ABCMdb

ABCC7 p.Ser912*

[switch to full view]
Comments [show]

None has been submitted yet.

Publications

PMID: 21429822 [PubMed] Coiana A et al: "Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program."

No. Sentence Comment

88 Mutation nomenclaturea Alleles (%) T338I (p.Thr338Ile) 26 (65.0) F508del (p.Phe508del) 9 (22.5) N1303K (p.Asn1303Lys) 1 (2.5) 2183AANG (c.2051_2052delAAinsG) 1 (2.5) 621+1GNT (c.489+1GNT) 1 (2.5) exon 2 del (c.54-5811_164+2187del8108ins182) 1 (2.5) R347P (p.Arg347Pro) 1 (2.5) The 3849+10kbCNT (c.3717+12191CNT), G85E (p.Gly85Glu), 2789+5GNA (c.2657+5GNA), W1282X (p.Trp1282X), G1244E (p.Gly1244Glu), 711+5GNA (c.579+5GNA), 711+1GNT (c.579+1GNA), 4016insT (p.Ser1297PhefsX5), G542X (p.Gly542X), 1717-1GNA (c.1585-1GNA), R553X (p.Arg553X), Q552X (p.Gln552X), G551D (p.Gly551Asp), S549R (ANC) (p.Ser549Arg), I507del (p.Ile507del), F508C (p.Phe508Cys), I502T (p.Ile502Thr), 1706del17 (p.Gln525LeufsX37), 1677delTA (p.Tyr515X), R117H (p.Arg117His), D1152H (p.Asp1152His), L1065P (p.Leu1065Pro), R1066H (p.Arg1066His), L1077P (p.Leu1077Pro), 4382delA (p.Glu1418ArgfsX14), R1162X (p.Arg1162X), R1158X (p.Arg1158X), 1259 insA (p.Gln378AlafsX4), 852del22 (p.Gly241GlufsX13), S912X (p.Ser912X), and 991del5bp (p.Asn287LysfsX19) mutations included in the CF panel were not detected in the population tested. Login to comment

PMID: 22853952 [PubMed] Ramachandran S et al: "A microRNA network regulates expression and biosynthesis of wild-type and DeltaF508 mutant cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

111 We also expressed a recombinant CMV promoter-driven CFTR-ΔF508 cDNA in primary human CFTR null airway epithelia (CFTR Q493X/S912X) using an adenovirus (Ad) vector (41). Login to comment
161 (A) (Upper) CFTR protein abundance from airway epithelia (CFTR Q493X/ S912X, 24-1 antibody) after indicated treatments. Login to comment
110 We also expressed a recombinant CMV promoter-driven CFTR-ƊF508 cDNA in primary human CFTR null airway epithelia (CFTR Q493X/S912X) using an adenovirus (Ad) vector (41). Login to comment
159 (A) (Upper) CFTR protein abundance from airway epithelia (CFTR Q493X/ S912X, 24-1 antibody) after indicated treatments. Login to comment

PMID: 7505693 [PubMed] Saba L et al: "Two novel mutations in the transmembrane domains of the CFTR gene in subjects of Sardinian descent."

No. Sentence Comment

4 In molecular screening for CF defects in Sardinians, carried out by DGGE analysis of exons 4 - 7 - 1 0 - 1 1 - 14a-15- 17b-20-21, we identified two novel mutations: a C - T transversionat nt 1145 (T338I) and a C-A transversion at nt 2867 (S912X). Login to comment
20 The S912X mutation was found in a single case showing a severe phenotype with pancreatic insufficiency and recurrent respiratory infections. Login to comment
21 The patient was compound heterozygote for the S912X and an unknown mutation. Login to comment
22 The S912X mutation may lead to premature termination of the protein production in the second transmembrane domain. Login to comment
26 GCCF15 : (40GC) CCTATTGATGGTGGATCAGC 10% c-OA G T A T T A T Figure 1. Detection of the S912X mutation in the CFTR gene by DGGE and sequencing analysis. Top Left: schematic representation of the CFTR gene and amplification primers for DGGE. Bottom left: DGGE with a 10-60% gradient. Login to comment
27 Lane 1 - normal subject lane 2 - subject heterozygous for the S912X mutation. Right: Direct sequencing of the PCR products of exon 15 showing a C-A transversion at nt2867. Login to comment

PMID: 16678395 [PubMed] Munthe-Kaas MC et al: "CFTR gene mutations and asthma in the Norwegian Environment and Childhood Asthma study."

No. Sentence Comment

25 CFTR mutation Alleles (%) F508del 184 (62.2) R117C 12 (4.1) R117H 12 394delTT 11 (3.8) 4005+2T-C 11 G551D 6 (2.0) 3659delC 5 (1.7) E60X 4 (1.4) V232D 4 1525-2A-G 3 (1.0) N1303K 3 G542X 2 (0.7) E279X 2 R75X 2 S912X 2 E116X 1 (0.3) L295Q 1 R347L 1 Q493X 1 I506L 1 I507del 1 R553X 1 G576A 1 621-1G-T 1 2183AA-G 1 S945L 1 R1162X 1 I1234V 1 3849+10 kbC-T 1 W1282X 1 Unknown 18 (6.5) Total alleles 296 (100%) Mutations detected with OLA31 m kit-74%. Login to comment

PMID: 25304080 [PubMed] Dell'Edera D et al: "Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study."

No. Sentence Comment

79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

PMID: 25835118 [PubMed] Sisman G et al: "Mutation analysis of PRSS1, SPINK1 and CFTR gene in patients with alcoholic and idiopathic chronic pancreatitis: A single center study."

No. Sentence Comment

45 DNA samples were multiplied by multiplex PCR with a CF 22Mut and CF 14Mut+Tn strip assay kit which has 36 common mutations of the CFTR gene (DF508, DI507, F508C, I502T, 1706del17, 1677del TA, G542X, 1717-1G>A, R553X, Q552X, G551D, S549R(A>C), N1303K, 4016insT, R1162X, R1158X, W1282X, G1244E, 2789+5G>A, 2183AA>G, 711+5G>A, 711+1G>T, G85E, 3849+10kbC>T, 621+1G>T, R117H, D1152H, L1065P, R1066H, L1077P, 4382delA, 1259insA, 852del22, R347P, T338I, S912X and Allele5T-7T-9T). Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

371 [1043T>A;2735C>A] CF-PI M348K nd; S912X CF-causing p. Login to comment