ABCMdb

ABCA4 p.Arg2107His

None has been submitted yet.

Publications

PMID: 9781034 [PubMed] Rozet JM et al: "Spectrum of ABCR gene mutations in autosomal recessive macular dystrophies."

No. Sentence Comment

45 Furthermore, all ABCR missense mutations Table 1 Mutations in the ABCR gene in STGD and FFM families Conserved aa in: Nucleotide change Amino acid change Domain ABCs RmP Phenotype Families Comment (571-2)A®G splicing mutation STGD 1 HAD1 (1938-2)A®G splicing mutation STGD 1 (4668+2)T®C splicing mutation STGD 1 (4735+2)T®A splicing mutation STGD 1 del(5196+1-5196+6 splicing mutation STGD 1 LOZ2 2570 delT frameshift mutation STGD 1 3209insGT frameshift mutation STGD 2 CHE2 G3754T E1252X STGD 1 C3994T Q1332X STGD 1 C6337G I2113X STGD 1 JEG2 C52T R18W IC - + STGD 1 C634T R212C EC - + STGD 5 GEN2, JEG2 G1908T Q636H IC - + STGD 1 LOZ2 C3056T T1019M IC - + STGD 1 C3322T R1107C IC - + STGD 1 JUL2 C4916T R1640W IC + + STGD 2 MAR1 G5929A G1977S ATP2 + + STGD 1 GEN2 G6320A R2107H IC + + STGD 1 JUL2 C3114T A1038V IC - + STGD 2 CHE2 +FFM +1 VII2 T1622C L541P EC - + FFM 1 VII2 T31C L11P IC + + FFM 1 G3272A G1090E IC + + FFM 1 G4522T G1508C IC + + FFM 1 C5908T L1970F IC + + FFM 1 GON2 T5912G L1971R IC + + FFM 1 GON2 Mutations refer to the standard nomenclature. Login to comment

PMID: 22328824 [PubMed] Roberts LJ et al: "Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients."

No. Sentence Comment

139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment

PMID: 20398653 [PubMed] Chen B et al: "Analysis of autofluorescent retinal images and measurement of atrophic lesion growth in Stargardt disease."

No. Sentence Comment

82 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,þ1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, þ5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 þ 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND ¼ not done. Login to comment
81 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,&#fe;1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, &#fe;5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 &#fe; 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND &#bc; not done. Login to comment

PMID: 19230850 [PubMed] Molday RS et al: "The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration."

No. Sentence Comment

134 Disease mutations, which are substituted in Stargardt disease, are shown in red italics - NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C); NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment
225 A subset of missense mutations reside in NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C, R1129L) and NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment

PMID: 19243736 [PubMed] Kellner S et al: "Lipofuscin- and melanin-related fundus autofluorescence in patients with ABCA4-associated retinal dystrophies."

No. Sentence Comment

32 Age Gender ABCA4 Mutation VA RE/LE Full-field ERG Multifocal ERG Group 1a CRD 2808 34 F c.5413AϾG (p.Asn1805Asp) c.4880_4903dup24 (p.Leu1627_Ala1634dup) 0.05 0.05 DA and LA markedly reduced No recordable potentials CRD 2830 53 F c.2690CϾT (p.Thr897Ile), c.6176GϾC (p.Gly2059Ala) 0.5 0.7 DA and LA moderately reduced Pericentral amplitude reduction CRD 2797 54 M c.4297GϾA (p.Val1433Ile) 2. mutation not foundc 0.1 0.16 DA and LA moderately reduced Not done SD 2872 44 F c.4462TϾC (p.Cys1488Arg) 2. mutation not done 0.6 0.7 DA and LA borderline Central amplitude reduction CRD 2861 72 F c.122GϾA (p.Trp41Ter) 2. mutation not done 0.4 0.5 DA: mildly and LA: moderately reduced Central amplitude reduction CRD 2644 67 F c.634CϾT (p.Arg212Cys), c.656GϾC (p.Arg219Thr), c.2588GϾC (p.Gly863Ala/ delGly863) 0.6 0.04 DA and LA moderately reduced Central amplitude reduction CRD 2936 44 F c.1622TϾC (p.Leu541Pro)/ c.3113CϾT (p.Ala1038Val), 2. mutation not done 1.0 1.0 DA: mildly and LA: moderately reduced Pericentral amplitude reduction Group 2b SD 2837 42 M c.1622TϾC (p.Leu541Pro)/ c.3113CϾT (p.Ala1038Val), c.5882GϾA (p.Gly1961Glu) 0.16 0.16 Normal Central amplitude reduction SD 2780 37 M c.768GϾT (splice mutation) c.5882GϾA (p.Gly1961Glu) 0.1 0.1 Normal Central amplitude reduction SD 2942 47 F c.1622TϾC (p.Leu541Pro) c.6320 GϾA (p.Arg2107His) 0.1 0.16 Not done Central amplitude reduction SD 2930 40 F c.6089GϾA (p.Arg2030Gln) c.6543del36bp, (p.Leu2182_Phe2193del) 0.1 0.1 DA and LA mildly reduced Central amplitude reduction SD 2933 43 F c.1609CϾT (p.Arg537Cys) c.5882GϾA (p.Gly1961Glu) c.1654GϾA (p.Val552Ile) 0.05 0.1 Normal Not done SD 2669 13 F c.768GϾT (splice mutation) c.6449GϾA (p.Cys2150Tyr) 0.1 0.16 DA and LA borderline Central amplitude reduction SD 2700 22 F c.1609CϾT (p.Arg537Cys) c.2588GϾC (p.Gly863Ala) 0.1 0.1 Normal Central amplitude reduction SD 2833 29 M c.1928TϾG (p.Val643Gly) 2. mutation not foundc 0.1 0.1 Normal Not done SD 2799 13 M c.3113CϾT (p.Ala1038Val) c.5461-10TϾC 0.4 0.4 Not done Central amplitude reduction CRD ϭ cone-rod dystrophy; DA ϭ dark adaptation; ERG ϭ electroretinography; F ϭ female; LA ϭ light adaptation; LE ϭ left eye; M ϭ male; RE ϭ right eye; SD ϭ Stargardt disease; VA ϭ visual acuity. Login to comment

PMID: 19028736 [PubMed] Aguirre-Lamban J et al: "Molecular analysis of the ABCA4 gene for reliable detection of allelic variations in Spanish patients: identification of 21 novel variants."

