ABCMdb

ABCC7 p.Arg555Lys

ClinVar:	c.1663A>G , p.Arg555Gly ? , not provided
CF databases:	c.1663A>G , p.Arg555Gly (CFTR1) ? , This mutation was detected by multiplex heteroduplex analysis on the MDE gel matrix. It was found in one Native Canadian CF patient (second mutation: Y1307X).
Predicted by SNAP2:	A: D (85%), C: D (85%), D: D (95%), E: D (91%), F: D (91%), G: D (91%), H: D (85%), I: D (91%), K: D (75%), L: D (71%), M: D (85%), N: D (85%), P: D (95%), Q: D (85%), S: D (85%), T: D (85%), V: D (91%), W: D (95%), Y: D (91%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]

Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
311 [140] R555K Partially complements processing defect of CFTR F508 and increases wild-type and F508 channel activity. Login to comment

[hide] Mutations in the nucleotide binding domain 1 signa... J Biol Chem. 2002 Sep 27;277(39):35896-905. Epub 2002 Jul 10. DeCarvalho AC, Gansheroff LJ, Teem JL
Mutations in the nucleotide binding domain 1 signature motif region rescue processing and functional defects of cystic fibrosis transmembrane conductance regulator delta f508.
J Biol Chem. 2002 Sep 27;277(39):35896-905. Epub 2002 Jul 10., 2002-09-27 [PMID:12110684]

Abstract [show]
The gene encoding the cystic fibrosis transmembrane conductance regulator (CFTR), an ATP binding cassette (ABC) transporter that functions as a phosphorylation- and nucleotide-regulated chloride channel, is mutated in cystic fibrosis (CF) patients. Deletion of a phenylalanine at amino acid position 508 (DeltaF508) in the first nucleotide binding domain (NBD1) is the most prevalent CF-causing mutation and results in defective protein processing and reduced CFTR function, leading to chloride impermeability in CF epithelia and heterologous systems. Using a STE6/CFTRDeltaF508 chimera system in yeast, we isolated two novel DeltaF508 revertant mutations, I539T and G550E, proximal to and within the conserved ABC signature motif of NBD1, respectively. Western blot and functional analysis in mammalian cells indicate that mutations I539T and G550E each partially rescue the CFTRDeltaF508 defect. Furthermore, a combination of both revertant mutations resulted in a 38-fold increase in CFTRDeltaF508-mediated chloride current, representing 29% of wild type channel activity. The G550E mutation increased the sensitivity of CFTRDeltaF508 and wild type CFTR to activation by cAMP agonists and blocked the enhancement of CFTRDeltaF508 channel activity by 2 mm 3-isobutyl-1-methylxanthine. The data show that the DeltaF508 defect can be significantly rescued by second-site mutations in the nucleotide binding domain 1 region, that includes the LSGGQ consensus motif.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 Interestingly, the three ⌬F508 revertant mutations previously isolated using the STE6/CFTR system, R553Q, R553M, and R555K, are also located within the NBD1 signature motif (28, 29). Login to comment

[hide] Impact of the deltaF508 mutation in first nucleoti... J Biol Chem. 2005 Jan 14;280(2):1346-53. Epub 2004 Nov 3. Lewis HA, Zhao X, Wang C, Sauder JM, Rooney I, Noland BW, Lorimer D, Kearins MC, Conners K, Condon B, Maloney PC, Guggino WB, Hunt JF, Emtage S
Impact of the deltaF508 mutation in first nucleotide-binding domain of human cystic fibrosis transmembrane conductance regulator on domain folding and structure.
J Biol Chem. 2005 Jan 14;280(2):1346-53. Epub 2004 Nov 3., 2005-01-14 [PMID:15528182]

Abstract [show]
Cystic fibrosis is caused by defects in the cystic fibrosis transmembrane conductance regulator (CFTR), commonly the deletion of residue Phe-508 (DeltaF508) in the first nucleotide-binding domain (NBD1), which results in a severe reduction in the population of functional channels at the epithelial cell surface. Previous studies employing incomplete NBD1 domains have attributed this to aberrant folding of DeltaF508 NBD1. We report structural and biophysical studies on complete human NBD1 domains, which fail to demonstrate significant changes of in vitro stability or folding kinetics in the presence or absence of the DeltaF508 mutation. Crystal structures show minimal changes in protein conformation but substantial changes in local surface topography at the site of the mutation, which is located in the region of NBD1 believed to interact with the first membrane spanning domain of CFTR. These results raise the possibility that the primary effect of DeltaF508 is a disruption of proper interdomain interactions at this site in CFTR rather than interference with the folding of NBD1. Interestingly, increases in the stability of NBD1 constructs are observed upon introduction of second-site mutations that suppress the trafficking defect caused by the DeltaF508 mutation, suggesting that these suppressors might function indirectly by improving the folding efficiency of NBD1 in the context of the full-length protein. The human NBD1 structures also solidify the understanding of CFTR regulation by showing that its two protein segments that can be phosphorylated both adopt multiple conformations that modulate access to the ATPase active site and functional interdomain interfaces.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 We also investigated the effect of three suppressor mutations (G550E, R553Q, R555K) that have been observed to improve in vivo trafficking efficiency of STE6-CFTR chimeras containing the ⌬F508 mutation expressed in yeast (23-25). Login to comment
100 Crystal Structure of ⌬F508 hNBD1 Shows Minimal Conformational Changes but Substantive Changes in Surface Topography at the Putative Site of MSD1 Interaction-Crystals diffracting to a resolution of 2.3 Å were obtained for hNBD1-7a- ⌬F508, which contains seven mutations (F409L, F429S, F433L, G550E, R553Q, R555K, H667R) in addition to the deletion of Phe-508 (see Table II). Login to comment
139 The three suppressor mutations (G550E, R553Q, R555K) occur either in or immediately following the LSGGQ signature sequence at the N terminus of ␣-helix 5. Login to comment

[hide] Side chain and backbone contributions of Phe508 to... Nat Struct Mol Biol. 2005 Jan;12(1):10-6. Epub 2004 Dec 26. Thibodeau PH, Brautigam CA, Machius M, Thomas PJ
Side chain and backbone contributions of Phe508 to CFTR folding.
Nat Struct Mol Biol. 2005 Jan;12(1):10-6. Epub 2004 Dec 26., [PMID:15619636]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR), an integral membrane protein, cause cystic fibrosis (CF). The most common CF-causing mutant, deletion of Phe508, fails to properly fold. To elucidate the role Phe508 plays in the folding of CFTR, missense mutations at this position were generated. Only one missense mutation had a pronounced effect on the stability and folding of the isolated domain in vitro. In contrast, many substitutions, including those of charged and bulky residues, disrupted folding of full-length CFTR in cells. Structures of two mutant nucleotide-binding domains (NBDs) reveal only local alterations of the surface near position 508. These results suggest that the peptide backbone plays a role in the proper folding of the domain, whereas the side chain plays a role in defining a surface of NBD1 that potentially interacts with other domains during the maturation of intact CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
148 Note added in proof: Crystal structures of the human F508A missense NBD1 (with solublizing mutations F429S and H667R) and the corrected ∆F508 NBD1 (with three known suppressor mutations G550E, R553Q and R555K, and the solublizing mutations F409L, F429S, F433L and H667R) have been reported51. Login to comment

[hide] CFTR channel opening by ATP-driven tight dimerizat... Nature. 2005 Feb 24;433(7028):876-80. Vergani P, Lockless SW, Nairn AC, Gadsby DC
CFTR channel opening by ATP-driven tight dimerization of its nucleotide-binding domains.
Nature. 2005 Feb 24;433(7028):876-80., 2005-02-24 [PMID:15729345]

Abstract [show]
ABC (ATP-binding cassette) proteins constitute a large family of membrane proteins that actively transport a broad range of substrates. Cystic fibrosis transmembrane conductance regulator (CFTR), the protein dysfunctional in cystic fibrosis, is unique among ABC proteins in that its transmembrane domains comprise an ion channel. Opening and closing of the pore have been linked to ATP binding and hydrolysis at CFTR's two nucleotide-binding domains, NBD1 and NBD2 (see, for example, refs 1, 2). Isolated NBDs of prokaryotic ABC proteins dimerize upon binding ATP, and hydrolysis of the ATP causes dimer dissociation. Here, using single-channel recording methods on intact CFTR molecules, we directly follow opening and closing of the channel gates, and relate these occurrences to ATP-mediated events in the NBDs. We find that energetic coupling between two CFTR residues, expected to lie on opposite sides of its predicted NBD1-NBD2 dimer interface, changes in concert with channel gating status. The two monitored side chains are independent of each other in closed channels but become coupled as the channels open. The results directly link ATP-driven tight dimerization of CFTR's cytoplasmic nucleotide-binding domains to opening of the ion channel in the transmembrane domains. This establishes a molecular mechanism, involving dynamic restructuring of the NBD dimer interface, that is probably common to all members of the ABC protein superfamily.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
85 c, Mutations at Arg 555 in NBD1 'tail` affect mean open burst (R555Q) and closed interburst (R555K) dwell times. Login to comment
90 b, Representative records from WT, single mutants R555K and T1246N, and double mutant R555K T1246N. Login to comment
97 Accordingly, the charge-conserving mutation R555K did not affect open burst duration (mean 0.39 ^ 0.04 s (n ¼ 26)). Login to comment
98 However, it substantially prolonged closed interburst duration (inversely related to opening rate) from 2.29 ^ 0.46 s (n ¼ 16) for WT to 8.53 ^ 1.23 s (n ¼ 15) for R555K (Fig. 2c, all measured at saturating [ATP]). Login to comment
99 On the basis of the evolutionary evidence suggesting the involvement of the side chain at this position in a conserved interaction (Fig. 2b), this slowing of channel opening could be explained if the R555K mutation were to weaken or remove a hydrogen bond between NBD1 and NBD2 that is absent in the closed, ground, state but present in the transition state for the channel opening reaction; the resulting destabilization of the transition state would increase the activation free energy (DG‡ ) for channel opening and hence decrease the opening rate. Login to comment
100 To quantify this suspected interaction between Arg 555 and Thr 1246 side chains (Fig. 2a), we applied double mutant-cycle analysis6,21 (see Supplementary Information), after mutating Arg 555 to Lys and Thr 1246 to Asn, both individually and jointly. Login to comment
102 If the two residues do not interact, the effects of mutating Arg 555 to Lys should be the same in a Thr 1246 background as in a T1246N background (and vice versa); that is, the effects of the single mutations should be independent and hence additive, and mutation-linked changes on parallel sides of the cycles should thus be equal. Login to comment
112 Current levels of the triple mutant R555K T1246N K1250R did not change when [ATP] was increased to 10 mM, indicating that 5 mM [ATP] was saturating. Login to comment
117 The apparent affinity for ATP was little influenced by the mutation R555K (R555K K0.5 ¼ 71 ^ 14 mM versus WT K0.5 ¼ 55 ^ 5 mM), but was reduced by the mutation T1246N (T1246N K0.5 ¼ 261 ^ 49 mM) by the same extent in the WT background as in the R555K background (R555K T1246N K0.5 ¼ 257 ^ 51 mM). Login to comment
124 The slowing of opening caused by the R555K mutation (Fig. 2c, above) corresponded to a 1.4 ^ 0.4kT increase in the activation energy barrier. Login to comment
133 Introducing the T1246N mutation into the K1250R background decreased Po, corresponding to destabilization of the open burst state by 2.5 ^ 1.0kT with respect to the closed state. However, adding the R555K mutation to T1246N-K1250R channels restored high stability of the open state (Fig. 4e, f). Login to comment
157 For constructs with very low Po (R555K and T1246N), we could not exclude the presence of unseen channels in the patch (even though the records lasted on average 6-7 min). Login to comment
158 The prolonged tib values we extract for R555K and T1246N channels are therefore most probably underestimates, and the real effects of the mutations are more severe (and, hence, jDDG‡ int(opening)j is actually larger) than the values we report. Login to comment

[hide] Processing of CFTR: traversing the cellular maze--... Pediatr Pulmonol. 2005 Jun;39(6):479-91. Amaral MD
Processing of CFTR: traversing the cellular maze--how much CFTR needs to go through to avoid cystic fibrosis?
Pediatr Pulmonol. 2005 Jun;39(6):479-91., [PMID:15765539]

Abstract [show]
Biosynthesis of the cystic fibrosis transmembrane conductance regulator (CFTR), like other proteins aimed at the cell surface, involves transport through a series of membranous compartments, the first of which is the endoplasmic reticulum (ER), where CFTR encounters the appropriate environment for folding, oligomerization, maturation, and export from the ER. After exiting the ER, CFTR has to traffic through complex pathways until it reaches the cell surface. Although not yet fully understood, the fine details of these pathways are starting to emerge, partially through identification of an increasing number of CFTR-interacting proteins (CIPs) and the clarification of their roles in CFTR trafficking and function. These aspects of CFTR biogenesis/degradation and by membrane traffic and CIPs are discussed in this review. Following this description of complex pathways and multiple checkpoints to which CFTR is subjected in the cell, the basic question remains of how much CFTR has to overcome these barriers and be functionally expressed at the plasma membrane to avoid CF. This question is also discussed here.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Although the simultaneous substitution of all four arginines by lysine (K) residues (4RK: R29K þ R516K þ R555K þ R766K) causes F508del-CFTR to function about one-third as efficiently as wt-CFTR, individual R/K substitutions at some of these positions, i.e., R29K30 and R555K,31 were also described as restoring F508del-CFTR function. Login to comment

[hide] Control of the CFTR channel's gates. Biochem Soc Trans. 2005 Nov;33(Pt 5):1003-7. Vergani P, Basso C, Mense M, Nairn AC, Gadsby DC
Control of the CFTR channel's gates.
Biochem Soc Trans. 2005 Nov;33(Pt 5):1003-7., [PMID:16246032]

