ABCMdb

PMID: 11385708

Paloma E, Martinez-Mir A, Vilageliu L, Gonzalez-Duarte R, Balcells S
Spectrum of ABCA4 (ABCR) gene mutations in Spanish patients with autosomal recessive macular dystrophies.
Hum Mutat. 2001 Jun;17(6):504-10., [PubMed]

Sentences

No. Mutations Sentence Comment

6 ABCA4 p.Arg212Cys The R212C change has been found in French, Italian, Dutch, German, and Spanish but not in British patients. Login to comment 7 ABCA4 p.Arg212Cys In the Spanish collection, R212C was found in a CRD patient, indicating that it may be a rather severe change. Login to comment 9 ABCA4 p.Arg1055Trp Interestingly, the c.2588G>C mutation has been found in a double mutant allele together with the missense R1055W. Login to comment 10 ABCA4 p.Leu1940Pro Finally, the newly described L1940P was found in two unrelated Spanish patients, and may be a moderate to severe allele. Login to comment 40 ABCA4 p.Arg152Gln The missense mutation R152Q was confirmed by HinfI digestion of a mismatched PCR product obtained using the 5FOR primer and the following reverse primer: 5' CATCTTTCAAGATATCCCTGATT3',which generates a HinfI restriction site in the mutant allele. Login to comment 41 ABCA4 p.Leu2060Arg ABCA4 p.Asn1805Asp ABCA4 p.Asn1799Asp ABCA4 p.Leu1940Pro ABCA4 p.Thr1253Leu ABCA4 p.Leu686Ser Mutations L686S, c.2888delG, T1253L, c.4253 +5G>A, N1799D, N1805D, L1940P , and L2060R were confirmed by TaqI, Sau96I, HgaI, HhaI, MboI, TaqI, HaeIII, and MspI digestion, respectively. Login to comment 59 ABCA4 p.Gly1961Glu ABCA4 p.Arg212Cys ABCA4 p.Arg2107His ABCA4 p.Arg2107His ABCA4 p.Arg1108Cys ABCA4 p.Arg152Gln ABCA4 p.Arg152Gln ABCA4 p.Leu2060Arg ABCA4 p.Asn1805Asp ABCA4 p.Asn1805Asp ABCA4 p.Arg1055Trp ABCA4 p.Asn1799Asp ABCA4 p.Leu1940Pro ABCA4 p.Leu1940Pro ABCA4 p.Thr1253Leu ABCA4 p.Leu686Ser Pathogenic Mutations In the absence of a functional assay, it is difficult to relate the structural alteration with the TABLE 1. Summary of the Pathogenic Variants Found in the Screening of the ABCA4 Gene Family (NAS) Paternal allele (E) Maternal allele (E) Onset (years) Phenotype SB1 c.3211-3212insGT (22) R212C (6) 9 CRD M266 (2) c.4253+5G>A (28) L2060R (46) 7/4 CRD SM3 [R152Q (5); R2107H (46)] [R152Q (5); R2107H (46)] 7 STGD SZ2 L1940P (41) ND 8 STGD SM1 N1799D (38) ND 9 STGD SM2 c.2888delG (19) [R1055W (21); C.2588G>C (17)] 11 STGD SP1 ND ND 12 STGD SZ3 ND ND 12 STGD M280 N1805D (39) N1805D (39) 14 STGD SB2 (2) R1108C (22) L686S (14) 18/11 STGD SZ4 ND ND 20/28 FFM SP2 ND ND 21 FFM SM4 [T1253L (25); G1961E (42)] ND 38 FFM SZ1 L1940P (41) ND 28 FFM Novel putative pathogenic variants are depicted in bold type and their corresponding nucleotide changes are as follows: L686S=c.2057T>C; R1055W=c.3163C>T; T1253L=c.3758C>T; N1799D=c.5396A>G; N1805D=c.5413A>G; L1940P=c.5819T>C; L2060R=c.6179T>G. Login to comment 72 ABCA4 p.Arg152Gln ABCA4 p.Thr1253Leu The fact that the more conservative changes R152Q and T1253L were found in a double mutant allele makes it difficult to evaluate their contribution to the disease phenotype. Login to comment 77 ABCA4 p.Arg943Gln ABCA4 p.Ser2255Ile These comprise two missense changes found also in control chromosomes that were described as polymorphisms by other authors (R943Q and S2255I). Login to comment 80 ABCA4 p.Pro1948Leu ABCA4 p.Arg943Gln ABCA4 p.Ser2255Ile We examined the genomic sequences surrounding each of the changes looking for cryptic splice sites, and none was found, with the exception of c.1356+ TABLE 2. Summary of the Putative Polymorphisms Found in the Screening