have been described so far, and we also did not identify any. Login to comment
99 However, as is the case for K776N in the present study, in Tangier disease there also does not seem to be a clear correlation between the reduction in plasma HDL-C levels and risk of IHD. Login to comment
103 Although K776N is a relatively common mutation, it is not a common cause of IHD. Login to comment
104 The population-attributable fraction of K776N to IHD is about 0.4% in the Copenhagen City Heart Study, or comparable to the risk of IHD attributed to low-density lipoprotein receptor mutations in the same study. Login to comment
108 When taking multiple testing into account, the log-rank test for the cumulative incidence of ischemic heart disease as a function of age and K776N genotype fulfilled a Bonferroni-corrected p value b0d;0.007 (0.05 of 7) on a two-sided test (seven different genetic variants tested including K776N). Login to comment
111 However, the fact that K776N was in Hardy-Weinberg equilibrium suggested that no serious selection bias had occurred in the cohort during follow-up. Login to comment
114 Risk of Ischemic Heart Disease as a Function of ABCA1 K776N Genotype in the General Population Events Incidence Rate/10,000 Person-Years (95% CI) Hazard Ratio (95% CI) Observed Expected Age-Adjusted HDL-C-Adjusted Multifactorial-Adjusted Non-carriers 1,023 1,029 61 (58-65) 1 1 1 K776N heterozygotes 10 4 157 (76-290) 2.4 (1.3-4.5) 2.4 (1.3-4.5) 2.4 (1.3-4.5) In the Cox regression model (age-adjusted, HDL-C-adjusted, and multifactorial-adjusted), age is adjusted for by incorporating age in the baseline hazard function (left truncation). Login to comment
119 Risk of Ischemic Heart Disease as a Function of ABCA1 K776N Genotype in the Case-Control Study Frequency Odds Ratio (95% CI) Age-Adjusted IHD Controls All Non-carriers 558 (99.3) 3,095 (99.7) 1 K776N heterozygotes 4 (0.7) 8 (0.3) 2.8 (0.8-9.4) A total of 562 45-to 64-year-old patients with ischemic heart disease (IHD) verified by coronary angiography were compared with 3,103 healthy controls within the same age range. Login to comment

[hide] Efflux and atherosclerosis: the clinical and bioch... Arterioscler Thromb Vasc Biol. 2003 Aug 1;23(8):1322-32. Epub 2003 May 22. Singaraja RR, Brunham LR, Visscher H, Kastelein JJ, Hayden MR
Efflux and atherosclerosis: the clinical and biochemical impact of variations in the ABCA1 gene.
Arterioscler Thromb Vasc Biol. 2003 Aug 1;23(8):1322-32. Epub 2003 May 22., [PMID:12763760]

Abstract [show]
Approximately 50 mutations and many single nucleotide polymorphisms have been described in the ABCA1 gene, with mutations leading to Tangier disease and familial hypoalphalipoproteinemia. Homozygotes and heterozygotes for mutations in ABCA1 display a wide range of phenotypes. Identification of ABCA1 as the molecular defect in these diseases has allowed for ascertainment based on genetic status and determination of genotype-phenotype correlations and has permitted us to identify mutations conferring a range of severity of cellular, biochemical, and clinical phenotypes. In this study we review how genetic variation at the ABCA1 locus affects its role in the maintenance of lipid homeostasis and the natural progression of atherosclerosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
136 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon -1095A/G Promoter ⅐ ⅐ ⅐ -477C/T Promoter ⅐ ⅐ ⅐ -419A/C Promoter ⅐ ⅐ ⅐ -320G/C Promoter ⅐ ⅐ ⅐ -191G/C Promoter ⅐ ⅐ ⅐ C69T 5ЈUTR 1 C117G 5ЈUTR 1 InsG319 5ЈUTR 2 G378C 5ЈUTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
148 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ⅐ ⅐ ⅐ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ⅐ ⅐ ⅐ ⅐ ⅐ ⅐ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
160 Clee et al75 reported significant LD between the R219K and the V771M, K776N, I883M, and R1587K cSNPs but found that after carriers of these variants were excluded, R219K remained significantly associated with degree of atherosclerosis and triglyceride levels. Login to comment
128 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon afa;1095A/G Promoter ዼ ዼ ዼ afa;477C/T Promoter ዼ ዼ ዼ afa;419A/C Promoter ዼ ዼ ዼ afa;320G/C Promoter ዼ ዼ ዼ afa;191G/C Promoter ዼ ዼ ዼ C69T 5b18;UTR 1 C117G 5b18;UTR 1 InsG319 5b18;UTR 2 G378C 5b18;UTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 Singaraja et al Clinical and Biochemical Impact of ABCA1 Variants markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
140 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ዼ ዼ ዼ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ዼ ዼ ዼ ዼ ዼ ዼ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
152 Clee et al75 reported significant LD between the R219K and the V771M, K776N, I883M, and R1587K cSNPs but found that after carriers of these variants were excluded, R219K remained significantly associated with degree of atherosclerosis and triglyceride levels. Login to comment

