ABCMdb

ABCB11 p.Asp482Gly

None has been submitted yet.

Publications

PMID: 11745042 [PubMed] Thompson R et al: "BSEP: function and role in progressive familial intrahepatic cholestasis."

No. Sentence Comment

91 Two mutations, E297G and D482G, are "common" and have been found in 25 and 16 European families, respectively. Login to comment

PMID: 12663868 [PubMed] Trauner M et al: "Bile salt transporters: molecular characterization, function, and regulation."

No. Sentence Comment

632 Most but not all of these mutations (C336S and D482G) also abolish bile salt transport activity when assessed in Sf9 cells (54, 314, 375, 376). Login to comment

PMID: 15768832 [PubMed] Carlton VE et al: "Molecular basis of intrahepatic cholestasis."

No. Sentence Comment

144 Several ABCB11 mutations have been functionally characterized in vitro, revealing that at least one ABCB11 mutation, D482G (common in patients of Polish ethnicity) may represent only a partial loss of function (39). Login to comment

PMID: 15791618 [PubMed] Hayashi H et al: "Two common PFIC2 mutations are associated with the impaired membrane trafficking of BSEP/ABCB11."

No. Sentence Comment

1 However, the mechanisms for the deficiency in the function of two mutations (E297G and D482G), which are frequently found in European patients, have not yet been identified. Login to comment
3 Introduction of E297G and D482G mutations into the human BSEP gene by site-directed mutagenesis resulted in a significant reduction in the BSEP expression level, which was associated with impaired membrane trafficking. Login to comment
4 Most of the D482G BSEP and some of the E297G BSEP underwent only core glycosylation and appeared to be predominantly located in the endoplasmic reticulum. Login to comment
7 In conclusion, E297G and D482G mutations result in impaired membrane trafficking, whereas the transport functions of these mutants remain largely unchanged. Login to comment
9 T he efficient biliary excretion of monovalent bile acids is mediated by the bile salt export pump (BSEP/ABCB11), an ATP-binding cassette transmembrane transporter located on the bile canalicular membrane.1 The function of BSEP/ABCB11 has been clarified by examining the adenosine triphosphate (ATP)- dependent transport of monovalent bile acids (such as taurocholic acid) in isolated bile canalicular membrane vesicles and/or membrane vesicles isolated from cells transfected with the complementary DNA (cDNA) for BSEP.2,3 Many studies have also been performed in patients and it has been shown that the hereditary defect in the expression of BSEP results in the acquisition of progressive familial intrahepatic cholestasis type 2 (PFIC2).4,5 Genomic analysis of PFIC2 patients has revealed that many kinds of missense, premature termination, frame shift, and splicing junction mutations are associated with the BSEP gene.4 Among these, E297G and D482G, two missense mutations in the second intracellular loop and in the first ATP-binding domain, respectively, are frequently observed in PFIC2 patients. Login to comment
23 In addition, the mechanism remains to be clarified for other important mutations, including D482G, which is very common in European PFIC2 patients. Login to comment
28 We focused particularly on E297G and D482G mutations, which are frequently found in European PFIC2 patients.6 Materials and Methods Materials. Login to comment
44 For the determination of BSEP messenger RNA (mRNA) levels, MDCK II cells were seeded 24 hours before infection at a density of 1.3 ϫ 106 cells per 10-cm dish and were infected with recombinant adenoviruses containing wild-type, E297G, and D482G BSEP cDNA at a multiplicity of infection (MOI) of 50. Login to comment
67 To determine the localization of BSEP, MDCK II cells were seeded on glass coverslips 24 hours before infection at a density of 3 ϫ 105 cells/well in 12-well plates and were infected with recombinant adenoviruses at 25 MOI (wild-type and E297G BSEP) or 250 MOI (D482G BSEP). Login to comment
74 To examine the cellular localization and transport function of the two mutants (E297G and D482G), we constructed recombinant adenoviruses containing wild-type and mutated BSEP cDNA. Login to comment
87 Although the wild-type BSEP was detected as approximately 170 kDa, D482G BSEP was detected as approximately 150 kDa. Login to comment
90 These results suggest that D482G BSEP and some of the E297G BSEP molecules are present as immature endoplasmic reticulum (ER)-resident forms. Login to comment
93 Although wild-type BSEP is predominantly localized in the apical membrane at 25 MOI (Fig. 3A), there was very little expression of D482G BSEP in most cells at 25 MOI because of the low expression level, as suggested by Western blot analysis (see Fig. 2A). Login to comment
94 An increase in the MOI to 250 resulted in significant expression of D482G BSEP, suggesting that D482G BSEP are expressed intracellularly (see Fig. 3A). Login to comment
99 Cell surface BSEP was detected in wild-type and E297G-expressing MDCK II cells as the mature form, whereas no D482G BSEP molecules were detectable on the cell surface (Fig. 3B). Login to comment
100 This result is also consistent with the results of the Western blot analysis of the whole cell lysate in which the mature form of D482G BSEP was not detectable (see Fig. 3B). Login to comment
102 It has been reported that proteasomes play an important role in the degradation of incompletely folded and misfolded protein retained in the ER.17,18 Because the expression levels of E297G and D482G BSEP were lower than that of the wild-type BSEP-and because it is possible that these mutants are localized in the ER-proteasomes may be responsible for their degradation. Login to comment
103 To examine this hypothesis, cells were treated with 5 ␮mol/L MG132, a specific proteasome inhibitor, for 8 hours, and its effects on E297G and D482G BSEP were examined via Western blot anasysis. Login to comment
104 Western blot analysis showed that MG132 treatment caused the accumulation of immature forms (150 kDa), particularly in E297G and D482G BSEP-expressing MDCK II cells (Fig. 4). Login to comment
106 It was found that MG132 treatment resulted in an increase in the number of wild-type, E297G, and D482G BSEP-expressing cells, and the degree of increase was particularly high for the latter two; in the absence of MG132, the number of E297G BSEP-expressing cells after adenovirus infection was only approximately 25% of those expressing wild-type BSEP, and only a minimal number of cells expressed D482G BSEP. Login to comment
107 In contrast, in the presence of MG132, the number of cells expressing E297G and D482G BSEP was almost the same as that in wild-type BSEP-expressing cells after infection of adenoviruses at the same MOI (data not shown). Login to comment
108 In the presence of MG132, E297G and D482G BSEP were predominantly expressed in the intracellular compartment, which is the same as that observed under control conditions (see Fig. 3A). Login to comment
115 (A) Results of Western blot analysis with crude membrane fraction prepared from MDCK II cells. MDCK II cells were infected with recombinant adrenoviruses at 250 MOI 48 hours before the experiments. Crude membrane fractions prepared from GFP (control), wild-type, E297G, and D482G BSEP-expressing MDCK II cells (80, 40, 80, and 80 ␮g protein, respectively) were analyzed. Login to comment
120 Before the transport experiments, the expression level of BSEP was compared among the isolated membrane vesicles expressing wild-type, E297G, and D482G BSEP. Login to comment
121 D482G BSEP, as well as wild-type and E297G BSEP, were detected as approximately 170-kDa bands in isolated membrane vesicles (Fig. 5A). Login to comment
122 The band density of the 170-kDa form of E297G and D482G in the isolated membrane vesicles was approximately 25% and 10% of wild-type BSEP, respectively (Fig. 5B). Login to comment
124 The ATP-dependent uptake of taurocholate and glycocholate by wild-type, E297G and D482G BSEP-expressing isolated membrane vesicles was much higher than that by GFP-expressing vesicles (Fig. 6A). Login to comment
125 By normalizing the BSEP expression levels in the isolated membrane vesicles based on the results of Western blot analysis (see Fig. 5B), it was demonstrated that the transport of taurocholate and glycocholate mediated per unit mass of E297G and D482G BSEP molecules was not significantly different from that by wild-type BSEP (Figs. 5B and 6B). Login to comment
127 Wild-type, E297G, and D482G BSEP-mediated initial ATP-dependent uptake rates were saturable with apparent Km values of 4.61 Ϯ 0.91, 5.41 Ϯ 0.27, and 14.3 Ϯ 2.0 ␮mol/L, respectively (Fig. 6C). Login to comment
128 The maximum taurocholate transport velocity (Vmax) for wild-type, E297G, and D482G BSEP were 2310 Ϯ 220, 485 Ϯ 15, and 761 Ϯ 60 pmol/min/mg isolated membrane vesicle protein, respectively. Login to comment
132 MDCK II cells were infected with the recombinant adenoviruses at 25 MOI (wild-type and E297G BSEP) or 250 MOI (D482G BSEP) 48 hours before the experiments. Login to comment
140 mass of E297G and D482G BSEP molecules was calculated to be 94% and 329%, respectively, of wild-type BSEP. Login to comment
141 Discussion In the present study, we analyzed the consequence of two frequently found PFIC2 mutations (E297G and D482G) in vitro to investigate the pathogenesis of PFIC2. Login to comment
143 Although quantitative PCR showed no difference in mRNA levels between the wild-type and two mutated BSEP (see Fig. 1), Western blot analysis indicated reduced expression of D482G and E297G BSEP (see Fig. 2A). Login to comment
144 In addition, the molecular weight of most of the D482G BSEP and some of the E297G molecules was approximately 150 kDa (see Fig. 2A). Login to comment
147 This suggestion is also consistent with the immunofluorescence observations which indicated that D482G and E297G BSEP molecules are located intracellularly (see Fig. 3A). Login to comment
148 The results of the surface biotinylation study also suggested that the D482G BSEP and core glycosylated form of E297G BSEP are located intracellularly (see Fig. 3B). Login to comment
149 In addition, the results of the MG132 treatment experiment suggested that E297G and D482G BSEP molecules are degraded by the proteasome pathway (see Fig. 4). Login to comment
156 Western blot analysis of the isolated membrane vesicles indicated the presence of approximately 170-kDa molecules for wild-type, E297G, and D482G BSEP. Login to comment
157 Moreover, it was found that the amount of 150-kDa molecules for E297G and D482G BSEP in the isolated membrane vesicles was lower than that in the crude membrane fraction. Login to comment
163 Effects of proteasome inhibitors on the localization of BSEP in MDCK II cells. MDCK II cells were infected with recombinant adenoviruses at 250 MOI 48 hours before the experiments. Crude membrane fractions prepared from GFP (control), wild-type, E297G, and D482G BSEP-expressing MDCK II cells (80, 40, 80, and 80 ␮g protein, respectively), treated with or without 5 ␮mol/L MG132 for 8 hours before the preparation of crude membrane, were subjected to Western blot analysis. Login to comment
165 Functional analysis using these membrane vesicles indicated that the transport of taurocholate and glycocholate in E297G and D482G BSEP-expressing isolated membrane vesicles was significantly higher than that in control isolated membrane vesicles (see Fig. 6A). Login to comment
166 Based on the hypothesis that the transport activity per unit mass of BSEP molecules can be calculated by considering the BSEP expression level in the isolated membrane vesicles, it was found that the transport of taurocholate and glycocholate mediated per unit mass of E297G and D482G BSEP molecules was not reduced compared with wild-type BSEP (see Figs. 5B and 6B). Login to comment
167 The Km values for taurocholate of wild-type, E297G, and D482G BSEP molecules were consistent with previous observations obtained using membrane vesicles isolated from human wild-type BSEP cDNA-infected Sf9 and Sf High Five cells.2,3 Based on these results, it appears that the transport function of two mutated BSEP molecules (E297G and D482G) per se remains normal (see Fig. 6). Login to comment
168 These results suggest that, if E297G and D482G are matured and consequently expressed on the membrane surface, these mutated transporters are able to transport BSEP substrates. Login to comment
169 Our results using mutated human BSEP were different fromthosereportedinapreviousstudy,inwhichthecauseof PFIC2wasexaminedusingmutatedratBsep,7 buttheywere consistentwiththosereportedrecently,inwhichtheeffectof D482G mutation was examined using mouse Bsep.8 In the study using rat Bsep gene, the pathogenic mechanism for the D482G mutation was not identified because D482G rat Bsep is localized in the apical membrane as well as the cytoplasm of MDCK cells, and this mutation did not significantly affect taurocholate transport examined using Fig. 5. Login to comment
174 5 ␮g (upper lane), 15 ␮g (middle lane) and 30 ␮g (lower lane) protein of isolated membrane vesicles prepared from GFP (control), wild-type, E297G and D482G BSEP-expressing HEK 293 cells were subjected to Western blot analysis. Login to comment
176 The results for wild-type (F), E297G (E), and D482G (■) BSEP are shown. Login to comment
177 (C) Results of Western blot analysis using crude membrane fraction and isolated membrane vesicles prepared from GFP (control), wild-type, E297G, and D482G BSEP-expressing HEK 293 cells (50, 20, 75, and 75 ␮g protein, respectively). Login to comment
179 membranevesiclesisolatedfromSf9cells.7 Incontrast,inthe study with mouse Bsep gene, it was found that D482G mutation resulted in impaired canalicular trafficking in HepG2 cells, although this mutation did not affect the transport of taurocholate examined using membrane vesicles isolated from Sf21 cells.8 Concerning E297G mutation, it has been shownthatE297GratBsepiswidelydistributedthroughout the cytoplasm, and the studies using isolated membrane vesicles indicated that this mutation resulted in the loss of taurocholate transport activity.7 The differences among these results involving the previous mutated rat Bsep, mouse Bsep, and the present mutated human BSEP may be explained by considering the species difference in the Bsep/BSEP sequence, although the homology of the amino acid sequence around E297G and D482G is quite high as far as human BSEPandratandmouseBsepareconcerned.Forexample,it is still possible that the introduction of the D482G mutation to human BSEP, but not rat Bsep, results in a conformational change in human BSEP so that D482G BSEP is bound to some molecular chaperons. Login to comment
180 The features of D482G BSEP resemble those of the CFTR ⌬F508 mutant in that the deletion of phenylalanine at 508 results in the accumulation of the mutated protein in the ER followed by proteasome degradation. Login to comment
182 One of the methods being explored as a potential treatment of CFTR ⌬F508 patients is to administer drugs (such as sodium 4-phenylbutyrate) which are capable of trafficking the mutated protein to the apical membrane by inhibiting the binding to the molecular chaperons in the ER.21-23 After clarifying the mechanism for the intracellular retention of E297G and D482G BSEP, it is possible to identify agents able to target these mutated BSEP molecules to the apical surface. Login to comment
184 In conclusion, the results of the present in vitro study suggest that E297G and D482G, which are frequently observed PFIC2 mutations, cause deficient BSEP maturation, although the transport functions of these mutants per se remain almost normal. Login to comment

PMID: 15841457 [PubMed] Keitel V et al: "Expression and localization of hepatobiliary transport proteins in progressive familial intrahepatic cholestasis."

No. Sentence Comment

166 Defective BSEP targeting as an important mechanism underlying PFIC-2 was reported recently: 5 of 7 mutations prevented rat Bsep from trafficking to the apical membrane.37 Similarly, increased intracellular degradation and reduced canalicular targeting of mouse Bsep carrying the common D482G mutation was demonstrated recently.38 MDR3 immunofluorescence is of limited value in the diagnosis of PFIC-3, as shown by the association of disease-causing MDR3 mutations and normal canalicular MDR3 localization. Login to comment

PMID: 16394881 [PubMed] Kubitz R et al: "Benign recurrent intrahepatic cholestasis associated with mutations of the bile salt export pump."

No. Sentence Comment

80 This might include protein misfolding and increased ER-associated degradation of BSEP as shown for some frequent BSEP mutations underlying PFIC-2.28,29 Other possibilities of reduced protein amounts of BSEP are an increased retention of BSEP within the secretory pathway11 or an increased vesicular retrieval of BSEP from the canalicular membrane as described in animal models of cholestasis.30,31 Targeting defects might be even more important than alteration in transporter activity as shown for the most frequent PFIC-2 mutations E297G and D482G.32 Cholestatic episodes of the patient were triggered by infections.16,33,34 These infections might induce cell stress,35,36 which might be the reason for protein instability and improper trafficking. Login to comment

PMID: 16550034 [PubMed] Rutherford AE et al: "Cholestasis and cholestatic syndromes."

No. Sentence Comment

38 Of these, two missense mutations (E297G and D482G) are present in 30% of European PFIC2 families. Login to comment

PMID: 16871584 [PubMed] Knisely AS et al: "Hepatocellular carcinoma in ten children under five years of age with bile salt export pump deficiency."

No. Sentence Comment

66 Patients, Clinical Courses, and ABCB11 / BSEP Mutations Patient/Gender; Origins Sibling(s) With PFIC Age, PFIC Manifest Intervention(s) Age, HCC Diagnosed Outcome to Date Nucleotide Changes Predicted Consequences A/Male; Northern European Caucasian 0 Cholestasis from 3 wk Hepatocyte infusion, 16 mo 21 mo (incidental in explant; AFP 199, nl Ͻ 7), at LT Healthy (2 y, 8 mo after LT) 1939delA/IVS16-8TϾG (compound heterozygote) 647K then VFTSLX/ splice site disruption B/Female; Northern European Caucasian 0 Cholestasis from 2 wk, hospitalized for evaluation aged 12 wk None 28 mo, at open biopsy; AFP not determined Palliative care only; death aged 33 mo IVS18ϩ1GϾA/74CϾA (compound heterozygote) Splice site disruption/ S25X C/Male; Northern European Caucasian 0 Cholestasis from birth None 23 mo (AFP 30k, nl Ͻ 5; liver mass); histologic diagnosis at necropsy, 24 mo Palliative care only; death aged 24 mo 1445AϾG/3691CϾT (compound heterozygote) D482G/R1231W D/Male; Northern European Caucasian 1 Cholestasis from 3 wk Partial external biliary diversion (PEBD), 11 mo; decreased pruritus temporarily, clinical-laboratory test results and growth no better 22 mo (AFP 158k, nl Ͻ 15); liver mass; lung and bone lesions; chemotherapy given; histologic diagnosis at LT, 25 mo Death, 6 d after LT (sepsis; no HCC at necropsy) 890AϾG/890AϾG (homozygote) E297G/E297G E/Male; Northern European Caucasian 1 Growth failure from 6 mo; diagnosed 9.5 mo PEBD, 10 mo; no response 29 mo (incidental in explant; AFP 6.4k, nl Ͻ 9), at LT Healthy (5 y, 10 mo after LT) IVS7ϩ1GϾA/890AϾG (compound heterozygote) Splice site disruption/ E297G F/Male; Northern European Caucasian 1 Cholestasis from 6 wk None 16 mo (clinically unsuspected), at necropsy; AFP not determined Death with metastatic HCC in lungs IVS9ϩ1GϾT/not known Splice site disruption/ not known G/Female; Arabic 3 Cholestasis from 6 wk None 15 mo (AFP 11k, nl Ͻ 7; liver mass); histologic diagnosis at LT, 16 mo Healthy (1 y, 7 mo after LT) 1416TϾA/1416TϾA (homozygote) Y472X/Y472X H/Male; Northern European Caucasian 0 Evaluation at 6 mo for jaundice and growth failure PEBD, 32 mo; excellent response (pruritus resolved, bile salts in serum normal range, growth resumed) 52 mo (marked increase in abdominal size; tumor metastasized at diagnosis; AFP 2x106, nl Ͻ 9), at open biopsy Palliative care only; death 3 wk after diagnosis 890 AϾG/ IVS13del-13ˆ-8 (compound heterozygote) E297G/splice site disruption I/Male; Central Asian Caucasian 0 Cholestasis from birth None 13 mo (incidental in explant; AFP 831, nl Ͻ 23), at LT Healthy (1 y, 11 mo after LT) IVS19ϩ2TϾC (homozygote) Splice site disruption J/Male; Central Asian Caucasian 0 Cholestasis from 1 wk None 14 mo (AFP 4k, nl Ͻ 23; liver mass), at biopsy; confirmed at LT, 15 mo Healthy (1 y, 2 mo after LT) 2316TϾG (homozygote) Y772X K/Male; Northern European Caucasian 3 Cholestasis from 3 mo None 26 mo (marked increase in abdominal size; tumor metastasized at diagnosis; AFP not measured), at open biopsy Death with metastatic HCC in lungs, aged 27 mo None sought None predicted Fig. 1. Login to comment
138 The common Polish mutation 1445AϾG (D482G)8 was present in one parent of a patient from whom leukocytes were not available (patient C). Login to comment
177 Among the missense changes is 1 in exon 27 (patient C); those in patients D, E, and H (890AϾG [E297G], exon 9) and the other mutation in patient C (1445AϾG [D482G], exon 14) have been described previously.8 The 890AϾG (E297G) and 1445AϾG (D482G) mutations reportedly affect BSEP transport activity,21,33 with altered trafficking of BSEP to the canalicular membrane.33-35 The mutation in patient C, 3691CϾT (R1231W), is predicted to alter an amino acid residue between the ATP-binding cassette signature motif and the Walker B motif of BSEP. Login to comment
185 Also of interest is the presence among our patients of the 890AϾG (E297G) mutation (patient D, homozygous; patients E and H, heterozygous) and the 1445AϾG (D482G) mutation (patient C, heterozy- gous). Login to comment
218 Note Added in Proof: The liver of yet another child with PFIC and hepatocellular carcinoma46 (3 years, 5 months of age at transplant hepatectomy) does not express BSEP; the common Polish mutation 1445AϾG(D482G)8 is present in one copy of ABCB11. Login to comment

PMID: 17051391 [PubMed] Stieger B et al: "The bile salt export pump."

No. Sentence Comment

160 Their bile flow rate is slightly but not significantly lower in comparison to controls, but the total bile salt output into bile is massively reduced and their liver bile salt concen- S114R G238V V284L* C336S D482G R487H S593R E636G G982R G1004D R1153CD R1268Q E186G E297G R432T I498T I498T T923P A926P R1050C R1128H S194P G260D N519S A1228V V444A K461E M677V R698H PFIC2 BRIC2 acquired cholestasis SNP Fig. 2 Putative secondary structure of Bsep (NT-005403) generated with the TOPO program (http://www.sacs.ucsf.edu/TOPO-run/wtopo.pl). Login to comment

PMID: 17082223 [PubMed] Mochizuki K et al: "Two N-linked glycans are required to maintain the transport activity of the bile salt export pump (ABCB11) in MDCK II cells."

No. Sentence Comment

350 However, a recent study (21) demonstrated that Bsep protein with a PFIC-2 mutation in the first nucleotide-binding domain (D482G) is unstable because of lack of glycosylation, suggesting that sugar attachment may be inhibited by a mutation in a region unrelated to N-linked glycosylation. Login to comment

PMID: 17181454 [PubMed] Sakurai A et al: "Prediction of drug-induced intrahepatic cholestasis: in vitro screening and QSAR analysis of drugs inhibiting the human bile salt export pump."

