ABCMdb

ABCA1 p.Thr774Pro

Predicted by SNAP2:	A: N (78%), C: D (80%), D: N (72%), E: N (72%), F: D (80%), G: N (87%), H: N (53%), I: N (57%), K: N (66%), L: N (53%), M: N (66%), N: N (93%), P: D (66%), Q: N (72%), R: D (53%), S: N (93%), V: N (72%), W: D (71%), Y: D (71%),
Predicted by PROVEAN:	A: N, C: N, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, R: N, S: N, V: N, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Genetic variation in the ABCA1 gene, HDL cholester... Atherosclerosis. 2010 Feb;208(2):305-16. Epub 2009 Jun 11. Frikke-Schmidt R
Genetic variation in the ABCA1 gene, HDL cholesterol, and risk of ischemic heart disease in the general population.
Atherosclerosis. 2010 Feb;208(2):305-16. Epub 2009 Jun 11., [PMID:19596329]

Abstract [show]
Epidemiological studies consistently demonstrate a strong inverse association between low levels of high-density lipoprotein (HDL) cholesterol and increased risk of ischemic heart disease (IHD). This review focuses on whether both rare and common genetic variation in ABCA1 contributes to plasma levels of HDL cholesterol and to risk of IHD in the general population, and further seeks to understand whether low levels of HDL cholesterol per se are causally related to IHD. Studies of the ABCA1 gene demonstrate a general strategy for detecting functional genetic variants, and show that both common and rare ABCA1 variants contribute to levels of HDL cholesterol and risk of IHD in the general population. The association between ABCA1 variants and risk of IHD appears, however, to be independent of plasma levels of HDL cholesterol. With the recent identification of the largest number of individuals heterozygous for loss-of-function mutations in ABCA1 worldwide, population studies suggests that genetically low HDL cholesterol per se does not predict an increased risk of IHD, and thus questions the causality of isolated low levels of HDL cholesterol for the development of IHD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
2338 The remaining non-synonymous mutations (S364C, T774P, and K776N), ranging in frequency from 0.1 to four per 1000, were not associated with low HDL cholesterol levels [65,66]. Login to comment

[hide] Association of loss-of-function mutations in the A... JAMA. 2008 Jun 4;299(21):2524-32. Frikke-Schmidt R, Nordestgaard BG, Stene MC, Sethi AA, Remaley AT, Schnohr P, Grande P, Tybjaerg-Hansen A
Association of loss-of-function mutations in the ABCA1 gene with high-density lipoprotein cholesterol levels and risk of ischemic heart disease.
JAMA. 2008 Jun 4;299(21):2524-32., [PMID:18523221]