No. Sentence Comment

80 Clinical science Br J Ophthalmol 2009;93:614-621. doi:10.1136/bjo.2008.145193 Table 1 Clinical findings of the Spanish patients with Stargardt disease (STGD), autosomal recessive cone-rod dystrophy and autosomal recessive retinitis pigmentosa Pedigree Age (years) Age (years) of onset Visual acuity Diagnosis Allele 1 Allele 2 Segregation OD OS Nucleotide changes (exons) Amino acid change Nucleotide changes (exons) Amino acid change ARDM-135 42 24 0.4 0.6 STGD c.5882G.A(42) p.Gly1961Glu c.1029_1030insT(8) p.Asn344fsX NP ARDM-240 15 13 0.2 0.16 STGD c.5882G.A(42) p.Gly1961Glu c.2285C.A(15) p.Ala762Glu Yes ARDM-225 32 25 0.25 0.50 STGD c.5882G.A(42) p.Gly1961Glu c.6559C.T(48) p.Gln2187X Yes ARDM-164 21 11 NA STGD c.3386G.T(23) p.Arg1129Leu c.700C.T(6) p.Gln234X Yes ARDM-162 50 16 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND Yes ARDM-198 27 19 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND NP ARDM-125 31 9 0.3 0.4 STGD c.3211insGT(22) FS p.KNLFA1876dup Yes ARDM-158 24 9 0.2 0.2 STGD c.3211insGT(22) FS c.4537delC(30) p.Gln1513fsX1525 NP ARDM-165 40 30 NA STGD c.3211insGT(22) FS ND ND NP ARDM-167 49 23 0.05 0.05 STGD c.3211insGT(22) FS ND ND NP ARDM-146 32 13 0.06 0.1 STGD c.3056C.T(21) p.Thr1019Met c.6140T.A(44) p.Ile2047Asn Yes ARDM-40 46 9 0.1 0.1 STGD c.3056C.T(21) p.Thr1019Met c.3943C.T(27) p.Gln1315X Yes ARDM-90 26 8 Hand moving STGD c.5929G.A (43) p.Gly1977Ser IVS21-2A.T Yes ARDM-181 57 16 0.1 0.09 STGD c.3323G.A (22) p.Arg1108His IVS38+5G.A Yes ARDM-197 35 15 0.1 0.1 STGD c.4793C.A(34) (false +) p.Ala1598Asp (false +) c.5172G.T(36) p.Trp1724Cys Yes ARDM-183 63 55 0.150 0.175 STGD c.6079C.T(44) p.Leu2027Phe c.5929G.A(43) (false -) p.Gly1977Ser (false -) NP ARDM-38 35 6 0.01 0.02 STGD c.1804C.T(13) p.Arg602Trp c.4739delT(33) p.Leu1580fs Yes ARDM-163 48 32 0.01 0.32 STGD c.4457C.T(30) p.Pro1486Leu ND ND Yes ARDM-166 42 39 NA STGD c.6320G.A(46) p.Arg2107His ND ND Yes ARDM-222 26 23 NA STGD c.2791G.A(19) p.Val931Met ND ND NP ARDM-160 30 5 0.25 0.1 STGD ND ND ND ND Yes ARDM-173 49 7 NA STGD ND ND ND ND Yes ARDM-205 NA NA NA STGD c.4919G.A(35) p.Arg1640Gln ND ND NP ARDM-247 30 12 0.05 0.1 CRD c.3386G.T(23) p.Arg1129Leu c.6410G.A(47) p.Cys2137Tyr Yes ARDM-99 59 46 0.05 0.05 CRD c.4297G.A(29) p.Val1433Ile ND ND NP ARDM-131 27 15 0.9 0.7 CRD c.2701A.G(18) p.Thr901Ala ND ND Yes ARDM-100 28 4 0.2 0.16 CRD ND ND ND ND Yes ARDM-142 30 25 0.8 0.5 CRD ND ND ND ND Yes RP-773 38 20 0.05 0.05 RP c.33N86G.T(23) p.Arg1129Leu ND ND NP RP-959 53 10 0.1 0.1 RP c.466A.G(5) p.Ile156Val ND ND Yes RP-1058 37 6 0.2 0.6 RP c.4297G.A(29) p.Val1433Ile ND ND NP Twenty-seven out of 31 subjects were found to be compound heterozygous for mutations in the ABCA4 gene detected by microarray. Login to comment

PMID: 19365039 [PubMed] Roberts LJ et al: "Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip."

No. Sentence Comment

58 One proband was confirmed to have inherited the heterozygous R2107H mutation from her father. Login to comment
61 This insertion, 4535insC, causes a 41-amino acid frameshift followed by a stop codon at position 1554, leading to STGD.10,11 Compound heterozygosity of the R2107H and the 4535insC mutations is therefore causative of disease in this proband (Figure 5C). Login to comment
87 If the microarray probes position 4537 and the sequence containing the insertion displays a C/C genotype at position 4537, no mutation should C Het R2107H (No 4535insC) Het R2107H (No 4535insC) 150 160 170 200 190 180 A C C C C C C C C C C C C C C C C C C C C C C C C C C C A G G G G G G G G G G G G G G G G G G G T T T T T T A A A A A A A A A B 180 190 200 210 220 230 C C C C C C C C C C C C C C C C C C C C C C N N N N N N N N N N N N N N A A A A A A A G G G G G G G G G G G G G G G G G T T Figure 5. Login to comment
91 C, The pedigree of family RPS145, showing the compound heterozygosity of R2107H and 4535insC. Login to comment
60 One proband was confirmed to have inherited the heterozygous R2107H mutation from her father. Login to comment
63 This insertion, 4535insC, causes a 41-amino acid frameshift followed by a stop codon at position 1554, leading to STGD.10,11 Compound heterozygosity of the R2107H and the 4535insC mutations is therefore causative of disease in this proband (Figure 5C). Login to comment
89 If the microarray probes position 4537 and the sequence containing the insertion displays a C/C genotype at position 4537, no mutation should C Het R2107H (No 4535insC) Het R2107H (No 4535insC) 150 160 170 200 190 180 A C C C C C C C C C C C C C C C C C C C C C C C C C C C A G G G G G G G G G G G G G G G G G G G T T T T T T A A A A A A A A A B 180 190 200 210 220 230 C C C C C C C C C C C C C C C C C C C C C C N N N N N N N N N N N N N N A A A A A A A G G G G G G G G G G G G G G G G G T T Figure 5. Login to comment
93 C, The pedigree of family RPS145, showing the compound heterozygosity of R2107H and 4535insC. Login to comment

PMID: 17325179 [PubMed] Aleman TS et al: "Macular pigment and lutein supplementation in ABCA4-associated retinal degenerations."

No. Sentence Comment

61 Clinical and Molecular Characteristics of the Patients Patient Age (y)/Gender ABCA4 Mutation Visual Acuity* Refraction† Kinetic Visual Field Extent (V-4e)‡ Lutein Trial Participant?RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 -0.50 -0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 -1.00 -1.25 103 104 N 3 18/M ࿣ 20/20 20/125 -1.00 -1.00 126 105 N 4§ 19/F R1129L/L1940P 20/40 20/50 ϩ0.25 ϩ0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 -0.75 -0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 -1.25 -1.50 112 105 Y 7§ 26/M ࿣ 20/40 20/32 ϩ1.00 ϩ0.75 86 88 Y 8 30/F ࿣ 20/50 20/40 ϩ2.25 ϩ1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 -2.25 -3.50 99 93 Y 10 32/F V935A/IVS40ϩ5G3A 20/32 20/40 -0.75 -1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 -1.50 -1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 -3.00 -2.00 99 105 Y 13¶ 38/F V256V/G1961E 20/25 20/25 -1.00 -1.25 106 101 Y 14¶ 42/F V256V/G1961E 20/25 20/32 -0.50 -0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 ϩ0.75 ϩ0.25 108 103 N 16§ 49/M ࿣ 20/32 20/32 -4.50 -4.50 84 79 Y 17 56/M G1977S 20/25 20/25 -5.50 -5.50 99 109 N * Best corrected visual acuity. Login to comment
62 RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 afa;0.50 afa;0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 afa;1.00 afa;1.25 103 104 N 3 18/M $f3; 20/20 20/125 afa;1.00 afa;1.00 126 105 N 4&#a7; 19/F R1129L/L1940P 20/40 20/50 af9;0.25 af9;0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 afa;0.75 afa;0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 afa;1.25 afa;1.50 112 105 Y 7&#a7; 26/M $f3; 20/40 20/32 af9;1.00 af9;0.75 86 88 Y 8 30/F $f3; 20/50 20/40 af9;2.25 af9;1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 afa;2.25 afa;3.50 99 93 Y 10 32/F V935A/IVS40af9;5G3A 20/32 20/40 afa;0.75 afa;1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 afa;1.50 afa;1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 afa;3.00 afa;2.00 99 105 Y 13&#b6; 38/F V256V/G1961E 20/25 20/25 afa;1.00 afa;1.25 106 101 Y 14&#b6; 42/F V256V/G1961E 20/25 20/32 afa;0.50 afa;0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 af9;0.75 af9;0.25 108 103 N 16&#a7; 49/M $f3; 20/32 20/32 afa;4.50 afa;4.50 84 79 Y 17 56/M G1977S 20/25 20/25 afa;5.50 afa;5.50 99 109 N * Best corrected visual acuity. Login to comment

PMID: 15192030 [PubMed] Stenirri S et al: "Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations."

No. Sentence Comment

35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment
34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment

PMID: 15223829 [PubMed] Kang Derwent JJ et al: "Dark adaptation of rod photoreceptors in normal subjects, and in patients with Stargardt disease and an ABCA4 mutation."