No. Sentence Comment

120 H2N COOH S56L G238V G260D C336S L339V V444A K461E D482G T923P K930X G982R R1090X R1153C Outside Inside R1268Q A1228VE1186K R1128H R1057X R1050C A926P A865V R698H E636G M677V S593R E592Q N591S R575XA570T Q558H I498T R432T R415Q R299K E297G V284A I206V S194P E186G cholestasis Expert Opin. Drug Saf. (2007) 6(1) Table 1. Login to comment
122 [39,41,44,46,48,102] - 12 1381 A→G Lys461Glu PFIC2 [35] - 13 1445 A→G Asp482Gly PFIC2 [35] - 13 1493 T→C Ile498Thr PFIC2?BRIC2? Login to comment

PMID: 17538928 [PubMed] Hayashi H et al: "4-phenylbutyrate enhances the cell surface expression and the transport capacity of wild-type and mutated bile salt export pumps."

No. Sentence Comment

1 We previously reported that E297G and D482G BSEP, which are frequently found mutations in European patients, result in impaired membrane trafficking, whereas both mutants retain their transport function. Login to comment
3 Because sodium 4-phenylbutyrate (4PBA) has been shown to restore the reduced cell surface expression of mutated plasma membrane proteins, in the current study, we investigated the effect of 4PBA treatment on E297G and D482G BSEP. Login to comment
4 Transcellular transport and cell surface biotinylation studies using Madin-Darby canine kidney (MDCK) II cells demonstrated that 4PBA treatment increased functional cell surface expression of wild-type (WT), E297G, and D482G BSEP. Login to comment
7 Conclusion: 4PBA treatment with a clinically achievable concentration enhances the cell surface expression and the transport capacity of WT, E297G, and D482G BSEP in MDCK II cells, and also induces functional BSEP expression at the canalicular membrane and bile acid transport via canalicular membrane in vivo. Login to comment
8 4PBA is a potential pharmacological agent for treating not only PFIC2 patients with E297G and D482G mutations but also other cholestatic patients, in whom the BSEP expression at the canalicular membrane is reduced. Login to comment
21 1506 ing junction mutations in the BSEP gene.1 Among them, E297G and D482G, two missense mutations in the second intracellular loop and in the first ATP-binding domain, respectively, are frequently observed in PFIC2 patients. Login to comment
23 However, both mutated BSEPs per se exhibit normal transport functions.10 Accordingly, restoration of the reduced cell surface expression of these mutated BSEPs is an important task for achieving the therapeutic goal for PFIC2 patients with E297G and D482G mutations. Login to comment
24 Sodium 4-phenylbutyrate (4PBA) has been shown to be capable of restoring the reduced cell surface expression of cystic fibrosis transmembrane conductance regulator (CFTR/ABCC7) with the deletion of phenylalanine at 508 (CFTR ⌬F508).11 CFTR ⌬F508 is the most common mutation in cystic fibrosis patients12 and has similar features to E297G and D482G BSEP in that this mutated molecule accumulates in the endoplasmic reticulum (ER), followed by degradation in the proteasomes, but maintains its normal function as a chloride channel.13-15 4PBA is a nontoxic butyrate analog that was originally approved for clinical use as an ammonia scavenger in subjects with urea cycle disorders.16 Clinical trials of this agent in cystic fibrosis patients with ⌬F508 demonstrated that CFTR function in the nasal epithelia is induced by 4PBA therapy.17 Considering that a surgical procedure such as liver transplantation is the only therapy to cure PFIC2, this compound may offer a new medical therapy for PFIC2. Login to comment
26 We evaluated the effectiveness and mechanism of action of 4PBA by biological and transport functional experiments with Madin-Darby canine kidney (MDCK) II cells expressing wild-type (WT), E297G, and D482G BSEP. Login to comment
36 The BD Adeno-X Adenoviral Expression System (BD Biosciences, Palo Alto, CA) was used to establish the human WT, E297G, and D482G BSEP recombinant adenoviruses as previously described.10 The virus titer was checked with an Adeno-X Rapid Titer Kit (Clontech). Login to comment
39 MDCK II cells were seeded in six-well plates at a density of 2.5 ϫ 105 cells per well. After a 24-hour culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, D482G BSEP, and GFP at 200 multiplicity of infection (MOI). Login to comment
47 After 2 days` culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, D482G BSEP, and GFP at 50 MOI. Cells were cultured for 24 hours after infection and subsequently treated with 1 mM 4PBA. Then, 24 hours after treatment, the transcellular transport assays were performed as described.19 The apparent efflux clearance across the apical membrane (PSapical) was calculated by dividing the steady-state rate for the transcellular transport of [3H]TC determined over 2 hours by the cellular concentration of [3H]TC determined at the end of the experiments (2 hours). Login to comment
49 MDCK II cells were seeded in 6-well plates at a density of 2.5 ϫ 105 cells per well. After a 24-hour culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, D482G BSEP, and GFP at 200 MOI. Cells were cultured for 24 hours after infection and subsequently treated with 1 mM 4PBA. Then, 24 hours after treatment, cell surface biotinylation was performed as described.10 When the degradation rate of the cell surface-resident protein was examined, biotinylated MDCK II cells were incubated for various periods at 37°C, with or without 1 mM 4PBA, before solubilization. Login to comment
52 MDCK II cells were seeded in six-well plates at a density of 2.5 ϫ 105 cells per well. After a 24-hour culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, D482G BSEP, and GFP at 50 MOI. Cells were cultured for 24 hours after infection and subsequently treated with 1 mM 4PBA. Then, 24 hours after treatment, RNA was isolated using ISOGEN (Wako Pure Chemical Industries, Osaka, Japan) according to the manufacturer`s instructions. Login to comment
57 MDCK II cells were seeded in 6-well plates at a density of 2.5 ϫ 105 cells per well. After a 24-hour culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, and D482G BSEP at 200 MOI. Cells were cultured for 36 hours after infection and subsequently treated, with or without 5 ␮g/ml Act D (Sigma, St. Louis, MO), to inhibit mRNA synthesis and, with or without 20 ␮g/ml CHX (Sigma, St. Louis, MO), to inhibit protein synthesis. Login to comment
59 Subsequently, 6 hours (E297G, D482G BSEP) or 8 hours (WT) after 4PBA treatment, the crude membrane fraction was prepared as described previously.19 The specimens were separated by 6% SDS-PAGE and subjected to western blot analysis. Login to comment
61 MDCK II cells were seeded in 6-well plates at a density of 2.5 ϫ 105 cells per well. After a 24-hour culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, and D482G BSEP at 200 MOI. Cells were cultured for 12 hours after infection, and subsequently treated, with or without 5 ␮g/ml brefeldin A (BFA) (Sigma, St. Louis, MO), to inhibit the translocation of BSEP from ER to the Golgi complex. Login to comment
82 MDCK II cells expressing WT, E297G, and D482G were treated with 4PBA for various periods and at various concentrations (Fig. 1A,B). Login to comment
84 4PBA treatment altered the expression level of the mature form of not only E297G and D482G BSEP but also WT BSEP in a concentration-dependent and time-dependent manner, the optimal condition being 1 mM for 24 hours. Login to comment
85 The expression level of the mature form of WT, E297G, and D482G BSEP was increased 2.5-fold to 3-fold in response to 1 mM 4PBA treatment for 24 hours, which is a clinically achievable concentration.21-23 We then examined the increase in cell surface expression of BSEP by 4PBA treatment using transcellular transport assay and cell surface biotinylation methods. Login to comment
87 Vectorial transport of [3H]TC in the apical direction was observed in MDCK II monolayers expressing WT, E297G, and D482G BSEP, and hardly detected in MDCK II monolayers expressing GFP. Login to comment
88 Similar to hepatocyte, coexpression of Naϩ-taurocholate cotransporting polypeptide (NTCP), basolateral uptake transporter, and BSEP, apical efflux transporter, is needed to detect the vectorial transport of [3H]TC in the apical direction in LLC-PK1 and MDCK monolayers.19,24 The finding that the expression of BSEP alone is sufficient to induce the vectorial transport of [3H]TC in the apical direction suggests that MDCK II cells endogenously express uptake transporter for bile acids in the basolateral membrane as suggested.25 The basal-to-apical flux of [3H]TC across MDCK II monolayers expressing WT, E297G, and D482G BSEP was increased 1.5-fold, 2.5-fold, and 3-fold, respectively, by 4PBA treatment under optimal conditions (1 mM, 24 hours), whereas the increase in the basal-to-apical flux of [3H]TC was not detected in MDCK II cells expressing GFP. Login to comment
93 MDCK II cells expressing WT, E297G, and D482G BSEP were treated for the indicated periods with 1 mM 4PBA before the preparation of crude membrane fractions. Prepared specimens (40 ␮g ) were separated by 6% SDS-PAGE and subjected to western blot analysis. Login to comment
95 MDCK II cells expressing WT, E297G, and D482G BSEP were treated with the indicated 4PBA concentration for 24 hours before the preparation of crude membrane fractions. Prepared specimens (40 ␮g) were separated by 6% SDS-PAGE and subjected to western blot analysis. Login to comment
97 PSapical was increased in MDCK II cells expressing WT, E297G, and D482G BSEP, but not affected in MDCK II cells expressing GFP by 4PBA treatment. Login to comment
98 BSEP-dependent PSapical (PSapical, BSEP) in MDCK II cells expressing WT, E297G, and D482G BSEP, which was calculated by subtracting the PSapical value in MDCK II cells expressing GFP from that in MDCK II cells expressing WT, E297G, and D482G BSEP, was enhanced 1.7-, 3.0-, and 2.8-fold, respectively, by 4PBA treatment under optimal conditions (1 mM, 24 hours). Login to comment
100 Cell surface expression of WT, E297G, and D482G BSEP was increased 1.8-fold, 3.1-fold, and 2.6-fold, respectively, by 4PBA treatment under optimal conditions (1 mM, 24 hours), whereas cell surface expression of exogenously expressing P-gp and endogenously expressing DPPIV was not affected (Fig. 2D). Login to comment
101 The increase in cell surface expression of BSEP by 4PBA treatment was to an equivalent degree to that in PSapical, BSEP, suggesting that 4PBA treatment with a clinically achievable concentration can enhance the transport capacity of BSEP in MDCK II cells expressing WT, E297G, and D482G BSEP by increasing the cell surface expression of WT, E297G, and D482G BSEP. Login to comment
104 A possible mechanism is that 4PBA treatment promotes transcription or translation of WT, E297G, and D482G BSEP and consequently increases the cell surface expression of WT, E297G, and D482G BSEP by mass action. Login to comment
107 WT, E297G, and D482G BSEP mRNA expression levels were slightly increased by 4PBA treat- Fig. 2. Login to comment
109 MDCK II cells expressing WT, E297G, D482G BSEP, and GFP were treated for 24 hours, with or without 1 mM 4PBA, before the experiments. Login to comment
112 Transcellular transport of 1 ␮M [3H]TC across MDCK II monolayers expressing WT, E297G, D482G BSEP, and GFP was examined as a function of time. Login to comment
118 The clearance of the transport of [3H]TC across the apical membrane of MDCK II monolayers expressing WT, E297G, D482G BSEP, and GFP (PSapical) was determined as described in Materials and Methods. Login to comment
123 ment, but the difference was not statistically significant [P ϭ 0.10 (WT), 0.20 (E297G, D482G)] (Fig. 3A). Login to comment
126 The inhibition of transcription with Act D and translation with CHX did not affect the 4PBA-mediated increase in the mature form of BSEP in MDCK II cells expressing WT, E297G, and D482G BSEP. Login to comment
127 These results indicate that a post-translational mechanism mainly contributes to the 4PBA-mediated increase in the cell surface expression of WT, E297G, and D482G BSEP. Login to comment
135 MDCK II cells expressing WT, E297G, and D482G BSEP were treated for 24 hours, with or without 1 mM 4PBA, before the experiments. Login to comment
140 MDCK II cells expressing WT, E297G, and D482G BSEP were treated for 6 hours (E297G, D482G BSEP) or 8 hours (WT BSEP), with or without 1 mM 4PBA, in the presence or absence of 5 ␮g/ml Act D (B), and 20 ␮g/ml CHX (C) before the preparation of crude membrane fractions. Prepared specimens (40 ␮g) were separated by 6% SDS-PAGE and subjected to western blot analysis. Login to comment
144 MDCK II cells expressing WT, E297G, and D482G BSEP were treated for 12 hours, with or without 1 mM 4PBA, in the presence or absence of 5 ␮g/ml BFA. Login to comment
151 The expression level of the immature ER-resident form of WT, E297G, and D482G BSEP was almost identical in non- and 4PBA-treated MDCK II cells just after BFA washout (Fig. 4A; 0 hours), and that of the mature form was similar in non- and 4PBA-treated MDCK II cells until 3 hours after BFA washout, at which time the mature form of BSEP linearly increased. Login to comment
153 This result suggests that 4PBA treatment does not promote WT, E297G, and D482G BSEP maturation, but stabilizes the mature form of these proteins. Login to comment
156 To examine whether 4PBA treatment can inhibit the cell surface-resident BSEP from entering the degradation pathway, we measured the degradation rate of the cell surface-resident BSEP using biotin-labeling methods in MDCK II cells expressing WT, E297G, and D482G BSEP. Login to comment
158 The degradation rate of cell surface-resident D482G BSEP could not be determined under the same conditions as WT and E297G because of its low expression level. Login to comment
169 (C) Cell surface expression of D482G BSEP at a low temperature. Login to comment
170 MDCK II cells expressing D482G BSEP were cultured for 24 hours at 27°C before the cell surface biotinylation. Login to comment
172 (D) The degradation rate of cell surface-resident D482G BSEP. Login to comment
173 MDCK II cells expressing D482G BSEP were cultured at 27°C for 24 hours, with or without 1 mM 4PBA, before the experiments. Login to comment
175 (E) Quantification of band density indicating D482G BSEP in (D). Login to comment
176 The intensity of the band indicating D482G BSEP was quantified by Image Gauge software and expressed as a percentage of the BSEP present at 0 hours, respectively. Closed and open circles represent remaining cell surface D482G BSEP in MDCK II cells treated, with and without 4PBA, respectively. Login to comment
178 D482G (Fig. 5C). Login to comment
179 The cell surface expression of D482G increased 4.0-fold by 24-hour culture at a lower temperature (27°C). Login to comment
180 We further examined the degradation rate of cell surface-resident D482G at 37°C after 24 hours` culture at a lower temperature (Fig. 5D,E). Login to comment
181 The half-life of the cell surface-resident D482G BSEP was prolonged 3.3-fold by 4PBA treatment such as WT and E297G BSEP. Login to comment
182 The prolonged half-life of the cell surface-resident WT, E297G, and D482G BSEP is consistent with the result of the BFA washout study, which suggests that 4PBA treatment stabilizes the mature form of BSEP (Fig. 4A,B). Login to comment
184 4PBA treatment can increase the functional cell surface expression of WT, E297G, and D482G BSEP in MDCK II cells (Fig. 2). Login to comment
205 Discussion We previously reported that E297G and D482G BSEP, which are frequently found mutants in European patients, result in impaired membrane trafficking, whereas the transport function of both mutated BSEPs remains almost normal.10 Restoration of the reduced cell surface expression of these mutated BSEPs is a therapeutic goal for PFIC2 patients with E297G and D482G mutations, because both mutated BSEPs per se exhibit normal transport functions. Login to comment
206 In the current study, we analyzed the potential therapeutic effect of 4PBA against PFIC2 by examining the effect of 4PBA treatment on the cell surface expression of E297G and D482G BSEP. Login to comment
208 Initially, we examined the effect of 4PBA treatment on WT, E297G, and D482G BSEP using MDCK II cells. Login to comment
210 Together with the finding that the increase in PSapical, BSEP by 4PBA treatment correlates with the cell surface expression of WT, E297G, and D482G BSEP (Fig. 2C), 4PBA treatment with a clinically achievable concentration can enhance the cell surface expression and the transport capacity of WT, E297G, and D482G BSEP in MDCK II cells. Login to comment
214 Furthermore, the expression levels of the immature ER-resident form of WT, E297G, and D482G BSEP were almost identical in non- and 4PBA-treated MDCK II cells just after BFA washout (Fig. 4A; 0 hours). Login to comment
215 These results indicate that a post-translational mechanism mainly contributes to the 4PBA-mediated increase in the cell surface expression of WT, E297G, and D482G BSEP. Login to comment
216 Although we investigated whether 4PBA treatment promotes the maturation of WT, E297G, and D482G BSEP as the possible post-translational mechanism, such an effect of 4PBA treatment was not observed in the BFA washout study (Fig. 4A,B). Login to comment
217 However, the results of this study showed that 4PBA treatment could stabilize the mature form of WT, E297G, and D482G BSEP (Fig. 4A,B). Login to comment
230 E297G, and D482G BSEP (Fig. 5A-E). Login to comment
231 Because cell surface-resident BSEP constitutively cycles between the canalicular membrane and the intracellular compartment, and is finally removed from this cycle to the degradation pathway,30,31 4PBA treatment may interrupt the internalization process or promote the recycling process and, consequently, increase the cell surface expression of WT, E297G, and D482G BSEP. Login to comment
233 Although the molecular mechanism of this effect remains unknown, taking into the consideration that the prolonged half-life with 4PBA treatment was only detected in cell surface-resident WT, E297G, and D482G BSEP, but not for other membrane proteins such as P-gp and DPPIV (Fig. 5B,E), 4PBA treatment possibly induces a specific interaction of WT, E297G, and D482G BSEP with adaptor proteins. Login to comment
238 If the prolonged half-life of cell surface-resident Bsep with 4PBA treatment is responsible for this result in vivo as well as in vitro, the protective effect of 4PBA treatment against hepatocellular damage by increasing biliary excretion of bile acids and lowering intrahepatic bile acids may be remarkably observed in PFIC2 patients with E297G and D482G mutations. Login to comment
249 In conclusion, we demonstrated that 4PBA treatment with a clinically achievable concentration induces the cell surface expression and the transport capacity of WT, E297G, and D482G BSEP in MDCK II cells and also enhances functional Bsep expression at the canalicuar membrane and bile acid transport via canalicular membrane in vivo. Login to comment
251 These results suggest that 4PBA is a potential pharmacological agent not only for PFIC2 patients with E297G and D482G mutations but also for other cholestatic patients, in whom the BSEP expression at the canalicular membrane is reduced. Login to comment

PMID: 17855769 [PubMed] Lam P et al: "Levels of plasma membrane expression in progressive and benign mutations of the bile salt export pump (Bsep/Abcb11) correlate with severity of cholestatic diseases."

No. Sentence Comment

9 Therefore we compared the effect of two PFIC2 mutations (D482G, E297G) with two BRIC2 mutations (A570T and R1050C) and one ICP mutation (N591S) with regard to the subcellular localization, maturation, and function of the rat Bsep protein. Login to comment
11 Mutant proteins were expressed at reduced levels on the plasma membrane of transfected HEK293 cells compared with wild-type (WT) Bsep in the following order: WT Ͼ N591S Ͼ R1050C ϳ A570T ϳ E297G ϾϾ D482G. Login to comment
14 Reduced temperature, sodium butyrate, and sodium 4-phenylbutyrate enhanced the expression of the mature and cell surface D482G protein in HEK293 cells. These results suggest that the clinical phenotypes of PFIC2, BRIC2, and ICP may directly correlate with the amount of mature protein that is expressed at the cell surface and that strategies to stabilize cell surface mutant protein may be therapeutic. Login to comment
32 These studies suggest that two PFIC2 mutations, D482G and E297G, lead to reduced total protein expression presumably due to folding, processing, and/or trafficking defects (8, 19, 22, 30). Login to comment
39 0363-6143/07 $8.00 Copyright (c) 2007 the American Physiological Societyhttp://www.ajpcell.org C1709 trast to these conclusions, we find that all five green fluorescent protein (GFP)-tagged mutant proteins, including D482G and E297G, traffic to the cell surface as detected by confocal microscopy and by biotinylation of plasma membrane Bsep when expressed in MDCK and HEK293 cells, respectively. Login to comment
45 All point mutations (D482G, E297G, A570T, R1050C, N591S) were introduced with the QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA). Login to comment
64 PFIC2 (D482G, E297G), BRIC2 (A570T, R1050C), and ICP (N591S) mutations that are investigated in this study are indicated in italics. Login to comment
84 Stably transfected D482G HEK293 cells were treated with and without 2 ␮M MG-132 for 16 h. Login to comment
94 Sf9 cells infected with recombinant virus (mock, WT, D482G, E297G, A570T, R1050C, and N591S) were harvested, and cell membranes were prepared as described previously (23). Login to comment
107 The subcellular distributions of D482G, E297G, A570T, R1050C, and N591S were examined first because intracellular accumulation of misfolded proteins has been shown for many diseases. Login to comment
118 The level of cell surface expression of Bsep protein was quantitated by densitometry and determined to be in the following order: WT (100%) Ͼ N591S (75.6 Ϯ 15.6%) Ͼ E297G (38.5 Ϯ 12.6%) ϳ R1050C (35.6 Ϯ 14.5%) ϳ A570T (29.5 Ϯ 8.8%) ϾϾ D482G (5.7 Ϯ 2.3%). Login to comment
120 The total expression (cell surface and intracellular proteins) also showed changes similar to those in cell surface expression: WT (100%) Ͼ N591S (73.5 Ϯ 4.3%) Ͼ E297G (33.7 Ϯ 20.4%) ϳ R1050C (26.7 Ϯ 16.0%) ϳ A570T (11.9 Ϯ 5.2%) ϾϾ D482G (2.5 Ϯ 2.0%) (Fig. 4B). Login to comment
132 We colocalized the D482G mutant with endogenous ubiquitin and with transfected rat ubiquitin tagged with hemagglutinin (Fig. 5C). Login to comment
135 To further confirm that Bsep is ubiquitinated, we immunoprecipitated D482G molecules from stably transfected cells and blotted the immunoprecipitates with an anti-ubiquitin antibody (Fig. 5D). Login to comment
137 MG-132 treatment increased both the D482G protein and its ubiquitinated form. Login to comment
138 These results indicate that the proteasome is involved in the turnover of D482G protein. Login to comment
140 To investigate whether chemical chaperones could stabilize the D482G mutant, we found that reduced temperature, sodium butyrate, and sodium 4-phenylbutyrate could enhance the expression of the mature D482G protein (band C) and surface expression in stably transfected HEK293 cells (Fig. 6). Login to comment
141 Recently, Hayashi and Sugiyama (7) also showed that sodium 4-phenylbutyrate enhances the expression of cell surface human D482G protein in MDCK cells. These results confirm that 4-phenylbutyrate has similar effect in stabilizing D482G mutant with human or rat gene. Login to comment
150 The membrane vesicles expressing D482G, A570T, R1050C, or N591S showed similar levels of taurocholate uptake compared with WT Bsep. Login to comment
155 Cells were transiently transfected with pEGFPN1 (control), rat Bsep-GFP [wild type (WT)], D482G-GFP, E297G-GFP, A570T-GFP, R1050C-GFP, and N591S-GFP constructs. Login to comment
164 A PFIC2 mutation (D482G) is highly unstable (ϳ5% of WT), while the BRIC2 variants A570T and R1050C are expressed at the plasma membrane at intermediate levels (ϳ25% of WT). Login to comment
169 Cells were transfected with rat Bsep-GFP (WT), D482G-GFP, E297G-GFP, A570T-GFP, R1050C-GFP, and N591S-GFP constructs and were examined for GFP by confocal laser microscopy. Login to comment
171 D482G, E297G, A570T, and R1050C mutants partially colocalized with recycling endosome marker Rab11. Login to comment
176 D4, D482G; E2, E297G; A5, A570T; R10, R1050C; N5, N591S. Login to comment
183 P Ͻ 0.05, D482G, E297G, A570T, R1050C, and N591S compared with WT control. Login to comment
186 This study shows that the D482G mutant is ubiquitinated and that proteasome inhibition increases the level of the mutant protein, thereby providing a means to regulate Bsep stability. Login to comment
192 Our results confirm previous results from this lab (30) and others (8, 19, 22) that have described a low expression of the PFIC2 mutant D482G in human, rat, and mouse Bsep following transfection into different mammalian cell lines. Login to comment
196 Twenty-five micrograms of protein was used for each reaction, except that 100 ␮g of D482G protein was used for digestion to detect expression (**). Login to comment
200 C: Bsep-D482G-GFP (a) colocalizes with transfected hemagglutinin (HA)-tagged ubiquitin (b) with HA antibody. Login to comment
202 Bar ϭ 5 ␮m. D: Western blots of total lysates or immunoprecipitates (IP) of D482G stably transfected HEK293 cells treated with and without MG-132 using anti-ubiquitin (ub) antibody or Bsep antibody (Bsep). Login to comment
204 Temperature and chemical chaperones rescue mature D482G mutant protein. Login to comment
205 A: stably transfected WT (top) and D482G (bottom) in HEK293 cells were incubated at 37°C or shifted to 27°C overnight. Login to comment
206 There was a marked increase in plasma membrane expression of the D482G-GFP mutant compared with slight increase in plasma membrane expression of WT-GFP. Login to comment
207 Western immunoblotting shows the increase in expression of mature and immature protein of D482G (bottom) compared with little change in expression of WT (top) after temperature rescue. Login to comment
208 B: chemical chaperones sodium butyrate (NaB) and sodium 4-phenylbutyrate (NaPB) and DMSO control (Ctl) were used to treat WT (top) and D482G (bottom) stably transfected HEK293 cells for 24 h. NaB and NaPB enhanced the expression of D482G at the plasma membrane and increased the expression levels of mature and immature protein (bottom). Login to comment
220 Reduced temperature and 4-phenylbutyrate have been demonstrated in this study and by others (7) to increase mature and cell surface protein expression for the D482G mutant. Login to comment
229 A: immunoblot of the isolated Sf9 cell membrane proteins with anti-Bsep polyclonal antibody: GFP control expressed in HEK293 cells, WT expressed in HEK293 cells, rat liver homogenate (L), pFastBac1-Gus control (C), wild type (WT), D482G (D4), E297G (E2), A570T (A5), R1050C (R10), N591S (N5). Login to comment
231 B: TCA (200 ␮M) stimulates and orthovanadate inhibits ATPase activity in membrane vesicles containing comparable levels of WT or D482G, E297G, A570T, R1050C, and N591S mutant Bsep. Login to comment

PMID: 17947449 [PubMed] Kagawa T et al: "Phenotypic differences in PFIC2 and BRIC2 correlate with protein stability of mutant Bsep and impaired taurocholate secretion in MDCK II cells."