Abstract [show]
CONTEXT: Low levels of high-density lipoprotein (HDL) cholesterol are inversely related to cardiovascular risk. Whether this is a causal effect is unclear. OBJECTIVE: To determine whether genetically reduced HDL cholesterol due to heterozygosity for 4 loss-of-function mutations in ABCA1 cause increased risk of ischemic heart disease (IHD). DESIGN, SETTING, AND PARTICIPANTS: Three studies of white individuals from Copenhagen, Denmark, were used: the Copenhagen City Heart Study (CCHS), a 31-year prospective general population study (n = 9022; 28 heterozygotes); the Copenhagen General Population Study (CGPS), a cross-sectional general population study (n = 31,241; 76 heterozygotes); and the Copenhagen Ischemic Heart Disease Study (CIHDS), a case-control study (n = 16,623; 44 heterozygotes). End points in all 3 studies were recorded during the period of January 1, 1976, through July 9, 2007. MAIN OUTCOME MEASURES: Levels of HDL cholesterol in the general population, cellular cholesterol efflux, and the association between IHD and HDL cholesterol and genotype. RESULTS: Heterozygotes vs noncarriers for 4 ABCA1 mutations (P1065S, G1216V, N1800H, R2144X) had HDL cholesterol levels of 41 mg/dL (interquartile range, 31-50 mg/dL) vs 58 mg/dL (interquartile range, 46-73 mg/dL), corresponding to a reduction in HDL cholesterol of 17 mg/dL (P < .001). A 17-mg/dL lower HDL cholesterol level in the CCHS was associated with a multifactorially adjusted hazard ratio for IHD of 1.70 (95% confidence interval [CI], 1.57-1.85). However, for IHD in heterozygotes vs noncarriers, the multifactorially adjusted hazard ratio was 0.67 (95% CI, 0.28-1.61; 1741 IHD events) in the CCHS, the multifactorially adjusted odds ratio was 0.82 (95% CI, 0.34-1.96; 2427 IHD events) in the CGPS, and the multifactorially adjusted odds ratio was 0.86 (95% CI, 0.32-2.32; 2498 IHD cases) in the CIHDS. The corresponding odds ratio for IHD in heterozygotes vs noncarriers for the combined studies (n = 41,961; 6666 cases; 109 heterozygotes) was 0.93 (95% CI, 0.53-1.62). CONCLUSION: Lower plasma levels of HDL cholesterol due to heterozygosity for loss-of-function mutations in ABCA1 were not associated with an increased risk of IHD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 The 9022 individuals were genotyped for all non-synonymous mutations (S364C, T774P, K776N, P1065S, G1216V, N1800H, R2144X [http://www.hgmd.cf.ac.uk/ac /index.php; http://www.mutdb.org]), which were previously identified by resequencing the promoter, coding region,andconsensussplicesitesofABCA1 in 190 individuals of Danish ancestry with high and low HDL cholesterol levels.13 All end points and data collection were recorded in the follow-up period of January 1, 1976, through July 9, 2007. Login to comment
70 reductions in levels of HDL cholesterol in plasma in heterozygotes vs noncarriers in the CCHS as well as in the CGPS, while 3 were not (S364C, T774P, K776N). Login to comment
25 The 9022 individuals were genotyped for all nonsynonymous mutations (S364C, T774P, K776N, P1065S, G1216V, N1800H, R2144X [http://www.hgmd.cf.ac.uk/ac /index.php; http://www.mutdb.org]), which were previously identified by resequencing the promoter, coding region,andconsensussplicesitesofABCA1 in 190 individuals of Danish ancestry with high and low HDL cholesterol levels.13 All end points and data collection were recorded in the follow-up period of January 1, 1976, through July 9, 2007. Login to comment
54 LOSS-OF-FUNCTION MUTATIONS IN THE ABCA1 GENE AND RISK OF ISCHEMIC HEART DISEASE 2528 reductions in levels of HDL cholesterol in plasma in heterozygotes vs noncarriers in the CCHS as well as in the CGPS, while were not (S364C, T774P, K776N). Login to comment

[hide] A novel haplotype in ABCA1 gene effects plasma HDL... Int J Cardiol. 2007 Jan 31;115(1):7-13. Epub 2006 Jun 23. Saleheen D, Khanum S, Haider SR, Nazir A, Ahmad U, Khalid H, Hussain I, Shuja F, Shahid K, Habib A, Frossard PM
A novel haplotype in ABCA1 gene effects plasma HDL-C concentration.
Int J Cardiol. 2007 Jan 31;115(1):7-13. Epub 2006 Jun 23., [PMID:16806540]