No. Sentence Comment

53 Description of Subjects Subject Number Age* Sex ABCA4 Variation Dark-Adapted Maximum Peak a-Wave Amplitude (␮V)† Normal subjects 101 55 M - -243 102 37 F - -410 103 26 M - -188 104 23 F - -397 105 56 F - -268 111 29 F - -362 112 23 M - -410 -325 Ϯ 91 Stargardt patients 106 50 F val849ala, arg2107his -201 107 41 M gly1961glu, arg2077trp -306 108 22 M ala60val, 1 bp ins codon 1513 -82 109 34 M leu541pro/ala1038val,‡ gly1961glu -277 110 51 M gly1961glu -191 -211 Ϯ 87 * Age on the date of determination of the a-wave result shown in the right-hand column. Login to comment

PMID: 14709597 [PubMed] Cideciyan AV et al: "Mutations in ABCA4 result in accumulation of lipofuscin before slowing of the retinoid cycle: a reappraisal of the human disease sequence."

No. Sentence Comment

46 Similarly, a compound heterozygote (P4) with V849A and R408X mutations showed less severe disease than a patient (P7) with V849A and R2107H changes. Login to comment

PMID: 11726554 [PubMed] Shroyer NF et al: "Cosegregation and functional analysis of mutant ABCR (ABCA4) alleles in families that manifest both Stargardt disease and age-related macular degeneration."

No. Sentence Comment

97 Pedigree Maternal allele Paternal allele AMD relative A priori Cosegregation AR19 pGM, -6 0.5 - AR33 [W1408R; R1640W] R24H and D1532N mA, -16 0.5 Yes AR59 4232insTATG C1488R pGM, -6 0.5 No AR80 T1526M pGF, -5 0.5 - AR80 T1526M mGF, -7 0.5 Yes AR125 4947delC C1488R pGM, -7 0.5 Yes AR215 [H1406Y; V2050L] pGM, -5 0.5 - AR218 2160+1G→C G1961E mA, -8 0.5 No AR262 W821R pGGF, -7 0.25 No AR271 P68R E1087K mGA, -6 0.25 No AR335 D645N F608I mGM, -9 0.5 Yes AR382 R1108C mGM, -6 0.5 Yes AR389 E2096K 5714+5G→A pGM, -8 0.5 Yes AR397 5196+1G→A 5585-1G→A mA, -5 0.5 No AR410 A1038V 768G→T pC, -5 0.25 Yes AR422 pGM, -6 0.5 - AR423 P1380L D1532N pGF, -4 0.5 No AR468 P1380L P1380L mU, -9 0.5 Yes AR484 L2027F G550R mGU, -5 0.25 Yes AR562 R2107H 3050+5G→A pGU, -5 0.25 No AR643 5196+2T→C L2027F mU, -4 0.5 Yes AR661 P1380L C54Y mGF, -6 0.5 Yes AR669 664del13 pGF, -4 0.5 No AR534 W821R P1380L pGM, -7 0.5 Yes (17) Family 1 R212C I2113M mGM, I-2 0.5 Yes (27) Family 2 R1108C R2107H mGM, I-2 0.5 Yes (27) Family 3 R212C G1977S mGF, I-1 0.5 Yes (27) 10.25 15 unlikely to account for many of the remaining alleles (our unpublished observations). Login to comment

PMID: 11527935 [PubMed] Briggs CE et al: "Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration."

No. Sentence Comment

147 Missense Changes Found in Patients with No Other Detected ABCR Changes Patient ID Missense Change Mouse abc134 Mouse abc234 Human ABCC35 032-069 Ala60Val Ala N/A Glu 032-028 Gly65Glu Gly N/A Leu 032-044 Gly550Arg* Gly N/A N/A 032-038 Trp821Arg‡ Trp N/A Trp 035-019, 032-097 Glu1122Lys Glu Glu Glu 032-063, 032-093 Arg2030Gln† Arg Arg Arg 071-002 Leu2035Pro Phe Leu Met 032-064 Val2050Leu Phe Val Cys 032-061 Arg2107His Arg Arg Arg 007-009 Gly2146Asp‡ Gly Gly Gly Residues at homologous locations in other ABCR proteins. Login to comment
144 Missense Changes Found in Patients with No Other Detected ABCR Changes Patient ID Missense Change Mouse abc134 Mouse abc234 Human ABCC35 032-069 Ala60Val Ala N/A Glu 032-028 Gly65Glu Gly N/A Leu 032-044 Gly550Arg* Gly N/A N/A 032-038 Trp821Argߥ Trp N/A Trp 035-019, 032-097 Glu1122Lys Glu Glu Glu 032-063, 032-093 Arg2030Glnߤ Arg Arg Arg 071-002 Leu2035Pro Phe Leu Met 032-064 Val2050Leu Phe Val Cys 032-061 Arg2107His Arg Arg Arg 007-009 Gly2146Aspߥ Gly Gly Gly Residues at homologous locations in other ABCR proteins. Login to comment

PMID: 11384574 [PubMed] Shroyer NF et al: "Analysis of the ABCR (ABCA4) gene in 4-aminoquinoline retinopathy: is retinal toxicity by chloroquine and hydroxychloroquine related to Stargardt disease?"

No. Sentence Comment

53 This alteration was reported previously in an unrelated patient with Stargardt disease.23 In addition, subject 7 is homozygous for the transition 6320G3A, which encodes the missense substitution Arg2107His, reported previously in six unrelated patients with Stargardt disease.24-26 Thus, subject 7 is compound heterozygous for both the missense mutation Arg2107His and for the complex allele (Leu1201Arg; Arg2107His). Login to comment
73 Also, recent biochemical characterization of recombinant ABCR protein with the Arg1129Leu mutation revealed a substantial reduction in both expression and ATP binding when compared with wild type ABCR.27 Thus, the pathogenic allele Arg1129Cys is likely to cause severe reduction in ABCR activity and may predispose development of chloroquine/hydroxychloroquine maculopathy in the heterozygous state. Subject 7 is compound heterozygous for the missense mutation Arg2107His and the complex allele (Leu1201Arg; Arg2107His). Login to comment
76 Neither the Leu1201Arg nor the Arg2107His mutations was identified in 160 control chromosomes. Login to comment
77 The Arg2107His mutation has also been biochemically characterized by Sun and associates,27 who report a moderate effect on expression level and reduced ATP binding of this mutant protein. Login to comment
78 It is unknown how the combinations of the Leu1201Arg and Arg2107His mutations may combine to reduce ABCR activity; however, we predict that subject 7 may have very low remaining ABCR activity. Login to comment

PMID: 11385708 [PubMed] Paloma E et al: "Spectrum of ABCA4 (ABCR) gene mutations in Spanish patients with autosomal recessive macular dystrophies."

No. Sentence Comment

59 Pathogenic Mutations In the absence of a functional assay, it is difficult to relate the structural alteration with the TABLE 1. Summary of the Pathogenic Variants Found in the Screening of the ABCA4 Gene Family (NAS) Paternal allele (E) Maternal allele (E) Onset (years) Phenotype SB1 c.3211-3212insGT (22) R212C (6) 9 CRD M266 (2) c.4253+5G>A (28) L2060R (46) 7/4 CRD SM3 [R152Q (5); R2107H (46)] [R152Q (5); R2107H (46)] 7 STGD SZ2 L1940P (41) ND 8 STGD SM1 N1799D (38) ND 9 STGD SM2 c.2888delG (19) [R1055W (21); C.2588G>C (17)] 11 STGD SP1 ND ND 12 STGD SZ3 ND ND 12 STGD M280 N1805D (39) N1805D (39) 14 STGD SB2 (2) R1108C (22) L686S (14) 18/11 STGD SZ4 ND ND 20/28 FFM SP2 ND ND 21 FFM SM4 [T1253L (25); G1961E (42)] ND 38 FFM SZ1 L1940P (41) ND 28 FFM Novel putative pathogenic variants are depicted in bold type and their corresponding nucleotide changes are as follows: L686S=c.2057T>C; R1055W=c.3163C>T; T1253L=c.3758C>T; N1799D=c.5396A>G; N1805D=c.5413A>G; L1940P=c.5819T>C; L2060R=c.6179T>G. Login to comment

PMID: 11328725 [PubMed] Webster AR et al: "An analysis of allelic variation in the ABCA4 gene."