No. Sentence Comment

13 The taurocholate transport activity was approximately half of the wild-type (WT) in BRIC2 mutants (A570T and R1050C), was substantially less in two PFIC2 mutants (D482G and E297G), and was almost abolished in six other PFIC2 mutants (K461E, G982R, R1153C, R1268Q, 3767-3768insC, and R1057X). Login to comment
15 The half-life of the D482G mutant was shorter than that of the WT (1.35 h vs. 3.49 h in the mature form). Login to comment
16 BRIC2 mutants and three PFIC mutants (D482G, E297G, and R1057X) were predominantly distributed in the apical membrane. Login to comment
19 In conclusion, taurocholate transport function was impaired in proportion to rapid degradation of Bsep protein in the mutants, which were aligned in the following order: A570T and R1050C Ͼ D482G Ͼ E297G Ͼ K461E, G982R, R1153C, R1268Q, 3767-3768insC, and R1057X. Login to comment
29 Of these, D482G and E297G mutations are most frequent (35). Login to comment
30 Studies of TC transport activity and intracellular trafficking by D482G and E297G mutants have reported inconstant results. Login to comment
32 D482G mutant Bsep was localized in the apical membrane of HepG2 (28) and Madin-Darby canine kidney (MDCK) cells (41), and in the cytoplasm of MDCK II cells (8). Login to comment
87 Briefly, MDCK II cells grown on 24-mm Transwell membrane inserts were transfected with WT or D482G mutant Bsep. Login to comment
115 RESULTS TC transport activity, protein expression, and mRNA expression of the D482G mutant. Login to comment
116 The D482G mutant is the most frequently observed mutation in PFIC2. Login to comment
118 In a polarized MDCK II monolayer, the D482G mutation revealed 32.3 Ϯ 5.8% (mean Ϯ SD) TC transport activity of that observed in WT (Fig. 2A). Login to comment
121 The D482G mutant produced the same two bands, suggesting normal maturation of Bsep protein. Login to comment
124 These results reveal that the observed decrease in TC transport activity of the D482G mutation is attributable to decrease in Bsep protein expression. Login to comment
126 The mRNA expression of D482G was slightly higher than that of WT; however, the difference was not statistically significant (Fig. 2C), which suggests that the D482G mutant Bsep protein may be degraded faster than is the WT. Login to comment
127 Next, we tested the subcellular distribution of the D482G mutant (Fig. 3). Login to comment
128 MDCK II cells were transfected with WT or D482G Bsep, and the fluorescent signals were observed by confocal laser scanning microscopy. Login to comment
129 The D482G mutant was predominantly distributed along apical membranes similar to that of WT (Fig. 3A). Login to comment
131 As expected, WT and D482G Bsep were not detected in the basolateral membrane (Fig. 3B). Login to comment
133 D482G mutant protein was present in the apical membrane at 30.6 Ϯ 14.4% of the level of WT. Login to comment
139 The positions of 8 PFIC2 mutations (E297G, K461E, D482G, G982R, R1057C, R1153C, 3767-3768insC, and R1268Q) and 2 BRIC2 mutations (A570T and R1050C) are indicated by ଝ and ଙ, respectively. Login to comment
142 G60 RAPID DEGRADATION OF PFIC2, BRIC2 MUTANT AJP-Gastrointest Liver Physiol • VOL 294 • JANUARY 2008 • www.ajpgi.org Biochemical half-life of the D482G mutant. Login to comment
143 To explore the mechanism(s) for attenuation of protein expression of the D482G mutant, the biochemical half-life was determined in MDCK II cells by analyzing Bsep protein expression after inhibiting further protein synthesis with cycloheximide treatment (Fig. 4). Login to comment
145 Band C of the WT was still present in 12 h, whereas, in D482G, bands disappeared in 4 h. Login to comment
146 The calculated half-life of band C in the D482G was 1.35 h, which was significantly shorter than that in WT (3.49 h, P Ͻ 0.05, Fig. 4B). Login to comment
147 Likewise the half-life of band B in the D482G was shorter than that in WT (0.41 h vs. 1.16 h, P Ͻ 0.05, Fig. 4B). Login to comment
148 These results suggest that the D482G protein is degraded faster than is the WT. Login to comment
152 Bands C of WT at 12 h and D482G at 4 h were denser in the presence of MG132. Login to comment
153 The half-life of each band was significantly extended by MG132 in WT and D482G; from 3.49 to 14.1 h in WT band C, from 1.35 to 13.2 h in D482G band C, from 1.16 to 2.95 h in WT band B, and from 0.41 to 1.73 h in D482G band B (Fig. 5C). Login to comment
155 These results suggest that the WT and D482G mutant Bsep proteins are degraded in proteasomes rather than in lysosomes. Login to comment
171 Taurocholate (TC) transport activity and expression of Bsep protein and mRNA of the D482G mutant expressed in MDCK II cells. Login to comment
172 A: MDCK II cells grown on Transwell membrane inserts were cotransfected with Ntcp and beta-gal or Ntcp and either wild-type (WT) or the D482G mutant Bsep. Login to comment
174 Each value represents mean Ϯ SD of 6 independent experiments performed in duplicate. B: MDCK II cells were transiently transfected with WT or D482G mutant Bsep and lysed. Five micrograms of cell lysates were separated by SDS-PAGE and subjected to immunoblot analysis using antibody to GFP. Login to comment
177 C: MDCK II cells were transiently transfected with an empty vector or WT or D482G mutant Bsep, and total RNA was extracted 24 h after transfection. cDNA was obtained by reverse transcription with SuperScript III and random hexamers, and quantitative real-time PCR was performed using TaqMan technology on ABI 7700 sequence detection system. Login to comment
186 Two PFIC2 mutants (D482G and E297G) were expressed at 10-30% of WT, trafficked correctly, and exhibited 10-30% activity. Login to comment
197 From the observation that a representative mutant, D482G, had a shorter biochemical half-life than the WT, rapid degradation of Bsep protein may be responsible for impaired function. Login to comment
204 The biochemical half-life of both forms of the D482G mutant was significantly shorter than that of the WT (mature form: 1.35 h, and core-glycosylated form: 0.41 h, Fig. 4B). Login to comment
205 These results suggest that after translation D482G Bsep protein is unstable and rapidly degraded. Login to comment
206 In contrast to a previous study (28), D482G was completely glycosylated (Fig. 2B). Login to comment
209 Subcellular localization of the WT and D482G mutant Bsep. Login to comment
210 A: MDCK II cells grown on Transwell membrane inserts were transfected with the WT or D482G mutant Bsep. Login to comment
214 The scale bars are 10 ␮m. B: MDCK II cells grown on 24-mm Transwell membrane inserts were transfected with the WT or the D482G mutant Bsep. Login to comment
228 Biochemical half-life of the WT and D482G mutant Bsep in MDCK II cells. Login to comment
229 A: MDCK II cells were transiently transfected with the WT or D482G mutant Bsep. Login to comment
230 After 24 h cells were further cultured in the presence of cycloheximide (20 ␮g/ml) and lysed at 0, 3, 6, and 12 h (WT) or at 0, 1, 2 and 4 h (D482G). Login to comment
237 A and B: MDCK II cells were transiently transfected with the WT or D482G mutant Bsep. Login to comment
238 After 24 h, cells were cultured with cycloheximide (20 ␮g/ml) in the absence or presence of either MG132 (10 ␮M) (A) or bafilomycin A1 (1 ␮M) (B) and lysed at 0, 3, 6, and 12 h (WT) or at 0, 1, 2, and 4 h (D482G). Login to comment
244 In the eight PFIC2 mutants studied, D482G and E297G were predominantly distributed in the apical membrane and exhibited TC transport activity (D482G: 32.3% and E297G: 10.2% of WT). Login to comment
247 Our observation that the D482G and E297G mutants exhibited less impaired transport activity than other mutants is in agreement with the clinical phenotype. Login to comment
248 The response to biliary diversion is better in PFIC2 patients carrying D482G and E297G mutations than in those with other mutations (27). Login to comment
290 From the view of maintenance of TC transport activity, the mutants could be aligned in the following order: A570T and R1050C Ͼ D482G Ͼ E297G Ͼ K461E, G982R, R1153C, R1268Q, 3767-3768insC, and R1057X. Login to comment
295 When we were preparing the manuscript, a paper appeared in which 4-phenylbutyrate (4PBA) was demonstrated to extend the half-life of cell surface-resident WT, E297G, and D482G BSEP by 1.8-, 2.5-, and 3.3-fold, respectively, in MDCK II cells (7). Login to comment

PMID: 18376240 [PubMed] Alissa FT et al: "Update on progressive familial intrahepatic cholestasis."

No. Sentence Comment

188 Other common mutations include R575X, R1057X, G982R, C336S, R1153C, D482G, K461E, R1153C, R1268Q, R1090X, G238V, S114R, S593R, del 695, and del 3213 (66,67). Login to comment
192 The E297G and D482G mutations may yield proteins that are functional but do not traffic appropriately to the canalicular membrane. Login to comment

PMID: 18692205 [PubMed] Chen HL et al: "Diagnosis of BSEP/ABCB11 mutations in Asian patients with cholestasis using denaturing high performance liquid chromatography."

No. Sentence Comment

28 In a recent study analyzing patients of mostly European origin, 82 mutations that occurred throughout the protein were detected in 109 families.13 Some mutations were found in a number of affected families of European descent, such as E297G and D482G.4,13-14 No such hot spots have been found in patients with ABCB11 mutations in other ethnic backgrounds, especially in Asian populations. In this study, we developed a method to perform ABCB11 genomic analysis more efficiently by first amplifying all of the ABCB11 exons, and then subjecting the exons to denaturing high performance liquid chromatography (DHPLC) analysis, followed by confirmation using direct sequencing. Login to comment
119 E297G and D482G were present in 58% of European families with PFIC, and the 2 mutations were proposed to originate from Northern Europe and Central/Eastern Europe, respectively.13 From our present data, there is no evidence that these mutations have spread to east Asia. Login to comment

PMID: 18798335 [PubMed] Wang L et al: "Degradation of the bile salt export pump at endoplasmic reticulum in progressive familial intrahepatic cholestasis type II."

No. Sentence Comment

4 G238V, D482G, G982R, R1153C, and R1286Q all retain Bsep to the endoplasmic reticulum (ER) to different extents. Login to comment
6 G238V and D482G are partially misfolded and can be stabilized by low temperature and glycerol. Login to comment
7 The proteasome provides the major degradation pathway for the PFIC II mutants, whereas the lysosome also contributes to the degradation of D482G. Login to comment
31 Inhibition of proteasomes also stabilized Bsep G238V, E297G, and D482G when examined in Madin-Darby canine kidney (MDCK) cells and human embryonic kidney (HEK) cells.8,10,13 These findings suggest that the proteasome plays a major role in the degradation of these BSEP mutants in PFIC II patients. Login to comment
48 The following missense mutants were studied in this work: G238V, D482G, G982R, R1153C, and R1286Q. Login to comment
82 The positions of G238V, D482G, G982R, R1153C, and R1286Q are indicated by star signs in a predicted topology model of rat Bsep. Login to comment
90 In contrast, the PFIC II mutants were mostly detected as core-glycosylated proteins, except G238V and D482G, for which a fraction of 190-kDa mature glycosylated form was also observed. Login to comment
96 For G238V and D482G, which are partially core-glycosylated, there is a partial colocalization between GFP-Bsep and calnexin. Login to comment
99 Besides different glycosylation pattern, PFIC II mutants were also noticeably expressed at lower levels compared with the wt protein, with D482G, G982R, and ⌬Gly showing the lowest expression (Fig. 2A). Login to comment
108 For D482G, approximately 30% of the core-glycosylated Fig. 2. Login to comment
118 protein was degraded, whereas a significant fraction was converted to the mature glycosylated form, indicating that this mutant is probably only weakly misfolded and a portion of correctly folded D482G can traffic through the secretory pathway. Login to comment
124 For G238V and D482G, respectively, only approximately 20% and 40% of the 140-kDa protein is converted to the 160-kDa protein, whereas approximately 50% of the 140-kDa protein is degraded over the 120-minute chase (Fig. 3D). Login to comment
125 These data suggest that the core-glycosylated G238V and D482G have a half-life of approximately 2 hours, which is consistent with the results from the cycloheximide chase studies, which used chase times up to 4 hours (Fig. 3A). Login to comment
126 The higher conversion percentage for D482G is also consistent with the data in Fig. 3A. Login to comment
127 The Effect of Low Temperature and Chemical on G238V and D482G. Login to comment
128 The data in Fig. 3 suggest that a portion of D482G and G238V can be converted to the mature glycosylated form over time during biosynthesis. Login to comment
129 We next asked whether conditions such as low temperature or chemical chaperones can stabilize D482G and G238V, because these conditions favor protein folding and have been shown to stabilize the misfolded mutant protein CFTR ⌬F508 during its biogenesis.19 Both incubation at low temperature (30°C) and addition of glycerol increases the peripheral, cell surface expression of GFP-tagged D482G and G238V in HEK cells (Fig. 4A). Login to comment
130 This is confirmed by a higher percentage of mature glycosylated form in D482G and G238V in HEK cells under these conditions (Fig. 4B). Login to comment
131 These data together confirm the notion that a fraction of correctly folded D482G and G238V can traffic through secretory pathway, and this fraction is increased under the conditions that favor protein folding. Login to comment
133 Because the proteasome and lysosome provide two of the major degradation mechanisms in the cell, we next examined the contribution of these two pathways to the stability of G238V, D482G, and G982R. Login to comment
147 Low temperature and glycerol stabilize G238V and D482G. Login to comment
148 (A) The HEK 293 cells were transfected with wt GFP-Bsep, G238V, and D482G. Login to comment
156 In contrast, treatment with MG132 significantly stabilized the 170-kDa core-glycosylated form of G982R, D482G, and G238V. Login to comment
158 In contrast, the combination of ammonium chloride, leupeptin, and pepstatin only moderately increases the mature glycosylated form of D482G, while not affecting the expression of G238V or G982R. Login to comment
161 (A) The HEK 293 cells were transfected with the wt GFP-Bsep, G238V, D482G, and G982R. Login to comment
173 It is possible that D482G became prone to lysosome degradation when it traffics to a later stage of secretory pathway. Login to comment
174 It is also worth noting that the 190-kDa mature glycosylated form of D482G also increases by the treatment of MG132 compared with the control condition. Login to comment
175 This may reflect a situation that when the proteasome function is inhibited, the stabilized immature glycosylated D482G can traffic beyond the ER and is thus converted to the 190-kDa mature glycosylated form. Login to comment
183 However, the increase in ubiquitination is moderate for wt Bsep, compared with the mutant proteins G238V, D482G, G982R, and ⌬Gly. Login to comment
246 Taken together, the data from this study show that G238V, D482G, G982R, R1153C, R1286Q, and ⌬Gly mutations cause retention of Bsep in the ER to different extents. Login to comment
248 Although weakly expressed, a significant portion of D482G is expressed as mature glycosylated protein, which is consistent with previous reports showing that this mutant can be expressed at the cell surface and also retains bile salt transport function.8-10 These data together show that D482G is likely to be only a weakly misfolded mutant. Login to comment
251 For mutants D482G and G238V, only a portion of immature glycosylated protein can be converted to mature glycosylated protein over the chase period, whereas a large pool of immature glycosylated protein is degraded. Login to comment
252 This suggests that D482G and G238V are partly misfolded. Login to comment
253 This notion is supported by the data showing that conditions favoring protein folding, such as low temperature or the addition of glycerol, stabilize D482G and G238V and increase the fraction of the mature glycosylated form and cell surface expression (Fig. 4). Login to comment
254 Proteasomes, rather than lysosomes, provide the major degradation pathway for the PFIC II mutants, whereas lysosome also moderately contributes to the degradation of D482G. Login to comment
255 This may reflect a situation that D482G can traffic through the secretory pathway, and at different stages of the secretory pathway it can be sorted to proteasome or lysosome for degradation. Login to comment
256 Kagawa et al.13 have recently also analyzed the degradation of D482G. Login to comment
257 Comparable results were seen for the stabilization of D482G by proteasome inhibitor MG132 in MDCK cells. Login to comment
263 In addition, G238V, D482G, G982R, and ⌬Gly become relatively more ubiquitinated, compared with wt Bsep, when the function of the proteasome is inhibited, consistent with the notion that these mutant Bseps are misfolded and thus unstable. Login to comment
300 This may be particularly pertinent to the rescue of those mutants that are partly misfolded but still functional, such as the D482G Bsep mutant. Login to comment

PMID: 18829893 [PubMed] Hayashi H et al: "Short-chain ubiquitination is associated with the degradation rate of a cell-surface-resident bile salt export pump (BSEP/ABCB11)."

No. Sentence Comment

2 On the other hand, BSEP mutations, E297G and D482G, found in progressive familial intrahepatic cholestasis type 2 (PFIC2), reduced it by shortening the degradation rate of cell-surface-resident BSEP. Login to comment
5 Ubiquitination susceptibility of BSEP/Bsep was reduced in vitro and in vivo by 4PBA treatment and, conversely, was enhanced by BSEP mutations E297G and D482G. Login to comment
20 1 Copyright (c) 2009 The American Society for Pharmacology and Experimental Therapeutics 49288/3415636 Mol Pharmacol 75:143-150, 2009 Printed in U.S.A. degradation from the endoplasmic reticulum (ER) are responsible for the reduced cell-surface expression of BSEP in PFIC2 patients with E297G and D482G mutations (Hayashi and Sugiyama, 2007), both of which are the most frequently found in patients with PFIC2 (Strautnieks et al., 2008). Login to comment
42 The BD Adeno-X Adenoviral Expression System (BD Biosciences) was used to create BSEP, E297G BSEP, D482G BSEP, HA-BSEP, HA-BSEP-Ub⌬GG , and HA-BSEP-Ub⌬GG/I44A recombinant adenoviruses as described previously (Hayashi et al., 2005a). Login to comment
60 After a 24-h culture, confluent cells were infected with recombinant adenovirus containing cDNAs for BSEP, E297G BSEP, D482G BSEP, HA-BSEP, and GFP at a multiplicity of infection of 200. Login to comment
112 We reported previously that E297G and D482G, frequent mutations in PFIC2 patients, shorten the half-life of cell-surface-resident BSEP by approximately 1.5-and 4-fold, respectively, and, conversely, 4PBA treatment prolongs cell-surface-resident BSEP 2-fold (Hayashi and Sugiyama, 2007). Login to comment
113 To explore a possible correlation between the half-life of cell-surface-resident BSEP and the short-chain ubiquitination susceptibility of BSEP, mutated BSEP was immunoprecipitated from MDCK II cells expressing E297G BSEP and D482G BSEP, and the immunoprecipitates were subjected to Western blot analysis for Ub and BSEP (Fig. 2A). Login to comment
115 Quantitative densitometry analysis revealed that the ratio of the short-chain ubiquitinated BSEP, PFIC2-type mutated BSEPs (Figs. 2A and 3, A and B, arrow) to the mature form of BSEP, PFIC2-type mutated BSEPs (Figs. 2A and 3, A and B, filled arrowhead) was significantly greater, 6- and 30-fold by E297G and D482G mutations, respectively, than that in wild-type BSEP (Fig. 2B), and was reduced in a time-dependent manner after 4PBA treatment in vitro (Fig. 3, D and E). Login to comment
120 A, short-chain ubiquitination susceptibility of PFIC2-type mutated BSEPs, E297G BSEP and D482G BSEP. Login to comment
126 Open, gray, and closed columns represent the ratio of band density indicating the short-chain ubiquitinated BSEP to that indicating the mature form of BSEP in MDCK II cells expressing BSEP, E297G BSEP, and D482G BSEP, respectively. Each bar represents the mean Ϯ S.E., n ϭ 3 to 4. Asterisks represent statistically significant differences between BSEP and mutated BSEP, ‫,ء‬ P Ͻ 0.05, and ‫,ءء‬ P Ͻ 0.01. Login to comment
148 We have found previously that shortening the half-life of cell-surface-resident BSEP is partly responsible for the reduced cell surface expression of BSEP in patients with PFIC2 with E297G and D482G mutations (Hayashi and Sugiyama, 2007). Login to comment

PMID: 18853996 [PubMed] Chen ST et al: "Prenatal diagnosis of progressive familial intrahepatic cholestasis type 2."