Abstract [show]
BACKGROUND AND OBJECTIVES: ATP-binding cassette transporter 1 (ABCA1) is a trans-membrane protein responsible for the efflux of cholesterol and phospholipids across the cell membrane, an essential step in the reverse cholesterol transport system. This study investigates the effect of five non-synonymous SNPs of ABCA1 gene on plasma HDL-C levels in Pakistani individuals free of ischemic heart disease and stroke. METHODS: Five non-synonymous SNPs were selected after sequencing ABCA1 gene in patients of Hypoalphalipoproteinemia. The presence of these SNPs was then checked in 200 individuals by using PCR-RFLP. Plasma glucose and lipid fractions were measured in fasting state. Ethical approval was obtained from the Ethical Review Committee, Aga Khan University and informed consent was obtained from all subjects. RESULTS: LL genotype of V825L polymorphism was associated with decreased levels of HDL-C [-0.17 (-0.32 to -0.19); P=0.02] and P774 allele showed a significant increase in HDL-C levels as compared to T774 allele [-0.15 (-0.18 to -0.02); P=0.01]. R219K, A399V and V771M polymorphisms did not show any association with levels of HDL-C, LDL-C, cholesterol and triglycerides. Haplotype analysis between R219K and V825L polymorphisms showed a unique interaction between R219 allele and L825 allele. The RL haplotype was found to be associated with decreased levels of HDL-C [-0.12 (-0.22 to -0.03); P=0.001]. CONCLUSIONS: ABCA1 polymorphisms are associated with varying levels of HDL-C in Pakistani individuals. These results warrant further investigations as ABCA1 polymorphisms may have a major role in the high incidence of cardiovascular disorders in South Asians.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
80 R219K, V399A and T774P polymorphisms followed the HWE however V825L and V771M showed a departure from HWE. Login to comment
83 Similarly, T774P showed high LD with V825L (DV=0.70; P-value<10À3 ). Login to comment
87 D. Saleheen et al. / International Journal of Cardiology 115 (2007) 7-13 9 polymorphism was in complete linkage equilibrium with T774P, V825L and V771M polymorphisms. Login to comment
97 South Asian populations (from Pakistan, India, Bangladesh and Sri Lanka) represent a quarter of the developing world and harbor thirty percent of the global Table 4 Haplotype association analysis of the ABCA1 gene polymorphisms in relation with the HDL-C levels Haplotype Haplotype frequencies Haplotypic additive effects [95% CI] P-value R219K RV 0.47 + V825L RL 0.18 À0.12 [À0.22 to À0.03] 0.001 KV 0.28 À0.04 [À0.10 to 0.01] 0.15 KL 0.06 0.08 [À0.06 to 0.22] 0.25 T774P TV 0.21 0.03 [À0.05 to 0.12] 0.41 V825L TL 0.09 0.10 [À0.06 to 0.27] 0.22 PV 0.47 + PL 0.21 À0.06 [À0.14 to 0.02] 0.15 R219K RM 0.55 + V771M RV 0.07 À0.13 [À0.45 to 0.19] 0.41 KM 0.34 À0.02 [À0.09 to 0.05] 0.54 KV 0.04 0.07 [À0.12 to 0.27] 0.46 Table 3 Mean HDL-C levels (S.D.) for the genotypes and alleles of the studied polymorphisms Frequencies HDL-C (S.D.) b (95% CI) P-value R219K RR 39.8 1.06 (0.30) À0.02 (À0.16 to 0.13) 0.85 RK 46.0 1.10 (0.28) 0.00 (À0.14 to 0.14) 0.99 KK 14.3 1.10 (0.31) + R 62.7 1.08 (0.26) 0.01 (À0.05 to 0.07) 0.79 K 37.3 1.09 (0.31) V399A AA 6.0 1.01 (0.23) À0.03 (À0.24 to 0.16) 0.70 AV 34.7 1.11 (0.28) 0.10 (À0.04 to 0.16) 0.22 VV 59.3 1.04 (0.31) + A 23.3 1.09 (0.28) À0.03 (À0.10 to 0.05) 0.58 V 76.7 1.04 (0.31) T774P PP 9.6 1.10 (0.31) 0.20 (0.01 to 0.40) 0.03 PT 37.5 1.03 (0.32) 0.13 (À0.03 to 0.20) 0.14 TT 52.9 0.97 (0.28) + P 28.4 1.05 (0.32) À0.15 (À0.18 to À0.02) 0.01 T 71.6 0.99 (0.29) V771M MM 6.1 1.09 (0.30) 0.01 (À0.24 to 0.25) VM 10.1 0.98 (0.24) À0.07 (À0.27 to 0.12) 0.46 VV 83.8 1.07 (0.29) + 0.94 M 11.1 1.04 (0.27) 0.03 (À0.10 to 0.15) 0.71 V 88.9 1.07 (0.29) V825L LL 9.8 0.89 (0.299) À0.17 (À0.32 to À0.19) 0.02 LV 32.8 1.06 (0.265) À0.03 (À0.11 to 0.076) 0.70 VV 57.5 1.07 (0.30) + L 26.1 1.07 (0.29) 0.10 (À0.00 to .13) 0.05 V 73.9 1.00 (0.28) P-values are adjusted for age and gender. Login to comment

[hide] Accurate prediction of the functional significance... PLoS Genet. 2005 Dec;1(6):e83. Epub 2005 Dec 30. Brunham LR, Singaraja RR, Pape TD, Kejariwal A, Thomas PD, Hayden MR
Accurate prediction of the functional significance of single nucleotide polymorphisms and mutations in the ABCA1 gene.
PLoS Genet. 2005 Dec;1(6):e83. Epub 2005 Dec 30., [PMID:16429166]