No. Sentence Comment

102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
148 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His. Login to comment
103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
149 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His. Login to comment

PMID: 10458172 [PubMed] Souied EH et al: "Age-related macular degeneration in grandparents of patients with Stargardt disease: genetic study."

No. Sentence Comment

3 ● RESULTS: Compound heterozygous missense mutations were observed in patients with Stargardt disease (Arg212Cys, Arg1107Cys, Gly1977Ser, Arg2107His, and le2113Met). Login to comment
46 Compound heterozygous missense mutations were observed in patients with Stargardt disease: Arg212Cys and Ile2113Met (III.1 and III.2, family 1), Arg1107Cys and Arg2107His (III.1 and III.2, family 2), Arg212Cys and Gly1977Ser (III.1 family 3) (Figure 1). Login to comment
56 Clinical Data of Individuals From the Three Pedigrees Individual, Family Age (yrs) Visual Acuity Macular Involvement (fundus examination and FA) Genotype*RE LE I.2, fam 1 78 CF CF RPE atrophy, some hard drusen and choroidal new vessel (Figure 2, top left) Arg212Cys/wt I.2, fam 2 86 CF CF Progressive geographic atrophy since the age of 80 (Figure 2, top right) Arg1107Cys/wt I.1, fam 2 75 20/30 20/40 Patches of RPE atrophy and perimacular soft drusen (Figure 2, middle left) Arg212Cys/wt I.2, fam 3 72 20/20 20/20 None wt/wt II.1, fam 1 44 20/20 20/20 None Ile2113Met/wt II.2, fam 1 50 20/20 20/25 Diffuse hard drusen (Figure 2, middle right) Arg212Cys/wt II.1, fam 2 70 20/20 20/20 None Arg2107His/wt II.2, fam 2 66 20/20 20/25 Diffuse hard drusen (Figure 2, bottom) Arg1107Cys/wt II.1, fam 3 37 20/20 20/20 None Gly1977Ser/wt II.2, fam 3 39 20/20 20/20 None Arg212Cys/wt III.1, fam 1 10 20/200 20/200 RPE atrophy, fundus flavimaculatus and choroidal silent Arg212Cys/Ile2113Met III.2, fam 1 6 20/20 20/20 None Ile2113Met/wt III.1, fam 2 33 20/200 CF RPE atrophy, fundus flavimaculatus and choroidal silent Arg1107Cys/Arg2107His III.2, fam 2 28 CF CF RPE atrophy, fundus flavimaculatus and choroidal silent Arg1107Cys/Arg2107His III.3, fam 2 24 20/20 20/20 None Arg2107His/wt III.1, fam 3 12 CF 20/200 RPE atrophy, fundus flavimaculatus and choroidal silent Arg212Cys/Gly1977Ser III.2, fam 3 9 20/20 20/20 None wt/wt CF ϭ counting fingers; FA ϭ fluorescein angiography; None ϭ no macular degeneration; RPE ϭ retinal pigment epithelium; wt ϭ wild type. Login to comment

PMID: 10206579 [PubMed] Fishman GA et al: "Variation of clinical expression in patients with Stargardt dystrophy and sequence variations in the ABCR gene."

No. Sentence Comment

70 Clinical Features of Patients With ABCR Gene Mutations* Patient No./ Sex/Age, y Clinical Phenotype Vision Silent Choroid Central Scotoma MutationOD OS 1/M/19 I 20/200 20/200 ND + Thr300Asn, exon 8 2/M/44 I 20/25 20/15 - + Cys1488Arg, exon 30 3/M/35 I 20/100 20/100 ND + Gly1961Glu, exon 42 Cys2150Tyr, exon 47 4/M/44 I 20/200 20/200 - + Gly1961Glu, exon 42 5/F/28 I 20/80 20/100 - + Gly1961Glu, exon 42 Gly65Glu, exon 3 6/M/36 I 20/25 20/200 - + Gly1961Glu, exon 42 Arg2077Trp, exon 45 7/F/44 I 20/200 20/200 - + Gly1961Glu, exon 42 8/M/41 I 20/200 20/200 - + Gly1961Glu, exon 42 9/F/32 I 20/25 20/30 - + Gly1961Glu, exon 42 10/F/36 I 20/50 20/200 - + Gly1961Glu, exon 42 11/M/31 I 20/200 20/200 - + Gly1961Glu, exon 42 Ala1038Val, exon 21 Leu541Pro, exon 12 12/M/35 I 20/200 20/200 - + Arg2107His, exon 46 Leu1729Pro, exon 36 13/M/22 II 20/200 20/200 + + 1bp del (g), codon 448, exon 10 14/F/9 II 20/200 20/40 ND + 9bp del, codon 1760/1761, exon 37 1bp ins (c), codon 1513, exon 30 15/M/19 II 10/120 10/160 + + 1bp ins (c), codon 1513, exon 30 Ala60Val, exon 3 16/M/25 II 20/200 20/200 + ND Ser974Pro, exon 20 17/F/12 II 20/200 20/200 ND + 2884 del (c), exon 19 18/F/73 II 20/30 20/25 + Paracentral scotoma 5bp del, codon 505, exon 11 19/F/35 II 10/160 10/120 ND + Val849Ala, exon 16 20/F/48 II 20/400 20/400 + +; Mild peripheral restriction Val849Ala, exon 16 Arg2107His, exon 46 21/M/54 II 20/200 20/200 + + Arg2030stop, exon 44 22/M/28 II 20/400 20/400 + + His2128Arg, exon 46 23/F/34 III 10/400 10/225 Diffuse hyperfluorescence ND Arg2038Trp, exon 44 24/F/53 III 10/700 10/600 Diffuse hyperfluorescence and notable choroidal atrophy + Arg1108Cys, exon 22 25/F/54 III 10/350 3/350 Diffuse hyperfluorescence +; Mild concentric restriction Tyr1652Asp, exon 35 Arg2107His, exon 46 26/M/57 III 20/50 20/80 ND ND Splice donor GϾA, exon 24 27/F/65 III 1/225 1/225 Diffuse choroidal atrophy Temporal islands Gly1961Glu, exon 42 frameshift del, codons 1620-1622, exon 35† 28/M/32 III 20/400 20/400 Diffuse hyperfluorescence +; Peripheral restriction Ala1038Val, exon 21 Leu541Pro, exon 12 Donor splice, exon 30 29/M/46 III 10/225 10/225 ND +; Peripheral restriction Trp1408Leu, exon 28 Ser206Arg, exon 6 Arg2107His, exon 46 *M indicates male; F, female; ND, angiography or visual field testing not done; +, present; and -, absent. Login to comment

PMID: 23499370 [PubMed] Fujinami K et al: "A longitudinal study of stargardt disease: clinical and electrophysiologic assessment, progression, and genotype correlations."