[hide] Genetics of HDL regulation in humans. Curr Opin Lipidol. 2003 Jun;14(3):273-9. Miller M, Rhyne J, Hamlette S, Birnbaum J, Rodriguez A
Genetics of HDL regulation in humans.
Curr Opin Lipidol. 2003 Jun;14(3):273-9., [PMID:12840658]

Abstract [show]
PURPOSE OF REVIEW: To review gene regulation of HDL-cholesterol and discuss molecular abnormalities in HDL candidate genes that may lead to human pathologic states. RECENT FINDINGS: The inverse association between HDL-cholesterol and vascular disease, especially coronary heart disease, has long been recognized, but understanding gene regulation of HDL in humans gained considerable momentum following the identification of ABCA1 as playing a pivotal role in reverse cholesterol transport. Recent data suggest that potentially important targets for upregulating HDL in humans include upregulators of ABCA1 and APOA1 (e.g. peroxisome proliferator activated receptor and liver X receptor agonists) and downregulators of CETP (e.g. JTT-705). A host of other nuclear receptors under investigation in animal models may advance to human testing in the near future. SUMMARY: Disorders affecting HDL metabolism are complex because monogenic disorders causing low HDL do not necessarily correlate with premature vascular disease. To date, pathologic phenotypes have only been deduced among several HDL candidate genes. Understanding the genetic underpinnings associated with variant HDL and reverse cholesterol transport provides an exceptional opportunity to identify novel agents that may optimize this process and reduce vascular event rates beyond currently available LDL lowering therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 TD 1591 T/C 11 V399A extracellular [68] TD 1979 (110bpAlu Ins) 12 truncated truncation [60] TD/FHA 2154 C/T 14 R587W extracellular [67,69] TD 2164 G/C 14 W590S extracellular [61] TD 2185 A/G 14 Q597R extracellular [59,67] TD 2219 G/del 14 truncated, 635X truncated [60,61] FHA 2472-2474 3bp del 15 Del L693 TM domain #3 [59] phosphorylation 2706 G/A 16 V771M extracellular [68] 2715 A/C 16 T774P extracellular [68] 2723 G/C 16 K776N extracellular [68] 2868 G/A 17 V825I TM domain #6 [67,68] TD/FHA 3044 A/G 18 I883M cytoplasmic [68] phosphorylat site FHA 3120 C/T 19 R909X truncation [63,71] TD 3181 C/T 19 T929I cytoplasmic [62] TD 3199 A/G 19 N935S Walker A [61] TD 3205 C/T 19 A937V Walker A [61] TD 3532 C/A 22 A1046D cytoplasmic, Walker A/B [70] FHA 3667 T/C 23 M1091T cytoplasmic [63] 3690 G/T 23 D1099Y cytoplasmic [9] TD 3738 2bp del 23 1145X truncation [66] FHA 3911 G/C 24 E1172D linker/cytoplasmic [68] FHA 4242 4bp del 27 1297X truncated [64] TD 4260 G/A 27 D1289N linker cytoplasm [64,65] TD 4824 T/C 31 C1477R extracellular [59] TD 4912 C/T 32 S1506L extracellular loop #2 [71] TD 5025 ins A 34 A1544S?1552X truncation [70] 5059 T/C 34 I1555T extracellular loop #2 [67] 5155 G/A 35 R1587K extracellular loop #2 [68] FHA 5226 A/G 36 N1611D extracellular loop #2 [75..] 5338 T/C 36 L1648P extracellular loop #2 [67] TD 5443 C/T 37 R1680W cytoplasmic [74.] Login to comment