Abstract [show]
The human genome contains an estimated 100,000 to 300,000 DNA variants that alter an amino acid in an encoded protein. However, our ability to predict which of these variants are functionally significant is limited. We used a bioinformatics approach to define the functional significance of genetic variation in the ABCA1 gene, a cholesterol transporter crucial for the metabolism of high density lipoprotein cholesterol. To predict the functional consequence of each coding single nucleotide polymorphism and mutation in this gene, we calculated a substitution position-specific evolutionary conservation score for each variant, which considers site-specific variation among evolutionarily related proteins. To test the bioinformatics predictions experimentally, we evaluated the biochemical consequence of these sequence variants by examining the ability of cell lines stably transfected with the ABCA1 alleles to elicit cholesterol efflux. Our bioinformatics approach correctly predicted the functional impact of greater than 94% of the naturally occurring variants we assessed. The bioinformatics predictions were significantly correlated with the degree of functional impairment of ABCA1 mutations (r2 = 0.62, p = 0.0008). These results have allowed us to define the impact of genetic variation on ABCA1 function and to suggest that the in silico evolutionary approach we used may be a useful tool in general for predicting the effects of DNA variation on gene function. In addition, our data suggest that considering patterns of positive selection, along with patterns of negative selection such as evolutionary conservation, may improve our ability to predict the functional effects of amino acid variation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
48 This SNP has been reported to be associated with decreased HDL cholesterol and increased severity of atherosclerosis in Table 1. subPSEC Scores and Probability of Functional Impairment (Pdeleterious) for ABCA1 Mutations and SNPs Mutations SNPs Variant SubPSEC Pdeleterious Variant subPSEC Pdeleterious P85L À4.62 0.83 R219K À0.57 0.08 H160F À2.79 0.45 V399A À2.26 0.32 R230C À4.27 0.78 V771M À2.86 0.46 A255T À1.81 0.23 T774P À1.99 0.27 E284K À2.34 0.34 K776N À3.53 0.63 Y482C À4.21 0.77 V825I À1.06 0.13 R587W À6.04 0.95 I883M À1.38 0.17 W590S À5.19 0.9 E1172D À1.96 0.26 W590L À4.48 0.82 R1587K À0.58 0.08 Q597R À7.15 0.98 S1731C À4.21 0.77 T929I À4.29 0.78 N935H À8.54 1 N935S À7.53 0.99 A937V À6.6 0.97 A1046D À7.52 0.99 M1091T À3.56 0.64 D1099Y À6.09 0.96 D1289N À2.48 0.37 L1379F À3.81 0.69 C1477R À5.44 0.92 S1506L À5.17 0.9 N1611D À5.69 0.94 R1680W À6.02 0.95 V1704D À3.21 0.55 N1800H À4.23 0.77 R1901S À5.06 0.89 F2009S À2.73 0.43 R2081W À8.08 0.99 P2150L À2.88 0.47 Q2196H À2.74 0.43 DOI: 10.1371/journal.pgen.0010083.t001 PLoS Genetics | www.plosgenetics.org December 2005 | Volume 1 | Issue 6 | e83 0740 Accurate Prediction of ABCA1 Variants Synopsis A major goal of human genetics research is to understand how genetic variation leads to differences in the function of genes. Login to comment

[hide] Mutation in ABCA1 predicted risk of ischemic heart... J Am Coll Cardiol. 2005 Oct 18;46(8):1516-20. Epub 2005 Sep 23. Frikke-Schmidt R, Nordestgaard BG, Schnohr P, Steffensen R, Tybjaerg-Hansen A
Mutation in ABCA1 predicted risk of ischemic heart disease in the Copenhagen City Heart Study Population.
J Am Coll Cardiol. 2005 Oct 18;46(8):1516-20. Epub 2005 Sep 23., [PMID:16226177]