No. Sentence Comment

103 Some common mutations have been found in European patients, such as E297G and D482G.15 There is no hotspot found in Asian patients reported from Taiwan and Japan.9,16 In this study, the four mutations found in the two families had not been found in European or Japanese patients. Login to comment

PMID: 18987030 [PubMed] Dixon PH et al: "Contribution of variant alleles of ABCB11 to susceptibility to intrahepatic cholestasis of pregnancy."

No. Sentence Comment

2 Methods: ABCB11 variation in ICP was investigated by screening for five mutant alleles (E297G, D482G, N591S, D676Y and G855R) and the V444A polymorphism (c.1331T.C, rs2287622) in two ICP cohorts (n = 333 UK, n = 158 continental Europe), and controls (n = 261) for V444A. Login to comment
5 Results: E297G was observed four times and D482G once. Login to comment
9 Structural analyses suggest that E297G and D482G destabilise the protein fold of BSEP. Login to comment
18 ABCC2 (encoding MRP2) variation has also been implicated in ICP in a South American cohort,23 but this has not been replicated to date in European populations.24 BSEP is a high affinity liver-specific transporter, which is responsible for the export of conjugated bile acids into the bile canaliculus.25-27 It is a member of the ABC transporter family of proteins, of which there are 48 members in the human genome and whose functions include the transport of a range of substances including lipids, drugs, cholesterol and bile salts.28 Two mutant alleles of ABCB11, namely E297G and D482G, have been found frequently in European families and one or both are present in 58%.29 The function of BSEP and the role of ABCB11 mutations in PFIC and BRIC indicate that variation in this gene could be involved in the aetiology of ICP. Login to comment
21 BSEP is homologous with the bacterial multidrug resistance protein (Sav1866) for which two structures have recently been determined at high resolution by x ray crystallography.35 36 We therefore used this structure to consider the possible effects of E297G, D482G, N591S and V444A on BSEP, all of which were identified in patients with ICP, to provide insights into potential mutational mechanisms. Login to comment
48 RESULTS Sequencing DNA sequence was generated for the UK ICP cohort (333 patients) for exons 9 and 14 which contain the common European mutations E297G and D482G, together with exons 15, 17 and 21 containing the previously described ICP-linked mutation (N591S) and the two DIC-linked mutations (D676Y and G855R), respectively. Login to comment
52 Analysis of exon 14 did not identify any carriers of D482G, and no carriers of the DIC mutations were identified. Login to comment
54 In this cohort, a single occurrence each of E297G and D482G was identified together with two occurrences of N591S. Login to comment
75 Replacing this conserved aspartic acid with a glycine (as in BSEP D482G) would probably destabilise this region of the protein and may prevent correct folding of the entire b-roll. Login to comment
77 S363 occupies the position of V444 in Sav1866. S363 hydrogen-bonds with D341 in an adjacent antiparallel b-strand within the Sav1866 NBD (fig 2C), but as it is only one of many bonds between the Table 1 Clinical features of ICP patients with heterozygous ABCB11 mutations Patient No Cohort Biochemistry (highest level measured) Other maternal clinical findings Fetal and labour complications Family history of ICPBile acids* ALT* GGT* E297G 1 UK 32 133 27 - - Yes 2{ UK 41 166 16 - M, H No 3{ UK 118 229 NP G, C Pr No 4 CE 41 82 NP - - No D482G 5 CE 74 98 15 J, P, BR - No N591S 6 CE 270 195 29 - - - 7 CE 32 60 11 - - - *Normal ranges: bile acids, ,14 mmol/l; alanine aminotransferase (ALT), (31 IU/l; c-glutamyl transferase (GGT), ,30 IU/l; bilirubin (BR), ,17 mmol/l. Login to comment
88 Indeed, in the sequence of MJ0796 from Methanococcus jannaschii this position is occupied by a serine, suggesting that the serine side chain is likely to be tolerated as a replacement for N591 in BSEP.38 DISCUSSION We report here the identification of seven heterozygous carriers of BSEP (ABCB11) mutations (four E297G, one D482G and two N591S) in a large cohort of patients with ICP. Login to comment
91 To understand the effects of PFIC and BRIC mutations, several groups have studied the effects of the E297G and D482G mutations on BSEP expression, transport, localisation, function and stability, in vitro. Login to comment
92 The D482G mutation has been studied in mouse,39 rat40-42 and human43 BSEP and, when expressed in mammalian cell lines at physiological temperature, all of the studies report reduced plasma membrane expression of the recombinant protein (quantified at 5%42 and 26%41 of the level of the wild-type protein). Login to comment
94 These data can be explained if the D482G mutant has a protein folding defect that slows progression through the trafficking pathway, resulting in much of the protein being degraded via the proteasome. Login to comment
95 Our structural analysis is entirely consistent with this interpretation and provides a molecular explanation for the observed phenotype, as the D482G change should destabilise the b-roll of NBD1. Login to comment
103 Table 3 Allelic analysis for the V444A polymorphism associated with cholestasis Allele OR (95%CI) p Value C vs T 1.70 (1.4 to 2.1) ,0.001 Table 4 Genotypic analysis for the V444A polymorphism associated with cholestasis OR (95% CI) p Value CC vs CT 1.9 (1.3 to 2.6) ,0.001 CC vs TT 2.8 (1.7 to 4.4) ,0.001 CC and CT vs TT 1.9 (1.3 to 2.9) 0.001 Biliary tract Gut 2009;58:537-544. doi:10.1136/gut.2008.159541 Figure 2 The structure of Sav1866 suggests a molecular mechanism for the bile salt export pump (BSEP) mutations E297G and D482G (A) Schematic representation of the drug exporter Sav1866 with two bound ADPs shown as spheres (pdb 2HYD). Login to comment
115 The N-terminal Biliary tract Gut 2009;58:537-544. doi:10.1136/gut.2008.159541 of the E297G mutant is likely to be less stable, resulting in reduced expression at the plasma membrane, but, because of the position of this residue at the interface between the domains, mutant protein at the cell surface may also be deficient in communication between the bile acid-binding sites and the ATP catalytic sites, offering a molecular explanation for the uncoupling observed in one of the studies.42 However, the underlying codon change in the D482G mutant may also impair RNA splicing,45 raising the possibility that the phenotypic effect of the 482G codon may be mediated earlier in the gene expression pathway. Login to comment
122 Our results suggest that the common E297G and D482G mutations of this gene do not play a major role in ICP predisposition in our population. Login to comment
124 However, the single carrier of D482G was a primigravid woman who had an extended phenotype with markedly elevated liver enzymes and hyperbilirubinaemia in the postnatal period. Login to comment
127 The 444A allele may contribute to susceptibility in a considerably higher number of cases of ICP than the E297G and D482G mutations. Login to comment

PMID: 19101985 [PubMed] Byrne JA et al: "Missense mutations and single nucleotide polymorphisms in ABCB11 impair bile salt export pump processing and function or disrupt pre-messenger RNA splicing."

No. Sentence Comment

3 The common ABCB11 missense mutation encoding D482G enhanced aberrant splicing, whereas the common SNP A1028A promoted exon skipping. Login to comment
67 ABCB11 Missense Mutations and SNPs Functionally Analyzed in This Study Exon Nucleotide Change Predicted Protein Effect Location in Protein Associated Phenotype Prevalence or Frequency* Any Defect(s) Identified Reference 4 c.149TϾC L50S NH2 term PFIC 1 family (het) Immature protein 31 5 c.270TϾC F90F EC1 SNP 2.7%-7.7% 43, 45 6 c.403GϾA E135K EC1 BRIC 1 family (het) Reduced levels of mature protein † 6 c.409GϾA E137K EC1 BRIC / ICP 1 family (het) Immature protein ‡ 7 c.500CϾT A167V TM2 PFIC 1 family (hom) Mild exon skipping beta 7 c.557AϾG E186G IC1 BRIC 2 families (both het) Moderate exon skipping; greatly reduced levels of mature protein 8, 37 7 c.580TϾC S194P IC1 SNP-PSC 1.1% 43 7 c.593TϾC L198P IC1 BRIC / ICP / DC 1 family (het) Greatly reduced levels of mature protein # 8 c.713GϾT G238V EC2 PFIC 1 family (hom) 29 8 c.725CϾT T242I TM4 PFIC 1 family (het) 31 8 c.779GϾA G260D TM4 SNP-PBC 0.8% 43 9 c.850GϾC V284L IC2 PFIC 1 family (het) No protein 28 9 c.851TϾC V284A IC2 SNP 0.5% Increased levels of mature protein 43, 45† 9 c.889GϾA E297K IC2 Prolonged NNH 1 family (het) Moderate differential splicing; immature protein ‡ 9 c. 890AϾG E297G IC2 PFIC, BRIC PFIC, 45 families (14 hom, 31 het) BRIC, 4 families (2 hom, 2 het) Greatly reduced levels of mature protein 7, 8, 12, 29-32, 35 10 c.936GϾT Q312H IC2 PFIC 1 family (het) ‡ 10 c.937CϾA R313S IC2 PFIC 1 family (het) 31 10 c.957AϾG G319G TM5 SNP 1.5 - 7.5% Mild exon skipping 42, 43, 45 10 c.980GϾA G327E TM5 PFIC 1 family (het) 31 10 c.1007GϾC C336S TM5 PFIC 1 family (het) 29 11 c.1168GϾC A390P NBF PFIC, BRIC 2 families (both het) Immature protein 31; # 12 c.1129GϾA G410D NBF PFIC 1 family (het) 31 12 c.1238TϾG L413W NBF PFIC 1 family (het) Greatly reduced levels of mature protein 31 12 c.1244GϾA R415Q NBF SNP-ICP 1.3% 42 12 c.1295GϾC R432T NBF BRIC 1 family (het) Reduced levels of mature protein 12 13 c.1331CϾT A444V NBF SNP, ICP, CC, DC, BRIC 43-60% Increased levels of mature protein 8, 28, 37, 39-45 13 c.1381AϾG K461E WA PFIC 1 family (hom) Immature protein 7 13 c.1388CϾT T463I WA PFIC 1 family (het) Mild exon skipping 31 13 c.1396CϾA Q466K Adj WA PFIC 1 family (het) 31 13 c.1409GϾA R470Q Adj WA PFIC 2 families (1 het, 1 consanguineous) Immature protein 31 14 c.1442TϾA V481E NBF1 PFIC 1 family (het) 31 14 c.1445AϾG D482G NBF1 PFIC 22 families (16 het, 6 hom) Severe differential splicing; immature protein 7, 30-32 14 c.1468AϾG N490D NBF1 PFIC 1 family (het) Greatly reduced levels of mature protein; reduction in bile salt transport 31 14 c.1493TϾC I498T NBF1 PFIC / BRIC 1 family (het) 38 14 c.1530CϾA T510T NBF1 SNP-PBC 0.7% 43 14 c.1535TϾC I512T NBF1 PFIC 1 family (het) 31 14 c.1544AϾC N515T NBF1 PFIC 1 family (het) 31, 32 14 c.1440GϾA R517H NBF1 PFIC 1 family (het) No protein 31, 32 14 c.1605CϾT A535A NBF1 SNP 0.3% Slightly reduced levels mature protein 39, 45 14 c.1621AϾC I541L NBF1 PFIC 3 families (1 het, 2 consanguineous) No protein 31-33 15 c.1643TϾA F548Y Adj ABCm PFIC 1 family (het) 31, 32 15 c.1685GϾA G562D ABCm PFIC 1 family (het) 31 15 c.1708GϾA A570T Adj ABCm/WB PFIC, BRIC PFIC, 1 family Greatly reduced levels of mature protein; reduction in bile salt transport 8, 31 Table 1. Login to comment
93 Differential splice products were seen for six predicted ABCB11 missense mutations, leading to very low levels of wild-type splicing (indicated in parentheses): E297K (c.889GϾA; 50%; Fig. 2B), D482G (c.1445AϾG; 5%; Fig. 2C), R832C (c.2494CϾT; 50%; Fig. 2E), and S1144R (c.3432CϾA; 3%), R1153H (c.3458GϾA; 3%), and S1154P (c.3460TϾC; 3%; Fig. 2F). Login to comment
107 Scanning of exon 14 with the ESS prediction programme FAS-ESS52,53 indicates that the mutant D482G (c.1445AϾG) nucleotide sequence causes the introduction of two additional ESS hexamers, whereas the adjacent V481E (c.1442TϾA) does not. Login to comment
111 Positive-acting and negative-act- Exon 14 D482G Aberrant product Exon 14Minigene Cryptic acceptor splice Exon 14 CTACCACCATTGCAGAAAATATTCGCTATG ATACCATCATCCCAGAAAATATTCGCTATG ATCTCTTTTCACCCAATTTCTACAGGGCAATGCTGGGGCAAGAT Exon 21Exon 20 R832C Aberrant product AAGGCTACGTAAATTTGGTTTCAGGGCAATGCTGGGGCAAGAT AAGGCTATGTAAATTTGGTTTCAGGGCAATGCTGGGGCAAGAT Exon 21 R832C Exon 21 Cryptic acceptor splice Exon 9 E297K Aberrant product CTGCTTTTGGTGGTGAGAAAAGAGAGGTTGAAAGgttggtta Normal donor splice siteCryptic donor splice site CTGCTTTTGGTGGTAAGAAAAGAGAGGTTGAAAGgttggttaE297K Exon 9 CTGCTTTTGGTGCTGTTCCTCCTCCCACTGACCTGCGATT MinigeneExon 9 Intron 9 Intron 9 S1144R, R1153H, S1154P Aberrant product Exon 26 ATACCATCATCCCAGGAACCAGTGTTGTTTGCCT Exon 26Minigene AATTGTTTCCCAGGAACCAGTGTTGTTTGCCTCAG Cryptic acceptor splice D Fig. 3. Login to comment
112 (A-D) Illustration of variant splice forms associated with ABCB11 mutations (A) E297K, (B) D482G, (C) R832C, and (D) S1144R, R1153H, and S1154P. Login to comment
123 No added splicing factor substantially altered the cryptic splicing pattern associated with the D482G (c.1445AϾG) nucleotide substitution (Fig. 4A). Login to comment
155 D482G (c.1445AϾG) showed an improvement on treatment, but mature protein levels were lower than those for wild-type BSEP (Fig. 6D). Login to comment
170 Of the ABCB11 nucleotide changes assayed for pre-mRNA splicing defects, the introduction into exon 14 of the one predicted to generate D482G (c.1445AϾG) resulted in the predominant use of a cryptic splice site within this exon (Figs. Login to comment
172 D482G is one of the most common PFIC missense mutations in European patients, and in vitro studies have differed in their conclusions on Fig. 7. Login to comment
183 Therefore, if such splicing predominates in vivo, D482G-containing BSEP, per se, may only exist at very low levels in hepatocytes. Login to comment
185 Of BSEP deficiency patients who developed malignancy, 16% have the D482G mutation,30,31,35 putatively making it a more severe disease-causing mutation than previously recognized. Login to comment
187 Additionally, D482G-containing mRNA in vivo appears to be unstable, because in a previous small study from our group, liver from a patient heterozygous for D482G yielded no PCR-amplifiable ABCB11 exon 13 to exon 15 (indicating that the second mutation also resulted in deficiency of ABCB11 mRNA).61 The fact that the D482G-associated cryptic splicing could not be modulated by the addition of exogenous SC35 splicing factor (Fig. 4A) may make it more difficult to develop novel treatments to overcome this particular defect. Login to comment
220 A recent study introduced E297G and D482G into human BSEP and assessed their trafficking in MDCK cells.66 The addition of sodium 4-phenylbutyrate prolonged the half-life of both mutant BSEP forms and resulted in increased functional expression of the proteins. Login to comment
221 This concurs with the data presented here, which show reduced levels of mature BSEP when E297G and D482G were expressed in vitro (Fig. 5D). Login to comment
222 Furthermore, the addition of 10% glycerol and incubation at 28°C resulted in a substantial and a marginal increase in mature E297G and D482G protein, respectively (Fig. 6A, D). Login to comment
223 For D482G, we found significant splicing defects (see previous discussion). Login to comment
224 Neither this treatment nor sodium 4-phenylbutyrate could have any clinical effect if normal D482G mRNA processing were almost completely disrupted by aberrant splicing in patients, as suggested by our results in vitro. Login to comment
240 Similarly, nucleotide changes not predicted to cause any abnormalities, such as D482G (c.1445AϾG), did disrupt splicing. Login to comment

PMID: 19133130 [PubMed] Davit-Spraul A et al: "Progressive familial intrahepatic cholestasis."

No. Sentence Comment

88 Missense mutations are also common defects [25] that either affect protein processing and trafficking (i.e. p.E297G, p.D482G) [26,27] or disrupt functional domains and protein structure. Login to comment
180 Preliminary data suggest that PFIC2 patients with p.D482G or p.E297G mutations may respond well to biliary diversion [60]. Login to comment

PMID: 19177487 [PubMed] Mullenbach R et al: "The transporter "variome": the missing link between gene variants and bile salt transporter function."

No. Sentence Comment

24 The results of the present study are consistent with data from recent high-throughput sequencing of transcripts, demonstrating that exon skipping is the most prevalent form of alternative splicing.12 This type of analysis also explains why some transporter variants that may appear to have rather low impact on the protein level, such as p.D482G,13 one of the most common PFIC missense mutations in Europe, give rise to a comparatively severe phenotype: The authors describe how this variant leads to altered pre-mRNA splicing, resulting in an mRNA which, when translated, introduces 14 novel amino acids, followed by a stop codon. Login to comment
25 This represents a much more serious alteration than the replacement of one amino acid, and the severity of the splice-induced abnormality explains the almost complete lack of detectable BSEP protein in immunohistochemical analysis of livers from patients with the p.D482G mutation.13,14 Of note, a patient with obstetric cholestasis carrying this variant also displayed a severe phenotype resolving only in part after delivery.3 Additional weight is added to the results from the splice site analyses by the fact that the development of hepatocellular carcinoma and cholangiocarcinoma is highly associated with splice site changes, deletions, insertions, and nonsense mutations predicted to result in total absence of BSEP protein. Login to comment
36 (4) Generation of a novel splice donor or acceptor site by an exonic variant may create exon skipping or missplicing, thereby creating a premature stop codon (as seen in ABCB11 p.D482G) or generating instable mRNA species. Login to comment

PMID: 19684528 [PubMed] Stieger B et al: "Recent insights into the function and regulation of the bile salt export pump (ABCB11)."

No. Sentence Comment

36 This study [13 ] also revealed that the common E297G and D482G mutant forms of BSEP varied most in their expression level between patients. Login to comment
37 This is of interest, as E297G and D482G have been shown to display residual [14] and normal [15] transport activity, respectively. Login to comment
41 Of note, the mutant D482G, which is common in Europe, displayed enhancement of aberrant splicing. Login to comment
42 This provides a possible explanation for the wide variation of BSEP expression found in patients with D482G mutations leading to clinical phenotypes with variable severity. Login to comment
76 Interestingly, the D482G mutation was found to exhibit decreased transport activity in this study, but after being cloned into mouse Bsep it displayed normal function [48]. Login to comment
81 Interestingly, it was demonstrated that levels of the E297G and the D482G mutants of BSEP could be increased at the plasma membrane, if cells were treated with 4-phenylbutyrate [53 ]. Login to comment

PMID: 19750581 [PubMed] Treepongkaruna S et al: "Novel ABCB11 mutations in a Thai infant with progressive familial intrahepatic cholestasis."

No. Sentence Comment

87 E297G and D482G are the two most common mutations in persons of European descent, and account for approximately 58% of BSEP mutations in European studies[7] . Login to comment

PMID: 19845854 [PubMed] Liu LY et al: "ABCB11 gene mutations in Chinese children with progressive intrahepatic cholestasis and low gamma glutamyltransferase."

No. Sentence Comment

89 Common mutations, such as E297G and D482G detected in western population (23), were not found in Chinese, either from Taiwan (9, 10) or from mainland China. Login to comment

PMID: 20214736 [PubMed] Ananthanarayanan M et al: "PFIC2 and ethnicity-specific bile salt export pump (BSEP, ABCB11) mutations: where do we go from here?"

No. Sentence Comment

29 It is interesting that common ABCB11 mutations found in Western populations such as E297G and D482G were not found in either the current or the Chen study. Login to comment

PMID: 20422495 [PubMed] Lam P et al: "The bile salt export pump: clinical and experimental aspects of genetic and acquired cholestatic liver disease."

No. Sentence Comment

39 Independent and collaborative studies have identified more than 100 different BSEP variants worldwide and the more frequent mutations are grouped as missense, nonsense, deletions and insertions, and splice-site mutations.11,42-47 A common result of these various gene mutations is the reduction or total loss of expression of the BSEP protein on the canalicular membrane.47 In addition, aberrant pre-mRNA splicing and reduced levels of BSEP mRNA can result from BSEP mutations and single nucleotide polymorphisms (SNPs) in the BSEP gene.48,49 Heterogeneity in clinical phenotypes from a single gene mutation (p.D482G) suggests that additional modifiers may influence the severity of the disease phenotype.47 To date, 86 polymorphisms in BSEP have been described in a population of Caucasians, Koreans, and African Americans.50 These polymorphisms are located in exons and introns, as well as in 50 -flanking regions, but no effect on the mRNA or protein has been determined. Login to comment
49 Similar to the results of immunofluorescence studies in liver tissue from PFIC2 patients,47 when PFIC2 human mutations were expressed in model mammalian cell lines (MDCK, HEK293, HepG2), the proteins failed to reach or be maintained at the cell surface.54-57 When BSEP mutations that cause PFIC2 (D482G, E297G), BRIC2 (A590T, R1050C), and ICP (N591S) were compared, the clinical severity of these mutations tended to correlate inversely with the amount of protein expressed on the cell surface. Login to comment
51 For example, the PFIC2 mutant D482G`s protein half-life is short compared with the wild-type and is shortened further after ubiquitylation with E3 ubiquitin ligases.58 However, a small amount of this mutant protein can reach the plasma membrane where it is functional.58 Additional studies have shown that the resident time on the cell surface is greatly reduced with D482G and E297G mutant proteins as a result of accelerated internalization, reduced recycling, and/or targeting of endocytosed proteins for degradation.57,59 These studies suggest that the use of small molecules that modulate these pathways might be worthwhile therapeutic approaches in some of these cholestatic disorders. Login to comment
52 For example, 4-phenylbutyrate (4-PBA) can enhance cell surface expression of D482G and E297G proteins.60 Furthermore, administration of 4-PBA to normal rats enhances BSEP expression and bile salt secretion.60 Further studies are clearly needed in this area. Login to comment
77 Ubiquitylation is involved in the degradation of receptors, channels, and transporters from the endoplasmic reticulum and cell surface of yeast and higher eukaryotes.86-88 Wang et al, showed for the first time that specific E3 ubiquitin ligases are involved in Bsep degradation.58 Bsep mutants (p.G238V, p.D482G, p.G982R, p.R1153C, and p.R1268Q) were highly ubiquitinated following overexpression of different E3 ubiquitin ligases and were rapidly degraded by proteasomes resulting in shorter half-lives compared with the wild-type protein.58 This study suggests that stabilizing aberrant BSEP proteins by inactivating key E3 ubiquitin ligases might be a novel therapeutic approach, providing that global effects on proteasomal degradation can be avoided. Login to comment

PMID: 20422497 [PubMed] Pauli-Magnus C et al: "Genetic determinants of drug-induced cholestasis and intrahepatic cholestasis of pregnancy."