[hide] The association of the R219K polymorphism in the A... J Mol Med (Berl). 2003 Apr;81(4):264-70. Epub 2003 Mar 26. Evans D, Beil FU
The association of the R219K polymorphism in the ATP-binding cassette transporter 1 ( ABCA1) gene with coronary heart disease and hyperlipidaemia.
J Mol Med (Berl). 2003 Apr;81(4):264-70. Epub 2003 Mar 26., [PMID:12700893]

Abstract [show]
The R219K polymorphism in the ATP-binding cassette transporter 1 gene ( ABCA1) has been associated with reduced severity of atherosclerosis, fewer coronary events, decreased triglycerides and a trend to increased HDL in men with coronary heart disease (CHD). This study examined the frequency and the effect on CHD and plasma lipids of the polymorphism in patients of both sexes attending a lipid out-patient clinic. The overall frequency of the K allele was 0.26. It was lower in patients with CHD (0.21) than in those without (0.27) but this was not statistically significant. Amongst patients with elevated Lp(a) the frequency of the K allele was significantly lower in those with CHD (0.16) than in those without (0.29). There were no statistically significant differences in total cholesterol, LDL, HDL, apoB or apoAI between carriers and non-carriers. When patients with probable secondary hypertriglyceridaemia (triglycerides >1000 mg/dl), type 2 diabetes and carriers of lipoprotein lipase polymorphisms associated with hypertriglyceridaemia were excluded, the K allele was significantly associated with reduced triglycerides but only in patients with apoE 3/3 genotype. In conclusion, we provide additional evidence that the R219K polymorphism in the ABCA1 gene either directly or as a result of linkage disequilibrium with additional functional variant(s), has a protective effect against CHD and is associated with lower plasma triglycerides in sub-groups of patients with hyperlipidaemia.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Clee et al. [15] found that the R219K polymorphism was in linkage disequilibrium with two less frequent variants, V771M and K776N; however, excluding patients who were also carriers of these polymorphisms did not alter the results they obtained for the R219K polymorphism. Login to comment

[hide] Common genetic variation in ABCA1 is associated wi... Circulation. 2001 Mar 6;103(9):1198-205. Clee SM, Zwinderman AH, Engert JC, Zwarts KY, Molhuizen HO, Roomp K, Jukema JW, van Wijland M, van Dam M, Hudson TJ, Brooks-Wilson A, Genest J Jr, Kastelein JJ, Hayden MR
Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease.
Circulation. 2001 Mar 6;103(9):1198-205., [PMID:11238261]