Abstract [show]
Unique among ABC (ATP-binding cassette) protein family members, CFTR (cystic fibrosis transmembrane conductance regulator), also termed ABCC7, encoded by the gene mutated in cystic fibrosis patients, functions as an ion channel. Opening and closing of its anion-selective pore are linked to ATP binding and hydrolysis at CFTR's two NBDs (nucleotide-binding domains), NBD1 and NBD2. Isolated NBDs of prokaryotic ABC proteins form homodimers upon binding ATP, but separate after hydrolysis of the ATP. By combining mutagenesis with single-channel recording and nucleotide photolabelling on intact CFTR molecules, we relate opening and closing of the channel gates to ATP-mediated events in the NBDs. In particular, we demonstrate that two CFTR residues, predicted to lie on opposite sides of its anticipated NBD1-NBD2 heterodimer interface, are energetically coupled when the channels open but are independent of each other in closed channels. This directly links ATP-driven tight dimerization of CFTR's cytoplasmic NBDs to opening of the ion channel in the transmembrane domains. Evolutionary conservation of the energetically coupled residues in a manner that preserves their ability to form a hydrogen bond argues that this molecular mechanism, involving dynamic restructuring of the NBD dimer interface, is shared by all members of the ABC protein superfamily.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
62 The WT, the two single mutants (in our case R555K and T1246N) and the double mutant (R555K/T1246N) form the corners of a thermodynamic cycle (Figure 3, inset). Login to comment
68 The R555K mutation did not significantly affect the apparent affinity, while the T1246N mutation reduced it to the same degree whether the residue at position 555 was Arg or Lys. Login to comment
69 The effects of the Thr to Asn mutation in WT and mutant (R555K) background are thus similar, yielding a negligible energetic coupling between the two target residues ( Gint(unbound-bound) = 0.3 ± 0.5kT). Login to comment
79 (A) Representative records from WT, single mutants R555K and T1246N, and double mutant R555K/T1246N, activated with 300 nM cAMP-dependent protein kinase and 5 mM ATP. Login to comment
83 The same mutation, however, when introduced in the non-hydrolytic background that also contained the R555K mutation, did not significantly alter the closed- to-open equilibrium. Login to comment

[hide] CFTR (ABCC7) is a hydrolyzable-ligand-gated channe... Pflugers Arch. 2007 Feb;453(5):693-702. Epub 2006 Sep 26. Aleksandrov AA, Aleksandrov LA, Riordan JR
CFTR (ABCC7) is a hydrolyzable-ligand-gated channel.
Pflugers Arch. 2007 Feb;453(5):693-702. Epub 2006 Sep 26., [PMID:17021796]

Abstract [show]
As the product of the gene mutated in cystic fibrosis, the most common genetic disease of Caucasians, CFTR is an atypical ABC protein. From an evolutionary perspective, it is apparently a relatively young member of the ABC family, present only in metazoans where it plays a critical role in epithelial salt and fluid homeostasis. Functionally, the membrane translocation process it mediates, the passive bidirectional diffusion of small inorganic anions, is simpler than the vectorial transport of larger more complex substrates ("allocrites") by most ABC transporters. However, the control of the permeation pathway which cannot go unchecked is necessarily more stringent than in the case of the transporters. There is tight regulation by the phosphorylation/dephosphorylation of the unique CFTR R domain superimposed on the basic ABC regulation mode of ATP binding and hydrolysis at the dual nucleotide binding sites. As with other ABCC subfamily members, only the second of these sites is hydrolytic in CFTR. The phosphorylation and ATP binding/hydrolysis events do not strongly influence each other; rather, R domain phosphorylation appears to enable transduction of the nucleotide binding allosteric signal to the responding channel gate. ATP hydrolysis is not required for either the opening or closing gating transitions but efficiently clears the ligand-binding site enabling a new gating cycle to be initiated.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
144 In addition to these theoretical concerns, it is noted that the effect of the NBD1 signature mutation, R555K on the rate of opening is quite different from that reported previously by Teem et al. [74] and as measured in our laboratory. Login to comment

[hide] Revertant mutants G550E and 4RK rescue cystic fibr... Proc Natl Acad Sci U S A. 2006 Nov 21;103(47):17891-6. Epub 2006 Nov 10. Roxo-Rosa M, Xu Z, Schmidt A, Neto M, Cai Z, Soares CM, Sheppard DN, Amaral MD
Revertant mutants G550E and 4RK rescue cystic fibrosis mutants in the first nucleotide-binding domain of CFTR by different mechanisms.
Proc Natl Acad Sci U S A. 2006 Nov 21;103(47):17891-6. Epub 2006 Nov 10., 2006-11-21 [PMID:17098864]

Abstract [show]
The revertant mutations G550E and 4RK [the simultaneous mutation of four arginine-framed tripeptides (AFTs): R29K, R516K, R555K, and R766K] rescue the cell surface expression and function of F508del-cystic fibrosis (CF) transmembrane conductance regulator (-CFTR), the most common CF mutation. Here, we investigate their mechanism of action by using biochemical and functional assays to examine their effects on F508del and three CF mutations (R560T, A561E, and V562I) located within a conserved region of the first nucleotide-binding domain (NBD1) of CFTR. Like F508del, R560T and A561E disrupt CFTR trafficking. G550E rescued the trafficking defect of A561E but not that of R560T. Of note, the processing and function of V562I were equivalent to that of wild-type (wt)-CFTR, suggesting that V562I is not a disease-causing mutation. Biochemical studies revealed that 4RK generates higher steady-state levels of mature CFTR (band C) for wt- and V562I-CFTR than does G550E. Moreover, functional studies showed that the revertants rescue the gating defect of F508del-CFTR with different efficacies. 4RK modestly increased F508del-CFTR activity by prolonging channel openings, whereas G550E restored F508del-CFTR activity to wt levels by altering the duration of channel openings and closings. Thus, our data suggest that the revertants G550E and 4RK might rescue F508del-CFTR by distinct mechanisms. G550E likely alters the conformation of NBD1, whereas 4RK allows F508del-CFTR to escape endoplasmic reticulum retention/retrieval mediated by AFTs. We propose that AFTs might constitute a checkpoint for endoplasmic reticulum quality control.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 Revertant mutants G550E and 4RK rescue cystic fibrosis mutants in the first nucleotide-binding domain of CFTR by different mechanisms Mo´ nica Roxo-Rosa*† , Zhe Xu‡ , Andre´ Schmidt*† , Ma´rio Neto*, Zhiwei Cai‡ , Cla´udio M. Soares§ , David N. Sheppard‡ , and Margarida D. Amaral*†¶ *Department of Chemistry and Biochemistry, Faculty of Sciences, University of Lisbon, Campo Grande, 1749-016 Lisbon, Portugal; †Centre of Human Genetics, National Institute of Health Dr. Ricardo Jorge, Avenida Padre Cruz, 1649-016 Lisbon, Portugal; ‡Department of Physiology, School of Medical Sciences, University of Bristol, Bristol BS8 1TD, United Kingdom; and §Institute of Chemistry and Biological Technology, New University of Lisbon, 2781-901 Oeiras, Portugal Communicated by Michael J. Welsh, University of Iowa College of Medicine, Iowa City, IA, September 22, 2006 (received for review June 9, 2006) The revertant mutations G550E and 4RK [the simultaneous mutation of four arginine-framed tripeptides (AFTs): R29K, R516K, R555K, and R766K] rescue the cell surface expression and function of F508del-cystic fibrosis (CF) transmembrane conductance regulator (-CFTR), the most common CF mutation. Login to comment
22 Moreover, Chang et al. (25) rescued the trafficking and function of F508del-CFTR with the simultaneous mutation of the four arginine-framed tripeptides (AFTs) (R29QR31, R516YR518, R553AR555, and R764RR766) present in CFTR termed 4RK (R29K, R516K, R555K, and R766K). Login to comment
37 47 ͉ 17891-17896 and 4RK act by different mechanisms. To explore this possibility, we tested the effects of G550E and 4RK on three additional CF mutations within NBD1: R560T, A561E, and V562I.ʈ We selected for study these CF mutants because (i) these residues constitute a hot spot for disease-causing mutations (seven mutations are associated with these three residues࿣ ); (ii) A561E and R560T are the second and fourth most frequent mutations among Portuguese and Irish CF patients, respectively (28); (iii) like G550E and R555K (one of the 4RK mutants), these mutations affect residues located between the LSGGQ and Walker B motifs of NBD1, which are highly conserved across species; and (iv) they all lie within the same ␣-helix (H5; G550-Y563) within the ATP-binding cassette ␣-subdomain of NBD1 (29, 30). Login to comment
185 Interestingly, different patterns of channel gating have been reported for R555K-CFTR. Login to comment
186 Teem et al. (24) demonstrated that R555K increases the activity of wt-CFTR by extending the duration of bursts without altering the closed time interval between bursts. Login to comment
187 In contrast, Vergani et al. (4) showed that R555K slows the rate of channel opening by markedly prolonging the closed time interval between bursts. Login to comment
190 Of note, the work of Hegedus et al. (40), who studied F508del-CFTR in cis with R29K and R555K (called 2RK), suggests that the stability of F508del-2RK-CFTR is temperature-dependent. Login to comment

[hide] Diminished self-chaperoning activity of the DeltaF... PLoS Comput Biol. 2008 Feb 29;4(2):e1000008. Serohijos AW, Hegedus T, Riordan JR, Dokholyan NV
Diminished self-chaperoning activity of the DeltaF508 mutant of CFTR results in protein misfolding.
PLoS Comput Biol. 2008 Feb 29;4(2):e1000008., [PMID:18463704]

Abstract [show]
The absence of a functional ATP Binding Cassette (ABC) protein called the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) from apical membranes of epithelial cells is responsible for cystic fibrosis (CF). Over 90% of CF patients carry at least one mutant allele with deletion of phenylalanine at position 508 located in the N-terminal nucleotide binding domain (NBD1). Biochemical and cell biological studies show that the DeltaF508 mutant exhibits inefficient biosynthetic maturation and susceptibility to degradation probably due to misfolding of NBD1 and the resultant misassembly of other domains. However, little is known about the direct effect of the Phe508 deletion on the NBD1 folding, which is essential for rational design strategies of cystic fibrosis treatment. Here we show that the deletion of Phe508 alters the folding dynamics and kinetics of NBD1, thus possibly affecting the assembly of the complete CFTR. Using molecular dynamics simulations, we find that meta-stable intermediate states appearing on wild type and mutant folding pathways are populated differently and that their kinetic accessibilities are distinct. The structural basis of the increased misfolding propensity of the DeltaF508 NBD1 mutant is the perturbation of interactions in residue pairs Q493/P574 and F575/F578 found in loop S7-H6. As a proof-of-principle that the S7-H6 loop conformation can modulate the folding kinetics of NBD1, we virtually design rescue mutations in the identified critical interactions to force the S7-H6 loop into the wild type conformation. Two redesigned NBD1-DeltaF508 variants exhibited significantly higher folding probabilities than the original NBD1-DeltaF508, thereby partially rescuing folding ability of the NBD1-DeltaF508 mutant. We propose that these observed defects in folding kinetics of mutant NBD1 may also be modulated by structures separate from the 508 site. The identified structural determinants of increased misfolding propensity of NBD1-DeltaF508 are essential information in correcting this pathogenic mutant.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 However, even in the presence of correcting mutants (G550E, R553Q, and R555K) [10,15-17] in our model of NBD1-DF508, we still observe a significant change in dynamics at the folding transition. Login to comment

[hide] Atomic model of human cystic fibrosis transmembran... Cell Mol Life Sci. 2008 Aug;65(16):2594-612. Mornon JP, Lehn P, Callebaut I
Atomic model of human cystic fibrosis transmembrane conductance regulator: membrane-spanning domains and coupling interfaces.
Cell Mol Life Sci. 2008 Aug;65(16):2594-612., [PMID:18597042]

Abstract [show]
We describe herein an atomic model of the outward-facing three-dimensional structure of the membrane-spanning domains (MSDs) and nucleotide-binding domains (NBDs) of human cystic fibrosis transmembrane conductance regulator (CFTR), based on the experimental structure of the bacterial transporter Sav1866. This model, which is in agreement with previous experimental data, highlights the role of some residues located in the transmembrane passages and directly involved in substrate translocation and of some residues within the intracellular loops (ICL1-ICL4) making MSD/NBD contacts. In particular, our model reveals that D173 ICL1 and N965 ICL3 likely interact with the bound nucleotide and that an intricate H-bond network (involving especially the ICL4 R1070 and the main chain of NBD1 F508) may stabilize the interface between MSD2 and the NBD1F508 region. These observations allow new insights into the ATP-binding sites asymmetry and into the molecular consequences of the F508 deletion, which is the most common cystic fibrosis mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 These mutations are actually located outside the NBD1 structure core, in the regulatory insertion (F409L, F429S, F433L) and extension (R667H), or in the signature sequence region (G550E, R553Q, R555K), whose local conformations in the crystal structure and in our model are perfectly superimposable. Login to comment

[hide] Review. ATP hydrolysis-driven gating in cystic fib... Philos Trans R Soc Lond B Biol Sci. 2009 Jan 27;364(1514):247-55. Muallem D, Vergani P
Review. ATP hydrolysis-driven gating in cystic fibrosis transmembrane conductance regulator.
Philos Trans R Soc Lond B Biol Sci. 2009 Jan 27;364(1514):247-55., 2009-01-27 [PMID:18957373]