of the ABCA4 Gene Nucleotide change Exon/IVS Amino acid change No. of patients No. of controls Referencesa c.1239-14T->C IVS9 1 NT c.1239-63insC IVS9 1 NT c.1356+11delG IVS10 1 7/140 1 c.1762-54G->A IVS12 2 NT c.2829G->A E19 R943Q 1 8/70 2 c.3863-110G->C IVS26 1 0/50 c.4284G->A E29 T1466T 1 0/50 c.5461-50insA IVS38 1 NT c.5584+11C->G IVS39 1 NT c.5715-25C->A IVS40 1 NT c.5844A->G E42 P1948P 1 5/29 3 c.5843CA->TG E42 P1948L 1 NT 3 c.5835-43A->C IVS41 1 NT c.5835-11A->G IVS41 1 NT c.6249C->T E45 I2083I 2 NT 2 c.6285T->C E46 D2095D 1 NT 3 c.6480-21C->T IVS47 1 0/51 c.6730-5A->C IVS48 1 3/50 c.6764G->T E49 S2255I 2 6/26 2 c.6816+28G->C IVS49 1 4/14 a References: 1, Papaioannou et al. [2000]; 2, Allikmets et al. [1997]; 3, Maugeri et al. [1999]. Login to comment 90 ABCA4 p.Arg212Cys When we consider our data together with previous reports of mutation screenings in the USA [Lewis et al., 1999], France [Rozet et al., 1998], Western Europe [Maugeri et al., 1999], United Kingdom [Papaioannou et al., 2000], Italy [Simonelli et al., 2000], and Germany [Rivera et al., 2000], the following picture emerges: 1) Mutation R212C is common in Southern Europe (1/14 Spanish, 2/11 Italian, and 5/55 French), infrequent in the USA (1/150) and Germany (1/144), and absent in UK. 2) Mutation c.2588G>C is rarely found in Southern Europe (1/14 Spanish, 0/11 Italian, 0/55 French) but is frequent in Western and Central Europe and the USA (15/40 Dutch, 5/70 British, 17/144 German, 11/150 USA). Login to comment 93 ABCA4 p.Gly1961Glu 3) Mutation G1961E, which has been reported in most populations as rather infrequent (16/150 USA, 2/40 Dutch, 2/11 Italian, and 1/14 Spanish), has now been reported as very frequent in Germany (33/144). Login to comment 95 ABCA4 p.Arg1108Cys 4) Mutation R1108C appears to show an even distribution (6/150 USA, 4/144 German, 1/55 French, and 1/14 Spanish patients). Login to comment 96 ABCA4 p.Leu1940Pro 5) The newly described L1940P is present in two out of 14 Spanish patients. Login to comment 101 ABCA4 p.Arg212Cys In patient SB1, R212C in combination with a frameshift mutation is associated with CRD. Login to comment 102 ABCA4 p.Arg212Cys This indicates that the R212C variant belongs to the moderate to severe group. Login to comment 103 ABCA4 p.Arg212Cys ABCA4 p.Arg212Cys In agreement with this, homozygous Italian and heterozygous French patients carrying R212C were affected with early onset STGD disease (before 10-12 years) [Rozet et al., 1998; Simonelly et al., 2000], and one R212C heterozygous Dutch patient was affected with CRD [Maugeri et al., 2000]. Login to comment 106 ABCA4 p.Leu2060Arg In family M266, the association of c.4253+ 5G>A and L2060R with CRD suggests that both could be ranked as moderately severe mutations. Login to comment 108 ABCA4 p.Leu1940Pro The newly identified Spanish mutation L1940P was found in heterozygous state in two unrelated patients, and the second disease allele remained unidentified for both of them.Thediseasephenotypewasdiscordant, one of the patients being STGD (onset at eightyears)andtheotherFFM(onsetat28). Login to comment 109 ABCA4 p.Leu1940Pro Based on the finding of L1940P in an early- onsetSTGDpatient,itseemsimprobablethat this is a mild allele. Login to comment 113 ABCA4 p.Arg1055Trp [1999],wasfoundinadouble- mutant allele together with R1055W in the STGD proband of family SM2. Login to comment 116 ABCA4 p.Arg1055Trp From this, we may consider that the double mutant allele c.2588G>C-R1055W is indeed a mild one. Login to comment