ABCMdb

PMID: 16678395

Munthe-Kaas MC, Lodrup Carlsen KC, Carlsen KH, Skinningsrud B, Haland G, Devulapalli CS, Pettersen M, Eiklid K
CFTR gene mutations and asthma in the Norwegian Environment and Childhood Asthma study.
Respir Med. 2006 Dec;100(12):2121-8. Epub 2006 May 5., [PubMed]

Sentences

No. Mutations Sentence Comment

5 ABCC7 p.Arg117His ABCC7 p.Arg117Cys Possible associations between asthma, reduced lung function, bronchial hyperresponsiveness (BHR), and increased or decreased nitrogen oxide (NO) levels (based on structural parental interview, spirometry, PD20 methacholine challenge test and exhaled NO measurements), and the five most common CFTR mutations in Norway (DF508, R117H, R117C, 4005+2T-C, 394delTT), the modulating polymorphisms IVS8(TG)mTn and the IVS8-5T were investigated. Login to comment 25 ABCC7 p.Arg347Leu ABCC7 p.Ser945Leu ABCC7 p.Gly576Ala ABCC7 p.Ile1234Val ABCC7 p.Arg117Cys ABCC7 p.Val232Asp ABCC7 p.Arg75* ABCC7 p.Glu60* ABCC7 p.Ile506Leu ABCC7 p.Ser912* ABCC7 p.Glu116* ABCC7 p.Leu295Gln ABCC7 p.Glu279* CFTR mutation Alleles (%) F508del 184 (62.2) R117C 12 (4.1) R117H 12 394delTT 11 (3.8) 4005+2T-C 11 G551D 6 (2.0) 3659delC 5 (1.7) E60X 4 (1.4) V232D 4 1525-2A-G 3 (1.0) N1303K 3 G542X 2 (0.7) E279X 2 R75X 2 S912X 2 E116X 1 (0.3) L295Q 1 R347L 1 Q493X 1 I506L 1 I507del 1 R553X 1 G576A 1 621-1G-T 1 2183AA-G 1 S945L 1 R1162X 1 I1234V 1 3849+10 kbC-T 1 W1282X 1 Unknown 18 (6.5) Total alleles 296 (100%) Mutations detected with OLA31 m kit-74%. Login to comment 45 ABCC7 p.Arg117His The CFTR mutations DF508, R117H, 4005+2T-C, 394delTT, IVS8 Tn(TG)m were analyzed by different PCR-based methods, as described in details below. Login to comment 46 ABCC7 p.Phe508Arg PCR and fragment analysis for the 394delTT and delF508 were performed in a multiplex reaction with the following primers: 394F (forward) 50 -FAM-GCAGAGAATGGGATAGA- GAGC-, 394R (reverse) 50 -ATTCACCAGATTTCGTA- GTC- and F508F (forward) 50 -HEX-GCCTGGCACCAT- TAAAGAA-and F508R (reverse) 50 -AGTTGGCATGC- TTTGATGAC-. Login to comment 52 ABCC7 p.Arg117His ABCC7 p.Arg117Cys In order to correlate the IVS8 Tn(TG)m haplotype to the fragment lengths, a couple of samples were sequenced and used as standards.30 R117C was analyzed by PCR with the forward primer 50 -M13-TTCACATATGGTATGACCCTC and reverse primer 50 - TTGTACCAGCTCACTACCTA followed by restriction digestion by BsmI and visualized on agarose gel. The fragment sizes from normal samples were 330 and 126 bp, while heterozygote samples got additional bands of 228 and 102 bp.31 R117H was analyzed in two separate PCR`s with a common forward primer C: 50 TCACATATGGTATGACCCTC, and with normal specific arms reverse primer in one tube 50 -CTTATGCCTAGATAAATCGCGA- TAGAAC and mutated specific arms reverse primer 50 -CTTATGCCTAGATAAATCGCGATAGACT in the other tube. Login to comment 53 ABCC7 p.Arg117His A R117H heterozygote sample would produce a 237 bp long fragment in both reactions. Login to comment