No. Sentence Comment

89 Clinical Data and Molecular Genetic Status of 59 Patients With Stargardt Disease Pt Onset (y) Age (y) logMAR VA Variants Identifieda BL FU BL FU 1 16 17 26 0.0/1.0 0.0/0.48 c.768G>T / p.Gly863Ala / p.Arg943Gln 2 15 17 25 0.78/0.78 1.0/1.0 p. Arg1443His 3 11 18 27 0.78/1.0 1.0/1.0 p.Trp439* / p.Gly863Ala / p.Leu1970Phe 4 19 21 32 0.78/0.78 1.0/1.0 p.Leu2027Phe 5 10 22 30 0.48/0.48 1.0/0.78 p.Gly863Ala / p.Arg943Gln / c.5461-10 T>C 6 18 26 37 0.78/1.0 1.0/1.0 p.Pro1380Phe 7 25 28 40 0.78/1.0 1.3/0.78 ND 8 24 29 38 1.0/0.78 1.0/1.0 p.Phe418Ser / p.Leu2027Phe 9 24 31 44 1.0/1.0 1.3/1.0 c.4253&#fe;5 G>T / p.Gly1507Arg 10 26 32 44 0.78/0.78 1.0/1.0 p.Cys1490Tyr / p.Arg2030Gln 11 31 34 46 0.18/0.3 0.6/0.7 ND 12 17 35 47 1.0/1.0 1.0/1.0 p.Asn96His 13 23 35 45 1.0/0.3 1.0/0.48 p.Gly1513Profs*1554 14 33 37 48 0.18/1.48 1.0/1.3 ND 15 38 40 51 0.18/0.78 1.0/1.0 p.Arg2107His 16 42 43 53 0.0/0.0 1.0/1.0 ND 17 22 48 59 1.0/1.0 1.0/1.0 p.Cys54Tyr 18 20 49 59 1.0/0.6 1.0/1.0 p.Pro1380Leu / p.Gly1961Glu 19 35 50 61 1.0/0.3 1.0/1.0 p.Arg1108Cys 20 25 56 67 1.3/0.18 1.0/1.0 p.Trp439* / p.Gly863Ala 21 48 59 71 1.0/0.78 1.0/1.0 p. Ile156 Val / p. Cys1455Arg / p. Phe1839Ser 22 21 22 31 0.3/1.0 1.0/1.0 p.Arg2107His 23 21 23 33 1.0/1.0 1.0/1.0 p.Gly863Ala 24 48 64 73 0.0/1.0 0.18/3.0 p.Tyr1652* 25 17 19 29 0.78/0.3 1.0/1.0 c.5461-10 T>C 26 17 21 33 1.0/0.78 1.0/1.0 ND 27 27 53 66 1.78/1.78 1.3/1.0 p.Ser1071Cysfs*1084 28 5 14 21 0.78/0.78 1.0/1.0 p.Arg408* / p.Val675lle 29 9 15 27 1.08/1.08 1.0/1.0 p.Cys2150Tyr 30 14 24 32 1.0/0.78 1.0/1.0 ND 31 18 28 39 1.0/1.0 1.0/1.0 p.Gly863Ala / p.Arg1108Cys / p.Arg943Gln 32 14 29 37 1.0/1.0 1.0/1.0 p.Arg653Cys / p.Arg2030Gln 33 19 29 40 1.0/1.0 1.0/1.08 ND 34 34 40 49 0.3/0.48 1.0/1.0 p.Gly863Ala / p.Glu1087Lys 35 25 43 54 1.0/1.0 1.0/1.0 p.Cys54Tyr / p.Gly863Ala 36 38 60 69 1.0/1.0 1.3/1.08 p.Val931Met / c.5461-10 T>C 37 10 11 20 1.0/0.78 1.3/1.3 p.Pro1380Leu 38 10 15 23 1.0/1.0 1.3/1.3 p.Ser1071Cysfs*1084 / p.Pro1380Leu 39 24 25 38 1.56/0.3 2.0/2.0 c.5461-10 T>C / c.5714&#fe;5 G>A 40 18 26 36 1.3/1.3 2.0/1.3 ND 41 32 33 45 0.48/0.48 1.0/1.0 ND 42 32 35 46 1.3/0.0 3.0/1.0 p.Cys54Tyr 43 30 35 45 0.48/0.48 2.0/1.3 ND 44 15 41 49 1.3/1.3 2.0/1.3 p.Asn965Ser 45 8 8 20 0.78/0.78 1.0/1.0 p.Thr1019Met 46 10 11 23 1.0/1.0 1.0/1.0 p.Thr1019Met 47 8 12 24 2.0/1.56 1.78/1.48 p.Cys2150Tyr 48 17 18 26 1.0/0.78 1.3/1.0 c.5461-10 T>C / p.Leu2027Phe 49 8 21 33 1.3/1.3 2.0/2.0 p.Asp574Aspfs*582 50 8 27 39 2.0/1.56 1.78/1.48 c.5461-10 T>C 51 24 31 43 1.18/1.18 1.08/1.3 p.Arg1640Trp / p.Leu2027Phe Continued on next page respective electrophysiologic traces appear in Figure 2. Login to comment

PMID: 23882696 [PubMed] Ritter M et al: "Characterization of stargardt disease using polarization-sensitive optical coherence tomography and fundus autofluorescence imaging."

No. Sentence Comment

102 Patient Characteristics Patient Number Sex Age Age of Onset Visual Acuity RE/LE Fundus Phenotype ERG Type ABCA4 Mutation Allele 1 ABCA4 Mutation Allele 2 Exon Position cDNA Effect on Protein Exon Position cDNA Effect on Protein 1 M 52 19 1.00/1.30 1 2 33 c.4738_4739delTT p.Leu1580Lysfs*16 46 c.6320G>A p.Arg2107His 2 F 32 9 1.30/1.00 1 1 19 c.2829delG p.Pro944Glnfs*6 42 c.5882G>A p.Gly1961Glu 3 M 29 16 1.30/1.00 1 1 IVS1 c.66&#fe;3A>C / 19 c.2791G>A p.Val931Met 4 F 32 20 1.00/1.00 1 1 17 c.2588G>C* p.Gly863Ala* 22 c.3266C>T p.Thr1089Ile 5 M 28 21 0.52/0.70 1 1 42 c.5882G>A p.Gly1961Glu 42 c.5882G>A p.Gly1961Glu 6 F 25 20 1.00/0.80 1 1 13 c.1865delG p.Ser622Thrfs*27 42 c.5882G>A p.Gly1961Glu 7 F 32 27 0.05/0.10 2 1 25 c.3626T>C p.Met1209Thr 33 c.4739T>C p.Leu1580Ser 8 F 42 17 1.00/1.00 2 1 12 c.1622T>C* p.Leu541Proߤ 42 c.5882G>A p.Gly1961Glu 9 F 23 23 0.00/0.00 2 1 IVS40 c.5714&#fe;5G>A / IVS40 c.5714&#fe;5G>A / 10 F 30 16 1.00/1.00 2 1 12 c.1622T>Cߤ p.Leu541Proߤ 19 c.2864A>G p.Glu955Gly 11 M 45 19 1.30/1.30 3 2 12 c.1622T>Cߤ p.Leu541Proߤ 17 c.2588G>C* p.Gly863Ala* 12 M 37 14 1.00/1.00 3 2 12 c.1622T>Cߤ p.Leu541Proߤ 19 c.2864A>G p.Glu955Gly 13 F 27 20 1.00/1.00 3 2 12 c.1622T>Cߤ p.Leu541Proߤ IVS40 c.5714&#fe;5G>A / 14 M 41 14 2.00/2.00 3 3 IVS13 c.1937&#fe;1G>A / 17 c.2588G>C* p.Gly863Ala* Patient number, sex, age, age of disease onset, visual acuity (logMAR), fundus phenotype (1, STGD phenotype 1; 2, STGD phenotype 2; 3, STGD phenotype 3), ERG type, ABCA4 mutation allele 1 and ABCA4 mutation allele 2; exons and coding DNA (cDNA) positions based on reference sequence NM_000350 (IVS: intervening sequence, intron) are shown. Login to comment
109 The four patients showing a central area of RPE atrophy were compound heterozygous for a known missense mutation and for a novel, previously not described, mutation: patient 1 harbored the known c.6320G>A (p.Arg2107His) mutation and a, so far not described, null mutation in exon 33, c.4738_4739delTT (p.Leu1580Lysfs*16), patient 2 the frequent mild missense mutation c.5882G>A (p.Gly1961Glu) and a novel single-base deletion, c.2829delG (p.Pro944Glnfs*6) in exon 19, and patient 3 the known c.2791G>A (p.Val931Met) mutation and a presumably destructive novel splice site mutation within the first intron (c.66&#fe;3A>C). Login to comment

PMID: 23953153 [PubMed] Fujinami K et al: "Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function."