Abstract [show]
Proteins belonging to the ATP-binding cassette superfamily couple ATP binding and hydrolysis at conserved nucleotide-binding domains (NBDs) to diverse cellular functions. Most superfamily members are transporters, while cystic fibrosis transmembrane conductance regulator (CFTR), alone, is an ion channel. Despite this functional difference, recent results have suggested that CFTR shares a common molecular mechanism with other members. ATP binds to partial binding sites on the surface of the two NBDs, which then associate to form a NBD dimer, with complete composite catalytic sites now buried at the interface. ATP hydrolysis and gamma-phosphate dissociation, with the loss of molecular contacts linking the two sides of the composite site, trigger dimer dissociation. The conformational signals generated by NBD dimer formation and dissociation are transmitted to the transmembrane domains where, in transporters, they drive the cycle of conformational changes that translocate the substrate across the membrane; in CFTR, they result in opening and closing (gating) of the ion-permeation pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
99 The WT, the two single mutants (R555K and T1246N) and the double mutant (R555K T1246N) form the corners of a thermodynamic cycle (figure 4a). Login to comment
116 However, the same T to N mutation, when introduced in the R555K K1250R non-hydrolytic background, did not significantly alter the closed- to-open equilibrium. Login to comment
119 The apparent dissociation constant obtained from [ATP] dependence of opening rate is, for CFTR (Vergani et al. 2005), a reasonable estimate for the real dissociation constant for the ATP binding reaction WT CFTR R555K R555K T1246N T1246N 0.4 pA 20 s ∆∆int = ∆3-∆1 = ∆4-∆2 WT ∆1 ∆3 ∆2 ∆4 T1246N R555K R555K T1246N (a) (c) OH T H2N H2NNH2 + COOH NH R H2NCOOH WT CFTR H2NCOOH NH3 + K NH2 H2NCOOH O N R555K T1246N (b) Figure 4. Login to comment
139 The R555K mutation did not significantly affect apparent affinity, while the T1246N mutation reduced it to the same degree whether the residue at position 555 was WT R or mutant K. The effects of the T to N mutation in WT and mutant background are thus similar, yielding a negligible energetic coupling between the two target residues (DDGint(unbound-bound)Z0.3G0.5 kT). Login to comment
97 The WT, the two single mutants (R555K and T1246N) and the double mutant (R555K T1246N) form the corners of a thermodynamic cycle (figure 4a). Login to comment
114 However, the same T to N mutation, when introduced in the R555K K1250R non-hydrolytic background, did not significantly alter the closed- to-open equilibrium. Login to comment
117 The apparent dissociation constant obtained from [ATP] dependence of opening rate is, for CFTR (Vergani et al. 2005), a reasonable estimate for the real dissociation constant for the ATP binding reaction WT CFTR R555K R555K T1246N T1246N 0.4 pA 20 s ∆∆int = ∆3-∆1 = ∆4-∆2 WT ∆1 ∆3 ∆2 ∆4 T1246N R555K R555K T1246N (a) (c) OH T H2N H2NNH2 + COOH NH R H2NCOOH WT CFTR H2NCOOH NH3 + K NH2 H2NCOOH O N R555K T1246N (b) Figure 4. Login to comment
137 The R555K mutation did not significantly affect apparent affinity, while the T1246N mutation reduced it to the same degree whether the residue at position 555 was WT R or mutant K. The effects of the T to N mutation in WT and mutant background are thus similar, yielding a negligible energetic coupling between the two target residues (DDGint(unbound- bound)Z0.3G0.5 kT). Login to comment

[hide] Cooperative assembly and misfolding of CFTR domain... Mol Biol Cell. 2009 Apr;20(7):1903-15. Epub 2009 Jan 28. Du K, Lukacs GL
Cooperative assembly and misfolding of CFTR domains in vivo.
Mol Biol Cell. 2009 Apr;20(7):1903-15. Epub 2009 Jan 28., [PMID:19176754]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) architecture consists of two membrane spanning domains (MSD1 and -2), two nucleotide binding domains (NBD1 and -2), and a regulatory (R) domain. Several point mutations lead to the channel misprocessing, with limited structural perturbation of the mutant domain. To gain more insight into the basis of CFTR folding defect, the contribution of domain-wise and cooperative domain folding was assessed by determining 1) the minimal domain combination that is recognized as native and can efficiently escape the endoplasmic reticulum (ER) retention and 2) the impact of mutation on the conformational coupling among domains. One-, two-, three-, and most of the four-domain assemblies were retained at the ER. Solubilization mutations, however, rescued the NBD1 processing defect conceivably by thermodynamic stabilization. The smallest folding unit that traversed the secretory pathway was composed of MSD1-NBD1-R-MSD2 as a linear or split polypeptide. Cystic fibrosis-causing missense mutations in the MSD1, NBD1, MSD2, and NBD2 caused conformational defect in multiple domains. We propose that cooperative posttranslational folding is required for domain stabilization and provides a plausible explanation for the global misfolding caused by point mutations dispersed along the full-length CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
186 Replacement of critical Arg with Lys residues in the MSD1 (R29K) and NBD1 (R516K and R555K) failed to revert the processing defect of M1(RK) and M1-N1(3RK) (Supplemental Figure S5), whereas it partially rescued the ⌬F508 CFTR ER retention (Owsianik et al., 2003; Roxo-Rosa et al., 2006). Login to comment

[hide] Molecular dynamics analysis of the wild type and d... Biochimie. 2010 Jan;92(1):51-7. Epub 2009 Sep 23. Bisignano P, Moran O
Molecular dynamics analysis of the wild type and dF508 mutant structures of the human CFTR-nucleotide binding domain 1.
Biochimie. 2010 Jan;92(1):51-7. Epub 2009 Sep 23., [PMID:19781595]

Abstract [show]
Mutations of CFTR (Cystic Fibrosis transmembrane Conductance Regulator), a membrane protein expressed in the epithelium that forms a chloride channel, cause a chronic, developmental and hereditary disease, known as Cystic Fibrosis. The most common mutation is the deletion of F508, a residue present in the first nucleotide binding domain (NBD1). We studied the thermodynamic properties of NBD1 wild type (WT) and mutant (dF508), starting from the crystallographic structures in the Protein Data Bank using the techniques of Molecular Dynamics. The two structures were similarly stable at room temperature, showed no change enthalpy or entropy, maintaining the same dimensions and the same order of magnitude of atomic fluctuations; the only difference was the energy of interaction with the solvent, in which the mutant appears slightly disadvantaged; these differences between the two models are at microscopic level and relate to local variations (in residues at 8 A from F508) of the surface exposed to the solvent. We also found a decrease in the mutant of about 30 times of affinity for ATP compared to WT.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Structures were obtained by X-ray crystallography, at a resolution of 2.55 Å and 2.30 Å for WT and mutant, respectively. These structures are both characterized by the presence of seven mutations: F409L, F429S, F433L, G550E, R553Q, R555K and H667R which make them more soluble and therefore more easily crystallizable [6,7]. Login to comment
152 The chosen PDB entries,1XMJ and 2BBO, contain seven mutations, F409L, F429S, F433L, G550E, R553Q, R555K and H667R, that were introduced to the NBD1, wild type and dF508 used for this study, to facilitate the crystallization of the polypeptide [6]. Login to comment
154 It is interesting to notice that several of these mutations (F429S, G550E, R555K), have been identified as ''rescue`` mutations [18-20], that improve the expression of the defective dF508 CFTR. Login to comment

[hide] NMR evidence for differential phosphorylation-depe... EMBO J. 2010 Jan 6;29(1):263-77. Epub 2009 Nov 19. Kanelis V, Hudson RP, Thibodeau PH, Thomas PJ, Forman-Kay JD
NMR evidence for differential phosphorylation-dependent interactions in WT and DeltaF508 CFTR.
EMBO J. 2010 Jan 6;29(1):263-77. Epub 2009 Nov 19., 2010-01-06 [PMID:19927121]

Abstract [show]
The most common cystic fibrosis (CF)-causing mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) is deletion of Phe508 (DeltaF508) in the first of two nucleotide-binding domains (NBDs). Nucleotide binding and hydrolysis at the NBDs and phosphorylation of the regulatory (R) region are required for gating of CFTR chloride channel activity. We report NMR studies of wild-type and DeltaF508 murine CFTR NBD1 with the C-terminal regulatory extension (RE), which contains residues of the R region. Interactions of the wild-type NBD1 core with the phosphoregulatory regions, the regulatory insertion (RI) and RE, are disrupted upon phosphorylation, exposing a potential binding site for the first coupling helix of the N-terminal intracellular domain (ICD). Phosphorylation of DeltaF508 NBD1 does not as effectively disrupt interactions with the phosphoregulatory regions, which, along with other structural differences, leads to decreased binding of the first coupling helix. These results provide a structural basis by which phosphorylation of CFTR may affect the channel gating of full-length CFTR and expand our understanding of the molecular basis of the DeltaF508 defect.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
50 Resonance assignment of G550E/R553M/R555K NBD1-RE The weak intensity of many of the resonances and the limited stability of the WT NBD1-RE NMR samples precluded resonance assignment. Login to comment
51 Therefore, we used a variant of NBD1-RE containing the revertant mutations, G550E (DeCarvalho et al, 2002), R553M (Teem et al, 1993), and R555K (Teem et al, 1996). Login to comment
53 The G550E/R553M/R555K mutant NBD1-RE could be concentrated to B600 mM and was stable for 420 days, allowing NMR data for backbone resonance assignment to be recorded. Login to comment
54 More resonances are present in the spectra of the G550E/R553M/R555K mutant compared with WT NBD1-RE (Supplementary Figure 3), pointing to less severe broadening than in the spectra of WT protein because of differences in motion on the ms-ms timescale. Login to comment
55 Although not as extensive as observed for the WT NBD1-RE, spectra of the G550E/R553M/R555K mutant also show broadening, with some of the weak resonances having elevated R2 rates from ms-ms timescale motion (Supplementary Table 1). Login to comment
56 Relaxation data recorded on 360 and 550 mM samples of the G550E/R553M/R555K mutant were very similar for most residues, indicating that the elevated R2 rates are not caused by sample aggregation at high concentrations (Supplementary Table 1). Login to comment
57 Many resonances are weak, especially in the spectra of the lower concentrated sample of the G550E/ R553M/R555K mutant (i.e., Val562, Asp572, and Ser573), precluding reliable R2 values from being obtained for these residues. Login to comment
58 Importantly, for resonances observed for both the WT and G550E/R553M/R555K mutant forms of the protein, backbone chemical shifts are very similar (Supplementary Figure 3), allowing the straightforward transfer of assignments for most resonances. Login to comment
59 Using triple resonance experiments and specific labelling on Leu, the combination of Gly, Ser, Asp, and Asn residues, or aromatic residues, we have assigned 70% of the 1 HN and 15 N resonances in the G550E/R553M/R555K mutant and 60% of the 1 HN and 15 N resonances in WT NBD1-RE (Supplementary Figure 4a). Login to comment
79 The ribbon is coloured blue for residues for which we have resonance assignments, light grey for those not assigned, and dark grey for those assigned in the G550E/R553M/R555K mutant but not transferable to WT NBD1-RE. Login to comment
86 The secondary structures of the G550E/R553M/R555K mutant, WT, and DF508 NBD1-RE were determined using 1 HN and 15 N chemical shifts, as well as 13 Ca, 13 Cb, and 13 CO chemical shifts where available (Supplementary Figure 5). Login to comment
87 As expected from the similarity of the NMR spectra, secondary structures of the G550E/R553M/R555K mutant, WT, and DF508 NBD1-RE proteins are very similar and largely agree with that of the crystal structures. Login to comment
92 Interestingly, the unassigned residues in the G550E/ R553M/R555K mutant map to distinct regions on NBD1-RE (Supplementary Figure 4b). Login to comment
227 The significant destabilization of all forms of phosphorylated NBD1-RE (WT, DF508, and the G550E/R553M/R555K) precludes NMR resonance assignment required to further test this hypothesis. Login to comment
265 Although the exact positions of the species may change depending on the type of data used, these data reflect the relative positions of the G550E/R553M/R555K mutant, WT, and DF508 NBD1-RE proteins. Login to comment
291 Materials and methods Sample preparation NBD1 from murine CFTR (residues 389-673 or 389-653) with the WT sequence, lacking Phe508 (DF508), or containing the revertant mutations G550E, R553M, and R555K (G550E/R553M/R555K) (Teem et al, 1993, 1996; Roxo-Rosa et al, 2006), was expressed as a 6x-His-Smt (SUMO) (Mossessova and Lima, 2000) fusion at 16 1C in BL21(DE3) Codon Plus cells grown in minimal media with 15 N- NH4Cl, 13 C-glucose, and/or 70% 2 H2O as required for NMR studies, and purified using standard chromatographic techniques, as previously described (Lewis et al, 2004, 2005). Login to comment
294 The G550E/R553M/R555K NBD1-RE mutant was used only for backbone resonance assignment (see Results). Login to comment
295 Purified WT, DF508, and G550E/R553M/R555K mutant proteins were exchanged into NMR buffer containing 20 mM Na phos, pH 7.0, 150 mM NaCl, 5 mM MgCl2, ATP or AMP-PNP, with 2 or 4% (v/v) glycerol. Login to comment
319 Backbone H, N, C, and Ca, and side chain Cb assignments for G550E/R553M/R555K NBD1-RE were obtained from standard triple resonance TROSY-based experiments (Sattler et al, 1999; Kanelis et al, 2001) and a 15 N-edited NOESY-HSQC spectrum (200 ms) recorded on samples of 0.5-0.6 mM G550E/R553M/R555K NBD1-RE that were uniformly 15 N and 13 C labelled and fractionally 2 H labelled to B50%. Login to comment
326 NMR assignments NMR resonance assignments for G550E/R553M/R555K NBD1-RE, WT NBD1-RE, and DF508 NBD1-RE have been deposited in the BioMag Res Bank under the accession codes 16367, 16393, and 16394, respectively. Login to comment

[hide] Structure and dynamics of NBD1 from CFTR character... J Mol Biol. 2010 Feb 19;396(2):406-30. Epub 2009 Nov 26. Lewis HA, Wang C, Zhao X, Hamuro Y, Conners K, Kearins MC, Lu F, Sauder JM, Molnar KS, Coales SJ, Maloney PC, Guggino WB, Wetmore DR, Weber PC, Hunt JF
Structure and dynamics of NBD1 from CFTR characterized using crystallography and hydrogen/deuterium exchange mass spectrometry.
J Mol Biol. 2010 Feb 19;396(2):406-30. Epub 2009 Nov 26., 2010-02-19 [PMID:19944699]