No. Sentence Comment

79 In the same study, heterozygosity for the BSEP mutations p.E297G, p.D482G, and p.N591S formerly associated with benign and progressive forms of familial intrahepatic cholestasis type 2 were found in four, one, and two ICP patients, respectively, allowing the extrapolation that 1% of European ICP cases are caused by these mutations.105 Although the molecular and mechanistic basis for p.V444A and p.N591S were not apparent, in silico structural and functional analysis suggests that p.E297G and p.D482G destabilizes the protein fold of BSEP, leading to decreased taurocholate transport in case of p.E297G.105,106 In addition, decreased hepatic BSEP expression,107,108 and very recently, significantly reduced hepatic mRNA levels109 was reported in healthy human liver tissue carrying the alanine allele in position 444 of BSEP, which could predispose to the development of ICP by way of decreased canalicular availability of BSEP. Login to comment

PMID: 20425482 [PubMed] Santos JL et al: "Cholestatic liver disease in children."

No. Sentence Comment

67 Interestingly, 93% of the mutations produced abnormal or absent BSEP expression on liver biopsies; immunostaining identified a variable pattern of BSEP expression in patients carrying the most common E297G or D482G mutations, thus limiting the use of immunohistochemistry to reliably pinpoint BSEP deficiency. Login to comment

PMID: 21103971 [PubMed] Stieger B et al: "The role of the sodium-taurocholate cotransporting polypeptide (NTCP) and of the bile salt export pump (BSEP) in physiology and pathophysiology of bile formation."

No. Sentence Comment

411 Another interesting finding of this study (Strautnieks et al. 2008) is the observation that the two common E297G and D482G mutants of BSEP varied most in their expression level among the respective carriers. Login to comment
412 This is notable, as E297G and D482G variants have been demonstrated to display residual (Noe et al. 2005) or normal (Hayashi et al. 2005a) transport activity, respectively. Login to comment
418 Importantly and interestingly, the common European mutant D482G shows an enhanced aberrant splicing. Login to comment
419 This finding could provide a possible explanation for the wide variation of BSEP expression observed in patients with D482G mutations consequently leading to clinical phenotypes with variable severity. Login to comment
472 Interestingly, the D482G mutation reduced transport activity for human BSEP but had no apparent effect on transport when introduced into mouse Bsep (Plass et al. 2004). Login to comment
486 (2008a) D482GReducedsurface expression na G982RNosurfaceexpressionnana R1153CNosurfaceexpressionnana R1286QNosurfaceexpressionnana E297GBSEPMDCKFasterturnoverof ubiquitinatedBSEP fromapical membrane Increased ubiquitination Hayashiand Sugiyama (2009) D482G AdditionalinformationonexpressionofBSEPmutantsisfoundinByrneetal. Login to comment
488 (2008) nanotassessed Of note, it was recently demonstrated that levels of the E297G and the D482G mutants of BSEP could be increased at the apical membrane of MDCK cells, if the cells were treated with 4-phenylbutyrate (Hayashi and Sugiyama 2007) or with short-and medium-chain fatty acids (Kato et al. 2010). Login to comment

PMID: 21219577 [PubMed] Shimizu H et al: "Living-related liver transplantation for siblings with progressive familial intrahepatic cholestasis 2, with novel genetic findings."

No. Sentence Comment

104 The common mutations include E297G, R575X, R1057X, G982R, C336S, R1153C, D482G, K461E, R1153C, R1268Q, R1090X, G238V, S114R, S593R, del 695 and del 3213 (22). Login to comment

PMID: 21344347 [PubMed] Morotti RA et al: "Progressive familial intrahepatic cholestasis (PFIC) type 1, 2, and 3: a review of the liver pathology findings."

No. Sentence Comment

42 elevated Normal Bile acid High High High Lipoprotein X Present Present Absent Albumin Low Usually normal Normal Biochemical tests, bile: Bile acid Low Low Normal Phospholipid Normal Normal Low *Patients with the D482G-BSEP mutation tend to survive to an older age without cirrhosis. Login to comment
92 In a recent study, BSEP deficiency patients with the common European D482G mutation were reported to show giant cell hepatitis less frequently than patients with other mutations.11 Cholestasis is hepatocellular, frequently within ballooned hepatocytes, and canalicular. Login to comment
105 A recent study indicated that BSEP-deficiency patients with the D482G mutation survived to an older age, with slower progression of their disease.11 Therefore, presence of fibrosis/cirrhosis in earlier liver biopsies may be indicative of a more aggressive genotype (other than the D482G mutation). Login to comment
108 As reported by Strautnieks et al, canalicular BSEP is not detectable by IHC in cases with protein-truncating mutations.12 With other mutations, such as single copy of the E297G and D482G, the BSEP expression varies from absent to abnormal to present/ normal. Login to comment

PMID: 9806540 [PubMed] Strautnieks SS et al: "A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis."

No. Sentence Comment

111 One Polish family and one Austrian family carry 1445 A→G (D482G), which causes substitution of a glycine for an aspartate. Login to comment
142 The ABC transporter family of proteins is the largest so far iden- Table 1• BSEP mutations found in PFIC patients Nucleotide mutation Amino acid number/ Protein consequence Families mutation 1723 C→T R575X Termination codon in first B2 heterozygous nucleotide binding fold Q homozygous 3169 C→T R1057X Termination codon in second B5 heterozygous nucleotide binding fold 908 del G 303 17 novel amino acids then truncation Family 57 heterozygous 3767-3768 ins C 1256 39 novel amino acids then truncation Family 99 homozygous 890 A→G E297G Glutamate to glycine in the intracellular loop S1, S3, S4B, S5, S6, S7, 38 homozygous between transmembrane spans 4 and 5 S4A, B5, B6, B7, 53, L heterozygous 1381 A→G K461E Lysine to glutamate in first Walker A motif Family 55 homozygous 1445 A→G D482G Aspartate to glycine in first P and 52 homozygous nucleotide binding fold 2944 G→A G982R Glycine to arginine in transmembrane span 11 Family 18 homozygous 3457 C→T R1153C Arginine to cysteine in second C and D homozygous nucleotide binding fold 3803 G→A R1268Q Arginine to glutamine in second J homozygous nucleotide binding fold In each case the nucleotide position in the human coding sequence is given along with details of the predicted protein consequence. Login to comment
162 Although no ancestral link can be established, 1445 A→G (D482G) has been found in both a Polish family and an Austrian family. Login to comment
236 The endonucleases used were: HphI (E297G), BpmI (K461E), FokI (D482G), AlwNI (G982R), BsrBI (R1153C) and AvaII (R1268Q). Login to comment

PMID: 21571517 [PubMed] Okiyoneda T et al: "Protein quality control at the plasma membrane."

No. Sentence Comment

31 Structural destabilization of the Pma1 and Gap1 transmembrane domains in strains defective of sphingoid base synthesis could be mechanistically similar to the farnesol-induced 484 Membranes and organelles Table 1 Peripheral protein QC substrates Membrane protein Mutation/condition Degron PM stability Related disease Reference Mammalian bile salt export pump (BSEP) E297G (Cy) D482G (Cy) 2-3 Ub # progressive familial intrahepatic cholestasis type 2 (PFIC2) [36] CFTR rDF508 (Cy) poly/multimono Ub # cystic fibrosis (CF) [44 ,27 ] D70 (Cy truncation) poly/multimono Ub # [27 ] N894D, N900D (Ex) poly/multimono Ub # [22] Na/H exchanger (NHE6) D255-256 (TM) poly/multimono Ub # Angelman syndrome [35] MLC1 multiple (TM or Cy) ND # megalencephalic leukoencephalopathy with subcortical cysts (MLC) [66] HERG low K+ Ub # type 2 long QT syndrome [37] LDL receptor high salt or low pH (Ex) ND # hypercholesterolemia [16] Dopamine D4.4 receptor M345T (TM) poly/multimono Ub # attention deficit hyperactivity disorder [28 ] Vasopressin V2 receptor W164S (TM) poly/multimono Ub # nephrogenic diabetes insipidus [28 ] alpha-2A adrenergic receptor D79N (TM) ND # cardiovascular diseases [14] N422D (TM) ND # [14] Di3loop (Cy) ND # [69] CD4tl-lm L57C (Cy) poly/multimono Ub # model protein [28 ] H+ /K+ -ATPase b subunit N99Q, N130Q, N161Q, N222Q (Ex) ND # gastric, autoimmune diseases [18] k opioid receptor N25/39Q (Ex) ND # pain control, neuronal phenotypes [19] D opioid receptor N18Q/N33Q (Ex) ND # pain control, neuronal phenotypes [20] GLUT1 N45Y, Q or D (ex) ND # GLUT1 deficiency syndrome [70] EGFR L858R (Cy), exon 19 deletion (Cy) poly/multimono Ub # cancer suspectibility [71] ErbB2 Hsp90 inhibition poly/multimono Ub # breast cancer [72] TGFBR2 Hsp90 inhibition poly/multimono Ub # tumor suspectibility [73] Yeast Pma1 Icb1-100 poly/multimono Ub # NA [29] Pma1-7 poly/multimono Ub # NA [7] Pma1-10 poly/multimono Ub # NA [52] Gap1 absence of sphingolipids poly/multimono Ub # NA [9] Abbreviations: Cy, cytosolic; Ex, extracellular; TM, transmembrane; Ub, ubiquitin; ND, not determined; #, decreasing stability; CFTR, cystic fibrosis transmembrane conductance regulator; HERG, human ether-a` -go-go related gene; LDL, low-density lipoprotein; GLUT, glucose transporter; EGFR, epidermal growth factor receptor; ErbbB2, v-erb-b2 erythroblastic leukemia viral oncogene homolog 2; TGFBR2, transforming growth factor (TGF)- beta type II; Pma1, H(+)-ATPase; Gap1, general amino acid permease. Login to comment

PMID: 20103563 [PubMed] Klaassen CD et al: "Xenobiotic, bile acid, and cholesterol transporters: function and regulation."

No. Sentence Comment

6508 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/ Localization ABCB11 BSEP N.D. G238V N.D. Intracellular A890G E297G 2 Intracellular N.D. C336S ↔ Normal G1296C R432T 2 Reduced T1331C V444A ↔ Normal/Reduced A1445G D482G 2 Normal/Reduced G2026T D676Y 2 Reduced G2563A G855R 2 Reduced G2944A G982R 2 Intracellular C3457T R1153C 2 Intracellular G3803A R1268Q 2 Intracellular searchers were able to identify functional roles for Mrp2 using rats lacking this transporter (Eisai hyperbilirubinemic rats on a Sprague-Dawley background and transport-deficient (TR-) on a Wistar background) (Paulusma et al., 1996; Ito et al., 1997). Login to comment

PMID: 22947535 [PubMed] Krawczyk M et al: "Prolonged cholestasis triggered by hepatitis A virus infection and variants of the hepatocanalicular phospholipid and bile salt transporters."

No. Sentence Comment

58 To detect genetic factors contributing to severe phenotype, we genotyped procholestatic mutations and polymorphisms in the ABCB4 (p.R590Q, c.711A>T), ABCB11 (p.E297G, p.A444V, p.D482G, c.3084A>G), ATP8B1 (p.N45T, p.E429A, p.I661T) and FXR (c.-1 G>T) genes. The genotyping was performed using PCR-based assays with 5`-nuclease and fluorescence detection (TaqMan). Login to comment
57 To detect genetic factors contributing to severe phenotype, we genotyped procholestatic mutations and polymorphisms in the ABCB4 (p.R590Q, c.711A>T), ABCB11 (p.E297G, p.A444V, p.D482G, c.3084A>G), ATP8B1 (p.N45T, p.E429A, p.I661T) and FXR (c.-1 G>T) genes. The genotyping was performed using PCR-based assays with 5`-nuclease and fluorescence detection (TaqMan). Login to comment

PMID: 22609295 [PubMed] Jankowska I et al: "Progressive familial intrahepatic cholestasis and inborn errors of bile acid synthesis."

No. Sentence Comment

42 Among PFIC2 patients, the course of disease is slower in patients bearing the D482G mutation [2]. Login to comment

PMID: 20955958 [PubMed] van der Woerd WL et al: "Familial cholestasis: progressive familial intrahepatic cholestasis, benign recurrent intrahepatic cholestasis and intrahepatic cholestasis of pregnancy."

No. Sentence Comment

67 In more than half of the European families the missense mutations E297G and/or D482G are present. Login to comment
69 Generally missense mutations, e.g. E297G or D482G, lead to a less severe phenotype than mutations that are predicted to result in premature protein truncation or total failure of protein production [6,23,29]. Login to comment
135 The type of mutation seems to be associated with the outcome of PEBD, with better prognosis in disease caused by milder mutations, especially for the ABCB11 mutations E297G and D482G [3,23]. Login to comment

PMID: 20034695 [PubMed] Stapelbroek JM et al: "Liver disease associated with canalicular transport defects: current and future therapies."

No. Sentence Comment

287 4-PBA has been tested in vitro for the E297G and D482G mutations frequently found inABCB11deficiency.Treatmentreducedtheproteinubiquitination and increased the cell surface expression of mature ABCB11 [200- 202]. Login to comment
286 4-PBA has been tested in vitro for the E297G and D482G mutations frequently found inABCB11deficiency.Treatmentreducedtheproteinubiquitination and increased the cell surface expression of mature ABCB11 [200-202]. Login to comment
285 4-PBA has been tested in vitro for the E297G and D482G mutations frequently found inABCB11deficiency.Treatmentreducedtheproteinubiquitination and increased the cell surface expression of mature ABCB11 [200- 202]. Login to comment

PMID: 19674157 [PubMed] Ikebuchi Y et al: "Receptor for activated C-kinase 1 regulates the cellular localization and function of ABCB4."

No. Sentence Comment

13 For example, we have found that E297G and D482G mutations in ABCB11, which are frequently found in PFIC2 patients, are associated with the retention of these mutated transporters in the endoplasmic reticulum (ER), although their transport function itself remains normal;20 indeed, following treatment with sodium 4-phenylbutyrate, E297G and D482G mutants appeared on the plasma membrane and were able to excrete substrate bile salts in Madin-Darby canine kidney (MDCK) II cells.21 In addition, insertion of several kinds of mutations in the ABCG5 or ABCG8 gene, which is found in sitosterolemia patients, results in the ER localization of this heterodimer.22 Furthermore, it has been demonstrated that localization of ABCB4 on the bile canalicular membrane is less marked in patients with one of the PFIC3 mutations.15 Concerning the pathogenesis of PFIC3, Dixon et al. tried to examine the localization and function of PFIC3 mutant in HEK293T cells;23 due to the difficulties in establishing a functional assay system of ABCB4 in mammalian cells, they introduced the PFIC3 mutation to the equivalent site of MDR1/ABCB1 to examine the function and localization of the mutated protein.23,24 From this perspective, it is important to identify the mechanism for the cellular localization of membrane transporters. Login to comment

PMID: 16180115 [PubMed] Ito K et al: "Apical/basolateral surface expression of drug transporters and its role in vectorial drug transport."

No. Sentence Comment

240 Seven amino acid substitutions in BSEP, linked to PFICII (G238V, E297G, C336S, D482G, G982R, R1153C, R1268Q), have been reported and have been examined using rat Bsep expressed in MDCK (128). Login to comment
244 Recently, the intracellular sorting and transport function of the D482G mutant was further examined in detail using mouse Bsep expressed in HepG2 cells and Sf21 insect cells (129). Login to comment
245 A considerable amount of D482G mutant mBsep protein was still detected in the cytoplasm as well as the bile canalicular space. Login to comment
253 D482G mutant without loss of transport function. Login to comment
254 D482G expressed in the nonpolarized Sf21 insect cell membrane was functionally active. Login to comment
255 Moreover, culturing the D482G expressing HepG2 cells at a lower temperature (30-C) resulted in increased expression of the fully glycosylated form of mouse Bsep (12.6-fold) compared with that at 37-C. Login to comment

PMID: 18698235 [PubMed] Kobayashi K et al: "Functional analysis of nonsynonymous single nucleotide polymorphism type ATP-binding cassette transmembrane transporter subfamily C member 3."

No. Sentence Comment

169 830 and D482G, both of which are frequently found in progressive familial intrahepatic cholestasis type 2 patients [39,40]. Login to comment

PMID: 21766090 [PubMed] Beausejour Y et al: "Description of two new ABCB11 mutations responsible for type 2 benign recurrent intrahepatic cholestasis in a French-Canadian family."

No. Sentence Comment

87 Among the two most common mutations in individuals of European descent are the E297G and D482G mutations, which collectively account for approximately 58% of all cases (9). Login to comment
86 Among the two most common mutations in individuals of European descent are the E297G and D482G mutations, which collectively account for approximately 58% of all cases (9). Login to comment

PMID: 23022423 [PubMed] Anzivino C et al: "ABCB4 and ABCB11 mutations in intrahepatic cholestasis of pregnancy in an Italian population."

No. Sentence Comment

92 Variants p.E135K, p.D482G and p.R698H were reported in previous studies [12,25-28]. Login to comment
101 Nucleotide change and effect on protein Location PSIC scores by PolyPhen-2 analysis Reference 1 c.217 C > G (p. L73V) Exon 4 0.489 [12] 2 c.523 A > G (p.T175A) Exon 6 0.774 [12] 3 c.1529 A > G (p.N510S) Exon 13 2.075 [24] 4 c.1758 1759 ins G (p.I587DfsX603) Exon 15 X This study 5 c.2211(+1) G > T (p.I738LfsX744) 5 Intron 17 X This study ABCB11 mutations 6 c.403 G > A (p.E135K) Exon 6 0.502 [26] 7 c.852 T > A (p.V284D) Exon 9 2.175 This study 8 c.1445 A > G (p.D482G) Exon 14 1.364 [26-28] 9 c.1674 G > C (p.Q558H) Exon 15 1.383 This study 10 c.2093 G > A (p.R698H) Exon 18 0.821 [12,25] 11 c.2191 C > T (p. P731S) Exon 19 0.851 This study New mutations are shown in bold. Login to comment
110 The already described mutations p.E135K and p.D482G are associated with two similar phenotypes (Table 4), except for the higher levels of serum bile acids in the patient carrying the p.E135K variant. Login to comment
129 Table 4 Clinical details of patients with ABCB11 mutations. Parameters Patient 6 E135K Patient7 V284D Patient 8 D482G Patient 9 Q558H Patient 10 R698H Patient 11 P731S Onset of pruritus 3rd trimester 2nd trimester 3rd trimester 2nd trimester 2nd trimester 3rd trimester Parity 2 1 2 2 2 2 Previous ICP Yes Yes Yes No Yes Yes Peak of AST (U/L) 24 92 29 125 244 105 Peak of ALT (U/L) 26 215 37 315 514 198 Peak of Bilirubin (mg/dL) 0.53 0.49 Nd 0.36 0.3 0.46 Peak of GGT (U/L) 7 25 Nd 23 14 16 Total bile acids (òe;mol/L) 93.6 112.4 28 Nd 20.4 23.4 Delivery Induction of labour (36w+4 )a Caesarean section (38w)a Induction of labour (38w+4 )a Caesarean section (36w)a Caesarean section (38w)a Induction of labour (38w) Cholelithiasis No No No No No No UDCA therapy Yes Yes No Yes Yes Yes AST: aspartate aminotransferase; ALT: alanine aminotransferase; GGT: ॹ-glutamyl transpeptidase; Nd: not determined. a Caesarean section or induction of labour due to pregnancy complications related to ICP (foetal distress and/or intolerable pruritus and/or persistent elevation of AST and ALT). Login to comment
93 Variants p.E135K, p.D482G and p.R698H were reported in previous studies [12,25-28]. Login to comment
102 Nucleotide change and effect on protein Location PSIC scores by PolyPhen-2 analysis Reference 1 c.217 C > G (p. L73V) Exon 4 0.489 [12] 2 c.523 A > G (p.T175A) Exon 6 0.774 [12] 3 c.1529 A > G (p.N510S) Exon 13 2.075 [24] 4 c.1758 1759 ins G (p.I587DfsX603) Exon 15 X This study 5 c.2211(+1) G > T (p.I738LfsX744) 5 Intron 17 X This study ABCB11 mutations 6 c.403 G > A (p.E135K) Exon 6 0.502 [26] 7 c.852 T > A (p.V284D) Exon 9 2.175 This study 8 c.1445 A > G (p.D482G) Exon 14 1.364 [26-28] 9 c.1674 G > C (p.Q558H) Exon 15 1.383 This study 10 c.2093 G > A (p.R698H) Exon 18 0.821 [12,25] 11 c.2191 C > T (p. P731S) Exon 19 0.851 This study New mutations are shown in bold. Login to comment
111 The already described mutations p.E135K and p.D482G are associated with two similar phenotypes (Table 4), except for the higher levels of serum bile acids in the patient carrying the p.E135K variant. Login to comment
130 Table 4 Clinical details of patients with ABCB11 mutations. Parameters Patient 6 E135K Patient7 V284D Patient 8 D482G Patient 9 Q558H Patient 10 R698H Patient 11 P731S Onset of pruritus 3rd trimester 2nd trimester 3rd trimester 2nd trimester 2nd trimester 3rd trimester Parity 2 1 2 2 2 2 Previous ICP Yes Yes Yes No Yes Yes Peak of AST (U/L) 24 92 29 125 244 105 Peak of ALT (U/L) 26 215 37 315 514 198 Peak of Bilirubin (mg/dL) 0.53 0.49 Nd 0.36 0.3 0.46 Peak of GGT (U/L) 7 25 Nd 23 14 16 Total bile acids (òe;mol/L) 93.6 112.4 28 Nd 20.4 23.4 Delivery Induction of labour (36w+4 )a Caesarean section (38w)a Induction of labour (38w+4 )a Caesarean section (36w)a Caesarean section (38w)a Induction of labour (38w) Cholelithiasis No No No No No No UDCA therapy Yes Yes No Yes Yes Yes AST: aspartate aminotransferase; ALT: alanine aminotransferase; GGT: ॹ-glutamyl transpeptidase; Nd: not determined. a Caesarean section or induction of labour due to pregnancy complications related to ICP (foetal distress and/or intolerable pruritus and/or persistent elevation of AST and ALT). Login to comment

PMID: 23141890 [PubMed] Jacquemin E et al: "Progressive familial intrahepatic cholestasis."

No. Sentence Comment

151 Preliminary data suggest that PFIC2 patients with p.D482G or p.E297G mutations may respond well to biliary diversion. Login to comment

PMID: 14672610 [PubMed] Plass JR et al: "A progressive familial intrahepatic cholestasis type 2 mutation causes an unstable, temperature-sensitive bile salt export pump."