Abstract [show]
BACKGROUND: Low plasma HDL cholesterol (HDL-C) is associated with an increased risk of coronary artery disease (CAD). We recently identified the ATP-binding cassette transporter 1 (ABCA1) as the major gene underlying the HDL deficiency associated with reduced cholesterol efflux. Mutations within the ABCA1 gene are associated with decreased HDL-C, increased triglycerides, and an increased risk of CAD. However, the extent to which common variation within this gene influences plasma lipid levels and CAD in the general population is unknown. METHODS AND RESULTS: We examined the phenotypic effects of single nucleotide polymorphisms in the coding region of ABCA1. The R219K variant has a carrier frequency of 46% in Europeans. Carriers have a reduced severity of CAD, decreased focal (minimum obstruction diameter 1.81+/-0.35 versus 1.73+/-0.35 mm in noncarriers, P:=0.001) and diffuse atherosclerosis (mean segment diameter 2.77+/-0.37 versus 2.70+/-0.37 mm, P:=0.005), and fewer coronary events (50% versus 59%, P:=0.02). Atherosclerosis progresses more slowly in carriers of R219K than in noncarriers. Carriers have decreased triglyceride levels (1.42+/-0.49 versus 1.84+/-0.77 mmol/L, P:=0.001) and a trend toward increased HDL-C (0.91+/-0.22 versus 0.88+/-0.20 mmol/L, P:=0.12). Other single nucleotide polymorphisms in the coding region had milder effects on plasma lipids and atherosclerosis. CONCLUSIONS: These data suggest that common variation in ABCA1 significantly influences plasma lipid levels and the severity of CAD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5Ј33Ј)* Reverse Oligo (5Ј33Ј)* Annealing Temperature, °C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
85 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587G† S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
132 Carriers of V399A had half the frequency of a positive family history of CAD (22.2% versus 49.4%, Pϭ0.18) and trends toward an increased baseline MOD (Table 6) and less progression in MSD (-0.05Ϯ0.10 versus 0.08Ϯ0.19 mm in noncarriers, Pϭ0.16) during the trial. Login to comment
137 Carriers of the other 3 rare variants (T774P, K776N, and E1172D) showed no significant differences in lipid levels or CAD compared with their respective noncarriers (Table 6). Login to comment
140 The presence of this variant in individuals heterozygous for the R2144X ABCA1 mutation was associated with further significantly decreased HDL-C compared with R2144X carriers without this polymorphism (0.16Ϯ0.04 mmol/L, nϭ2, versus 0.64Ϯ0.14 mmol/L, nϭ10; Pϭ0.0009). Login to comment
144 Two rare cSNPs (V771M and K776N) are most commonly found in individuals carrying the R219K K allele. Login to comment
145 If all V771M and K776N carriers are excluded, the results are unaltered, with increased MOD (1.80Ϯ0.35 versus 1.73Ϯ0.35 mm, Pϭ0.006) and MSD (2.76Ϯ0.36 versus 2.70Ϯ0.37 mm, Pϭ0.02) and lower mean TG levels (1.71Ϯ0.75 versus 1.84Ϯ0.77 mmol/L, Pϭ0.02) in carriers of R219K (nϭ329) compared with noncarriers (nϭ422). Login to comment
156 No significant differences in lipid levels or CAD were observed for E1172D carriers compared with R1587K heterozygotes without E1172D. Login to comment
161 ABCA cSNPs in REGRESS MOD, mm MSD, mm HDL-C, mmol/L TG, mmol/L Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P V825I 1.74Ϯ0.37 (107) 1.77Ϯ0.35 (575) 0.39 2.70Ϯ0.38 2.75Ϯ0.38 0.21 0.91Ϯ0.23 0.93Ϯ0.22 0.42 1.86Ϯ0.84 1.80Ϯ0.76 0.49 I883M 1.74Ϯ0.38 (100) 1.75Ϯ0.36 (320) 0.71 2.69Ϯ0.38 2.73Ϯ0.36 0.41 0.91Ϯ0.22 0.91Ϯ0.21 0.97 1.75Ϯ0.77 1.82Ϯ0.75 0.42 R1587K 1.77Ϯ0.34 (346) 1.76Ϯ0.37 (433) 0.75 2.73Ϯ0.39 2.74Ϯ0.36 0.64 0.90Ϯ0.22 0.94Ϯ0.23 0.03 1.79Ϯ0.76 1.81Ϯ0.78 0.77 V399A 1.92Ϯ0.32 (9) 1.73Ϯ0.35 (540) 0.13 2.73Ϯ0.40 2.71Ϯ0.37 0.89 1.03Ϯ0.28 0.92Ϯ0.23 0.15 1.71Ϯ0.63 1.82Ϯ0.78 0.68 V771M 1.89Ϯ0.38 (37) 1.76Ϯ0.35 (598) 0.045 2.83Ϯ0.49 2.73Ϯ0.37 0.13 0.91Ϯ0.20 0.92Ϯ0.22 0.58 1.98Ϯ0.79 1.78Ϯ0.76 0.11 T774P 1.63Ϯ0.31 (4) 1.76Ϯ0.36 (621) 0.47 2.85Ϯ0.34 2.73Ϯ0.37 0.52 0.85Ϯ0.07 0.93Ϯ0.22 0.50 1.90Ϯ1.04 1.82Ϯ0.77 0.84 K776N 1.92Ϯ0.33 (3) 1.78Ϯ0.34 (546) 0.48 2.95Ϯ0.48 2.76Ϯ0.37 0.36 0.94Ϯ0.28 0.93Ϯ0.22 0.93 2.25Ϯ0.94 1.76Ϯ0.76 0.26 E117SD 1.80Ϯ0.39 (34) 1.77Ϯ0.36 (610) 0.67 2.78Ϯ0.35 2.74Ϯ0.37 0.42 0.93Ϯ0.23 0.94Ϯ0.23 0.89 1.80Ϯ0.90 1.77Ϯ0.76 0.80 Values are meanϮSD (n). Login to comment
186 Furthermore, we show that I883M is a common variant that is possibly associated with an increased risk of CAD in the homozygous state, although no differences in HDL-C were evident. Login to comment
191 Similarly, the region containing the V771M, T774P, and K776N variants is unlikely to be critical to ABCA1 function, because a high degree of polymorphism is tolerated without functional effects. Login to comment
43 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5b18;33b18;)* Reverse Oligo (5b18;33b18;)* Annealing Temperature, &#b0;C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
80 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587Gߤ S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
139 Two rare cSNPs (V771M and K776N) are most commonly found in individuals carrying the R219K K allele. Login to comment