Abstract [show]
OBJECTIVES: We tested whether heterozygosity for the K776N mutation (frequency: 0.4%) in ATP-binding cassette transporter A1 (ABCA1) predicted ischemic heart disease (IHD) in the Copenhagen City Heart Study population. BACKGROUND: In a complex trait like IHD, genetic variation is considered to be conferred by common DNA polymorphisms, although rare mutations may have a larger impact. Tangier disease, a rare high-density lipoprotein cholesterol (HDL-C) deficiency syndrome with IHD, is caused by homozygous ABCA1 mutations. METHODS: We analyzed blood samples from a large cohort study of 9,076 Danish individuals followed for 24 years (167,287 person-years), during which 1,033 incident IHD events occurred. The hypothesis was retested in an independent case-control study comparing 562 IHD patients with 3,103 controls. RESULTS: The cumulative incidence of IHD as a function of age was increased in K776N heterozygotes compared with non-carriers (log-rank test: p = 0.005). At the age of 80 years, 48% of heterozygotes and 23% of non-carriers had IHD. Incidence rates in non-carriers and K776N heterozygotes were 61 and 157 per 10,000 person-years. The age-adjusted hazard ratio for IHD in K776N heterozygotes versus non-carriers was 2.4 (95% confidence interval 1.3 to 4.5). Adjusting for HDL-C, or for smoking, diabetes, and hypertension did not change the result, suggesting that genotype predicted risk of IHD beyond that offered by HDL-C, and by other conventional risk factors. Similar trends were obtained in an independent case-control study. CONCLUSIONS: Heterozygosity for an ABCA1 mutation (K776N) conferred two- to three-fold risk of IHD in 37 participants in the Copenhagen City Heart study.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
94 tion (T774P, allele frequency 0.004) situated, respectively, five and two amino acids N-terminal of the K776 residue, have been reported. Login to comment
92 tion (T774P, allele frequency 0.004) situated, respectively, five and two amino acids N-terminal of the K776 residue, have been reported. Login to comment

[hide] Efflux and atherosclerosis: the clinical and bioch... Arterioscler Thromb Vasc Biol. 2003 Aug 1;23(8):1322-32. Epub 2003 May 22. Singaraja RR, Brunham LR, Visscher H, Kastelein JJ, Hayden MR
Efflux and atherosclerosis: the clinical and biochemical impact of variations in the ABCA1 gene.
Arterioscler Thromb Vasc Biol. 2003 Aug 1;23(8):1322-32. Epub 2003 May 22., [PMID:12763760]

Abstract [show]
Approximately 50 mutations and many single nucleotide polymorphisms have been described in the ABCA1 gene, with mutations leading to Tangier disease and familial hypoalphalipoproteinemia. Homozygotes and heterozygotes for mutations in ABCA1 display a wide range of phenotypes. Identification of ABCA1 as the molecular defect in these diseases has allowed for ascertainment based on genetic status and determination of genotype-phenotype correlations and has permitted us to identify mutations conferring a range of severity of cellular, biochemical, and clinical phenotypes. In this study we review how genetic variation at the ABCA1 locus affects its role in the maintenance of lipid homeostasis and the natural progression of atherosclerosis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
136 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon -1095A/G Promoter ⅐ ⅐ ⅐ -477C/T Promoter ⅐ ⅐ ⅐ -419A/C Promoter ⅐ ⅐ ⅐ -320G/C Promoter ⅐ ⅐ ⅐ -191G/C Promoter ⅐ ⅐ ⅐ C69T 5ЈUTR 1 C117G 5ЈUTR 1 InsG319 5ЈUTR 2 G378C 5ЈUTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
148 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ⅐ ⅐ ⅐ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ⅐ ⅐ ⅐ ⅐ ⅐ ⅐ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment
128 Single Nucleotide Polymorphisms in the ABCA1 Gene Nucleotide Amino Acid Exon afa;1095A/G Promoter ዼ ዼ ዼ afa;477C/T Promoter ዼ ዼ ዼ afa;419A/C Promoter ዼ ዼ ዼ afa;320G/C Promoter ዼ ዼ ዼ afa;191G/C Promoter ዼ ዼ ዼ C69T 5b18;UTR 1 C117G 5b18;UTR 1 InsG319 5b18;UTR 2 G378C 5b18;UTR 2 G1051A R219K 7 T1591C V399A 11 G2706A V771M 16 A2715C T774P 16 G2723C K776N 16 G2826A V825I 17 A3044G I883M 18 G3911C E1172D 24 G5255A R1587K 35 C5587G S1731C 38 Singaraja et al Clinical and Biochemical Impact of ABCA1 Variants markers, namely, increased arterial wall thickness and ABCA1-mediated cholesterol efflux, was performed.73 The study group consisted of 30 individuals heterozygous for 4 different missense mutations in the ABCA1 gene, C1477R, M1091T, P2150L, and T929I. Login to comment
140 In TABLE 4. Conservation of Amino Acids Polymorphic in Humans cSNP H. sapiens M. musculus G. gallus D. melanogaster C. elegans R219K R R K ዼ ዼ ዼ L V399A V V V A I V771M V V V L Y T774P T S S S G K776N K K K K R V825I V V A M L I883M I V P R A E1172D E E E ዼ ዼ ዼ ዼ ዼ ዼ R1587K R K K E V S1731C S S S T H Five of 10 (50%) amino acids at which cSNPs occur are conserved with G. gallus, indicating a relatively less crucial functional role of these residues compared with those at which mutations occur (Figure 2). Login to comment