Abstract [show]
The DeltaF508 mutation in nucleotide-binding domain 1 (NBD1) of the cystic fibrosis transmembrane conductance regulator (CFTR) is the predominant cause of cystic fibrosis. Previous biophysical studies on human F508 and DeltaF508 domains showed only local structural changes restricted to residues 509-511 and only minor differences in folding rate and stability. These results were remarkable because DeltaF508 was widely assumed to perturb domain folding based on the fact that it prevents trafficking of CFTR out of the endoplasmic reticulum. However, the previously reported crystal structures did not come from matched F508 and DeltaF508 constructs, and the DeltaF508 structure contained additional mutations that were required to obtain sufficient protein solubility. In this article, we present additional biophysical studies of NBD1 designed to address these ambiguities. Mass spectral measurements of backbone amide (1)H/(2)H exchange rates in matched F508 and DeltaF508 constructs reveal that DeltaF508 increases backbone dynamics at residues 509-511 and the adjacent protein segments but not elsewhere in NBD1. These measurements also confirm a high level of flexibility in the protein segments exhibiting variable conformations in the crystal structures. We additionally present crystal structures of a broader set of human NBD1 constructs, including one harboring the native F508 residue and others harboring the DeltaF508 mutation in the presence of fewer and different solubilizing mutations. The only consistent conformational difference is observed at residues 509-511. The side chain of residue V510 in this loop is mostly buried in all non-DeltaF508 structures but completely solvent exposed in all DeltaF508 structures. These results reinforce the importance of the perturbation DeltaF508 causes in the surface topography of NBD1 in a region likely to mediate contact with the transmembrane domains of CFTR. However, they also suggest that increased exposure of the 509-511 loop and increased dynamics in its vicinity could promote aggregation in vitro and aberrant intermolecular interactions that impede trafficking in vivo.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Comparing these hNBD1 structures to each other and to wild-type murine NBD1 (mNBD1) suggested that the overall fold of NBD1 was retained in the ΔF508 mutant and that structural changes were localized near the site of the deleted phenylalanine residue.5 However, three of these solubility-enhancing mutations (G550E/ R553Q/R555K) were known to be in vivo suppressors of the trafficking defect caused by the ΔF508 mutation.51-53 Compared to mNBD1, no significant structural perturbations were observed in the vicinity of these suppressor mutation sites in the crystal structures of hNBD1, suggesting that they act indirectly to suppress the effects of the ΔF508 mutation.5 Indeed, folding studies of a wider variety of hNBD1 variants, including several without trafficking-suppressor mutations, indicated that these mutations increase the thermodynamic stability of NBD1,5 which could account for improved folding and maturation in vivo. Login to comment
41 This structure was obtained from the same hNBD1-7a protein construct that yielded the previously reported ΔF508 structure, which has seven solubilizing mutations including the three trafficking-suppressor mutations G550E/R553Q/R555K. Login to comment
133 The structures harboring the G550E/R553Q/ R555K suppressor mutation set are shown in bright green (F508) and bright red (ΔF508). Login to comment
139 This region contains F508, the LSGGQ signature sequence (at residues 548-552), and the G550E/ R553Q/R555K suppressor mutation sites. Login to comment
300 The G550E/R553Q/ R555K mutation set has been demonstrated to suppress the defective trafficking of ΔF508-CFTR (Fig. 11).51-53 Based on detailed structural, dynamic, and thermodynamic considerations presented in section ST12 in the Supplementary Information, we conclude that these suppressor mutations are unlikely to directly reverse a cryptic structural Fig. 9. Login to comment
352 The trafficking-suppressor mutations (G550E/R553Q/R555K) overlap the LSGGQ signature sequence located at residues 548-552 in hNBD1. Login to comment

[hide] Interplay between ER exit code and domain conforma... Mol Biol Cell. 2010 Feb 15;21(4):597-609. Epub 2009 Dec 23. Roy G, Chalfin EM, Saxena A, Wang X
Interplay between ER exit code and domain conformation in CFTR misprocessing and rescue.
Mol Biol Cell. 2010 Feb 15;21(4):597-609. Epub 2009 Dec 23., 2010-02-15 [PMID:20032308]

Abstract [show]
Multiple mutations in cystic fibrosis transmembrane conductance regulator (CFTR) impair its exit from the endoplasmic reticulum (ER). We compared two processing mutants: DeltaF508 and the ER exit code mutant DAA. Although both have severe kinetic processing defect, DAA but not DeltaF508 has substantial accumulation in its mature form, leading to higher level of processing at the steady state. DAA has much less profound conformational abnormalities. It has lower Hsp70 association and higher post-ER stability than DeltaF508. The ER exit code is necessary for DeltaF508 residual export and rescue. R555K, a mutation that rescues DeltaF508 misprocessing, improves Sec24 association and enhances its post-ER stability. Using in situ limited proteolysis, we demonstrated a clear change in trypsin sensitivity in DeltaF508 NBD1, which is reversed, together with that of other domains, by low temperature, R555K or both. We observed a conversion of the proteolytic pattern of DAA from the one resembling DeltaF508 to the one similar to wild-type CFTR during its maturation. Low temperature and R555K are additive in improving DeltaF508 conformational maturation and processing. Our data reveal a dual contribution of ER exit code and domain conformation to CFTR misprocessing and underscore the importance of conformational repair in effective rescue of DeltaF508.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 R555K, a mutation that rescues ⌬F508 misprocessing, improves Sec24 association and enhances its post-ER stability. Login to comment
7 Using in situ limited proteolysis, we demonstrated a clear change in trypsin sensitivity in ⌬F508 NBD1, which is reversed, together with that of other domains, by low temperature, R555K or both. Login to comment
9 Low temperature and R555K are additive in improving ⌬F508 conformational maturation and processing. Login to comment
50 The pcDNA3.1(ϩ)-CFTR-⌬F508/R555K and pcDNA3.1(ϩ)- CFTR-⌬F508/DAA were constructed by introducing R555K and DAA, respectively, into pcDNA3.1(ϩ)-CFTR-⌬F508. Login to comment
51 The pcDNA3.1(ϩ)-CFTR-⌬F508/ R555K/DAA was constructed by introducing DAA into pcDNA3.1(ϩ)-CFTR- ⌬F508/R555K. Login to comment
53 Finally, the pcDNA3.1(ϩ)- CFTR-⌬F508/R29K/R555K was constructed by replacing the BspeI-HpaI fragment of pcDNA3.1(ϩ)-CFTR-⌬F508/R29K with the corresponding fragment from pcDNA3.1(ϩ)-CFTR-⌬F508/R555K. Login to comment
65 HEK293 cells stably expressing DAA, ⌬F508/DAA and ⌬F508/R555K CFTR were generated by transfecting HEK293 cells with specific CFTR expression plasmids and selecting in the presence of 400 ␮g/ml G418 (A. Login to comment
68 BHK cells stably expressing ⌬F508/R555K CFTR (BHK-⌬F/R555K) were generated by transfecting BHK cells with the CFTR expression plasmid and selecting with 400 ␮g/ml G418. Login to comment
207 R555K Rescues ⌬F508 CFTR by Improving Both Export and Post-ER Stability R555K, alone (Teem et al., 1996) or in combination with R29K (Hegedus et al., 2006) rescues ⌬F508 CFTR. Login to comment
208 We found that R29K does not improve ⌬F508 processing, nor does it contribute to ⌬F508 rescue when combined with R555K (2RK) in HEK293 cells and this is true at both 37 and 30°C (Figure 7A). Login to comment
209 In BHK cells, R29K alone inhibits ⌬F508 processing but only slightly enhances ⌬F508 processing when combined with R555K at 37°C (Supplemental Figure 2). Login to comment
210 Of note, in HEK293 cells, the combination of low temperature and R555K additively increases the processing of ⌬F508 based on the percent of total band C (Figure 7A), whereas the enhancement in processing by the combination of the two is much less in BHK cells (Supplemental Figure 2). Login to comment
211 Consistent with the role of the "DAD" motif as the ER exit code in the context of ⌬F508 CFTR, the enhanced processing of ⌬F508 CFTR by introducing R555K at both 37 and 30°C is abolished by further introduction of DAA mutation (Figure 7B). Login to comment
212 To probe the mechanism of R555K rescue of ⌬F508 CFTR, we first observed the kinetic accumulation of ⌬F508/R555K in bands B and C and compared it with that of ⌬F508. Login to comment
213 Although the rates of accumulation in band B are largely similar between the two forms of CFTR, R555K significantly increases the accumulation of ⌬F508 CFTR in band C (Figure 7C), suggesting increased export and/or post-ER stability. Login to comment
214 CHX chase indicated a moderate increase in the post-ER stability by R555K (Figure 7D), and CFTR quantitative co-immunoprecipitation revealed an increase in association with Sec24 (Figure 7E). Login to comment
215 These results suggest that R555K rescues ⌬F508 CFTR through enhancing both export and post-ER stability. Login to comment
216 Rescue of ⌬F508 CFTR by Low Temperature or R555K Is Accompanied by the Enhancement in Global Conformational Maturation We probed domain conformation of ⌬F508 CFTR after rescue with low temperature, R555K, or both using in situ limited proteolysis. Login to comment
220 The introduction of R555K has a similar effect (Figure 8Ac), suggesting that R555K substitution alters the folding of ⌬F508 CFTR in a way that achieves a comparable level of conformational maturation as the low-temperature rescue. Login to comment
221 Although "⌬F508, 30°C", "⌬F508/R555K," and "DAA" have comparable distribution between bands B and C, at the steady state, the relative intensity of the 37-kDa band is higher and the 42-kDa fragments are more resistant to tryp- Figure 5. Login to comment
233 Notably, when low temperature is combined with R555K in HEK293 cells, we have observed a dramatic increase in the trypsin resistance of the 42-kDa fragments and an increased relative intensity of the 37-kDa band, which together lead to a tryptic pattern similar to wild-type CFTR (Figure 8A, d and e). Login to comment
238 In contrast, R555K substitution results in a more uniform tryptic pattern (Figure 8Ah). Login to comment
239 Although the 30-kDa fragment typical of wild-type conformation is now clearly present (black arrowhead), the 34-kDa common band that is present in ⌬F508, DAA and wild-type CFTR is greatly diminished (Figure 8A, f-h, gray arrowheads), suggesting that R555K produces an additional conformational change in NBD2. Login to comment
240 The combination of low temperature and R555K did not produce additional conformational correction in NBD2 over what has been achieved by R555K alone (Figure 8A, h and i). Login to comment
241 Taken together, we show that rescue of ⌬F508 by low temperature or R555K is associated with improved conformational maturation in multiple domains. Login to comment
266 To test the relationship between ⌬F508 rescue and its domain conformation, we conducted in situ limited proteolysis on microsomes prepared from BHK-WT cells, BHK-⌬F cells incubated at 37 or 30°C, and BHK-⌬F/R555K cells. Login to comment
271 In contrast, BHK cells stably expressing ⌬F508/R555K showed a clear appearance of the 37-kDa bands at high trypsin concentrations (Figure 9Bd, black arrowhead). Login to comment
274 In contrast, R555K was able to restore the 50-kDa pattern to wild-type level. Login to comment
277 Parallel to the behavior of the amino terminal module, reducing temperature did not lead to the appearance of the 30-kDa fragment (Figure 9Bg) but R555K did (Figure 9Bh). Login to comment
284 R555K improves export and post-ER stability of ⌬F508 CFTR. Login to comment
285 (A) HEK293 cells were transiently transfected with ⌬F, ⌬F/ R29K, ⌬F/R555K and ⌬F/R29K/R555K (⌬F/ 2RK) and cultured at 37°C for 20 h (37°C), or further switched to 30°C and incubated for an additional 16 h (30°). Login to comment
290 (B) HEK293 cells were transiently transfected with ⌬F, ⌬F/R555K and ⌬F/ R555K/DAA CFTR. Login to comment
295 (C) HEK293 cells were transiently transfected with ⌬F or ⌬F/ R555K CFTR and incubated at 37°C for the indicated time. Login to comment
300 (D) CHX chase on HEK293 cells stably expressing ⌬F and ⌬F/R555K was performed and quantified as described in Figure 2. Login to comment
301 (E) HEK293 cells were transiently transfected with ⌬F or ⌬F/R555K. Login to comment
318 3) The pattern of ⌬F508 CFTR reverts to wild-type-like upon rescue by low temperature or R555K or both in HEK293 cells (Figure 8). Login to comment
326 Low temperature and R555K promote the conformational maturation of ⌬F508 CFTR in HEK293 cells. Login to comment
328 For ⌬F, 30°C and ⌬F/R555K, 30°C, cells were incubated at 30°C for 16 h before the preparation of microsomes. Login to comment
333 ⌬F508 CFTR has reduced coupling to Sec24, which is reversed by low temperature (Wang et al., 2004, 2008) or R555K (Figure 7E). Login to comment
337 We found that R29K does not contribute to ⌬F508 rescue in HEK 293 cells (Figure 7A) but slightly improves ⌬F508 rescue only in combination with R555K in BHK cells (Supplemental Figure 2). Login to comment
338 R555K rescues ⌬F508 CFTR by improving its coupling to COPII and moderately increasing its post-ER stability (Figure 7, D and E). Login to comment
343 Instead, like other second site mutations in NBD1, R555K and R553M substitutions might alter the conformation of CFTR in a way that repairs ⌬F508 conformation defects. Login to comment
344 The ER exit code "DAD", F508, and many ⌬F508 rescuing mutations (including R555K and R553M) reside in NBD1. Login to comment
346 This is partly attributable to the inclusion of multiple "solubilization mutations" into ⌬F508 NBD1 to facilitate its purification (Lewis et al., 2005), several of which, including R555K, rescue the ⌬F508 export and channel gating defects (Pissarra et al., 2008). Login to comment
361 Although ⌬F508 mutation initiates a global conformational change from NBD1, R555K, originating in same domain, reverses the global conformational defect. Login to comment
363 Reducing the temperature produces a similar effect on ⌬F508 CFTR conformation as R555K in HEK293 cells (Figure 8). Login to comment
377 Rescue maneuvers such as low temperature and R555K restore both its ER export (Figure 7E; Wang et al., 2004) and post-ER stability (Figure 7D; Sharma et al., 2001; Varga et al., 2008), and these processes are highly dependent upon the ER exit code "DAD" (Figures 6 and 7B). Login to comment
381 R555K improves the ER export (Figure 7E), post-ER stability (Figure 7D), and channel gating (Teem et al., 1996) of ⌬F508 CFTR. Login to comment
386 Combining R555K with low-temperature additively improves the conformational maturation of ⌬F508 CFTR (Figure 8) and its processing (Figure 7A) in HEK293 cells. Login to comment