[hide] ABCA1 mutation carriers with low high-density lipo... Eur Heart J. 2013 Jan;34(4):286-91. doi: 10.1093/eurheartj/ehs376. Epub 2012 Nov 7. Bochem AE, van Wijk DF, Holleboom AG, Duivenvoorden R, Motazacker MM, Dallinga-Thie GM, de Groot E, Kastelein JJ, Nederveen AJ, Hovingh GK, Stroes ES
ABCA1 mutation carriers with low high-density lipoprotein cholesterol are characterized by a larger atherosclerotic burden.
Eur Heart J. 2013 Jan;34(4):286-91. doi: 10.1093/eurheartj/ehs376. Epub 2012 Nov 7., [PMID:23136402]

Abstract [show]
AIMS: Low HDL-C is a potent risk factor for cardiovascular disease (CVD). Yet, mutations in ABCA1, a major determinant of circulating HDL-C levels, were previously not associated with CVD risk in cohort studies. To study the consequences of low plasma levels of high-density lipoprotein cholesterol (HDL-C) due to ATP-binding cassette transporter A1 (ABCA1) dysfunction for atherosclerotic vascular disease in the carotid arteries. METHODS AND RESULTS: We performed 3.0 Tesla magnetic resonance imaging (MRI) measurements of the carotid arteries in 36 carriers of high impact functional ABCA1 mutations and 36 normolipidemic controls. Carriers presented with 42% lower HDL-C levels (P < 0.001), a larger mean wall area (18.6 +/- 6.0 vs. 15.8 +/- 4.3 mm(2); P = 0.02), a larger mean wall thickness (0.82 +/- 0.21 vs. 0.70 +/- 0.14 mm; P = 0.005), and a higher normalized wall index (0.37 +/- 0.06 vs. 0.33 +/- 0.04; P = 0.005) compared with controls, retaining significance after adjustment for smoking, alcohol consumption, systolic blood pressure, diabetes, body mass index, history of CVD, LDL-C, and statin use (P = 0.002). CONCLUSION: Carriers of loss of function ABCA1 mutations display a larger atherosclerotic burden compared with age and sex-matched controls, implying a higher risk for CVD. Further studies are needed to elucidate the full function of ABCA1 in the protection against atherosclerosis. These data support the development of strategies to up-regulate ABCA1 in patients with established CVD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
115 An alternative approach is the assessment of effects of genetic variation in ABCA1 using a Mendelian randomization approach as performed by Frikke-Schmidt et al.42 In line with our results, they report that in a prospective cohort comprising 9000 individuals, heterozygosity for the ABCA1 mutation p.Lys776Asn led to a two-to-three-fold higher risk of ischaemic heart disease. Login to comment