[hide] Genetics of HDL regulation in humans. Curr Opin Lipidol. 2003 Jun;14(3):273-9. Miller M, Rhyne J, Hamlette S, Birnbaum J, Rodriguez A
Genetics of HDL regulation in humans.
Curr Opin Lipidol. 2003 Jun;14(3):273-9., [PMID:12840658]

Abstract [show]
PURPOSE OF REVIEW: To review gene regulation of HDL-cholesterol and discuss molecular abnormalities in HDL candidate genes that may lead to human pathologic states. RECENT FINDINGS: The inverse association between HDL-cholesterol and vascular disease, especially coronary heart disease, has long been recognized, but understanding gene regulation of HDL in humans gained considerable momentum following the identification of ABCA1 as playing a pivotal role in reverse cholesterol transport. Recent data suggest that potentially important targets for upregulating HDL in humans include upregulators of ABCA1 and APOA1 (e.g. peroxisome proliferator activated receptor and liver X receptor agonists) and downregulators of CETP (e.g. JTT-705). A host of other nuclear receptors under investigation in animal models may advance to human testing in the near future. SUMMARY: Disorders affecting HDL metabolism are complex because monogenic disorders causing low HDL do not necessarily correlate with premature vascular disease. To date, pathologic phenotypes have only been deduced among several HDL candidate genes. Understanding the genetic underpinnings associated with variant HDL and reverse cholesterol transport provides an exceptional opportunity to identify novel agents that may optimize this process and reduce vascular event rates beyond currently available LDL lowering therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 TD 1591 T/C 11 V399A extracellular [68] TD 1979 (110bpAlu Ins) 12 truncated truncation [60] TD/FHA 2154 C/T 14 R587W extracellular [67,69] TD 2164 G/C 14 W590S extracellular [61] TD 2185 A/G 14 Q597R extracellular [59,67] TD 2219 G/del 14 truncated, 635X truncated [60,61] FHA 2472-2474 3bp del 15 Del L693 TM domain #3 [59] phosphorylation 2706 G/A 16 V771M extracellular [68] 2715 A/C 16 T774P extracellular [68] 2723 G/C 16 K776N extracellular [68] 2868 G/A 17 V825I TM domain #6 [67,68] TD/FHA 3044 A/G 18 I883M cytoplasmic [68] phosphorylat site FHA 3120 C/T 19 R909X truncation [63,71] TD 3181 C/T 19 T929I cytoplasmic [62] TD 3199 A/G 19 N935S Walker A [61] TD 3205 C/T 19 A937V Walker A [61] TD 3532 C/A 22 A1046D cytoplasmic, Walker A/B [70] FHA 3667 T/C 23 M1091T cytoplasmic [63] 3690 G/T 23 D1099Y cytoplasmic [9] TD 3738 2bp del 23 1145X truncation [66] FHA 3911 G/C 24 E1172D linker/cytoplasmic [68] FHA 4242 4bp del 27 1297X truncated [64] TD 4260 G/A 27 D1289N linker cytoplasm [64,65] TD 4824 T/C 31 C1477R extracellular [59] TD 4912 C/T 32 S1506L extracellular loop #2 [71] TD 5025 ins A 34 A1544S?1552X truncation [70] 5059 T/C 34 I1555T extracellular loop #2 [67] 5155 G/A 35 R1587K extracellular loop #2 [68] FHA 5226 A/G 36 N1611D extracellular loop #2 [75..] 5338 T/C 36 L1648P extracellular loop #2 [67] TD 5443 C/T 37 R1680W cytoplasmic [74.] Login to comment

[hide] Common genetic variation in ABCA1 is associated wi... Circulation. 2001 Mar 6;103(9):1198-205. Clee SM, Zwinderman AH, Engert JC, Zwarts KY, Molhuizen HO, Roomp K, Jukema JW, van Wijland M, van Dam M, Hudson TJ, Brooks-Wilson A, Genest J Jr, Kastelein JJ, Hayden MR
Common genetic variation in ABCA1 is associated with altered lipoprotein levels and a modified risk for coronary artery disease.
Circulation. 2001 Mar 6;103(9):1198-205., [PMID:11238261]