[hide] Structures of a minimal human CFTR first nucleotid... Protein Eng Des Sel. 2010 May;23(5):375-84. Epub 2010 Feb 11. Atwell S, Brouillette CG, Conners K, Emtage S, Gheyi T, Guggino WB, Hendle J, Hunt JF, Lewis HA, Lu F, Protasevich II, Rodgers LA, Romero R, Wasserman SR, Weber PC, Wetmore D, Zhang FF, Zhao X
Structures of a minimal human CFTR first nucleotide-binding domain as a monomer, head-to-tail homodimer, and pathogenic mutant.
Protein Eng Des Sel. 2010 May;23(5):375-84. Epub 2010 Feb 11., [PMID:20150177]

Abstract [show]
Upon removal of the regulatory insert (RI), the first nucleotide binding domain (NBD1) of human cystic fibrosis transmembrane conductance regulator (CFTR) can be heterologously expressed and purified in a form that remains stable without solubilizing mutations, stabilizing agents or the regulatory extension (RE). This protein, NBD1 387-646(Delta405-436), crystallizes as a homodimer with a head-to-tail association equivalent to the active conformation observed for NBDs from symmetric ATP transporters. The 1.7-A resolution X-ray structure shows how ATP occupies the signature LSGGQ half-site in CFTR NBD1. The DeltaF508 version of this protein also crystallizes as a homodimer and differs from the wild-type structure only in the vicinity of the disease-causing F508 deletion. A slightly longer construct crystallizes as a monomer. Comparisons of the homodimer structure with this and previously published monomeric structures show that the main effect of ATP binding at the signature site is to order the residues immediately preceding the signature sequence, residues 542-547, in a conformation compatible with nucleotide binding. These residues likely interact with a transmembrane domain intracellular loop in the full-length CFTR channel. The experiments described here show that removing the RI from NBD1 converts it into a well-behaved protein amenable to biophysical studies yielding deeper insights into CFTR function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
226 The 389-678(F409L, F429S, F433L, G550E, R553Q, R555K, H667R) (hNBD1-7a) structures are shown without (dark blue) and with the DF508 mutation (light blue) (H. Lewis, in preparation). Login to comment

[hide] Restoration of domain folding and interdomain asse... FASEB J. 2010 Aug;24(8):3103-12. Epub 2010 Mar 16. He L, Aleksandrov LA, Cui L, Jensen TJ, Nesbitt KL, Riordan JR
Restoration of domain folding and interdomain assembly by second-site suppressors of the DeltaF508 mutation in CFTR.
FASEB J. 2010 Aug;24(8):3103-12. Epub 2010 Mar 16., [PMID:20233947]

Abstract [show]
Deletion of PHE508 (DeltaF508) from the first nucleotide-binding domain (NBD1) of CFTR, which causes most cystic fibrosis, disrupts the folding and assembly of the protein. Although the folding pathways and yield of isolated NBD1 are altered, its global structure is not, and details of the changes in the rest of the protein remain unclear. To gain further insight into how the whole mutant protein is altered, we have determined the influence of known second-site suppressor mutations in NBD1 on the conformation of this domain and key interfaces between domains. We found that the suppressors restored maturation of only those processing mutations located in NBD1, but not in other domains, including those in the C-terminal cytoplasmic loop of the second membrane-spanning domain, which forms an interface with the NBD1 surface. Nevertheless, the suppressors promoted the formation of this interface and others in the absence of F508. The suppressors restored maturation in a DeltaF508 construct from which NBD2 was absent but to a lesser extent than in the full-length, indicating that DeltaF508 disrupts interactions involving NBD2, as well as other domains. Rescue of DeltaF508-CFTR by suppressors required the biosynthesis of the entire full-length protein in continuity, as it did not occur when N- and C-terminal "halves" were coexpressed. Simultaneous with these interdomain perturbations, DeltaF508 resulted in suppressor reversed alterations in accessibility of residues both in the F508-containing NBD1 surface loop and in the Q loop within the domain core. Thus, in the context of the full-length protein, DeltaF508 mutation causes detectable changes in NBD1 conformation, as well as interdomain interactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 These suppressor mutations (I539T, G550E, R553M/Q, and R555K) promote ⌬F508-CFTR maturation and trafficking to the cell surface, and also restore channel activity (16). Login to comment
28 The R555K mutation alone increases the channel activity of both WTand ⌬F508-CFTR by extending the open-channel burst duration (15). Login to comment
72 RESULTS Suppressor mutations restore folding mutations in NBD1 but not elsewhere Four suppressor mutations (I539T, G550E, R553M, and R555K) were originally found to rescue ⌬F508-CFTR maturation in a yeast mating screen using STE6/CFTR chimeras (14-16). Login to comment
79 B, C) HEK293 cells were transiently transfected with CFTR variants with maturation-compromising mutations introduced in different domains, in the presence or absence of single or combined suppressor mutations (4S: I539T/G550E/R4553M/R555K; 3S: G550E/R553M/R555K). Login to comment
84 Among these four suppressor mutations, R555K had the largest effect in promoting ⌬F508-CFTR maturation, while R553M had the least effect. Login to comment
85 The addition of G550E and R553M to R555K (3S) further increased its maturation, but no additional effect was detected by the addition of the fourth mutation I539T (4S) (Fig. 1A). Login to comment
112 Stable BHK cells overexpressing WT-CFTR and ⌬F508-CFTR with and without 4 suppressor mutations (I539T/G550E/R553M/R555K, ⌬F/ 4S) were pulse labeled with 100 ␮Ci/ml [35 S] methionine for 20 min, followed by 0, 1, 2, and 4 h chase. Login to comment
124 To test whether these NBD/CL interfaces not formed in ⌬F508-CFTR could be restored by the suppressor mutations, the 4 combined suppressor mutations, I539T/G550E/R553M/R555K (4S) were introduced into the ⌬F508-CFTR constructs with the Cys pairs at the potential interfaces. Login to comment
139 HEK293 cells were transiently transfected with Cys-less ⌬F508-CFTR in the presence or absence of suppressor mutations I539T/G550E/R553M/R555K, with Cys pairs introduced at CL2/NBD2 (A) or CL4/NBD1 (B) interfaces. Login to comment
146 However, when suppressor mutations (3S: G550E/R553M/R555K) were introduced into the N-half ⌬F508-CFTR, they did not promote complex glycosylation of the C half (Fig. 5A, lane 4), as they did in full-length CFTR (Fig. 1). Login to comment
154 HEK293 cells were transiently transfected with 1172X-CFTR or ⌬F508-1172X-CFTR in the presence or absence of single or combined suppressor mutations (4S: I539T/G550E/R4553M/R555K; 3S: G550E/R553M/R555K). Login to comment
162 N halves were either WT or carried the ⌬F508 mutation, in the absence or presence of suppressor mutations (3S: G550E/R553M/R555K). Login to comment

[hide] The V510D suppressor mutation stabilizes DeltaF508... Biochemistry. 2010 Aug 3;49(30):6352-7. Loo TW, Bartlett MC, Clarke DM
The V510D suppressor mutation stabilizes DeltaF508-CFTR at the cell surface.
Biochemistry. 2010 Aug 3;49(30):6352-7., 2010-08-03 [PMID:20590134]

Abstract [show]
Deletion of Phe508 (DeltaF508) in the first nucleotide-binding domain (NBD1) of CFTR causes cystic fibrosis. The mutation severely reduces the stability and folding of the protein by disrupting interactions between NBD1 and the second transmembrane domain (TMD2). We found that replacement of Val510 with acidic residues (but not neutral or positive residues) promoted maturation of DeltaF508-CFTR with V510D more efficiently than V510E. Promotion of DeltaF508-CFTR maturation did not require NBD2 as introduction of V510D into a DeltaNBD2/DeltaF508-CFTR mutant restored maturation to levels similar to that of full-length protein. The V510D mutation increased the half-life of mature DeltaF508-CFTR at the cell surface by about 5-fold to resemble the half-life of wild-type CFTR. It was also observed that introduction of the V510R/R1070D mutations into DeltaF508-CFTR also promoted maturation whereas the V510D/R1070A mutations did not. We propose that the V510D mutation in NBD1 promotes maturation and stabilizes DeltaF508-CFTR at the cell surface through formation of a salt bridge with Arg1070 in TMD2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
64 It was recently reported that rescue of ΔF508-CFTR byother suppressor mutations inNBD1(I539T,G550E,R553M, R555K) was drastically reduced in wild-type CFTR lacking NBD2 (ΔNBD2) (20). Login to comment
129 A similar effect was observed when the combination of four NBD1 suppressormutations(I539T,G550E,R553M,R555K) was introduced into ΔF508-CFTR (20). Login to comment

[hide] The cystic fibrosis-causing mutation deltaF508 aff... J Biol Chem. 2010 Nov 12;285(46):35825-35. Epub 2010 Jul 28. Thibodeau PH, Richardson JM 3rd, Wang W, Millen L, Watson J, Mendoza JL, Du K, Fischman S, Senderowitz H, Lukacs GL, Kirk K, Thomas PJ
The cystic fibrosis-causing mutation deltaF508 affects multiple steps in cystic fibrosis transmembrane conductance regulator biogenesis.
J Biol Chem. 2010 Nov 12;285(46):35825-35. Epub 2010 Jul 28., 2010-11-12 [PMID:20667826]

Abstract [show]
The deletion of phenylalanine 508 in the first nucleotide binding domain of the cystic fibrosis transmembrane conductance regulator is directly associated with >90% of cystic fibrosis cases. This mutant protein fails to traffic out of the endoplasmic reticulum and is subsequently degraded by the proteasome. The effects of this mutation may be partially reversed by the application of exogenous osmolytes, expression at low temperature, and the introduction of second site suppressor mutations. However, the specific steps of folding and assembly of full-length cystic fibrosis transmembrane conductance regulator (CFTR) directly altered by the disease-causing mutation are unclear. To elucidate the effects of the DeltaF508 mutation, on various steps in CFTR folding, a series of misfolding and suppressor mutations in the nucleotide binding and transmembrane domains were evaluated for effects on the folding and maturation of the protein. The results indicate that the isolated NBD1 responds to both the DeltaF508 mutation and intradomain suppressors of this mutation. In addition, identification of a novel second site suppressor of the defect within the second transmembrane domain suggests that DeltaF508 also effects interdomain interactions critical for later steps in the biosynthesis of CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Printed in the U.S.A. NOVEMBER 12, 2010•VOLUME 285•NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 35825 G550E, R553Q, and R555K (19-21). Login to comment
104 The introduction of the single mutations, G550E, R553M or R553Q, and R555K, has previously been shown to partially rescue the ⌬F508 trafficking defect in CFTR and restore channel activity at the plasma membrane (Fig. 1A) (19-21). Login to comment
131 Disruption of the RXR by substitution of Arg-555 with lysine showed no discernible effects on wild type CFTR maturation. Login to comment
142 The introduction of the -3M mutations (G550E, R553M, R555K) rescues the trafficking defects associated with the ⌬F508 mutation and restores near wild type function. Login to comment
178 The substitution of R555A, R555G, and R555T resulted in a marked reduction in the formation of band C CFTR, whereas the R555K, as measured by Western blotting of transiently transfected HEK-293 cells displays near wild type CFTR maturation. Login to comment

[hide] Thermal unfolding studies show the disease causing... Protein Sci. 2010 Oct;19(10):1917-31. Protasevich I, Yang Z, Wang C, Atwell S, Zhao X, Emtage S, Wetmore D, Hunt JF, Brouillette CG
Thermal unfolding studies show the disease causing F508del mutation in CFTR thermodynamically destabilizes nucleotide-binding domain 1.
Protein Sci. 2010 Oct;19(10):1917-31., [PMID:20687133]

Abstract [show]
Misfolding and degradation of CFTR is the cause of disease in patients with the most prevalent CFTR mutation, an in-frame deletion of phenylalanine (F508del), located in the first nucleotide-binding domain of human CFTR (hNBD1). Studies of (F508del)CFTR cellular folding suggest that both intra- and inter-domain folding is impaired. (F508del)CFTR is a temperature-sensitive mutant, that is, lowering growth temperature, improves both export, and plasma membrane residence times. Yet, paradoxically, F508del does not alter the fold of isolated hNBD1 nor did it seem to perturb its unfolding transition in previous isothermal chemical denaturation studies. We therefore studied the in vitro thermal unfolding of matched hNBD1 constructs +/-F508del to shed light on the defective folding mechanism and the basis for the thermal instability of (F508del)CFTR. Using primarily differential scanning calorimetry (DSC) and circular dichroism, we show for all hNBD1 pairs studied, that F508del lowers the unfolding transition temperature (T(m)) by 6-7 degrees C and that unfolding occurs via a kinetically-controlled, irreversible transition in isolated monomers. A thermal unfolding mechanism is derived from nonlinear least squares fitting of comprehensive DSC data sets. All data are consistent with a simple three-state thermal unfolding mechanism for hNBD1 +/- F508del: N(+/-MgATP) <==> I(T)(+/-MgATP) --> A(T) --> (A(T))(n). The equilibrium unfolding to intermediate, I(T), is followed by the rate-determining, irreversible formation of a partially folded, aggregation-prone, monomeric state, A(T), for which aggregation to (A(T))(n) and further unfolding occur with no detectable heat change. Fitted parameters indicate that F508del thermodynamically destabilizes the native state, N, and accelerates the formation of A(T).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
44 hNBD1 Nameb Termini / Mutationsc Tm d DTm ¼ Tm D508 - Tm wt ( C) PDB ID 1 hNBD1-D(RI,RE) 2935c46917 387-646[D405-436] 57.7 þ 0.2 2PZE 1 (F508del)hNBD1D (RI,RE) 2935c47217 387-646[D405-436, F508del] 51.5 þ 0.3 À6.2 þ 0.3 2PZF 2 387-646[D405-436, V510D] 60.2 þ 0.4 2 387-646[D405-436, V510D, F508del] 53.0 þ 0.1 À7.2 þ 0.4 3 387-646[D405-436, F494N, Q637R] 59.2 3 387-646[D405-436, F494N, Q637R, F508del] 52.8 À6.4 4 387-646[D405-436, G550E, R553Q, R555K] 61.7 4 387-646[D405-436, G550E, R553Q, R555K,F508del] 55.7 À6.0 5 387-678[D405-436] 58.1 5 387-678[D405-436, F508del] 51.7 À6.2 6 hNBDI-315 2935c38217 389-678[F429S, F494N, Q637R] 49.8 þ 0.3 6 hNBDI-3F508del15 2935c37117 389-678[F429S, F494N, Q637R, F508del] 43.6 þ 0.1 À6.3 þ 0.3 2BBS 7 389-678[F429S, F494N, L636E5, Q637R] 50.5 þ 0.2 7 389-678[F429S, F494N, L636E, Q637R, F508del] 44.9 À6.2 þ 0.2 a DSC conducted at 1 mg/mL protein. Login to comment