[hide] ATP-binding cassette transporters, atherosclerosis... Circ Res. 2014 Jan 3;114(1):157-70. doi: 10.1161/CIRCRESAHA.114.300738. Westerterp M, Bochem AE, Yvan-Charvet L, Murphy AJ, Wang N, Tall AR
ATP-binding cassette transporters, atherosclerosis, and inflammation.
Circ Res. 2014 Jan 3;114(1):157-70. doi: 10.1161/CIRCRESAHA.114.300738., [PMID:24385509]

Abstract [show]
Although recent genome-wide association studies have called into question the causal relationship between high-density lipoprotein (HDL) cholesterol levels and cardiovascular disease, ongoing research in animals and cells has produced increasing evidence that cholesterol efflux pathways mediated by ATP-binding cassette (ABC) transporters and HDL suppress atherosclerosis. These differing perspectives may be reconciled by a modified HDL theory that emphasizes the antiatherogenic role of cholesterol flux pathways, initiated in cells by ABC transporters. ABCA1 and ABCG1 control the proliferation of hematopoietic stem and multipotential progenitor cells in the bone marrow and hematopoietic stem and multipotential progenitor cell mobilization and extramedullary hematopoiesis in the spleen. Thus, activation of cholesterol efflux pathways by HDL infusions or liver X receptor activation results in suppression of hematopoietic stem and multipotential progenitor cell mobilization and extramedullary hematopoiesis, leading to decreased production of monocytes and neutrophils and suppression of atherosclerosis. In addition, macrophage-specific knockout of transporters has confirmed their role in suppression of inflammatory responses in the arterial wall. Recent studies have also shown that ABCG4, a close relative of ABCG1, controls platelet production, atherosclerosis, and thrombosis. ABCG4 is highly expressed in megakaryocyte progenitors, where it promotes cholesterol efflux to HDL and controls the proliferative responses to thrombopoietin. Reconstituted HDL infusions act in an ABCG4-dependent fashion to limit hypercholesterolemia-driven excessive platelet production, thrombosis, and atherogenesis, as occurs in human myeloproliferative syndromes. Activation of ABC transporter-dependent cholesterol efflux pathways in macrophages, hematopoietic stem and multipotential progenitor cells, or platelet progenitors by reconstituted HDL infusion or liver X receptor activation remain promising approaches to the treatment of human atherothrombotic diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 In a Mendelian randomization approach in a prospective cohort comprising ࣈ9000 individuals, heterozygosity for the ABCA1 mutation K776N led to a 2-to-3 times higher risk of ischemic heart disease.105 Furthermore, 5 single-nucleotide polymorphisms (SNPs) inABCA1 (V771M,V825I, I883M, E1172D, R1587K) were shown to predict risk of ischemic heart disease in a cohort of 9259 individuals.106 However, the same group reported more recently that heterozygosity for 4 loss-of-function mutations (P1065S, G1216V, N1800H, R2144X) was not associated with a higher risk of ischemic heart disease in 3 prospective cohorts comprising 56ߙ886 individuals.107 It must be noted, however, that only small decreases in HDL, of ࣈ28% as opposed to ࣈ50% in previously reported ABCA1 heterozygotes, were observed.94,101-103,107 Also, the residual cholesterol efflux was substantial (74%-79% for P1065S and G1216V and 48%-49% for N1800H and R2144X for homozygous mutations compared with controls),107 whereas in patients with TD there was only 20% to 30% residual cholesterol efflux.108 In addition, LDL levels were reduced by ࣈ25%, probably offsetting the effects of reduced HDL on CVD.107 Thus, the conflicting results in these studies could be related to inclusion of relatively mild ABCA1 mutations as well as offsetting effects of reduced LDL cholesterol levels.109 In a meta-analysis of genome-wide association studies, SNPs near the ABCA1 gene have been associated with HDL and total cholesterol levels,110,111 but not with cardiovascular risk.112 Although these studies have the benefit of huge statistical power, some caution is merited in the interpretation of findings. Login to comment