Abstract [show]
BACKGROUND: Low plasma HDL cholesterol (HDL-C) is associated with an increased risk of coronary artery disease (CAD). We recently identified the ATP-binding cassette transporter 1 (ABCA1) as the major gene underlying the HDL deficiency associated with reduced cholesterol efflux. Mutations within the ABCA1 gene are associated with decreased HDL-C, increased triglycerides, and an increased risk of CAD. However, the extent to which common variation within this gene influences plasma lipid levels and CAD in the general population is unknown. METHODS AND RESULTS: We examined the phenotypic effects of single nucleotide polymorphisms in the coding region of ABCA1. The R219K variant has a carrier frequency of 46% in Europeans. Carriers have a reduced severity of CAD, decreased focal (minimum obstruction diameter 1.81+/-0.35 versus 1.73+/-0.35 mm in noncarriers, P:=0.001) and diffuse atherosclerosis (mean segment diameter 2.77+/-0.37 versus 2.70+/-0.37 mm, P:=0.005), and fewer coronary events (50% versus 59%, P:=0.02). Atherosclerosis progresses more slowly in carriers of R219K than in noncarriers. Carriers have decreased triglyceride levels (1.42+/-0.49 versus 1.84+/-0.77 mmol/L, P:=0.001) and a trend toward increased HDL-C (0.91+/-0.22 versus 0.88+/-0.20 mmol/L, P:=0.12). Other single nucleotide polymorphisms in the coding region had milder effects on plasma lipids and atherosclerosis. CONCLUSIONS: These data suggest that common variation in ABCA1 significantly influences plasma lipid levels and the severity of CAD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed. Login to comment
48 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5Ј33Ј)* Reverse Oligo (5Ј33Ј)* Annealing Temperature, °C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
85 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587G† S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment
132 Carriers of V399A had half the frequency of a positive family history of CAD (22.2% versus 49.4%, Pϭ0.18) and trends toward an increased baseline MOD (Table 6) and less progression in MSD (-0.05Ϯ0.10 versus 0.08Ϯ0.19 mm in noncarriers, Pϭ0.16) during the trial. Login to comment
137 Carriers of the other 3 rare variants (T774P, K776N, and E1172D) showed no significant differences in lipid levels or CAD compared with their respective noncarriers (Table 6). Login to comment
156 No significant differences in lipid levels or CAD were observed for E1172D carriers compared with R1587K heterozygotes without E1172D. Login to comment
161 ABCA cSNPs in REGRESS MOD, mm MSD, mm HDL-C, mmol/L TG, mmol/L Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P Carrier Noncarrier P V825I 1.74Ϯ0.37 (107) 1.77Ϯ0.35 (575) 0.39 2.70Ϯ0.38 2.75Ϯ0.38 0.21 0.91Ϯ0.23 0.93Ϯ0.22 0.42 1.86Ϯ0.84 1.80Ϯ0.76 0.49 I883M 1.74Ϯ0.38 (100) 1.75Ϯ0.36 (320) 0.71 2.69Ϯ0.38 2.73Ϯ0.36 0.41 0.91Ϯ0.22 0.91Ϯ0.21 0.97 1.75Ϯ0.77 1.82Ϯ0.75 0.42 R1587K 1.77Ϯ0.34 (346) 1.76Ϯ0.37 (433) 0.75 2.73Ϯ0.39 2.74Ϯ0.36 0.64 0.90Ϯ0.22 0.94Ϯ0.23 0.03 1.79Ϯ0.76 1.81Ϯ0.78 0.77 V399A 1.92Ϯ0.32 (9) 1.73Ϯ0.35 (540) 0.13 2.73Ϯ0.40 2.71Ϯ0.37 0.89 