No. Sentence Comment

3 In this study, we analysed the effect of the D482G PFIC-2 mutation on BSEP function. Login to comment
4 Methods: Adenosine triphosphatase (ATPase) and taurocholate transport assays were performed with full-length mouse Bsep (mBsep) with and without the D482G mutation. Login to comment
6 Results: The D482G mutation did not significantly affect the taurocholate transport activity of mBsep, even though the bile salt-inducible ATPase activity of the mutant protein was slightly reduced. Login to comment
7 Protein expression and canalicular sorting were strongly affected by the D482G mutation. Login to comment
10 Conclusions: These data suggest that PFIC-2 patients with the D482G mutation express a functional, but highly unstable, temperature-sensitive bile salt export pump. Login to comment
24 Abbreviations: ABC, ATP-binding cassette; ATPase, adenosine triphosphatase; BCV, bile canalicular-like vacuole; BSEP, human bile salt export pump; mBsep, mouse bile salt export pump; D482G, aspartate- to-glycine mutation at position 482 in BSEP/Bsep; EGFP, enhanced green fluorescent protein; NBD, nucleotide binding domain; PCR, polymerase chain reaction; PFIC, progressive familial intrahepatic cholestasis; PNGase F, peptide N-glycosidase F; SDS-PAGE, sodium dodecyl sulphate polyacrylamide gel electrophoresis; TCA, taurocholate. Login to comment
40 We investigated the effects of the PFIC-2 related missense mutation D482G, an aspartate to glycine change at position 482 [10], occurring in the first nucleotide-binding domain of BSEP, on the adenosine triphosphatase (ATPase) activity, transport activity, sorting, and expression of the protein. Login to comment
42 In fact, the D482G mutation causes a temperature-sensitive reduction of BSEP protein expression, probably caused by reduced protein stability. Login to comment
48 HepG2 cells were stably transfected with pEGFP-C1-mBsep[WT] or pEGFP-C1-mBsep[D482G] using the calcium phosphate precipitation method [12] and geneticin-resistant clones were selected. Login to comment
55 Site-directed mutagenesis was performed using the QuickChange Site-Directed Mutagenesis Kit (Stratagene, La Jolla, CA) to introduce the D482G mutation in pFASTBAC1-mBsep and pEGFP-C1-mBsep (primers used: mD482Gsense/antisense). Login to comment
87 The D482G mutation is present in the first nucleotide-binding domain of BSEP, which is highly conserved between species (Fig. 1). Login to comment
90 The mBsep[D482G] protein is still functional as a bile salt transporter Wild type and D482G mutant mBsep were expressed at comparable levels in Sf21 insect cells (Fig. 2A, insert). Login to comment
94 Similar results were obtained with membrane fractions containing mBsep[D482G] (black bars). Login to comment
96 This shows that the ATPase activity of both WT and D482G mBsep are stimulated by the substrates of the transporter. Login to comment
97 The bile salt transport activity of the wild type and mutant mBsep is shown in Fig. 2B. Both mBsep[WT] - and mBsep[D482G] -vesicles show similar TCA uptake rates (32.7 ^ 1.5 versus 30.5 ^ 3.3 pmol TCA&#b7;min21 &#b7;mg21 protein). Login to comment
99 The EGFP-mBsep[D482G] is inefficiently targeted to the canalicular membrane in HepG2 cells To study the protein stability and subcellular sorting of wild type and mutant mBsep, we generated stable HepG2 cell lines that express these proteins, N-terminally tagged to the EGFP. Login to comment
111 The EGFP-mBsep[D482G] mutant protein was detected in the BCV`s but, in addition, a considerable amount of protein was retained in the cytoplasm (Figs. 3D-F). Login to comment
113 The D482G mutation results in unstable and immature mBsep protein Next, we analyzed the correlation between the mRNA and protein level of cells stably expressing EGFP-mBsep[WT] and EGFP-mBsep[D482G] . Login to comment
115 However, the EGFP-mBsep[D482G] signal at this position is hardly detectable (Fig. 4, lane 1). Login to comment
119 PNGase F-treatment of EGFP-mBsep[D482G] resulted in the disappearance of the minor 190 kDa band. Login to comment
121 This shows that the 160 kDa EGFP-mBsep[D482G] protein band is full-length, but improperly glycosylated protein. Login to comment
122 Moreover, the specific amount of EGFP-mBsep[D482G] protein appeared lower than the EGFP-mBsep[WT] protein. Login to comment
123 Therefore, we determined the specific mRNA levels of EGFP-mBsep[WT] and EGFP-mBsep[D482G] in the corresponding cell lines. Login to comment
124 In contrast to the difference in protein level, the relative amount of EGFP-mBsep[D482G] was 4.5-fold higher compared to the EGFP-mBsep[WT] mRNA level (Fig. 5A). Login to comment
125 These data show that high mRNA levels for EGFP-mBsep[D482G] do not give rise to similarly high protein levels, relative to the results obtained for EGFP-mBsep[WT] . Login to comment
129 Therefore, we cultured both the EGFP-mBsep[WT] and EGFP-mBsep[D482G] HepG2 cells at 308C and determined the specific mRNA and protein levels. Login to comment
130 Surprisingly, we found that the relative mRNA levels for both EGFP-mBsep[WT] and EGFP-mBsep[D482G] increased approximately 12-fold in cells grown at 308C compared to cells grown at 378C (Fig. 5A). Login to comment
131 However, the 4.5-fold difference between EGFP-mBsep[D482G] and EGFP-mBsep[WT] remained despite the overall higher mRNA levels. Login to comment
132 In cells grown at 308C, the protein level of both EGFP-mBsep[WT] and EGFP-mBsep[D482G] increased significantly when compared to cells at 378C (Fig. 5B). Login to comment
133 However, the EGFP-mBsep[D482G] showed a much stronger increase in protein level than the EGFP-mBsep[WT] . Login to comment
134 Moreover, at 308C the EGFP-mBsep[D482G] appeared predominantly in fully glycosylated form. Login to comment
135 Under these conditions, the EGFP-mBsep[D482G] protein level was approximately 5-fold higher than EGFP-mBsep[WT] as determined by densitometry. Login to comment
137 Confocal laser scanning microscopy revealed that at 308C, the EGFP-mBsep[D482G] protein was efficiently targeted to the BCV`s (Figs. 3G-I). Login to comment
139 The D482G mutation does not block the ATPase and transport activity of mBsep. Login to comment
140 (A) Membrane vesicles containing comparable levels of wild type or D482G mutant mBsep (insert) are subjected to an ATPase assay in the absence or presence of 30 mM TCA and 200 mM orthovanadate as described in Section 2. Login to comment
148 Discussion In this study, we analysed the effect of the PFIC-2 mutation, D482G, on Bsep function and intracellular expression. Login to comment
151 The D482G-mutant Bsep protein appears to be temperature-sensitive. Login to comment
152 At 308C, high levels of normally glycosylated, and correctly sorted Bsep[D482G] were detected. Login to comment
156 Efficient sorting of the D482G mutant mBsep in HepG2 cells is temperature-sensitive. Login to comment
158 At 378C, both EGFP-tagged wild type (A, C) and D482G mutant (D, F) mBsep sort to the BCV. Login to comment
159 However, significant amounts of the D482G mutant mBsep are detected intracellular (D, F). Login to comment
162 When cells were grown at 308C, the D482G mutant mBsep was solely observed in the BCV`s. Login to comment
167 The D482G mutation leads to low levels and incompletely glycosylated mBsep protein. Login to comment
168 Western blot analysis using a GFP antibody of approximately160 mg of total protein extracts from EGFP-mBsep[D482G] HepG2 cells (lane 1), and EGFP-mBsep[WT] cells (lanes 2 and 3). Login to comment
170 Since the D482G mutation is present in the first NBD of BSEP, we first tested its effect on the ATPase activity. Login to comment
173 The ATPase activity of the mBsep[D482G] -protein was also induced by TCA, be it to a lower level than the WT protein. Login to comment
175 Taken together, these results show that the mBsep[D482G] is a functional bile salt transporter with biochemical characteristics comparable to the wild type protein. Login to comment
176 To study the effect of the D482G mutation on intracellular sorting and protein stability, we constructed stable HepG2 cell lines, expressing mBsep[WT] or mBsep[D482G] N-terminally tagged with EGFP. Login to comment
177 Detectable amounts of EGFP-mBsep[D482G] protein were only observed in clones with significantly (5-fold) higher mRNA levels as compared to EGFP-mBsep[WT] . Login to comment
179 This was confirmed by confocal laser scanning microscopy analyses, in which significant amounts of the EGFP-mBsep[D482G] protein were detected in a fine reticulum-like pattern in the cytoplasm. Login to comment
181 Collectively, our findings suggest that the D482G mutation results in low BSEP protein levels and that the mutant protein is improperly glycosylated and targeted at physiological conditions. Login to comment
186 Therefore, we cultured our stable cell lines at reduced (308C) temperatures and found that the mRNA level for both EGFP-mBsep[WT] and EGFP-mBsep[D482G] increased approximately 12-fold compared to the level in cells grown at 378C. Login to comment
192 At 308C, both the mRNA and protein level of EGFP-mBsep[D482G] were approximately 5-fold higher than those for EGFP-mBsep[WT] mRNA level. Login to comment
196 They found that the D482G mutation reduced the taurocholate transport activity of rat Bsep by approximately 50% and GFP-tagged rBsep[D482G] was found at the apical membrane and in the cytoplasm of Madin-Darby canine kidney (MDCK) cells. Login to comment
197 The correlation between GFP- rBsep[D482G] mRNA and protein levels was not determined in detail. Login to comment
198 Our results show little or no effect of the D482G mutation on the BSEP transport function, but a very strong effect on protein stability, maturation and/or turnover. Login to comment
202 The deleterious effect of the D482G mutation could Fig. 5. Login to comment
206 (B) Total protein lysates from HepG2 cells expressing the wild type or D482G mutant mBsep were isolated. Login to comment
213 In conclusion, our data show that PFIC-2 patients with the D482G mutation express a functional, but highly unstable bile salt export pump. Login to comment

PMID: 16039748 [PubMed] Noe J et al: "Impaired expression and function of the bile salt export pump due to three novel ABCB11 mutations in intrahepatic cholestasis."

No. Sentence Comment

29 However, the D482G mutation, which was found to exhibit decreased function by Wang, showed preserved transport activity when cloned into mouse Abcb11, indicating the possible impact of species differences on protein function [13]. Login to comment

PMID: 18395098 [PubMed] Strautnieks SS et al: "Severe bile salt export pump deficiency: 82 different ABCB11 mutations in 109 families."

No. Sentence Comment

7 Thirty-two percent of mutations occurred in >1 family, with E297G and/or D482G present in 58% of European families (52/89). Login to comment
9 Expression varied most for E297G and D482G, with some BSEP detected in 45% of patients (19/42) with these mutations. Login to comment
77 The common mutations E297G, D482G, R575X, R1153C, and R1153H abolish HphI, FokI, FokI, BsrBI, and BsrBI sites, respectively, while G982R creates an AlwNI site. Login to comment
98 Most frequent were E297G and D482G, one or both of which were present in 58% of European families (52/89) and 15% of non-European families (3/20). Login to comment
100 D482G occurred in 20 European families (25 alleles) and on one allele in a Central Asian/Arab family. Login to comment
112 In 23 families homozygosity was associated with known consanguinity, while in 9 families, 2 copies of either E297G or D482G were found. Login to comment
113 To assess effects of specific ABCB11 genotypes on expression of immunohistochemically detectable BSEP protein, families were grouped according to whether they carried 2 likely protein-truncating mutations, at least one missense mutation (E297G or D482G excluded), at least one copy of E297G, at least one copy of D482G, or only one identified mutation (Supplementary Tables 1A-E). Login to comment
116 Variability in BSEP expression was greatest when either of the 2 common European mutations, E297G or D482G, was present on one or both alleles (Supplementary Tables 1C-E). Login to comment
118 For 14 patients with at least one copy of D482G, BSEP staining was not detected in 8 (57%), was abnormal in 3 (21%), and was normal in 3 (21%). Login to comment
150 Missense Mutations in ABCB11 Nucleotide change Predicted effect Exon CpG site Location Change in: Size Charge Hyd/Pol Shape c.149Tb0e;C p.Leu50Ser 4 No NH2 term Y Y Y c.470Ab0e;G p.Tyr157Cys 6 No TM2 Y Y Y c.725Cb0e;T p.Thr242Ile 8 No TM4 Y Y c.890Ab0e;G p.Glu297Gly 9 No IC2 Y Y Y c.908Gb0e;A p.Arg303Lys 9 No IC2 c.937Cb0e;A p.Arg313Ser 10 Yes IC2 Y Y Y Y c.980Gb0e;A p.Gly327Glu 10 No TM5 Y Y Y c.1168Gb0e;C p.Ala390Pro 11 No TM/NBF Y c.1229Gb0e;A p.Gly410Asp 12 No TM/NBF Y Y c.1238Tb0e;G p.Leu413Trp 12 No TM/NBF c.1388Cb0e;T p.Thr463Ile 13 No Adj Walker A Y Y Y c.1396Cb0e;A p.Gln466Lys 13 No Adj Walker A Y c.1409Gb0e;A p.Arg470Gln 13 Yes Adj Walker A Y c.1415Ab0e;G p.Tyr472Cys 13 No Adj Walker A Y Y Y c.1442Tb0e;A p.Val481Glu 14 No NBF1 Y Y Y c.1445Ab0e;G p.Asp482Gly 14 No NBF1 Y Y c.1460Gb0e;C p.Arg487Pro 14 Yes NBF1 Y Y Y Y c.1468Ab0e;G p.Asn490Asp 14 No NBF1 Y c.1535Tb0e;C p.Ile512Thr 14 No NBF1 Y Y Y c.1544Ab0e;C p.Asn515Thr 14 No NBF1 Y Y c.1550Gb0e;A p.Arg517His 14 Yes NBF1 Y Y c.1621Ab0e;C p.Ile541Leu 14 No NBF1 c.1622Tb0e;C p.Ile541Thr 14 No NBF1 Y Y Y c.1643Tb0e;A p.Phe548Tyr 15 No Adj ABC c.1685Gb0e;A p.Gly562Asp 15 No ABC Y Y c.1708Gb0e;A p.Ala570Thr 15 Yes ABC/Walker B Y c.1763Cb0e;T p.Ala588Val 15 No Adj Walker B Y c.2272Gb0e;C p.Gly758Arg 19 No NBF/TM Y Y Y c.2296Gb0e;A p.Gly766Arg 19 Yes TM7 Y Y Y c.2494Cb0e;T p.Arg832Cys 21 Yes IC3 Y Y Y Y c.2576Cb0e;G p.Thr859Arg 21 No IC3 Y Y Y Y c.2842Cb0e;T p.Arg948Cys 23 Yes IC4 Y Y Y Y c.2935Ab0e;G p.Asn979Asp 23 No TM11 Y c.2944Gb0e;A p.Gly982Arg 23 Yes TM11 Y Y Y c.3086Cb0e;A p.Thr1029Lys 24 No TM12 Y Y Y Y c.3329Cb0e;A p.Ala1110Glu 25 Yes Adj Walker A Y Y Y c.3382Cb0e;T p.Arg1128Cys 25 Yes Adj Walker A Y Y Y Y c.3457Cb0e;T p.Arg1153Cys 26 Yes NBF2 Y Y Y Y c.3458Gb0e;A p.Arg1153His 26 Yes NBF2 Y Y c.3460Tb0e;C p.Ser1154Pro 26 No NBF2 Y c.3628Ab0e;C p.Thr1210Pro 27 No Adj ABC Y c.3691Cb0e;T p.Arg1231Trp 27 Yes ABC/Walker B Y Y c.3692Gb0e;A p.Arg1231Gln 27 Yes ABC/Walker B Y c.3724Cb0e;A p.Leu1242Ile 27 No Walker B c.3892Gb0e;A p.Gly1298Arg 28 No NBF2 Y Y Y NOTE. Login to comment
162 In 5 cases, the single mutations were splice-site changes or E297G/D482G. Login to comment
208 By far most common, however, were E297G and D482G, at least one of which was present in 58% (52/89) of European and in 15% (3/20) of non-European families. Login to comment
211 In contrast, D482G likely originated in Central or Eastern Europe, with cases identified in Polish, Austrian, Slovak, Czech, Hungarian, and Russian families. Login to comment
231 Residual staining was most striking in patients with E297G or D482G, with some seen in 45% of patients (19/42) carrying at least one of these alleles. Login to comment
234 Because most of these were found in combination with E297G or D482G, their individual effects could not be assessed. Login to comment

PMID: 20398791 [PubMed] Kato T et al: "Short- and medium-chain fatty acids enhance the cell surface expression and transport capacity of the bile salt export pump (BSEP/ABCB11)."

No. Sentence Comment

5 Two PFIC2-type variants, E297G and D482G BSEP, were similarly affected with both compounds treatment. Login to comment
19 We and other groups have indicated previously that the reduced cell surface expression of BSEP is responsible for the dysfunction of BSEP in PFIC2 patients with E297G or D482G mutation, both of which are observed frequently in European PFIC2 patients [12,14-17]. Login to comment
29 We previously reported that 4-phenylbutyrate (4PBA), an approved drug for treating urea cycle disorders, is a promising agent for the treatment of intrahepatic cholestasis because it increases both the cell surface expression and the transport capacity of wild type (WT), and PFIC2-type (E297G and D482G) BSEP [18]. Login to comment
34 Therefore, in this study, we investigated the potency of short-and medium-chain fatty acids against intrahepatic cholestasis by assessing the effects of these compounds on WT, E297G, and D482G BSEP expression and their transport functions using western blot analysis and transcellular transport, respectively. Login to comment
41 Generation of recombinant adenovirus The BD Adeno-X Adenoviral Expression System (BD Biosciences) was used to establish the human WT, HA-WT, E297G, D482G BSEP and BCRP recombinant adenoviruses as described previously [3,14,22,23]. Login to comment
49 After 2 days of culture, confluent cells were infected by recombinant adenovirus containing cDNAs for WT, E297G, D482G BSEP or GFP at 20 MOI. Cells were cultured for 24 h after infection and subsequently treated with media containing 4PBA, formate, acetate, propionate, butyrate, pentanoic acid, hexanoic acid, heptanoic acid, octanoic acid, or decanoic acid, each at 1 mM. Then, 24 h after treatment, transcellular transport assays were performed as described [18,24]. Login to comment
51 WT, E297G, and D482G BSEP-dependent PSapical (PSapical, WT BSEP-dependent, PSapical, E297G BSEP-dependent, and PSapical, D482G BSEP-dependent) were calculated by subtracting the PSapical value in MDCK II cells expressing GFP (PSapical, GFP) from that in MDCK II cells expressing WT, E297G, and D482G BSEP (PSapical, WT BSEP, PSapical, E297G BSEP, and PSapical, D482G BSEP), respectively. Login to comment
57 Preparation of crude membrane fraction MDCKII cells were seeded in 12-well plates at a density of 2.5&#d7;105 cells per well. After 24 h of culture, confluent cells were infected by recombinant adenovirus containing cDNAs for E297G or D482G BSEP at 200 MOI. Login to comment
73 Up-regulation of WT, E297G, and D482G BSEP-mediated transport by fatty acids We previously found that 4PBA treatment induces WT, E297G, and D482G BSEP expression at the cell surface by inhibiting the degradation of cell surface-resident WT, E297G, and D482G BSEP, and which facilitates the biliary excretion of bile acids. Login to comment
74 In this study, we first examined whether short-and medium-chain fatty acids, which have similar characteristics to 4PBA such as a carboxyl group and low-molecular-weight, can increase the cell surface expression of WT, E297G, and D482G BSEP and enhance WT, E297G, and D482G BSEP-mediated bile acid transport in a manner similar to that of 4PBA. Login to comment
80 The effect of fatty acid treatment on transport function of WT, E297G, and D482G BSEP in MDCK II cells. Login to comment
81 (A-C) MDCK II cells expressing WT (A), E297G (B), D482G BSEP (C), or GFP (A-C) were treated with formate, acetate, propionate, butyrate, pentanoic acid, hexanoic acid, heptanoic acid, octanoic acid, or decanoic acid, each at 1 mM, for 24 h before the experiments. Login to comment
82 Transcellular transport of 1 bc;M [3 H]TC across MDCK II monolayers expressing WT (A), E297G (B), D482G BSEP (C), or GFP (A-C) was examined. Login to comment
84 The PSapical was expressed as the percentage of PSapical in MDCK II cells expressing WT (A), E297G (B), or D482G (C) BSEP under the untreated condition. Login to comment
85 The closed and open bars represent WT (A), E297G (B), or D482G (C) BSEP- and GFP (A-C)-expressing MDCK II cells, respectively. Each bar represents the mean&#b1;S.E. of triplicate determinations. Asterisks represent statistically significant differences between the control and the compound-treated cells. Login to comment
89 Butyrate and octanoic acid, the most potent short-and medium-chain fatty acids, respectively, also enhanced PSapical of [3 H]TC in MDCK II cells expressing E297G and D482G BSEP, both of which are the most frequently observed in European PFIC2 patients (Fig. 1B and C). Login to comment
90 PSapical, E297G BSEP-dependent and PSapical, D482G BSEP-dependent substantially increased with the treatment of butyrate and octanoic acid 8.4- and 3.1-fold in MDCK II cells expressing E297G BSEP and 3.6- and 1.7-fold in that expressing D482G BSEP, respectively. Login to comment
92 Increased WT, E297G, and D482G BSEP expression after fattyacid treatment Results from a cell surface biotinylation study showed that WT BSEP expression at the cell surface of MDCK II cells increased 2.7-, and 6.1- Fig. 2. Login to comment
93 The effect of octanoic acid and butyrate treatment on expression level of WT, E297G, and D482G BSEP in MDCK II cells. Login to comment
94 (A-C) Determination of expression level of HA-WT (A), E297G (B), and D482G BSEP (C). Login to comment
95 MDCK II cells expressing HA-WT (A), E297G (B), or D482G BSEP (C) were treated with 4PBA, butyrate, or octanoic acid, each at 1 mM, for 24 h before the experiments. Login to comment
97 Quantification of band density indicating the 170 kDa forms of HA-WT (A), E297G (B), or D482G BSEP (C) was also shown (right). Login to comment
105 The expression levels of 170 kDa form of E297G and D482G BSEP in crude membrane fractions, which are considered to be the mature form located on the cell surface [14,18], were also elevated 3.1and 2.7-fold for E297G BSEP and 2.6- and 2.2-fold for D482G BSEP with the treatment of butyrate and octanoic acid, respectively (Fig. 2B and C). Login to comment
106 Since it is difficult to detect E297G and D482G in cell surface fractions due to low expression, crude membrane fractions were used instead to determine the alteration in those expression levels. Login to comment
107 The increased expression rates of WT BSEP on the cell surface and of the 170 kDa forms of E297G and D482G BSEP in crude membrane fractions induced by these three compounds correlated with those of WT, E297G, and D482G BSEP-mediated [3 H]TC transport (Fig. 3A-C). Login to comment
108 This suggests that all three compounds increase WT, E297G, and D482G BSEP-mediated transport by inducing WT, E297G, and D482G BSEP expression at the cell surface, but not by the activating WT, E297G, and D482G BSEP transport function itself. Login to comment
111 Neither compounds had any effect on these expression levels (Fig. 2D), suggesting that both compounds do indeed increase the expression of WT, E297G, and D482G BSEP with high specificity. Login to comment
119 Correlation between expression level and transport capacity of WT, E297G, and D482G BSEP under octanoic acid- and butyrate-treated conditions. Login to comment
120 The WT, E297G, and D482G BSEP-dependent clearance of [3 H]TC across the apical membrane of MDCK II monolayers (PSapical, WT BSEP-dependent (A), PSapical, E297G BSEP-dependent (B), PSapical, D482G BSEP-dependent (C)) treated with 4PBA, butyrate, or octanoic acid was determined as described in 'Materials and methods` using the results of Fig. 1. Login to comment
121 The PSapical, WT BSEP-dependent (A), PSapical, E297G BSEP-dependent (B), and PSapical, D482G BSEP-dependent (C) are expressed as the percentages of these values under the untreated condition. Login to comment
122 The expression level of the 170 kDa forms of HA-WT BSEP in cell surface fractions and E297G and D482G BSEP in crude membrane fractions are taken from those in Fig. 2A-C. Login to comment
136 We previously demonstrated that 4PBA is a potential therapeutic agent to combat intrahepatic cholestasis, which induces the cell surface expression of WT and PFIC2-type (E297G and D482G) BSEP by slowing its degradation rate from cell surface [18]. Login to comment
143 Both butyrate and octanoic acid were also effective on E297G and D482G BSEP (Figs. Login to comment
148 Although there is no evidence for the molecular mechanism responsible for the effect elicited by octanoic acid, based on our previous study of 4PBA [22], it is likely that octanoic acid reduces the susceptibility of ubiquitination of WT, E297G, and D482G BSEP, an important regulatory signal for degradation of these proteins on the cell surface [22], by inactivating the enzymes involved in the ubiquitination reaction and consequently also increases their expressions at the cell surface. Login to comment
149 Another possible explanation is that octanoic acid directly stabilizes the cell surface-resident WT, E297G, and D482G BSEP and interrupts their ubiquitinations at the cell surface. Login to comment
151 Because the mRNA expression level of WT BSEP itself was not significantly increased by butyrate treatment under the experimental conditions we used in this study (Fig. 5), it is possible that butyrate induces a gene expression that promotes the translation and/or inhibits the ER-associated protein degradation pathway, and subsequently increases the amount of WT, E297G, and D482G BSEP in Fig. 5. Login to comment
172 The rapid degradation of BSEP/Bsep from the cell surface partly contributes to the reduced BSEP/Bsep expression at the cell surface in PFIC2 patients with E297G or D482G mutations and in rat models of endotoxin- or drug-induced cholestasis [10-17], suggesting that octanoic acid may combat intrahepatic cholestasis. Login to comment
174 Since octanoic acid induced the expression of E297G and D482G BSEP, accompanied with the enhanced [3 H]TC transport by them (Fig. 3B and C), particularly, PFIC2 patients with E297G or D482G mutations are expected to benefit from its effectiveness. Login to comment
182 Considering the effectiveness on E297G and D482G BSEP, a particular benefit to PFIC2 patients with either an E297G or D482G mutation is expected. Login to comment