[hide] Integrated biophysical studies implicate partial u... Protein Sci. 2010 Oct;19(10):1932-47. Wang C, Protasevich I, Yang Z, Seehausen D, Skalak T, Zhao X, Atwell S, Spencer Emtage J, Wetmore DR, Brouillette CG, Hunt JF
Integrated biophysical studies implicate partial unfolding of NBD1 of CFTR in the molecular pathogenesis of F508del cystic fibrosis.
Protein Sci. 2010 Oct;19(10):1932-47., [PMID:20687163]

Abstract [show]
The lethal genetic disease cystic fibrosis is caused predominantly by in-frame deletion of phenylalanine 508 in the cystic fibrosis transmembrane conductance regulator (CFTR). F508 is located in the first nucleotide-binding domain (NBD1) of CFTR, which functions as an ATP-gated chloride channel on the cell surface. The F508del mutation blocks CFTR export to the surface due to aberrant retention in the endoplasmic reticulum. While it was assumed that F508del interferes with NBD1 folding, biophysical studies of purified NBD1 have given conflicting results concerning the mutation's influence on domain folding and stability. We have conducted isothermal (this paper) and thermal (accompanying paper) denaturation studies of human NBD1 using a variety of biophysical techniques, including simultaneous circular dichroism, intrinsic fluorescence, and static light-scattering measurements. These studies show that, in the absence of ATP, NBD1 unfolds via two sequential conformational transitions. The first, which is strongly influenced by F508del, involves partial unfolding and leads to aggregation accompanied by an increase in tryptophan fluorescence. The second, which is not significantly influenced by F508del, involves full unfolding of NBD1. Mg-ATP binding delays the first transition, thereby offsetting the effect of F508del on domain stability. Evidence suggests that the initial partial unfolding transition is partially responsible for the poor in vitro solubility of human NBD1. Second-site mutations that increase the solubility of isolated F508del-NBD1 in vitro and suppress the trafficking defect of intact F508del-CFTR in vivo also stabilize the protein against this transition, supporting the hypothesize that it is responsible for the pathological trafficking of F508del-CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Moreover, three second-site mutations, selected by Teem and coworkers to reverse the in vivo trafficking defect caused by F508del,37 appeared to stabilize hNBD1 against chemical unfolding.15 Because this ''Teem suppressor triplet`` (G550E, R553Q, and R555K) does not significantly alter the structure of F508del-hNBD1,18 its effect increasing the thermodynamic stability of hNBD1 seems likely to be responsible for reversing the deleterious effects of the F508del mutation. Login to comment
155 Second-Site Solubilizing/Suppressor Mutations Delay the Initial Unfolding Transition Figure 4 shows the isothermal denaturation behavior of F508del-hNBD1-D(RI,RE) constructs harboring additional point mutations known to suppress the trafficking defect caused by the F508del mutation.32,37,39,40 The G550E, R553Q, and R555K mutations in the Teem suppressor triplet were isolated in vivo using a selection for mutations restoring the export of a yeast CFTR homolog bearing the equivalent of the F508del mutation. Login to comment
179 This research program led to the identification of several point mutations that improve the solubility and yield of purified hNBD1, including the Teem suppressor triplet (G550E, R553Q, and R555K) isolated as suppressors of the in vivo trafficking defect of F508del-CFTR.37 However, surprisingly, the other efficacious solubilizing mutations chosen exclusively on the basis of polarity and consistency with the CFTR sequence profile also generally suppress the defective in vivo trafficking of F508del-CFTR.32,39 This correlation is readily explained if the initial unfolding transition in hNBD1 (left side of Fig. 5) controls both aggregation of the purified domain in vitro and aberrant ER retention and degradation of intact CFTR in vivo. Login to comment

[hide] Intragenic suppressing mutations correct the foldi... J Biol Chem. 2010 Nov 19;285(47):36304-14. Epub 2010 Sep 13. Pagant S, Halliday JJ, Kougentakis C, Miller EA
Intragenic suppressing mutations correct the folding and intracellular traffic of misfolded mutants of Yor1p, a eukaryotic drug transporter.
J Biol Chem. 2010 Nov 19;285(47):36304-14. Epub 2010 Sep 13., 2010-11-19 [PMID:20837481]

Abstract [show]
ATP-binding cassette (ABC) transporters play pivotal physiological roles in substrate transport across membranes, and defective assembly of these proteins can cause severe disease associated with improper drug or ion flux. The yeast protein Yor1p is a useful model to study the biogenesis of ABC transporters; deletion of a phenylalanine residue in the first nucleotide-binding domain (NBD1) causes misassembly and retention in the endoplasmic reticulum (ER) of the resulting protein Yor1p-DeltaF670, similar to the predominant disease-causing allele in humans, CFTR-DeltaF508. Here we describe two novel Yor1p mutants, G278R and I1084P, which fail to assemble and traffic similar to Yor1p-DeltaF670. These mutations are located in the two intracellular loops (ICLs) that interface directly with NBD1, and thus disrupt a functionally important structural module. We isolated 2 second-site mutations, F270S and R1168M, which partially correct the folding injuries associated with the G278R, I1084P, and DeltaF670 mutants and reinstate their trafficking. The position of both corrective mutations at the cytoplasmic face of a transmembrane helix suggests that they restore biogenesis by influencing the behavior of the transmembrane domains rather than by direct restoration of the ICL1-ICL4-NBD1 structural module. Given the conserved topology of many ABC transporters, our findings provide new understanding of functionally important inter-domain interactions and suggest new potential avenues for correcting folding defects caused by abrogation of those domain interfaces.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
249 Remarkably, all suppressing mutations identified (I539T, G550E, R553M, and R555K) by this study are located within the NBD1 domain itself. Login to comment

[hide] Mutant cycles at CFTR's non-canonical ATP-binding ... J Gen Physiol. 2011 Jun;137(6):549-62. doi: 10.1085/jgp.201110608. Epub 2011 May 16. Szollosi A, Muallem DR, Csanady L, Vergani P
Mutant cycles at CFTR's non-canonical ATP-binding site support little interface separation during gating.
J Gen Physiol. 2011 Jun;137(6):549-62. doi: 10.1085/jgp.201110608. Epub 2011 May 16., [PMID:21576373]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel belonging to the adenosine triphosphate (ATP)-binding cassette (ABC) superfamily. ABC proteins share a common molecular mechanism that couples ATP binding and hydrolysis at two nucleotide-binding domains (NBDs) to diverse functions. This involves formation of NBD dimers, with ATP bound at two composite interfacial sites. In CFTR, intramolecular NBD dimerization is coupled to channel opening. Channel closing is triggered by hydrolysis of the ATP molecule bound at composite site 2. Site 1, which is non-canonical, binds nucleotide tightly but is not hydrolytic. Recently, based on kinetic arguments, it was suggested that this site remains closed for several gating cycles. To investigate movements at site 1 by an independent technique, we studied changes in thermodynamic coupling between pairs of residues on opposite sides of this site. The chosen targets are likely to interact based on both phylogenetic analysis and closeness on structural models. First, we mutated T460 in NBD1 and L1353 in NBD2 (the corresponding site-2 residues become energetically coupled as channels open). Mutation T460S accelerated closure in hydrolytic conditions and in the nonhydrolytic K1250R background; mutation L1353M did not affect these rates. Analysis of the double mutant showed additive effects of mutations, suggesting that energetic coupling between the two residues remains unchanged during the gating cycle. We next investigated pairs 460-1348 and 460-1375. Although both mutations H1348A and H1375A produced dramatic changes in hydrolytic and nonhydrolytic channel closing rates, in the corresponding double mutants these changes proved mostly additive with those caused by mutation T460S, suggesting little change in energetic coupling between either positions 460-1348 or positions 460-1375 during gating. These results provide independent support for a gating model in which ATP-bound composite site 1 remains closed throughout the gating cycle.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
239 Site-1 mutations affect channel closing, likely by affecting the relative stability of open states In contrast to composite site-2 mutations R555K and T1246N (Vergani et al., 2005, but compare Teem et al., 1996), in positions equivalent to T460 and L1353, all site-1 mutations studied here had relatively small effects on channel gating, consistent with the notion that the gating cycle is driven by the catalytic cycle at composite site 2. Login to comment

[hide] Biochemical and biophysical approaches to probe CF... Methods Mol Biol. 2011;741:365-76. Schmidt A, Mendoza JL, Thomas PJ
Biochemical and biophysical approaches to probe CFTR structure.
Methods Mol Biol. 2011;741:365-76., [PMID:21594797]

Abstract [show]
The cystic fibrosis transmembrane regulator (CFTR) is a multi-domain integral membrane protein central to epithelial fluid secretion (see Chapter 21). Its activity is defective in the recessive genetic disease cystic fibrosis (CF). The most common CF-causing mutation is F508del in the first nucleotide binding domain (NBD1) of CFTR. This mutation is found on at least one allele of more than 90% of all CF patients. It is known to interfere with the trafficking/maturation of CFTR through the secretory pathway, leading to a loss-of-function at the plasma membrane. Notably, correction of the trafficking defect by addition of intragenic second-site suppressor mutations, or the alteration of bulk solvent conditions, such as by reducing the temperature or adding osmolytes, leads to appearance of functional channels at the membrane--thus, the rescued F508del-CFTR retains measurable function. High-resolution structural models of NBD1 from X-ray crystallographic data indicate that F508 is exposed on the surface of the domain in a position predicted by homologous ABC transporter structures to lie at the interface with the intracellular loops (ICLs) connecting the transmembrane spans. Determining the relative impact of the F508del mutation directly on NBD1 folding or on steps of domain assembly or both domain folding and assembly requires methods for evaluating the structure and stability of the isolated domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
30 Subsequently, in a screen for suppressor mutations of the F508del defect, the original R553Q suppressor mutation was identified as were I539T, G550E, R553Q, and R555K (18, 19). Login to comment

[hide] NMR spectroscopy to study the dynamics and interac... Methods Mol Biol. 2011;741:377-403. Kanelis V, Chong PA, Forman-Kay JD
NMR spectroscopy to study the dynamics and interactions of CFTR.
Methods Mol Biol. 2011;741:377-403., [PMID:21594798]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is a multi-domain membrane chloride channel whose activity is regulated by ATP at two nucleotide-binding domains (NBD1 and NBD2) and by phosphorylation of the regulatory (R) region. The NBDs and the R region have functionally relevant motions that are critical for channel gating. Nuclear magnetic resonance (NMR) spectroscopy is a highly useful technique for obtaining information on the structure and interactions of CFTR and is extremely powerful for probing dynamics. NMR approaches for studying CFTR are reviewed, using our previous NBD1 and the R region results to provide examples. These NMR data are yielding insights into the dynamic properties and interactions that facilitate normal CFTR regulation as well as pathological effects of mutations, including the most common disease mutant, deletion of F508 in NBD1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 (b) HSQC spectrum of the G550E/R553M/R555K mutant NBD1-RE (398-673). Login to comment
102 The interacting peptide is in red and the NBD1-RE structure is colored blue for residues for which we have resonance assignments, light grey for those not assigned, and dark grey for those assigned in the G550E/R553M/R555K mutant but not transferable to WT NBD1-RE (19). Login to comment
134 The solubility of mNBD1 is greatly improved by the inclusion of the RE (14), which transiently populates helical structures that interact with NBD1 (19, 20), and incorporation of the revertant mutations, G550E, R553M, and R555K (43-45), yielding an NBD1-RE construct that is sufficiently soluble for NMR assignment experiments. Login to comment
140 Higher concentrations of glycerol and lower temperatures further stabilize the protein, but increase the viscosity of the solution, leading to Table 25.1 List of preferred CFTR constructs for NMR studies Construct Boundaries "Solubilizing" mutations mNBD1-RE 389-673 G550E, R553M, R555K hNBD1a 387-404, 437-646 None hNBD1-REa 387-404, 437-678 None hNBD1-RE 389-678 F494N hNBD1-RE 389-678 F429S, F494N, Q637R aThe RI (residues 405-436) have been deleted in these constructs. Login to comment
187 HSQC spectra recorded on samples specifically 15N labeled on Leu residues, aromatic residues (Phe, Tyr, and Trp), or the combination of Gly, Ser, Asp, and Asn residues were used to assist in identification of residue type in order to achieve 70% assignment of the G550E, R553M, R555K mutant NBD1-RE, which were then transferred to the WT protein (19), as the level of uniformity of lineshapes was greater for the G550E, R553M, R555K mutant than either WT or F508del (compare Fig. 25.2b, c). Login to comment