1.03Ϯ0.28 0.92Ϯ0.23 0.15 1.71Ϯ0.63 1.82Ϯ0.78 0.68 V771M 1.89Ϯ0.38 (37) 1.76Ϯ0.35 (598) 0.045 2.83Ϯ0.49 2.73Ϯ0.37 0.13 0.91Ϯ0.20 0.92Ϯ0.22 0.58 1.98Ϯ0.79 1.78Ϯ0.76 0.11 T774P 1.63Ϯ0.31 (4) 1.76Ϯ0.36 (621) 0.47 2.85Ϯ0.34 2.73Ϯ0.37 0.52 0.85Ϯ0.07 0.93Ϯ0.22 0.50 1.90Ϯ1.04 1.82Ϯ0.77 0.84 K776N 1.92Ϯ0.33 (3) 1.78Ϯ0.34 (546) 0.48 2.95Ϯ0.48 2.76Ϯ0.37 0.36 0.94Ϯ0.28 0.93Ϯ0.22 0.93 2.25Ϯ0.94 1.76Ϯ0.76 0.26 E117SD 1.80Ϯ0.39 (34) 1.77Ϯ0.36 (610) 0.67 2.78Ϯ0.35 2.74Ϯ0.37 0.42 0.93Ϯ0.23 0.94Ϯ0.23 0.89 1.80Ϯ0.90 1.77Ϯ0.76 0.80 Values are meanϮSD (n). Login to comment
186 Furthermore, we show that I883M is a common variant that is possibly associated with an increased risk of CAD in the homozygous state, although no differences in HDL-C were evident. Login to comment
191 Similarly, the region containing the V771M, T774P, and K776N variants is unlikely to be critical to ABCA1 function, because a high degree of polymorphism is tolerated without functional effects. Login to comment
39 To screen the V399A, V771M, T774P, I883M, and E1172D cSNPs, TaqMan-based assays12 were developed. Login to comment
43 Methods for Restriction Fragment Length Polymorphism Screening of ABCA1 cSNPs Variant pmol of Each Oligo Forward Oligo (5b18;33b18;)* Reverse Oligo (5b18;33b18;)* Annealing Temperature, &#b0;C Enzyme Product, bp Wild-type Allele Variant Allele % Agarose Gel for Resolution G1051A 20 GTATTTTTGCAAGGCTACCAGTTACATTTGACAA 60 EcoN I 177 1.5 (R219K) GATTGGCTTCAGGATGTCCATGTTGGAA 107, 70 T1591C 27.5 GCTGCTGTGATGGGGTATCT 57 Hph I 117, 103, 48, 33 1.5 (V399A) ACCTCACTCACACCTGGGAA 220, 48, 33 G2706A 27.5 CAAGTGAGTGCTTGGGATTG 57 BsaA I 98, 252 2 (V771M) TGCTTTTATTCAGGGACTCCA 350 A2715C 27.5 GTGATCCCAGCGTGGTGTTTGTCTT 55 Hph I 56, 69, 95 2 (T774P) GAAAGGCCAGAGGTACTCACAGCGAAGATCTTGAGGG 56, 161 G2723C 12 TCGTTTTATTCAGGGACTCCA 55 Bgl II 269, 80 2 (K776N) CAAGTGAGTGCTTGGGATTG 349 G2868A 27.5 CCCATGCACTGCAGAGATTC 57 Bsa I 149, 237 2 (V825I) GCAAATTCAAATTTCTCCAGG 386 A3044G 27.5 GAGAAGAGCCACCCTGGTTCCAACCAGAAGAGGAT 55 EcoR V 94, 35 2.5 (I883M) AAGGCAGGAGACATCGCTT 129 G3911C 27.5 GAGCAGTTCTGATGCTGGCCTGGGCAGCGACCACGA 55 BssS I 104, 37 2 (E1172D) TCTGCACCTCTCCTCCTCTG 141 G5155A 27.5 CAGCTTGGGAAGATTTATGACAGGACTGGACACGA 55 BssS I 114, 31 2 (R1587K) ATGCCCCTGCCAACTTAC 145 C5587G 20 GTGCAATTACGTTGTCCCTGCCACACT 60 Mnl I 82, 35 3 (S1731C) CCATACAGCAAAAGTAGAAGGGCTAGCACA 117 *Bold indicates mismatch in oligo to create restriction site. Login to comment
80 Frequencies of ABCA1 cSNPs Nucleotide Change Amino Acid Change Exon REGRESS Carrier Frequency Allele Frequency n* Nonsynonymous G1051A R219K 7 46.3 0.254 1588 T1591C V399A 11 1.6 0.008 1098 G2706A V771M 16 5.8 0.029 1270 A2715C T774P 16 0.6 0.003 1250 G2723C K776N 16 0.5 0.003 1106 G2868A V825I 17 15.7 0.081 1364 A3044G I883M 18 23.8 0.136 840 G3911C E1172D 24 5.3 0.026 1288 G5155A R1587K 35 44.3 0.259 1566 C5587Gߤ S1731C 38 0 0 558 Synonymous From sequencing G869A None 6 62.5 0.38 32 C1331T None 9 31.3 0.19 32 G1343A None 9 25 0.133 32 T3554G None 22 12.5 0.059 32 G4676A None 30 6.3 0.06 32 C6842T None 49 6.3 0.033 32 *Number of alleles screened. Login to comment