PMID: 20447715 [PubMed] Pawlikowska L et al: "Differences in presentation and progression between severe FIC1 and BSEP deficiencies."

No. Sentence Comment

15 Among BSEP patients, the course of disease was less rapidly progressive in patients bearing the D482G mutation. Login to comment
64 We also performed exploratory analyses to evaluate whether BSEP patients carrying 1 or 2 copies of the common European D482G (c.1445A>G) and/or E297G (c.890A>G) mutations differed from other BSEP patients, and whether FIC1 patients carrying G308V differed from other FIC1 patients. Login to comment
65 For clinical findings, we used a three-way categorization of 'FIC1` versus 'D482G BSEP` (BSEP patients carrying D482G on one or both of their ABCB11 alleles) versus 'non-D482G BSEP` (BSEP patients not carrying D482G). Login to comment
66 Since biochemical data were available for relatively few D482G-bearing patients, three-way analyses were not performed, although in some figures the 2 BSEP subgroups are shown separately for qualitative comparison. Login to comment
67 The D482G and non-D482G BSEP subgroups do not always sum to the total N for 'all BSEP`, because we could not sub-classify 3 BSEP patients in whom only one mutation was detected and presence of D482G on the 2nd allele was not ruled out; they were excluded from this analysis. Login to comment
77 One of two 'common` ABCB11 mutations (D482G or E297G) was identified on one or both alleles in 51 BSEP patients (61%) [2,12]. Login to comment
81 Since functional studies have suggested that the BSEP D482G and E297G mutations may not completely abolish protein function [9,44-47], we performed exploratory analyses stratified by mutation. Login to comment
82 Our results suggested that phenotypic differences exist between BSEP patients with and without D482G (data not shown); those differences that attained statistical significance are discussed below. Login to comment
86 For all patient groups, birth-weights trended below expectation; this only reached statistical significance in non-D482G BSEP patients (p <0.0003, 95% CI 0.88-0.96). Login to comment
88 Onset by 3 months was reported in most patients (FIC1: 85%; D482G BSEP: 67%; non-D482G BSEP: 71%). Login to comment
92 Jaundice was less frequent in patients bearing BSEP D482G (48%) than in patients carrying other BSEP mutations (78%; p = 0.013) or in FIC1 patients (78%; p = 0.014) (Table 2). Login to comment
95 Clinically manifest vitamin deficiency was more common in BSEP patients bearing D482G than in FIC1 patients (p = 0.047). Login to comment
97 Seven of the 12 (3 D482G BSEP patients, 3 other BSEP patients, and 1 FIC1 patient) presenting with manifestations of vitamin deficiency were not clinically jaundiced. Login to comment
116 Two of six (33%) BSEP patients with D482G and 22/27 (81%) without D482G were reported to have giant cells (p = 0.034). Login to comment
128 Feature FIC1 BSEP p* All BSEP D482G Non-D482G FIC1 versus All BSEP Birth-weighta , 0.97 0.93 0.95 0.93 median (0.88-1.09) (0.87-1.02) (0.89-1.05) (0.87-1.00) 0.23 (interquartile range) N = 42 N = 70 N = 19 N = 48 Age (months) at Onset, 2.0 2.0 3.0 1.8 median (0.5-2.0) (1.0-4.5) (1.3-5.0) (0.4-4.0) 0.059 (interquartile range) N = 53 N = 79 N = 18 N = 58 Symptoms initially 25/56 46/81 13/21 30/57 intermittent (45%) (57%) (62%) (53%) 0.17* Jaundice 42/54 57/82 10/21 45/58 (78%) (70%) (48%) (78%) 0.29 Diarrhea 11/54 5/82 2/21 3/58 (20%) (6%) (10%) (5%) 0.017 Manifestations 2/54 10/82 4/21 6/58 of vitamin deficiency (4%) (12%) (19%) (10%) 0.11 Linear and logistic regression, or Fisher Exact test (*), were used. Login to comment
130 Bolded entries in the D482G column indicate that results for D482G BSEP patients differ from one or both other groups (as described in the text). Login to comment
138 Four BSEP patients, all without D482G, were diagnosed with hepatocellular carcinoma (HCC). Login to comment
139 Overall, 31% of patients were diagnosed with portal hypertension (PH); BSEP patients without D482G developed PH more frequently than those bearing D482G (p = 0.017), and than FIC1 patients (p = 0.022). Login to comment
140 Twenty-four percent of patients were diagnosed with cirrhosis (median age 4.4y, interquartile range 2.3-6.5 y); BSEP patients bearing the D482G mutation survived to an older age without diagnosis of cirrhosis than did other BSEP patients (p = 0.029, hazard ratio = 0.19, 95% CI = 0.04-0.84). Login to comment
170 Of those patients who did not undergo surgical intervention, 7 died (5 FIC1 and 2 BSEP patients without D482G). Login to comment
171 BSEP patients carrying the D482G mutation survived to a greater age without OLT than did other BSEP patients (p = 0.0092, hazard ratio = 0.31, 95% CI = 0.13-0.75) or FIC1 patients (p = 0.045, hazard ratio = 0.41, 95% CI = 0.17-0.98) (Fig. 4A). Login to comment
172 The probability of any form of surgery was less in BSEP patients with D482G than in others, and this bordered on significance (p = 0.050, hazard ratio = 0.56, 95% CI = 0.31-1.00) (Fig. 4B). Login to comment
192 Feature FIC1 BSEP p All BSEP D482G Non-D482G FIC1 versus All BSEP Gallstones 0/61 (0%) 27/84 (32%) 8/21 (38%) 17/60 (28%) <0.0001 HCC 0/61 (0%) 4/84 (5%) 0/21 (0%) 4/60 (7%) 0.14 Portal Hypertension 15/61 (25%) 30/84 (36%) 3/21 (14%) 27/60 (45%) 0.20 Diarrhea 37/61 (61%) 17/84 (20%) 4/21 (19%) 13/60 (22%) <0.0001 Pancreatic Disease 7/61 (12%) 1/84 (1%) 1/21 (5%) 0/60 (0%) 0.0099 Rickets 28/61 (46%) 10/84 (12%) 1/21 (5%) 8/60 (13%) <0.0001 Pneumonia 8/61 (13%) 1/84 (1%) 1/21 (5%) 0/60 (0%) 0.0044 Hearing Loss* 19/61 (31%) 0/83 (0%) 0/21 (0%) 0/59 (0%) <0.0001 Failure to thrive 46/51 (90%) 46/78 (59%) 15/21 (71%) 31/55 (56%) 0.0001 Height <3rd percentile 33/39 (85%) 32/65 (49%) 8/19 (42%) 21/43 (49%) 0.0003 Weight <3rd percentile 23/41 (56%) 20/68 (29%) 2/16 (13%) 16/49 (33%) 0.0083 Fisher exact test was used. Login to comment
195 Bolded entries in the 'Portal Hypertension` row indicate that results for non-D482G BSEP patients differ from D482G BSEP and FIC1 patients (as described in the text). Login to comment
204 The higher incidence of presentation without jaundice but with vitamin deficiency, and lower frequency of giant cells upon biopsy, in ''D482G BSEP" suggests a more insidious onset; however, the overall clinical picture at presentation does not differ substantially among the BSEP mutation subclasses. Login to comment
205 Some features of the disease course in BSEP patients with D482G suggested a more slowly progressing disease, consistent with data suggesting that the D482G BSEP protein retains some function [9,45,46]; when compared to other BSEP patients, those bearing D482G developed portal hypertension less frequently, developed cirrhosis at an A B ALP (IU/l) FIC1 BSEP Age (years) Age (years) Age (years) Age (years) 0 - 1 1 - 2 2 - 4 4 - 6 > 6 0 500 1000 1500 2000 2000 3000 4000 5000 6000 0 - 1 1 - 2 2 - 4 4 - 6 > 6 0 500 1000 1500 2000 2000 3000 4000 5000 6000 FIC1 BSEP sAT 0 - 1 1 - 2 2 - 4 4 - 6 > 6 0 5 10 15 20 25 0 5 10 15 20 25 0 - 1 1 - 2 2 - 4 4 - 6 > 6 Fig. 3. Login to comment
208 For BSEP, filled shapes represent data from patients bearing D482G, and open shapes, all other patients. Login to comment
213 D482G BSEP FIC1 Other BSEP D482G BSEP FIC1 Other BSEP Transplant-free Survival (%) 0 25 50 75 100 A B Age (years) 0 5 10 15 20 25 30 Surgery-free Survival (%) 0 25 50 75 100 Age (years) 0 5 10 15 20 25 30 Fig. 4. Login to comment
215 In each case FIC1, D482G BSEP, and other BSEP are plotted. Login to comment
218 Among BSEP patients, 5/ 21 (24%) with D482G and 30/60 (50%) without D482G underwent OLT. Login to comment
221 For most disease features, the results of comparison between FIC1 and BSEP patients were similar whether BSEP patients with D482G were included or excluded. Login to comment
222 An exception was portal hypertension, where FIC1 patients had an intermediate phenotype between BSEP D482G and non-D482G patients. Login to comment

PMID: 22464344 [PubMed] Misawa T et al: "Discovery and structural development of small molecules that enhance transport activity of bile salt export pump mutant associated with progressive familial intrahepatic cholestasis type 2."

No. Sentence Comment

8 Genomic analysis of PFIC2 patients has revealed many kinds of missense, premature termination, frame-shift and splicing-junction mutations in the BSEP gene.3 Among them, two missense mutations, E297G (Glu297Gly) and D482G (Asp482Gly), are frequently observed in PFIC2 patients.4,5 Generally, wild-type (WT) BSEP is synthesized and folded at the endoplasmic reticulum (ER). Login to comment
12 Hayashi et al. reported that the E297G and D482G mutations cause a reduction of BSEP on plasma membrane, but importantly, they found that the transport function of both mutated BSEPs is almost normal if they localized correctly.5 Thus, the folding-defective nature, linked to abnormal trafficking (retention at ER), of E297G mutant lies at the core of the etiology of PFIC2, at least in part. Login to comment

PMID: 22583617 [PubMed] Misawa T et al: "E297G mutated bile salt export pump (BSEP) function enhancers derived from GW4064: structural development study and separation from farnesoid X receptor-agonistic activity."

No. Sentence Comment

1 Several BSEP mutants, including Glu297Gly (E297G) and Asp482Gly (D482G), cause progressive familial intrahepatic cholestasis type 2. Login to comment
5 Bile salt export pump (BSEP) is a member of the ATP-binding cassette transmembrane transporter family and mediates the biliary excretion of monovalent bile acids (such as taurocholate) from hepatocytes.1-3 It is well known that several BSEP mutants cause progressive familial intrahepatic cholestasis type 2 (PFIC2) which is a recessive hereditary liver disease characterized by cholestasis and jaundice in the first year of life, leading to cirrhosis and death before adulthood unless liver transplantation is carried out.4 Among the PFIC2-causing mutations, two missense mutations, that is, E297G (Glu297Gly) and D482G (Asp482Gly), are frequently observed in PFIC2 patients.5,6 The E297G mutant is considered to be folding-defective (misfolded), and as a result, this mutant BSEP is retained within the cell on endoplasmic reticulum (ER), and does not acquire the usual golgi-related glycosylation. Login to comment
6 Hayashi et al. reported that the E297G and D482G mutations cause a reduction of BSEP on plasma membrane, but importantly, they found that the transport function of both mutated BSEPs is almost normal if they are correctly localized.7 Furthermore, Hayashi et al. reported that sodium 4-phenylbutyric acid (4-PBA) enhanced the cell-surface expression and transport capacity of E297G BSEP by prolonging the half-life of cell-surface-resident BSEP, through modulating its ubiquitination status and AP2-mediated internalization.6-8 In our previous work, we found that bile acids showed moderate E297G BSEP-function-promoting activity, and chenodeoxycholic acid (CDCA) was the most potent function-promoter among the tested bile acids.9 Furthermore, compounds based on GW4064 [a representative farnesoid X receptor (FXR) agonist10 ] ( Fig. 1) enhanced the BSEP transport activity. Among the tested compounds, compound 2d possessed the most potent E297G BSEP-function-promoting activity at 10 lM (Table 2). Login to comment

PMID: 22795478 [PubMed] Kubitz R et al: "The bile salt export pump (BSEP) in health and disease."

No. Sentence Comment

173 By the use of an in vitro minigene approach, interference with splicing was shown for c.1445A > G (p.D482G), c.1757C > T (p.T586I), c.3432C > A (p.S1144R), c.3458G > A (p.R1153H), c.3460T > C (p.S1154P), c.3691C > T (p.R1231 W) and c.3692G > A (p.R1231Q) [132]. Login to comment
176 Interestingly, the very common polymorphism p.V444A of BSEP (allele frequency > 50%), which may occur isoallelic to mutations, strongly increases ERAD, as shown in expression studies of cloned BSEP [23]; thirdly, a decrease in half-life may shorten residency of BSEP at the canalicular membrane as shown for the two common PFIC-2 mutations p.E297G and p.D482G in Madin-Darby canine kidney (MDCK) cells [134]. Login to comment
185 PFIC BRIC/NFC ICP Other liver diseases Genetic variants without disease association Missense mutations M1V C336S D549V L1055P E135K E137K T87R V43I S701P G19R W342G G556R C1083Y E137K L198P M123T S56L L712L L50S A382G G562D A1110E E186G E297G S194P Q121K A865D M62K R387H A570T S1114R L198P R415Q L198P R128H A865G C68Y A390P L581F G1116E E297G V444A G260D I206V S874P C107R G410D A588V G1116F G374S D482G E297K V284A I939M I112T L413W S593R G1116R A390P N591S V444A G295C R958Q W114R I420T I627T S1120N R432T T655I T510T G295R F959C Y157C D440E E636G R1128C V444A T655I G295S F959V A167T G455E R698C S1144R I498T D676Y R299K T965S A167V K461E S699P R1153C A570T P710P R303K F971L I182K T463I E709K R1153H T586I L827I L339V F971Y M183T Q466K G758R S1154P G648V G855R H423R L1006F M183V R470Q G766R N1173D T655I E1186K V444A N1009H G188W Y472C Y818F T1210P T923P V444D K1145N M217R V481E R832C N1211D A926P V444G I1183T R223C D482G R832H V1212F R948C A459V S226L R487H T859R R1231Q G1004D I468I G238V R487P A865V R1231W R1050C R487L T242I N490D Q869P L1242I G1116R Q546K A257G I498T G877R D1243G R1128H Q558H V284L G499E S901R R1268Q L1197G E592Q E297G I512T R948C A1283V R1231Q V597M R303G N515T N979D G1292V R616G R303K R517H G982R G1298R T619A Q312H F540L G1004D M677L R313S I541L T1029K M677V G327E I541T G1032R R696Q W330R F548Y A1044P R698H Nonsense mutations (premature stop-codons) S25X Y472X Y772X R1090X E96X W493X Q791X V1147X W330X R520X R928X Q1215X Y354X I528X Y1041X R1235X R415X R575X R1057X E1302X R470X Q702X Q1058X Table 1 (Continued) PFIC BRIC/NFC ICP Other liver diseases Genetic variants without disease association Splice site mutations 76 + 3G > T 908 + 1delG 2178 + 1G > T 3057-2A > G Q159Q 77-1G > C 908 + 1G > T 2179-2A > G 3213 + 1delG Q361Q 99-1G > T 908 + 1G > A 2343 + 1G > T 3213 + 4A > G 150 + 3A > C 1435-13 -8del 2343 + 2T > C 3213 + 5G > A 390-1G > A 2012-8T > G 2611-2A > T 611 + 1G > A 2178 + 1G > A R1001R Deletions/insertions/frame shifts Q101Dfs8X L380Wfs18X G648Vfs5X Q1058Hfs38X F959Hfs1X T127Hfs6X A382 A388del K700Sfs12X I1061Vfs34X F959Gfs48X N199Ifs14X P456Pfs24X T919del L1165del L232Cfs9X H484Rfs5X K930Efs92X A1192Efs50X R303Sfs17X I528Sfs21X K930Efs79X T1256Tfs40X V368Rfs27X I610Qfs45X K969 K972del Synonymous variants without disease association R33R F90F L232L I416I G557G I876I A1028A K1145K D36D I134I Y269Y G418G V597V G937G K1070K R52R S136S Q312Q F427F A804A Y981Y T1086T D58D V195V G319G E395E A535A G817G G1004G A1110A The overview shows ࣈ 290 known variants of BSEP on the protein level, except splice site mutations, which are shown on cDNA level. Login to comment
208 A few ''common`` BSEP mutations (including p.E297G, p.D482G and p.N591S) have been detected in ICP-patients in heterozygous form and account for about 1.4% (7/491) of ICP-patients [150]. Login to comment
209 Canalicular expression of BSEP with the ''typical`` ICP mutation p.N591S was higher than that of the BRIC-2 (p.A570 T, p.R1050 C) or PFIC-2 mutations (p.D482G, p.E297G) [144]. Login to comment

PMID: 22859919 [PubMed] Chan J et al: "Hepatobiliary transport in health and disease."

No. Sentence Comment

84 The most common mutations are E297G and D482G [26]. Login to comment
85 The disease progresses more slowly in patients with D482G mutations, and they develop cirrhosis at an older age [24]. Login to comment
86 The disease progresses more slowly in patients with D482G mutations, and they develop cirrhosis at an older age [24]. Login to comment

PMID: 23548013 [PubMed] Jaquotot-Herranz M et al: "Clinical variability of mutations in the ABCB11 gene: a case report."

No. Sentence Comment

67 On the other hand, a recent study identified some mutations in BSEP deficiency, like D482G , that cause the illness to assume a more indolent path, with less progression of liver disease and better chances of survival (5). Login to comment

PMID: 23685087 [PubMed] Soroka CJ et al: "Biosynthesis and trafficking of the bile salt export pump, BSEP: therapeutic implications of BSEP mutations."

No. Sentence Comment

138 Two common mutations in human BSEP, E297G and D482G, have been reported to have both reduced (Noe et al., 2005; Wang et al., 2002) and normal (Hayashi et al., 2005; Lam et al., 2007) transport activity. Login to comment
139 The D482G mutation has also been found to have enhanced aberrant mRNA splicing, perhaps providing an explanation for the variable expression, function and severity of disease (Byrne et al., 2009). Login to comment
140 This mutation (D482G) is the most common PFIC missense mutation in the European population and 16% of BSEP deficiency patients who develop malignancy have this mutation (Knisely et al., 2006; Strautnieks et al., 2008). Login to comment
142 In addition, Bryne et al. have reported that the D482G-containing mRNA is unstable (Byrne et al., 2009). Login to comment
145 We examined differences in protein maturation, plasma membrane localization and transport activity in mutants of rat Bsep representing two PFIC2 (D482G and E297G), two BRIC2 (A570T and R1050C) and one ICP (N591) mutation (Lam et al., 2007). Login to comment
177 HEK293 cells were transfected with WT Bsep-GFP (A and B) or D482G- GFP (C and D) and confocal microscopy was used to monitor the plasma membrane expression of the constructs after treatment with sodium butyrate (NaB) for 24 h. (A) DMSO control treated cells express WT Bsep-GFP primarily on the plasma membrane. Login to comment
179 (C) Cells transfected with mutant D482G Bsep-GFP show little GFP fluorescence due to degradation of the protein (see details in Lam et al. (2007)). Login to comment
180 (D) Treatment with NaB resulted in stabilization of the protein and cells show increased plasma membrane expression of the D482G mutant of Bsep-GFP. Login to comment
182 For example, the very low plasma membrane expression of the PFIC2 mutant, D482G, could be increased by treatment with low temperature, sodium butyrate (Fig. 2) and sodium 4-phenylbutyrate (4-PB) in MDCK II, HEK293, or HepG2 cells (Hayashi and Sugiyama, 2007; Lam et al., 2007; Plass et al., 2004). Login to comment
185 In vitro studies using rat Bsep mutants of the human mutations G238V, D482G, G982R, R1153C, and R1268Q all resulted in retention of Bsep in the ER to different extents (Wang et al., 2008). Login to comment
186 Ubiquitinylation with over expression of E3 ubiquitin ligases shortened the half life of both the wild type protein and the already short half life of the PFIC2 mutant, D482G, however small amounts of the mutant protein were still able Fig. 3. Login to comment
197 This and other studies also suggest that the residence time on the cell surface of the common D482G and E297G mutant proteins is greatly reduced due to accelerated internalization, reduced recycling or targeting of the endocytosed protein for degradation. Login to comment
200 Indeed, in vitro studies demonstrate that 4-phenylbutyrate (4-PBA) can increase the cell surface expression of PFIC2 mutant proteins D482G and E297G in MDCK cells and stimulate bile salt secretion and Bsep expression in vivo in rats (Hayashi and Sugiyama, 2007). Login to comment

PMID: 23722250 [PubMed] Kagawa T et al: "Ursodeoxycholic acid stabilizes the bile salt export pump in the apical membrane in MDCK II cells."