[hide] Probing conformational rescue induced by a chemica... J Biol Chem. 2011 Jul 15;286(28):24714-25. Epub 2011 May 21. Yu W, Chiaw PK, Bear CE
Probing conformational rescue induced by a chemical corrector of F508del-cystic fibrosis transmembrane conductance regulator (CFTR) mutant.
J Biol Chem. 2011 Jul 15;286(28):24714-25. Epub 2011 May 21., 2011-07-15 [PMID:21602569]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene that cause loss of function of the CFTR channel on the apical surface of epithelial cells. The major CF-causing mutation, F508del-CFTR, is misfolded, retained in the endoplasmic reticulum, and degraded. Small molecule corrector compounds have been identified using high throughput screens, which partially rescue the trafficking defect of F508del-CFTR, allowing a fraction of the mutant protein to escape endoplasmic reticulum retention and traffic to the plasma membrane, where it exhibits partial function as a cAMP-regulated chloride channel. A subset of such corrector compounds binds directly to the mutant protein, prompting the hypothesis that they rescue the biosynthetic defect by inducing improved protein conformation. We tested this hypothesis directly by evaluating the consequences of a corrector compound on the conformation of each nucleotide binding domain (NBD) in the context of the full-length mutant protein in limited proteolytic digest studies. Interestingly, we found that VRT-325 was capable of partially restoring compactness in NBD1. However, VRT-325 had no detectable effect on the conformation of the second half of the molecule. In comparison, ablation of the di-arginine sequence, R(553)XR(555) (F508del-KXK-CFTR), modified protease susceptibility of NBD1, NBD2, and the full-length protein. Singly, each intervention led to a partial correction of the processing defect. Together, these interventions restored processing of F508del-CFTR to near wild type. Importantly, however, a defect in NBD1 conformation persisted, as did a defect in channel activation after the combined interventions. Importantly, this defect in channel activation can be fully corrected by the addition of the potentiator, VX-770.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
259 In the context of the full-length F508del-CFTR protein, the substitution of R553 M, or the substitution of arginine to lysine at position 555, led to partial rescue of the primary processing defect, and hence, these were originally described as "suppressor" mutations (24, 25). Login to comment
264 In addition, Thibodeau et al. (28) showed that in the context of the full-length protein, F508del-NBD1 exhibited enhanced protease sensitivity (in limited proteolysis studies) relative to WT-CFTR-NBD1 and further that the solubilizing mutations (G550E, R553M, and R555K) conferred protease resistance to F508del-NBD1. Login to comment

[hide] The W232R suppressor mutation promotes maturation ... Biochemistry. 2011 Feb 8;50(5):672-85. Epub 2011 Jan 11. Loo TW, Bartlett MC, Clarke DM
The W232R suppressor mutation promotes maturation of a truncation mutant lacking both nucleotide-binding domains and restores interdomain assembly and activity of P-glycoprotein processing mutants.
Biochemistry. 2011 Feb 8;50(5):672-85. Epub 2011 Jan 11., 2011-02-08 [PMID:21182301]

Abstract [show]
ATP-binding cassette (ABC) proteins contain two nucleotide-binding domains (NBDs) and two transmembrane (TM) domains (TMDs). Interdomain interactions and packing of the TM segments are critical for function, and disruption by genetic mutations contributes to disease. P-glycoprotein (P-gp) is a useful model to identify mechanisms that repair processing defects because numerous arginine suppressor mutations have been identified in the TM segments. Here, we tested the prediction that a mechanism of arginine rescue was to promote intradomain interactions between TM segments and restore interdomain assembly. We found that suppressor W232R(TM4/TMD1) rescued mutants with processing mutations in any domain and restored defective NBD1-NBD2, NBD1-TMD2, and TMD1-TMD2 interactions. W232R also promoted packing of the TM segments because it rescued a truncation mutant lacking both NBDs. The mechanism of W232R rescue likely involved intradomain hydrogen bond interactions with Asn296(TM5) since only N296A abolished rescue by W232R and rescue was only observed when Trp232 was replaced with hydrogen-bonding residues. In TMD2, suppressor T945R(TM11) also promoted packing of the TM segments because it rescued the truncation mutant lacking the NBDs and suppressed formation of alternative topologies. We propose that T945R rescue was mediated by interactions with Glu875(TM10) since T945E/E875R promoted maturation while T945R/E875A did not.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
121 Suppressor mutations can rescueΔF508-CFTRbya variety ofmechanisms.Examplesinclude removal of the ER retention signals (arginine-framed trafficking motif mutations; R29K, R516K, R555K, and R766K) (61, 62), introduction of a combination of CFTR suppressor mutations (F949/Q637R or F29S/F494N/Q637R) that increase solubility of NBD1(63),orintroductionofsuppressormutationssuchasV510D (TMD1) (64) and R1070W(TMD2) (65) that restore NBD1-TMD2 interactions. Login to comment
122 In a recent study of four of the CFTR suppressor mutations located in NBD1 (I539T, G550E, R553M, and R555K), it was found that they only restored maturation of mutants that had processing mutations in NBD1 but not those that had processing mutations in other domains such as NBD2 (N1303K) or TMD2 (L1065P or R1066C) (66). Login to comment
329 It appears that the ΔF508 mutation inhibits folding of NBD1 and its ability to stably associate with other domains resulting in altered CFTR-chaperone interactions, ER retention,andenhanceddegradation(65).Second-sitesuppressor mutations in NBD1 (such as I539T/G550E/R553M/R555K) can restore interdomain assembly (65, 66) to yield a more stable ΔF508-CFTR molecule (64, 66). Login to comment

[hide] Conformational changes relevant to channel activit... J Biol Chem. 2012 Aug 17;287(34):28480-94. doi: 10.1074/jbc.M112.371138. Epub 2012 Jun 21. Hudson RP, Chong PA, Protasevich II, Vernon R, Noy E, Bihler H, An JL, Kalid O, Sela-Culang I, Mense M, Senderowitz H, Brouillette CG, Forman-Kay JD
Conformational changes relevant to channel activity and folding within the first nucleotide binding domain of the cystic fibrosis transmembrane conductance regulator.
J Biol Chem. 2012 Aug 17;287(34):28480-94. doi: 10.1074/jbc.M112.371138. Epub 2012 Jun 21., [PMID:22722932]

Abstract [show]
Deletion of Phe-508 (F508del) in the first nucleotide binding domain (NBD1) of the cystic fibrosis transmembrane conductance regulator (CFTR) leads to defects in folding and channel gating. NMR data on human F508del NBD1 indicate that an H620Q mutant, shown to increase channel open probability, and the dual corrector/potentiator CFFT-001 similarly disrupt interactions between beta-strands S3, S9, and S10 and the C-terminal helices H8 and H9, shifting a preexisting conformational equilibrium from helix to coil. CFFT-001 appears to interact with beta-strands S3/S9/S10, consistent with docking simulations. Decreases in T(m) from differential scanning calorimetry with H620Q or CFFT-001 suggest direct compound binding to a less thermostable state of NBD1. We hypothesize that, in full-length CFTR, shifting the conformational equilibrium to reduce H8/H9 interactions with the uniquely conserved strands S9/S10 facilitates release of the regulatory region from the NBD dimerization interface to promote dimerization and thereby increase channel open probability. These studies enabled by our NMR assignments for F508del NBD1 provide a window into the conformational fluctuations within CFTR that may regulate function and contribute to folding energetics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
315 A similar argument can be made for an underlying allosteric mechanism of suppression by the "3M" (G550E/R553M/R555K) mutations (17) which can improve CFTR processing in the absence of F508; even though they do not directly address the structural changes at the Phe-508 site, these mutations apparently change the equilibrium distribution of conformations accessed by NBD1 to be more similar to that of wild-type. Login to comment
313 A similar argument can be made for an underlying allosteric mechanism of suppression by the "3M" (G550E/R553M/R555K) mutations (17) which can improve CFTR processing in the absence of F508; even though they do not directly address the structural changes at the Phe-508 site, these mutations apparently change the equilibrium distribution of conformations accessed by NBD1 to be more similar to that of wild-type. Login to comment

[hide] Thermal instability of DeltaF508 cystic fibrosis t... Biochemistry. 2012 Jun 26;51(25):5113-24. Epub 2012 Jun 15. Liu X, O'Donnell N, Landstrom A, Skach WR, Dawson DC
Thermal instability of DeltaF508 cystic fibrosis transmembrane conductance regulator (CFTR) channel function: protection by single suppressor mutations and inhibiting channel activity.
Biochemistry. 2012 Jun 26;51(25):5113-24. Epub 2012 Jun 15., [PMID:22680785]

Abstract [show]
Deletion of Phe508 from cystic fibrosis transmembrane conductance regulator (CFTR) results in a temperature-sensitive folding defect that impairs protein maturation and chloride channel function. Both of these adverse effects, however, can be mitigated to varying extents by second-site suppressor mutations. To better understand the impact of second-site mutations on channel function, we compared the thermal sensitivity of CFTR channels in Xenopus oocytes. CFTR-mediated conductance of oocytes expressing wt or DeltaF508 CFTR was stable at 22 degrees C and increased at 28 degrees C, a temperature permissive for DeltaF508 CFTR expression in mammalian cells. At 37 degrees C, however, CFTR-mediated conductance was further enhanced, whereas that due to DeltaF508 CFTR channels decreased rapidly toward background, a phenomenon referred to here as "thermal inactivation." Thermal inactivation of DeltaF508 was mitigated by each of five suppressor mutations, I539T, R553M, G550E, R555K, and R1070W, but each exerted unique effects on the severity of, and recovery from, thermal inactivation. Another mutation, K1250A, known to increase open probability (P(o)) of DeltaF508 CFTR channels, exacerbated thermal inactivation. Application of potentiators known to increase P(o) of DeltaF508 CFTR channels at room temperature failed to protect channels from inactivation at 37 degrees C and one, PG-01, actually exacerbated thermal inactivation. Unstimulated DeltaF508CFTR channels or those inhibited by CFTR(inh)-172 were partially protected from thermal inactivation, suggesting a possible inverse relationship between thermal stability and gating transitions. Thermal stability of channel function and temperature-sensitive maturation of the mutant protein appear to reflect related, but distinct facets of the DeltaF508 CFTR conformational defect, both of which must be addressed by effective therapeutic modalities.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Thermal inactivation of ΔF508 was mitigated by each of five suppressor mutations, I539T, R553M, G550E, R555K, and R1070W, but each exerted unique effects on the severity of, and recovery from, thermal inactivation. Login to comment
13 Consistent with this hypothesis, low-temperature rescued ΔF508 CFTR channels exposed to 37 °C exhibit a markedly reduced metabolic half-life (t1/2 < 4 h versus t1/2 > 24 h for wt CFTR14-17,21 ) and rapid thermal inactivation of chloride channel function.5,22 ΔF508 CFTR folding defects can also be suppressed to varying degrees by a variety of second-site mutations in NBD1.4,8,18,23-30 I539T, occurring naturally in many CFTR orthologs, improved the maturation of ΔF508 CFTR at 37 °C,4,25,30 but actually reduced open probability (Po) determined in detached patches.9 Another, R555K, modestly improved protein processing but also increased Po of ΔF508 CFTR channels in detached patches. Login to comment
18 We identified unique functional signatures for five second-site mutations, four in NBD1 (I539T, G550E, R553M, and R555K) and one in the fourth intracellular loop (ICL4, R1070W), and also investigated the relation of thermal stability to variations in channel gating brought about by intracellular cAMP, CFTR potentiators, and CFTR inhibitors. Login to comment
125 In contrast, pairing ΔF508 with R555K, a mutation that has been reported to be somewhat more effective than R553M at improving NBD1 folding and protein maturation,4,6,24 resulted in a channel that, although unable to sustain the initial increase in conductance evoked at 37 °C, was inactivated only slightly and returned to its prewarming level relatively rapidly when superfusate temperature was returned to 22 °C. Login to comment
137 (B) R555K/ΔF508 CFTR (n = 5). Login to comment
146 There was no apparent correlation of the functional phenotype of the double mutant channels at 37 °C with the improvements reported for NBD1 folding and protein maturation,4,6 but the partial protection from thermal inactivation by R555K and G550E suggested that the effects might be correlated with the induction of increased Po.8,24 R553M, however, had been reported by Teem et al.24 not to increase Po of ΔF508 channels (34-36 °C), so we investigated the behavior of the double mutant in inside-out patches. Login to comment
154 Pairing R1070W and a second NBD1 suppressor, R555K, with ΔF508, however, resulted in thermal stability that was indistinguishable from that of wt CFTR (Figure 7B). Login to comment
170 (B) Following stimulation, an oocyte expressing R555K/R1070W/ΔF508 CFTR (n = 4) was warmed to 37 °C for 10 min twice. After cooling to 22 °C, the oocyte was exposed to 10 μM CF172. Login to comment
247 Similarly, G550E, R555K, and R1070W; when combined individually with ΔF508, improved protein maturation at 37 °C to at most 18% of wt,4,6 but nevertheless significantly improved the thermal stability of the double mutant channels. Login to comment
251 The three NBD1, second-site mutations that fully or partially protected ΔF508 CFTR channels from thermal inactivation at 37 °C, R553M, R555K, and G550E, share a common effect on ΔF508 CFTR channel function. Login to comment
254 Mendoza et al.6 reported that these three NBD1 suppressor mutations increased the yield of folded ΔF508 NBD1 in a cell-based assay from 0% (R553M) to 60% (R555K), although even a 60% increase represented less than 20% of the yield of wt protein under the same conditions. Login to comment
256 A fourth NBD1 suppressor mutation, I539T, in contrast to G550E, R553M, and R555K, is predicted to lie within an unstructured linker connecting two α-helical portions of NBD1. Login to comment
259 Recovery from partial inactivation was also seen with R555K and G550E, but unlike I539T, both of these second-site mutations also resulted in persistent, steady-state conductance at 37 °C. Login to comment
266 Like G550E, R553M, and R555K, this second-site mutation has been associated with increased open probability of the double mutant,7 an effect attributed to a partial improvement in the interaction between NBD1 and ICL4.29,57 Combining the ICL4 mutation with an NBD1 suppressor mutation on the ΔF508 background (R555K/R1070W/ΔF508), however, fully restored wt-like thermal stability at 37 °C, an "additive" effect similar to that reported by Mendoza et al 6 in their study of the effect of these mutations on NBD1 folding and ΔF508 CFTR protein yield. Login to comment

[hide] Allosteric modulation balances thermodynamic stabi... J Mol Biol. 2012 May 25;419(1-2):41-60. Epub 2012 Mar 8. Aleksandrov AA, Kota P, Cui L, Jensen T, Alekseev AE, Reyes S, He L, Gentzsch M, Aleksandrov LA, Dokholyan NV, Riordan JR
Allosteric modulation balances thermodynamic stability and restores function of DeltaF508 CFTR.
J Mol Biol. 2012 May 25;419(1-2):41-60. Epub 2012 Mar 8., [PMID:22406676]