No. Sentence Comment

45 Mutation screening of ABCA4 was performed with the arrayed primer extension (APEX) microarray (ABCR400 chip, Asper Ophthalmics, TABLE 1. Summary of Clinical Findings and Molecular Status of 40 Patients With a Foveal-Sparing Phenotypea of Stargardt Disease Patient Onsetb (y) Age (y) LogMAR Visual Acuity Fundus Patternc OCT ERGe Mutation Status CFTd (mm) ORT Group PERG mfERG OD OS OD OS OD OS OD OS 1 45 45 0 0 3 219 223 NA NA NA NA NA [c.1411 G>A, p.Glu471Lys/c.2588 G>C, p. Gly863Ala/c.4594 G>A, p.Asp1532Asn/c.5693 G>A, p.Arg1898His] 2 33 33 0.18 0.48 1 NA NA 3 ND ND NA NA [c.1622 T>C, p.Leu541Pro/c.3113 C>T, p.Ala1038Val/c.6089 G>A, p.Arg2030Gln] 3 53 66 0.18 0.18 1 NA NA 2 A A NA NA [c.768 G>T, Splice site/c. 6320 G>A, p. Arg2107His ] 4 37 54 1.48 0.18 1 32 39 U 3 ND ND 2 2 [c.1760 &#fe;1 G>T, Splice site/c.4594 G>T, p.Asg1532Tyr ] 5 57 57 0.3 0.18 1 NA NA 1 ND ND NA NA [c. Login to comment
127 2588G>C, p.Gly863Ala 4 Het Allikmets46 Intol. 0.01 PRD 0.996 No change 68/13006 db SNP (rs76157638) 21 c.3113C>T, p.Ala1038Val 1 Het Webster53 Tol. NA Benign 0.014 Donor 43.5 70 New site (&#fe;61.72) 22/13006 db SNP (rs61751374) 24 c.3602T>G, p.Leu1201Arg 2 Het Lewis48 Tol. NA Benign 0.052 Donor 61.3 74 New site (&#fe;20.08) 416/13006 db SNP (rs61750126) 27 c.3898C>T, p.Arg1300* 1 Het Rivera49 NA NA ND 28 c.4139C>T, p.Pro1380Leu 2 Het Lewis48 Intol. 0.01 Benign 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4222 T>C, p.Trp1408Arg 2 Het Lewis48 Tol. NA PRD 0.845 No change ND dbSNP (rs61750135) 29 c.4319T>C, p.Phe1440Ser 1 Het Lewis48 Tol. NA PRD 0.744 No change ND dbSNP (rs61750141) 30 c.4469G>A, p.Cys1490Tyr 1 Het Webster53 Intol. 0.03 PRD 0.994 No change ND dbSNP (rs61751402) 31 c.4577C>T, p.Thr1526Met 1 Het Lewis48 Intol. 0.00 PRD 0.91 No change ND db SNP (rs61750152) 31 c.4594G>T, p.Asp1532Asn 3 Het Lewis48 Tol. NA PRD 0.853 No change ND 33 c.4685T>C, p.Ile1562Thr 1 Het Allikmets46 Tol. NA Benign 0.034 No change 18/13006 db SNP (rs1762111) 35 c.4956T>G, p.Tyr1652* 1 Het Fumagalli52 NA NA Acceptor 43 72 New site (&#fe;67.36) ND 35 c.4918C>T, p.Arg1640Trp 2 Het Rozet47 Intol. 0.00 PRD 1 No change ND dbSNP (rs61751404) 35 c.4926C>G, p.Ser1642Arg 1 Het Birch50 Tol. 0.68 Benign 0.116 No change ND db SNP (rs61753017) Int 35 c.5018&#fe;2T>C, Splice site 1 Het Fumagalli52 NA NA Donor 81.2 54 WT site broken (33.07) ND Int 38 c.5461-10T>C 3 Het Briggs50 NA NA No change 3/13006 db SNP (rs1800728) 40 c.5693G>A, p.Arg1898His 2 Het Allikmets46 NA Benign 0.00 No change 25/13006 db SNP (rs1800552) 42 c.5882G>A, p.Gly1961Glu 1 Het Allikmets46 Tol. 0.18 PRD 1 No change 41/13006 db SNP (rs1800553) 44 c.6079C>T, p.Leu2027Phe 4 Homo Lewis48 Intol. 0.02 PRD 0.999 No change 4/13006 db SNP (rs61751408) 44 c.6089G>A, p.Arg2030Gln 4 Het Lewis48 Tol. NA PRD 0.995 No change 8/13006 db SNP (rs61750641) 44 c.6118C>T, p.Arg2040* 1 Het Rosenberg54 NA NA ND 46 c.6320G>A, p.Arg2107His 1 Het Fishman8 Intol. 0.00 PRD 0.996 No change 91/13006 db SNP (rs62642564) EVS &#bc; Exome Variant Server; HSF &#bc; Human Splicing Finder program; Hum var score &#bc; Human var score; Int &#bc; intron; Intol &#bc; intolerant; Mt CV &#bc; mutant consensus value; NA &#bc; not applicable; ND &#bc; not detected; PRD &#bc; probably damaging; Pred. &#bc; prediction; SIFT &#bc; Sorting Intolerant from Tolerance program; Tol. &#bc; tolerant; Wt CV &#bc; wild-type consensus value. Login to comment
142 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) (Continued) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency Int 33 c.4773&#fe;48C>T 1 0.36% 34 c.4793C>A, p.Ala1598Asp 1 0.36% 35 c.c.4918C>T, p.Arg1640Trp 1 0.36% Int 35 c.5018&#fe;2T>C, Splice site 2 0.71% 36 c.5114G>A, p.Arg1705Gln 2 0.71% 37 c.5222_5233delTGGTGGTGGGC, p.Lys1741Hisfs 1 0.36% 37 c.5281_5289delCTT CCT GCC, p.Pro1761_Leu1763del 2 0.71% Int 38 c.5461-10T>C 23 8.21% Int 39 c.5585-1G>A, Splice site 1 0.36% Int 40 c.5714&#fe;5G>A, Splice site 5 1.79% 42 c.5882G>A, p.Gly1961Glu 17 6.07% 43 c.5908C>T, p.Leu1970Phe 2 0.71% 43 c.5917delG, p.Val1973* 1 0.36% 44 c.6079C>T, p.Leu2027Phe 10 3.57% 44 c.6089G>A, p.Arg2030Gln 3 1.07% 44 c.6118C>T, p.Arg2040* 1 0.36% 45 c.6148G>C, p.Val2050Leu 3 1.43% 46 c.6286G>A, p.Glu2096Lys 1 0.36% 46 c.6320G>A, p.Arg2107His 4 1.43% 47 c.6445C>T, p.Arg2149* 1 0.36% 47 c.6449G>A, p.Cys2150Tyr 3 1.07% 48 c.6658C>T, p.Gln2220* 3 1.07% 48 c.6709_6710insG, p.Thr2237Serfs 1 0.36% Int &#bc; Intron. Login to comment

PMID: 23982839 [PubMed] Fujinami K et al: "ABCA4 gene screening by next-generation sequencing in a British cohort."