No. Sentence Comment

11 UDCA significantly increased the activity of Bsep with a benign recurrent intrahepatic cholestasis 2 mutation (A570T) but did not affect Bsep with a progressive familial intrahepatic cholestasis 2 mutation (G982R or D482G). Login to comment
88 MDCK-Ntcp cells were transfected with an expression vector that contained mutated Bsep, including any of a PFIC2 mutation (G982R or D482G) and a BRIC2 mutation (A570T) [11]. Login to comment
90 Basal Bsep activity was slightly lower in the A570T mutant (80.6 % of the wild-type Bsep activity) and much lower in the G982R (15.3 %) and D482G (18.8 %) mutants compared with that in wild-type Bsep (Fig. 6). Login to comment
93 In contrast, UDCA did not affect the activity of the G982R and D482G mutant proteins. Login to comment
163 The inability of TUDCA to stimulate Bsep activity was unexpected because this molecule has been reported to 0 50 100 150 200 wild-type A570T G982R D482G UDCA - + - + - + - + * ** Bsep activity (%) Fig. 6 The effect of UDCA on mutant Bsep activity. Login to comment
164 MDCK II cells stably expressing wild-type or mutant (A570T, G982R, or D482G) Bsep were incubated in the presence or absence of UDCA (100 lM) for 24 h after preincubation with sodium butyrate (5 mM) for 24 h. Thereafter, these cells were incubated for 1 h at 37 &#b0;C with [3 H]-TC (1 lM) and cold TC (10 lM) in the lower compartment. The intracellular accumulation and transcellular flux of TC were calculated on the basis of the radioactivity in the total cells and apical medium, respectively. Bsep activity was determined by the permeability-surface area product for TC transport across the apical membrane (PSapical), which was calculated as (rate of transcellular TC flux)/(intracellular TC concentration). Login to comment
175 Negligible Bsep activity was observed for the G982R and D482G mutants, which cause PFIC2. Login to comment

PMID: 24378332 [PubMed] Aida K et al: "Differential roles of ubiquitination in the degradation mechanism of cell surface-resident bile salt export pump and multidrug resistance-associated protein 2."

No. Sentence Comment

192 The cell surface-resident forms of BSEP with E297G and D482G, both of which are the most frequently found mutations in patients with progressive familial IC type 2, a genetic disorder caused by mutations in the BSEP gene, are highly ubiquitinated (Hayashi and Sugiyama, 2009). Login to comment

PMID: 24644547 [PubMed] Lisowska A et al: "Small intestinal bacterial overgrowth in patients with progressive familial intrahepatic cholestasis."

No. Sentence Comment

42 biochemical and genetic data of the studied patients Sex ABCB11 gene defect HMBT first/ second/ third Age (y) Body mass, Z-score Height, Z-score Treatment Bilirubin (mg/dl) Bile acids (&#b5;mol/l) Fecal fat excretion (g/day) M - B/-/- 7 -0.67 -0.77 BD 0.9 1.4 10 M - B/B/N 7.11 -0.88 -1.21 BD 0.9 1.5 6.7 F - B/P/- 15 -0.41 -1.36 BD 0.6 3.6 9.9 F - B/N/- 8.11 -0.25 -1.11 IB/BD 0.9 4.1 0.5 M c.1445 A>G; p.Asp482Gly. c.1544 A>C; p.Asn515Thr B/-/- 11.4 -1.99 -3.42 BD 0.9 2.6 2.1 M c.890 A>G; p.Glu297Gly (HOM) P/N/- 19.7 0.41 0.56 IB 1.1 405 2.2 F - P/N/- 12.11 -1.31 -0.73 UDCA 1.5 21.7 1.1 F c.1445 A>G; p.Asp482Gly. Login to comment
43 c.1550 G>A; p.Arg517His P/P/- 10.9 0.02 -0.79 BD 0.9 4.8 2.4 F - P/B/P 18.2 -0.25 -1.06 BD 0.9 8.7 9.7 M c.1445 A>G; p.Asp482Gly. Login to comment
45 c.2178+1 G>C; Splice Defect P/-/- 14.5 -1.09 -1.38 UDCA 1.3 0.5 0.3 M c.1445 A>G; p.Asp482Gly. c.1544 A>C; p.Asn515Thr P/-/- 11.4 -0.81 -0.60 BD 0.9 4 1.5 F c.1445 A>G; p.Asp482Gly. Login to comment
46 c.890 A>G; p.Glu297Gly P/P/P 9.8 -1.01 -1.48 BD 0.9 4 4.5 M c.890 A>G; p.Glu297Gly (HET) N/-/- 12.5 0.83 -1.14 BD 1.1 2.1 2 M c.1445 A>G; p.Asp482Gly. Login to comment
48 c.1643 T>A; p.Phe548Tyr N/-/- 13.1 -1.13 -1.49 BD 1.4 3.5 70 M c.1445 A>G; p.Asp482Gly* N/-/- 8.9 -0.72 0.07 UDCA 0.9 3.1 1.2 M - N/-/- 18.5 -1.51 -2.26 IB/BD 0.9 67.8 4.3 M c.1445 A>G; p.Asp482Gly (HOM) N/-/- 20.7 -0.90 -0.38 UDCA 0.9 2.4 8.5 M c.1445 A>G; p.Asp482Gly (HOM) N/-/- 13.5 -1.15 -1.15 UDCA 0.9 2.4 6.2 F c.1445 A>G; p.Asp482Gly (HOM) N/-/- 24.2 -1.68 -2.21 BD 0.9 2.4 2.7 F c.1445 A>G; p.Asp482Gly. Login to comment
49 c.3086 C>A; p.Thr1029Lys N/-/- 12.11 -1.31 -1.71 UDCA 0.9 8.8 8.9 M - N/-/- 12.7 0.34 -1.63 UDCA 0.9 7.7 0.3 F - N/-/- 15.6 -1.05 0.70 BD 1.7 4.3 3.7 M c.1445 A>G; p.Asp482Gly. Login to comment

PMID: 24969679 [PubMed] Hu G et al: "Diagnosis of ABCB11 gene mutations in children with intrahepatic cholestasis using high resolution melting analysis and direct sequencing."

No. Sentence Comment

202 Common mutations that have been reported in European populations, such as E297G and D482G, were not detected in Chinese subjects. Login to comment

PMID: 25027376 [PubMed] Kubitz R et al: "Genetic variations of bile salt transporters."

No. Sentence Comment

89 Among these p.E297G, p.D482G and p.N591S belong to the more frequent mutations. Login to comment
90 While homozygosity of p.E297G or p.D482G is linked to PFIC-2, heterozygosity of these mutations was detected in about 1.4% of 491 patients with intrahepatic cholestasis of pregnancy (ICP) [17]. Login to comment
100 For example, the two 'BRIC-2 mutations` p.A570T and p.R1050C had lower expression levels than the 'ICP mutation` p.N591S, but higher expression levels as compared to the PFIC-2 mutations p.D482G and p.E297G [59]. Login to comment
110 For example reduced splicing and exon skipping was reported for the typical PFIC-2 mutation c.1445A>G (p.D482G), but also for the frequent synonymous variant c.3084A>G (p.A1028A) of BSEP [7] (Table 1). Login to comment
117 For the two common BSEP mutations p.E297G and p.D482G it has been reported that treatment with 4-phenylbutyrate prolongs half-life at the canalicular membrane and consecutively overall expression of BSEP [29]. Login to comment

PMID: 25274209 [PubMed] Hayashi H et al: "[Development of new therapeutic strategy for transporter-related diseases]."

No. Sentence Comment

12 BSEP Expression on the Canalicular Membrane Is Decreased in Patients with PFIC25) 1008 Vol. 134 (2014) d3b;ឋf5c;ᵨఌa2;dd;c8;fc;b7;b9;fc3;⍈f5c;ᵨఔecb;௱ıf;d30;Pde;bd2;ឋ Ĳb;ఐĴa;,[cd;be4;Ĳa;̩d;a5f;Pfd;ωc;bb3;İc;f15;İd;d77;௭௯Ĵc;Ĵb;&#ff0e;ᱯĲb; [cd;be4;Ĳa;̩d;ᑁPc6;c41;௦௷ede;ఔᕈ௳Ĵb;Kbe;<a3;Ĳe;e00;f8b;௼௱௺, BSEP Ĳe;΋a;f1d;b50;᜕ᶒĲb;d77;8e0;௱௺˿a;Kc7;௳Ĵb;e0c;c11;`e3;cbb;ឋ Kbe;<a3;Ĳe; PFIC2 İc;Me5;఑Ĵc;௺௤Ĵb;&#ff0e; 3,4) PFIC2 Ĳb;bfe;௱௺ Ĳf;,Ife;Hb6;௻Ĳf;ᑁOd1;Ḅᷚcd5;İc;Nba;acb;௱௺İa;఑ıa;,̩d;Ofb;ʲd; ఔ5d7;௫Ĳa;௫Ĵc;௾,əd;᧡ʟf;Ȍd;Ĳb;Qf4;b7b;ឋĲe;d4c;Έe;ఔfbf;Ĵb;&#ff0e; ̩d;Ofb;ʲd;Ĳf;˯f;Ḽ௳Ĵb;İb;௽௦İb;İc;Nba;b9f;௻Ĳf;Ĳa;İf;ea;b9;af;İc; ad8;௤௭௼, ad8;Ϙd;Ĳa;ɰb;⊕cbb;İc;İb;İb;Ĵb;௭௼,௯఑Ĳb;Ȃd;Kab; ᢓᑴᒐఔe00;˯f;ʞd;ᵨ௱d9a;௫Ĳa;İf;௺Ĳf;Ĳa;఑Ĳa;௤௭௼Ĳa;௽ İb;఑,<a3;ὅĲb;ᾙf53;Ḅ,[d1;\ad;ḄĲb;ɏa;ᜧĲa;ca0;>c5;ఔf37;௤Ĵb; cbb;ᷚcd5;௻௢Ĵb;&#ff0e;௱ıf;İc;௷௺,PFIC2 Ĳb;bfe;௳Ĵb;ȕb;Uac; 6c1;Ĳe;ξb;˿a;İc;ᑗʟb;௯Ĵc;௺௤Ĵb;&#ff0e; ee5;e0a;Ĳe;Pcc;ʚf;İb;఑,b46;ὅĲf;,PFIC2 <a3;ὅĲe; 60%ee5; e0a;İc;fdd;8e0;௳Ĵb; 297 ˴a;Lee;Ĳe;b0;eb;bf;df;f3;⏚İc;b0;ea;b7;f3;Ĳb; ee3;Ĵf;Ĵb;᜕ᶒf53;(E297G) ,482 ˴a;Lee;Ĳe;a2;b9;d1;e9;ae;f3; ⏚İc;b0;ea;b7;f3;Ĳb;ee3;Ĵf;Ĵb;᜕ᶒf53;(D482G)Ĳe; 2 ௸Ĳe; d2;c8; BSEP ᜕ᶒf53;˿a;Ife;d30;Pde;ఔEcb;bc9;௱,a2e;஽Ĳe; in vitro b9f; a13;ఔb9f;Abd;௱ıf;&#ff0e; 5) ıd;Ĳe;d50;ʧc;,e21;᜕ᶒİc; BSEP Ĳe;e0d;b89;b9a;ᓄĲb;2cd;İd;,BSEP Ĳe;d30;Pde;̳c;˿a;Ife;[cf;ఔf4e;e0b;௯ ıb;௺௤Ĵb;௭௼ఔ΂b;௤3fa;௱ıf;(Fig. 1) &#ff0e;ıd;Ĳe;e00;Ab9;௻, e21; BSEP ᜕ᶒf53;ఔ˿a;Ife;௯ıb;ıf;d30;Pde;İb;఑d30;Pde;̳c;d9;b7; af; eb; ఔ abf; Xfd; ௱ , f38; 〈 b9f; a13; ఔ b9f; Abd; ௱ ıf; ௼ ௭ Ĵd; , E297G, D482G İc;ᓮf4d; BSEP [cf;f53;ıf;Ĵa;Ĳe;Pc6;c41;⏚f38;〈 d3b;ឋĲb;Ĳf;f71;aff;ఔe0e;௨Ĳa;௤௭௼İc;ʔe;఑İb;௼Ĳa;௷ıf;&#ff0e; E297G, D482G ᜕ᶒఔᢝ௸ PFIC2 <a3;ὅĲe;̩d;d44;e54; ఔᵨ௤ıf;Ȃd;Kab;d44;e54;Cd3;⁐cd5;௻Ĳf;,bdb;d30;Pc6;ba1;Ꮢ̳c;e0a;Ĳb;İa; ௫Ĵb; BSEP ˿a;Ife;[cf;İc;♿℉Ĳb;f4e;e0b;௱௺İa;Ĵa;, 4) Ĵf;Ĵc;Ĵf; Ĵc;Ĳe; in vitro Ye3;᪆d50;ʧc;௼̺f;ɕd;Ĳa;Lf8;_a2;İc;a8d;ఉ఑Ĵc;௺௤ Ĵb;&#ff0e;௱ıf;İc;௷௺,eca;f8c;Ǵb;஽Ĳe; PFIC2 <a3;ὅĲe;Kc5;ɦb;˿a; Kc7;a5f;Ecb;ఔe88;e2c;௳Ĵb;e0a;௻,b46;ὅĲe;b9f; a13;cfb;Ĳf;Ϗe;e38;Ĳb;ᨵᵨ Ĳa;c4;fc;eb;௼Ĳa;Ĵb;௭௼İc;ʟf;f85;௯Ĵc;Ĵb;&#ff0e; PFIC2 cbb;ᷚUac;Ĳe;?a2;d22; b46;ὅ఑Ĳf;,in vitro b9f; a13;İb;఑,PFIC2 <a3;ὅ௻Ĳf;ɏa; İf;Ĳe;ᛊᔠ,BSEP Ĳe;d30;Pde;̳c;˿a;Ife;[cf;İc;f4e;e0b;௳Ĵb;e00;Ab9; ௻,˿a;Ife;௱௺௤Ĵb; BSEP Ĳe;Pc6;c41;⏚f38;〈d3b;ឋĲf;fdd;ᢝ ௯Ĵc;௺௤Ĵb;௭௼İb;఑,BSEP Ĳe;d30;Pde;̳c;˿a;Ife;[cf;ఔᜉ4a0; ௯ıb;Ĵb;Ab9;cd5;ad6;Ĳe;ξb;˿a;İc;,PFIC2 Ĳe;ᑁOd1;Ḅᷚcd5;Ĳe;Nba; acb;Ĳb;௸Ĳa;İc;Ĵb;௼ὃ௨ıf;&#ff0e;ᱯĲb;,Qe8;e8a;fc3;ea6;௻ BSEP Ĳe;d30;Pde;̳c;˿a;Ife;[cf;ఔ ad8;ఉĴb;Uac;4b9;ఔᨵ௳Ĵb;Ae2;b58;ȕb;Uac;6c1;ఔ Ȝc;b9a;௳Ĵb;௭௼İc;௻İd;Ĵc;௾,d4c;e08;Ḅca0;>c5;,5ca;ఁξb;˿a;ea; b9;af;ఔefd;e1b;௱ıf; PFIC2 Ĳb;bfe;௳Ĵb;Ab0;Uac;ᒛXfd;İc;b9f;Ife;5ef; Pfd;௻௢Ĵb;௼ὃ௨,BSEP Ĳe;d30;Pde;̳c;˿a;Ife;[cf;Ĳe;᜕4d5;ఔc21; fbf;İb;௸Med;᧲╹௻a55;fa1;5ef;Pfd;Ĳa;Hec;Qea;Ĳe; in vitro b9f; a13;cfb;ఔ Ecb;bc9;௱,a2e;஽Ĳe;Ae2;b58;ȕb;Uac;6c1;ఔb9;af;ea;fc;cb;f3;b0;௱ıf;&#ff0e; ıd;Ĳe;d50;ʧc;,⋋ᦪĲe;χd;ឋᓄᔠᱥĲe;Ȝc;b9a;Ĳb;ᡂȑf;௱ıf; (Fig. 2) &#ff0e;௭Ĵc;఑Ĳe;χd;ឋᓄᔠᱥĲe;௦௵,d2;c8;Ĳb;d4c;5e3; ᢗe0e;௱ıf;f8c;,BSEP İc;˿a;Ife;௳Ĵb;̩d;Qd3;Ĳb;ᑖe03;௳Ĵb;௭௼ İc;ʔe;఑İb;௼Ĳa;௷௺௤ıf;c3f;d20;b5;a4;af;eb;ᶒe38;Kc7;(urea cycle disorder; UCD ) Ĳe; cbb; ᷚ Uac; ௻ ௢ Ĵb; 4-phenylbutyrate (4PB)Ĳb;ḼLee;௱,௯఑Ĳb;Ẇa76;ఔ⍈ఉĴb;௭ ௼௼௱ıf;&#ff0e; 6) UCD <a3;ὅĲb;bfe;௳Ĵb;Qe8;e8a;ᵨ[cf;Ĳe; 4PB ఔe9;c3;c8;Ĳb;d4c; 5e3;ᢗe0e;௱ıf;௼௭Ĵd;,̩d;bdb;d30;Pc6;ba1;Ꮢ̳c;Ĳb;İa;௫Ĵb; Bsep Ĳe;˿a;Ife;[cf;ᜉ4a0;,̩d;bdb;d30;Pc6;ba1;Ꮢ̳c;ఔecb;௱ıf;Pc6;c41;⏚f38;〈 Ĳe;ea2;⍈İc;Yb3;bdf;௯Ĵc;,4PB İc; in vivo ௻ఊȜc;Ed8;Ĳe;Uac;4b9; ఔ˿a;Ife;௳Ĵb;௭௼İc;Nba;a8d;௯Ĵc;ıf;&#ff0e; 6) ıd;௭௻,b21;Ĳb;d2;c8; ௻Ĳe;Uac;4b9;ఔNba;a8d;௳Ĵb;ıf;ఉ,Ƕb;ᳮ;d4;6e1;f1a;Ĳe;ɳf;a8d;Ĳe;e0b;, UCD <a3;ὅఔbfe;c61;௼௱ıf;ec;c8;ed;b9;da;af;c6;a3;d6;Ẇa76;ఔ b9f;Abd;௱ıf;&#ff0e;UCD <a3;ὅĲf;,Nba;b9a;a3a;Aad;f8c;,4PB Ĳe;ʞd;ᵨ ఔξb;;cb;௱,ᨬd42;ḄĲb;Ĳf;̩d;Ofb;ʲd;ఔ5d7;௫Ĵb;&#ff0e;Nba;b9a;a3a;Aad;Ĳe; Lee;Ḅ௻?a1;5d6;௯Ĵc;ıf;̩d;˯f;ʳc;b5;f3;d7;eb;5ca;ఁ,̩d;Ofb;ʲd;Ĳe;ωb; Ĳb;˯f;௲Ĵb;<a3;ὅĲe;᤺3fa;̩d;İb;఑̩d;c97;̳c;ᑖ˱b;ఔabf;Xfd;௱, BSEP ˿a;Ife;[cf;ఔa55;fa1;௱ıf;௼௭Ĵd;,᤺3fa;̩d;௻d04; 3 Ǵd;Ĳe; ᜉ4a0;İc;a8d;ఉ఑Ĵc;&#f;&#ff0e; 7) ĳe;ıf;,4PB Ĳe;ʞd;ᵨξb;;cb;f8c;Ĳb;⊈ 1009 Fig. 2. Login to comment

PMID: 25342496 [PubMed] Kubitz R et al: "Autoimmune BSEP disease: disease recurrence after liver transplantation for progressive familial intrahepatic cholestasis."

No. Sentence Comment

112 Following this report, similar observations were published (1) K930Efs79X wtBSEP (2) (3) (4) R1050C (7) D482G G374S (6) (5) c.150+3A>C (8) G982R Fig. 2 Different effects of genetic ABCB11 variants on processing and function of BSEP. Login to comment

PMID: 26019043 [PubMed] Czubkowski P et al: "Successful pregnancy after ileal exclusion in progressive familial intrahepatic cholestasis type 2."

No. Sentence Comment

26 PFIC-2 was confirmed by C.1445 A > G; p.Asp482Gly (HOM) mutation in ABCB11 gene, which is characteristic for the Polish population of patients.1 No mutations were found in ATP8B1. Login to comment
59 Several estrogens and progesterone metabolites are able to induce trans-inhibition of BSEP and the subsequent toxicity induced by the accumulation of bile acids, which may also play a role in the etiopathogenesis of intrahepatic cholestasis of pregnancy (ICP).10,11 Mutations in MDR3 (ABCB4) gene coding transporter for phospholipids across the canalicular membrane may account for 15% of cases of ICP.12 Interestingly, a Czubkowski P, et al. , 2015; 14 (4): 550-552 few "common" BSEP mutations (including p.E297G, p.D482G, and p.N591S) have been detected in ICP-patients in heterozygous form, and common BSEP polymorphism (p.V444A) has been linked to ICP as well.13 The reoccurrence of BSEP cholestasis and development of ICP may be clinically indistinguishable, since both usually present with pruritus, elevated bile acids and aminotransferases, and normal hepatic imaging.11,12 Moreover, in ICP, mutations or polymorphisms of some hepatobiliary transport proteins may contribute to disease pathogenesis or severity, but on the other hand consideration must be given to the possibility of other rare underlying hepatic disorders that may be unmasked during pregnancy with cholestasis as its first manifestation.14 Thus, the diagnosis of ICP should be given after exclusion of preexisting liver disease.15 Pruritus remains the most important clinical symptom of PFIC-2. Login to comment

PMID: 26601667 [PubMed] Okushin K et al: "The intrahepatic expression levels of bile acid transporters are inversely correlated with the histological progression of nonalcoholic fatty liver disease."

No. Sentence Comment

143 In patients with either of the two common BSEP mutations p.E297G and p.D482G, 4-phenylbutyrate prolongs BSEP half-life in the canalicular membrane and, thus, increases the overall BSEP expression level [29]. Login to comment