ABCMdb

PMID: 7505693

Saba L, Leoni GB, Meloni A, Faa V, Cao A, Rosatelli MC
Two novel mutations in the transmembrane domains of the CFTR gene in subjects of Sardinian descent.
Hum Mol Genet. 1993 Oct;2(10):1739-40., [PubMed]

Sentences

No. Mutations Sentence Comment

4 ABCC7 p.Thr338Ile ABCC7 p.Ser912* In molecular screening for CF defects in Sardinians, carried out by DGGE analysis of exons 4 - 7 - 1 0 - 1 1 - 14a-15- 17b-20-21, we identified two novel mutations: a C - T transversionat nt 1145 (T338I) and a C-A transversion at nt 2867 (S912X). Login to comment 10 ABCC7 p.Thr338Ile The T338I mutation was found in four unrelated CF patients, of whom two had on the other chromosome the AF508 mutation and two an unknown mutation. Login to comment 11 ABCC7 p.Thr338Ile The analysis of two extragenic markers (XV-2c and KM 19) revealed that all four T338I alleles carried the same haplotype B (KM19/PstI = 2; XV2c/TaqI = 1) (7). Login to comment 12 ABCC7 p.Thr338Ile All patients with the T338I mutation were pancreatic sufficient (PS). Login to comment 14 ABCC7 p.Thr338Ile In the two patients with the T338I/AF508 compound heterozygosity, the disease manifested at 6 months of age with hyponatremia, hypochloremia and metabolic alkalosis, and at 2 years of age with failure to thrive and poor weight gain respectively. Login to comment 15 ABCC7 p.Thr338Ile The two patients compound heterozygotes for T338I/unknown mutation are adults suffering only from recurrent bronchopulmonary infections. Login to comment 19 ABCC7 p.Thr338Ile Likewise, in the T338I mutation the encoded amino acid switched from apolar to polar (Thr--De), presumably producing an alteration of the pore of the channel formed by the transmembrane segment. Login to comment 20 ABCC7 p.Ser912* The S912X mutation was found in a single case showing a severe phenotype with pancreatic insufficiency and recurrent respiratory infections. Login to comment 21 ABCC7 p.Ser912* The patient was compound heterozygote for the S912X and an unknown mutation. Login to comment 22 ABCC7 p.Ser912* The S912X mutation may lead to premature termination of the protein production in the second transmembrane domain. Login to comment 26 ABCC7 p.Ser912* GCCF15 : (40GC) CCTATTGATGGTGGATCAGC 10% c-OA G T A T T A T Figure 1. Detection of the S912X mutation in the CFTR gene by DGGE and sequencing analysis. Top Left: schematic representation of the CFTR gene and amplification primers for DGGE. Bottom left: DGGE with a 10-60% gradient. Login to comment 27 ABCC7 p.Ser912* Lane 1 - normal subject lane 2 - subject heterozygous for the S912X mutation. Right: Direct sequencing of the PCR products of exon 15 showing a C-A transversion at nt2867. Login to comment