No. Sentence Comment

56 40 c.4926C>G p.S1642R DC c.5041_5055del GTGGTTGCCATCTGC p.V1681_C1685del DC 2 41 c.4956T>G p.Y1652* DC 1 42 c.5018&#fe;2T>C Splice site DC 1 43 c.5461-10T>C DC c.6385A>G p.S2129G PDC 2 44 c.5461-10T>C DC 1 45 c.5461-10T>C DC 1 46 c.5461-10T>C DC 1 47 c.5461-10T>C DC 1 48 c.5461-10T>C DC 1 49 c.5461-10T>C DC 1 50 c.5461-10T>C DC 1 51 c.5585-1G>A Splice site DC 1 52 c.5714&#fe;5G>A Splice site DC c.6209C>G p.T2070R DC 2 53 c.5882G>A p.G1961E DC c.2686A>G p.K896E B 1 54 c.5882G>A p.G1961E DC c.3050&#fe;1G>C Splice site DC 2 55 c.5882G>A p.G1961E DC c.3392delC/3393C>G p.A1131Gfs DC 2 56 c.5882G>A p.G1961E DC c.4539&#fe;2T>G Splice site DC 2 57 c.5882G>A p.G1961E DC c.4552A>C p.S1518R DC 2 58 c.5882G>A p.G1961E DC c.5899-2delA Splice site DC 2 59 c.5882G>A p.G1961E DC 1 60 c.6079C>T p.L2027F DC c.1906C>T p.Q636* DC 2 61 c.6079C>T p.L2027F DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 62 c.6079C>T p.L2027F DC c.3370G>T p.D1124Y DC 2 63 c.6079C>T p.L2027F DC 1 64 c.6089G>A p.R2030Q DC c.4326C>A p.N1442K DC 2 65 c.6445C>T p.R2149* DC 1 66 c.6709A>C p.T2237P DC c.5899-3_5899-2delTA Splice site DC 2 67 c.2971G>C p.G991R B c.4538A>G p.Q1513R DC 1 68 c.3602T>G p.L1201R B c.1749G>C p.K583N DC 1 69 c.3602T>G p.L1201R B c.1982_1983insG p.A662fs DC 1 70 c.3602T>G p.L1201R B c.2972G>T p.G991V DC 1 71 c.4685T>C p.I1562T B c.3289A>T p.R1097* DC 1 72 c.6320G>A p.R2107H B c.2510T>C p.L837P DC 1 73 c.6320G>A p.R2107H B c.4352&#fe;1G>A Splice site DC 1 74 c.2701A>G p.T901A B 0 75 c.3602T>G p.L1201R B 0 76 c.4283C>T p.T1428M B 0 77 c.466A>G p.I156V B 0 78 c.466A>G p.I156V B 0 79 c.4715C>T p.T1572M B 0 Putative novel variants are shown in italics. Login to comment
63 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 30 c.4537_4538insC p.G1513fs 1 38 [ Briggs CE, et al. 19 ND False-negative in NGS in patient 38 31 c.4577C>T p.T1526M 1 39 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.910 No change ND db SNP (rs61750152) 33 c.4685T>C p.I1562T 1 71 [ [ Yatsenko, et al. 13 Tol. NA PRD 0.783 No change ND Benign 33 c.4715C>T p.T1572M 1 79 [ [ Pang CP and Lamm DS 23 Del. 0.02 B 0.326 No change ND db SNP (rs185093512) Benign 35 c.4926C>G p.S1642R 1 40 [ [ Birch DG, et al. 22 Tol. 0.68 B 0.116 No change ND db SNP (rs61753017) 35 c.4956T>G p.Y1652* 1 41 [ [ Fumagalli A, et al. 16 ND db SNP (rs61750561) IVS35 c.5018&#fe;2T>C Splice site 1 42 [ [ APEX Don. 81.2 54.3 WT site broken (33.07) ND 36 c.5113C>T p.R1705W 1 7 [ Ernest PJ, et al. 26 Del. NA PRD 0.996 Don. 46.5 73.3 No change ND IVS38 c.5461-10T>C 8 43, 44, 45, 46, 47, 48, 49, 50 [ [ Briggs CE, et al. 19 No change 3/13006 db SNP (rs1800728) IVS39 c.5585-1G>A Splice site 1 51 [ [ Shroyer NF, et al. 21 Acc. 86.3 57.4 WT site broken (33.53) ND IVS40 c.5714&#fe;5G>A Splice site 1 52 [ [ Cremers FP, et al. 8 Don. 85.5 73.3 Wild type site broken (14.23) ND 42 c.5882G>A p.G1961E 7 53, 54, 55, 56, 57, 58, 59 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.998 No change 41/13006 db SNP (rs1800553) 44 c.6079C>T p.L2027F 4 60, 61, 62, 63 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 1.000 No change 4/13006 db SNP (rs61751408) 44 c.6089G>A p.R2030Q 1 64 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.995 No change 8/13006 db SNP (rs61750641) 46 c.6320G>A p.R2107H 2 72, 73 [ [ Fishman GA, et al. 15 Del. 0.04 PRD 0.999 No change 91/13006 db SNP (rs62642564) Benign 47 c.6445C>T p.R2149* 1 65 [ [ Lewis RA, et al. 14 1/13006 db SNP (rs61750654) 48 c.6529G>A p.D2177N 1 19 [ Rivera A, et al. 17 Tol. 0.41 B 0.004 No change 116/13006 db SNP (rs1800555) Benign 48 c.6709A>C p.T2237P 1 66 [ [ APEX Del. NA POD 0.719 No change ND IVS48 c.6729&#fe;4_ &#fe;18del AGTTGGCCCTGGGGC Splice site 1 17 [ Littink KW, et al. 28 NA ND Splice-site alteration (described as splice site) includes the change expected to affect splicing, for example, when the splice donor or splice acceptor site is changed, and the change that might affect splicing, for example, changes close to the splice donor or splice acceptor site, or in the first or last nucleotide of an exon. SIFT (version 4.0.4) results are reported to be tolerant if tolerance index is ߥ0.05 or deleterious if tolerance index is <0.05. Login to comment

PMID: 24011517 [PubMed] Utz VM et al: "Identification of three ABCA4 sequence variations exclusive to African American patients in a cohort of patients with Stargardt disease."

No. Sentence Comment

4 RESULTS: ABCA4 sequence changes were identified in 85 patients from 80 families, of which 11 patients identified themselves as African American.Of these 11 patients, 10 unrelated patients shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). Login to comment
10 CONCLUSIONS: Three ABCA4 sequence variations were identified exclusively in 10 unrelated African American patients: p.L1201R and p.R1300Q likely represent nonpathogenic sequence variants, whereas the p.R2107H substitution appears to be pathogenic. Login to comment
38 For p.R2107H, exons 46 and 47 were amplified together as one amplicon by PCR and analyzed. The forward primer sequence was 59 CCTTCTGTCAGCTCATCCTC CACA 39 and the reverse primer sequence was 59 CCAAGTGTCAATGGAGAACACAGG 39 . Login to comment
70 However, patient 5 possessed two additional sequence variations: c.618C>T (p.S206S), a synonymous sequence variation that has been found to cosegregate with disease in a family with Stargardt disease,41 and c.2546T>C (p.V849A).25 Patient 6 exhibited both a c.3113C>T mutation (p.A1038V), present in 15% of our cohort, and a c.1937&#fe;1G>C sequence variation that results in a splice site mutation in intron 13.27 The c.3113C>T mutation produces a biochemically altered protein product42 and has been detected in patients with Stargardt disease but not in control patients.18,20,25 The third sequence variation, c.6320 G>A (p.R2107H), existed as a heterozygous sequence variation in patients 7, 8, 9, and 10. Login to comment
82 DISCUSSION IN THE PRESENT STUDY, 10 UNRELATED AFRICAN AMERICAN patients with Stargardt disease shared 1 of 3 ABCA4 sequence variations: c.3602T>G (p.L1201R); c.3899G>A (p.R1300Q); or c.6320G>A (p.R2107H). Login to comment
88 3113C>T (p.A1038V) 15 c.1937&#fe;1G>C (N/A) 0 7 c.6320G>A (p.R2107H) 0 c.IVS38-10T>C (N/A) 10 8 c.6320G>A (p.R2107H) 0 c.174C>G (p.N58K) 0 9 c.6320G>A (p.R2107H) 0 c.6286G>A (p.E2096K) 0 10 c.6320G>A (p.R2107H) 0 cDNA &#bc; complementary DNA; N/A &#bc; not applicable; % Popn &#bc; percentage of patients in the remaining population with the specific sequence variation; Pt &#bc; patient. Login to comment
94 In contrast to the c.3602T>G and c.3899G>A sequence variations, the c.6320G>A (p.R2107H) likely represents a pathogenic mutation. Login to comment
97 Allele Frequency of Sequence Variations Found in African American patients with Stargardt Disease in a Local African American Control Population and Corresponding Population Frequency in Those of African American and European Ancestry per the Exome Variant Server35 Sequence Variation and Amino Acid Substitution Allele Frequency in Control AA Patients (CEI) Allele Frequency in AA Population (EVS) Allele Frequency in European American Population (EVS) c.3602T>G (p.L1201R) 7.50% (n &#bc; 305) 9.35% (n &#bc; 2203) 0.05% (n &#bc; 4300) c.3899G>A (p.R1300Q) 6.30% (n &#bc; 301) 6.17% (n &#bc; 2203) 0.05% (n &#bc; 4300) c.6320G>A (p.R2107H) 2.00% (n &#bc; 294) 2.04% (n &#bc; 2203) 0.01% (n &#bc; 4300) AA &#bc; African American; CEI &#bc; Cole Eye Institute; EVS &#bc; Exome Variant Server; N &#bc; number of alleles tested. Login to comment
102 Of note, our control population of African Americans had a normal retinal phenotype, whereas the purpose of the Exome Variant Server is to provide general population reference, and ocular phenotyping was not part of the project; therefore, the ocular phenotype of the individual homozygous for c.6320G>A (p.R2107H) is unknown. Login to comment
116 In contrast to previous reports of potential pathogenicity, our study of controls and bioinformatic analyses suggests that c.3602T>G (p.L1201R) and c.3899G>A (p.R1300Q) are not directly pathogenic, whereas c.6320G>A (p.R2107H) likely alters protein structure and therefore is pathogenic. Login to comment
119 In Silico Analysis of ABCA4 Missense Variants Identified in African American Patients with Stargardt Disease Sequence Variation (Amino Acid Substitution) Polymorphism Phenotyping V2 PMut Sorting Intolerant from Tolerant Human Var Score Prediction NN output Reliability Prediction Score Prediction c.3602T>G (p.L1201R) 0.031 Benign 0.7702 5 Pathologic 0.52 Tolerant c.3899G>A (p.R1300Q) 0.143 Benign 0.6548 3 Pathologic 0.61 Tolerant c.6320G>A (p.R2107H) 1.00 Probably damaging 0.8993 7 Pathologic 0.00 Intolerant NN &#bc; neural network; V &#bc; version; Var &#bc; variability. Login to comment

PMID: 25283059 [PubMed] Duncker T et al: "Quantitative fundus autofluorescence distinguishes ABCA4-associated and non-ABCA4-associated bull's-eye maculopathy."

No. Sentence Comment

66 [L541P; A1038V] 438 432 16 M 25 White 0.60 0.60 p.S84fs p.R2107H 294 17 F 24 Black 0.70 0.88 p.G991R p.L1138P 321 326 18 M 26 White 0.00y 0.00y p.R1300* p.R2106C 419 412 19 M 11 White 0.40z 0.40z p.W821R p.C2150Y 304 296 20 F 16 White 0.70 0.40 p.K1547* p.R2030Q 481 513 21 F 13 White 1.30 1.00 pR1108C p.Q1412* 511 528 22 F 18 White 0.00 0.00 p.G863A c.5898&#fe;1G/A 465 431 Mutations in Other Genes 23 F 16 White 0.40 0.48 GUCY2D e p.R838H 152 165 24 M 53 Black 0.88 0.88 CNGA3 e p. Login to comment

PMID: 25444351 [PubMed] Lambertus S et al: "Early-onset stargardt disease: phenotypic and genotypic characteristics."

No. Sentence Comment

143 1 1 1, 23, 32, 41, 43 c.5762_5763dup p.Ala1922fs 1 1 34 c.5882G>A p.Gly1961Glu 5 6 18, 31, 32, 44, 49 c.6320G>A p.Arg2107His 2 2 8, 31, 40, 45, 50 c.6411T>A p.Cys2137* 1 1 34 c.6543_6578del p.Leu2182_Phe2193del 1 1 1 del &#bc; deletion; dup &#bc; duplication; fs &#bc; frame shift. Login to comment

PMID: 25884411 [PubMed] Grassmann F et al: "Common synonymous variants in ABCA4 are protective for chloroquine induced maculopathy (toxic maculopathy)."

No. Sentence Comment

121 In this report, however, patient #7 carried three pathologic mutations known to be associated with Stargardt disease (Arg2107His and Leu1201Arg/Arg2107His in a cis configuration). Login to comment

PMID: 26207301 [PubMed] Park JC et al: "Objective Analysis of Hyperreflective Outer Retinal Bands Imaged by Optical Coherence Tomography in Patients With Stargardt Disease."

No. Sentence Comment

52 of ABCA4 Mutations Mutation(s) 1 13 M 20/70 2 p.[(L541P; A1038V)] (;)c.5714&#fe;5G>A 2 15 F 20/60 2 c.3050&#fe;5G>A(;)p.(G1961E) 3 15 F 20/80 2 p.[(R1129L(;)A1773V)] 4 16 F 10/1001 Sister of patient 3 5 20 M 20/160&#fe;2 2 p.[(R1129C(;)R2077W)] 6 20 F 20/1601 2 p.[(G1961E(;)R2040*)] 7 21 M 20/40 2 p.[(R219T(;)W439*(;)G863A)] 8 23 F 10/100 2 c.5461-10T>C(;)p.(G1961E) 9 23 F 20/1001 2 c.302&#fe;1G>A(;)p.(R2107H) 10 28 F 20/1001 2 c.5461-10T>C(;)p.(G1961E) 11 30 F 20/25&#fe;2 1 p.[(R2077W)];[?] Login to comment

PMID: 26230768 [PubMed] Sparrow JR et al: "Flecks in Recessive Stargardt Disease: Short-Wavelength Autofluorescence, Near-Infrared Autofluorescence, and Optical Coherence Tomography."

No. Sentence Comment

52 [5898&#fe;1G>A 17 F 35.33 Caucasian 0.9 0.1 p. [N1799D] 18* F 52.33 African American 0.2 0.3 p. [W339G]; [R2107H] 19 F 54.03 Caucasian 0.3 0.2 p. [R2077W] BCVA, best-corrected visual acuity; logMAR, logarithm of the minimum angle of resolution; OD, right eye; OS, left eye. Login to comment

PMID: 26311262 [PubMed] Noupuu K et al: "Recessive Stargardt disease phenocopying hydroxychloroquine retinopathy."

No. Sentence Comment

53 [5461-10T > C] P2 55, F White 20/20 20/20 Mottling + flecks Mottling + flecks p. [A1357V]; [G1961E] P3 57, M African-American 20/20 20/20 BEM + flecks BEM + flecks p. [R2107H] P4 10, F White 20/30 20/25 BEM + flecks BEM + flecks p. [E160*]; [R1108C] P5 26, F African-American 20/30 20/20 Mottling + flecks Mottling + flecks p. [R2107H]; [E526A] P6 19, F Asian-Caucasian 20/25 20/25 BEM BEM p. [R602W] P7 26, M African-Arab 20/20 20/20 BEM BEM p. [R1300*]; [R2106C] P8 25, M White 20/20 20/40 BEM BEM p. [Q1003*]; [G1961E] Abbreviations: M male, F female, BCVA best-corrected visual acuity, OD right eye, OS left eye, BEM bull`s eye maculopathy Fig. 1 Thinning of the parafoveal region with relative foveal sparing presenting as the hydroxychloroquine retinopathy- associated parafoveal outer retina thinning phenotype in patients with recessive Stargardt disease (STGD1). Login to comment
109 In fact, one of the two patients was homozygous for the missense mutation p.R2107H, but was thought to have HCQ maculopathy due to the classical appearance of this retinopathy in addition to the lack of dark choroid and flecks characteristic of STGD1. Login to comment
110 Interestingly, the p.R2107H mutation was also present in two of the eight patients with phenotypes resembling HCQ retinopathy in our study. Login to comment

PMID: 26551331 [PubMed] Duncker T et al: "Quantitative Fundus Autofluorescence and Optical Coherence Tomography in ABCA4 Carriers."

No. Sentence Comment

29 [L541P;A1038V] 0.00 0.00 OS 342 326 S23.2 F 37.4 White Sister p.G1961E 0.00 0.00 OS 220 n/a S24.2 F 37.5 White Daughter c.247_250dup 0.00 0.00 OD 298 288 S25.3 F 49.9 Black Mother p.R2107H 0.88 0.10 n/a n/a 385 S26.3 F 58.2 White Mother p.G1961E 0.00 0.00 OD 238 297 S26.4 M 57.2 White Father p. Login to comment
70 [L541P;A1038V] p.L2027F 0.30 0.40 591 608 P 23.1ߤ F 26.0 White p.G1961E c.5196&#fe;1056A>G 0.40 0.70 379 344 P 24.1 F 52.0 White c.247_250dup 0.80 0.00 n/a n/a P 25.1 F 26.0 Black p.E526A p.R2107H 0.48 0.00 507 536 P 25.2 F 25.9 Black p.E526A p.R2107H 0.18 0.00 461 468 P 26.1&#a7; F 25.6 White p. Login to comment