Abstract [show]
Most cystic fibrosis is caused by a deletion of a single residue (F508) in CFTR (cystic fibrosis transmembrane conductance regulator) that disrupts the folding and biosynthetic maturation of the ion channel protein. Progress towards understanding the underlying mechanisms and overcoming the defect remains incomplete. Here, we show that the thermal instability of human DeltaF508 CFTR channel activity evident in both cell-attached membrane patches and planar phospholipid bilayers is not observed in corresponding mutant CFTRs of several non-mammalian species. These more stable orthologs are distinguished from their mammalian counterparts by the substitution of proline residues at several key dynamic locations in first N-terminal nucleotide-binding domain (NBD1), including the structurally diverse region, the gamma-phosphate switch loop, and the regulatory insertion. Molecular dynamics analyses revealed that addition of the prolines could reduce flexibility at these locations and increase the temperatures of unfolding transitions of DeltaF508 NBD1 to that of the wild type. Introduction of these prolines experimentally into full-length human DeltaF508 CFTR together with the already recognized I539T suppressor mutation, also in the structurally diverse region, restored channel function and thermodynamic stability as well as its trafficking to and lifetime at the cell surface. Thus, while cellular manipulations that circumvent its culling by quality control systems leave DeltaF508 CFTR dysfunctional at physiological temperature, restoration of the delicate balance between the dynamic protein's inherent stability and channel activity returns a near-normal state.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
237 A striking feature of the strong stabilizing effect of the proline substitutions was the essentially absolute dependence on the I539T substitution. This dependence contrasts the positive effects on ΔF508 CFTR maturation of other second site changes that are not wholly dependent on I539 T, such as those near the NBD1 signature sequence (G550E/R553M/R555K) and the RI. Login to comment

[hide] Correction of both NBD1 energetics and domain inte... Cell. 2012 Jan 20;148(1-2):150-63. Rabeh WM, Bossard F, Xu H, Okiyoneda T, Bagdany M, Mulvihill CM, Du K, di Bernardo S, Liu Y, Konermann L, Roldan A, Lukacs GL
Correction of both NBD1 energetics and domain interface is required to restore DeltaF508 CFTR folding and function.
Cell. 2012 Jan 20;148(1-2):150-63., [PMID:22265408]

Abstract [show]
The folding and misfolding mechanism of multidomain proteins remains poorly understood. Although thermodynamic instability of the first nucleotide-binding domain (NBD1) of DeltaF508 CFTR (cystic fibrosis transmembrane conductance regulator) partly accounts for the mutant channel degradation in the endoplasmic reticulum and is considered as a drug target in cystic fibrosis, the link between NBD1 and CFTR misfolding remains unclear. Here, we show that DeltaF508 destabilizes NBD1 both thermodynamically and kinetically, but correction of either defect alone is insufficient to restore DeltaF508 CFTR biogenesis. Instead, both DeltaF508-NBD1 energetic and the NBD1-MSD2 (membrane-spanning domain 2) interface stabilization are required for wild-type-like folding, processing, and transport function, suggesting a synergistic role of NBD1 energetics and topology in CFTR-coupled domain assembly. Identification of distinct structural deficiencies may explain the limited success of DeltaF508 CFTR corrector molecules and suggests structure-based combination corrector therapies. These results may serve as a framework for understanding the mechanism of interface mutation in multidomain membrane proteins.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Both the R mutations (G550E, R553Q, and R555K) and S mutations (F409L, F429S, F433L, F494N, and H667R) could partially rescue the DF508 CFTR folding and functional defect (Lewis et al., 2005; Pissarra et al., 2008; Teem et al., 1993, 1996) and were assumed to stabilize the domain either alone or in combinations (1S, 3S, R, R1S, and R4S; see Figure 1B). Login to comment

[hide] Human-mouse cystic fibrosis transmembrane conducta... Proc Natl Acad Sci U S A. 2012 Jan 17;109(3):917-22. Epub 2011 Dec 30. Dong Q, Ostedgaard LS, Rogers C, Vermeer DW, Zhang Y, Welsh MJ
Human-mouse cystic fibrosis transmembrane conductance regulator (CFTR) chimeras identify regions that partially rescue CFTR-DeltaF508 processing and alter its gating defect.
Proc Natl Acad Sci U S A. 2012 Jan 17;109(3):917-22. Epub 2011 Dec 30., [PMID:22210114]

Abstract [show]
The DeltaF508 mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene is the most common cause of cystic fibrosis. The mutation disrupts biosynthetic processing, reduces channel opening rate, and decreases protein lifetime. In contrast to human CFTR (hCFTR)-DeltaF508, mouse CFTR-DeltaF508 is partially processed to the cell surface, although it exhibits a functional defect similar to hCFTR-DeltaF508. To explore DeltaF508 abnormalities, we generated human-mouse chimeric channels. Substituting mouse nucleotide-binding domain-1 (mNBD1) into hCFTR partially rescued the DeltaF508-induced maturation defect, and substituting mouse membrane-spanning domain-2 or its intracellular loops (ICLs) into hCFTR prevented further DeltaF508-induced gating defects. The protective effect of the mouse ICLs was reverted by inserting mouse NBDs. Our results indicate that the DeltaF508 mutation affects maturation and gating via distinct regions of the protein; maturation of CFTR-DeltaF508 depends on NBD1, and the DeltaF508-induced gating defect depends on the interaction between the membrane-spanning domain-2 ICLs and the NBDs. These appear to be distinct processes, because none of the chimeras repaired both defects. This distinction was exemplified by the I539T mutation, which improved CFTR-DeltaF508 processing but worsened the gating defect. Our results, together with previous studies, suggest that many different NBD1 modifications improve CFTR-DeltaF508 maturation and that the effect of modifications can be additive. Thus, it might be possible to enhance processing by targeting several different regions of the domain or by targeting a network of CFTR-associated proteins. Because no one modification corrected both maturation and gating, perhaps more than a single agent will be required to correct all CFTR-DeltaF508 defects.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
120 (i) A genetic approach identified second-site suppressor mutations, including I539T, G550E, R553M/Q, and R555K (18-21, 25, 26). Login to comment
167 Other examples are the G550E and R555K mutations, which also partially rescued CFTR-ΔF508 processing and increased the Po by lengthening the burst duration. Login to comment

[hide] Thermally unstable gating of the most common cysti... J Biol Chem. 2011 Dec 9;286(49):41937-48. Epub 2011 Sep 30. Wang W, Okeyo GO, Tao B, Hong JS, Kirk KL
Thermally unstable gating of the most common cystic fibrosis mutant channel (DeltaF508): "rescue" by suppressor mutations in nucleotide binding domain 1 and by constitutive mutations in the cytosolic loops.
J Biol Chem. 2011 Dec 9;286(49):41937-48. Epub 2011 Sep 30., [PMID:21965669]

Abstract [show]
Most cystic fibrosis (CF) cases are caused by the DeltaF508 mutation in the CF transmembrane conductance regulator (CFTR), which disrupts both the processing and gating of this chloride channel. The cell surface expression of DeltaF508-CFTR can be "rescued" by culturing cells at 26-28 degrees C and treating cells with small molecule correctors or intragenic suppressor mutations. Here, we determined whether these various rescue protocols induce a DeltaF508-CFTR conformation that is thermally stable in excised membrane patches. We also tested the impact of constitutive cytosolic loop mutations that increase ATP-independent channel activity (K978C and K190C/K978C) on DeltaF508-CFTR function. Low temperature-rescued DeltaF508-CFTR channels irreversibly inactivated with a time constant of 5-6 min when excised patches were warmed from 22 degrees C to 36.5 degrees C. A panel of CFTR correctors and potentiators that increased DeltaF508-CFTR maturation or channel activity failed to prevent this inactivation. Conversely, three suppressor mutations in the first nucleotide binding domain rescued DeltaF508-CFTR maturation and stabilized channel activity at 36.5 degrees C. The constitutive loop mutations increased ATP-independent activity of low temperature-rescued DeltaF508-CFTR but did not enhance protein maturation. Importantly, the ATP-independent activities of these DeltaF508-CFTR constructs were stable at 36.5 degrees C, whereas their ATP-dependent activities were not. Single channel recordings of this thermally stable ATP-independent activity revealed dynamic gating and unitary currents of normal amplitudes. We conclude that: (i) DeltaF508-CFTR gating is highly unstable at physiologic temperature; (ii) most rescue protocols do not prevent this thermal instability; and (iii) ATP-independent gating and the pore are spared from DeltaF508-induced thermal instability, a finding that may inform alternative treatment strategies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 For example, Hegedus et al. have shown that eliminating two arginine-based motifs (RXR) from ⌬F508-CFTR (e.g. R29K and R555K) promotes maturation of ⌬F508, but channel activity in lipid bilayers is highly thermally unstable (i.e. inactivates at physiologic temperature) (42). Login to comment
65 The ⌬F508-CFTR construct with NBD1 suppressor mutations (G550E, R553M, R555K (3M/⌬F508)) was provided by Dr. Phillip Thomas (University of Texas Southwestern Medical Center, Dallas). Login to comment
137 Suppressor Mutations in NBD1 Correct Misfolding and Stabilize ⌬F508-CFTR Channel Activity at 36.5 °C-We have shown recently that three suppressor mutations (G550E, R553M, R555K (3M/⌬F508)) in NBD1 correct ⌬F508-CFTR maturation and misfolding and markedly increase its channel activity in excised patches at room temperature (43). Login to comment
180 Cells expressing G550E/R553M/R555K/⌬F508 (3M/⌬F508) were grown at 37 °C. Login to comment

[hide] Model of the cAMP activation of chloride transport... J Theor Biol. 2010 Jan 7;262(1):73-9. Epub 2009 Sep 17. Moran O
Model of the cAMP activation of chloride transport by CFTR channel and the mechanism of potentiators.
J Theor Biol. 2010 Jan 7;262(1):73-9. Epub 2009 Sep 17., [PMID:19766125]

Abstract [show]
Mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) cause cystic fibrosis, a hereditary lethal disease. CFTR is a chloride channel expressed in the apical membrane of epithelia. It is activated by cAMP dependent phosphorylation and gated by the binding of ATP. The impaired chloride transport of some types of cystic fibrosis mutations could be pharmacologically solved by the use of chemical compounds called potentiators. Here it is undertaken the construction of a model of the CFTR activation pathways, and the possible modification produced by a potentiator application. The model yields a novel mechanism for the potentiator action, describing the activatory and inhibitory activities on two different positions in the CFTR activation pathway.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Disruption of the binding site on NBD1 and NBD2 by mutations R555K and T1246N, respectively, yield an approximation of the independent equilibrium constants, KATP1 ¼ 71 mM and KATP2 ¼ 261 mM (Vergani et al., 2005). Login to comment
59 Disruption of the binding site on NBD1 and NBD2 by mutations R555K and T1246N, respectively, yield an approximation of the independent equilibrium constants, KATP1 &#bc; 71 mM and KATP2 &#bc; 261 mM (Vergani et al., 2005). Login to comment

[hide] Functional rescue of DeltaF508-CFTR by peptides de... Chem Biol. 2009 May 29;16(5):520-30. Kim Chiaw P, Huan LJ, Gagnon S, Ly D, Sweezey N, Rotin D, Deber CM, Bear CE
Functional rescue of DeltaF508-CFTR by peptides designed to mimic sorting motifs.
Chem Biol. 2009 May 29;16(5):520-30., [PMID:19477416]

Abstract [show]
The cystic fibrosis (CF)-causing mutant, deltaF508-CFTR, is misfolded and fails to traffic out of the endoplasmic reticulum (ER) to the cell surface. Introduction of second site mutations that disrupt a diarginine (RXR)-based ER retention motif in the first nucleotide binding domain rescues the trafficking defect of deltaF508-CFTR, supporting a role for these motifs in mediating ER retention of the major mutant. To determine if these RXR motifs mediate retention of the native deltaF508-CFTR protein in situ, we generated peptides that mimic these motifs and should antagonize mistrafficking mediated via their aberrant exposure. Here we show robust rescue of deltaF508-CFTR in cell lines and in respiratory epithelial tissues by transduction of RXR motif-mimetics, showing that abnormal accessibility of this motif is a key determinant of mistrafficking of the major CF-causing mutant.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 Previously, Teem and Welsh determined that second site revertant mutations in an endogenous RXR motif, proximal to the ABC signature sequence in NBD1 (including R553M and R555K in the motif: R553 AR555 ), partially restored trafficking of deltaF508-CFTR, suggesting that the motif in this region has particular functional significance (Teem et al., 1993, 1996). Login to comment
51 The current studies focus on the RXR motif residing in NBD1, proximal to the ABC signature motif and starting at the arginine at position 553, as it has been implicated in ER retrieval of deltaF508-CFTR with mutations R553M/Q or R555K leading to the enhanced surface expression of the major mutant (Teem et al., 1993, 1996). Login to comment

[hide] Mild processing defect of porcine DeltaF508-CFTR s... Biochem Biophys Res Commun. 2008 Aug 15;373(1):113-8. Epub 2008 Jun 12. Liu Y, Wang Y, Jiang Y, Zhu N, Liang H, Xu L, Feng X, Yang H, Ma T
Mild processing defect of porcine DeltaF508-CFTR suggests that DeltaF508 pigs may not develop cystic fibrosis disease.
Biochem Biophys Res Commun. 2008 Aug 15;373(1):113-8. Epub 2008 Jun 12., [PMID:18555011]

Abstract [show]
Recent efforts have made significant progress in generating transgenic pigs with the DeltaF508-CFTR mutation to model the lung and pancreatic disease of human cystic fibrosis. However, species differences in the processing and function of human, pig and mouse DeltaF508-CFTR reported recently raise concerns about the phenotypic consequence of the gene-targeted pig model. The purpose of the present study was to characterize the DeltaF508 mutant of porcine CFTR to evaluate the severity of its processing defect. Biochemical and immunofluorescence analysis in transfected COS7 and FRT cells indicated that pig DeltaF508-CFTR efficiently targets to the plasma membrane and is present mainly as the mature glycosylated protein. Functional characterization in stably transfected FRT cells by fluorometric and electrophysiological assays supported efficient plasma membrane targeting of pig DeltaF508-CFTR. The mild cellular processing defect of pig DeltaF508-CFTR suggests that its gene-targeted pig model may not develop the lung and pancreatic phenotypes seen in CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
149 The identified revertant mutations I539T, G550E, and R555K each partially res- Fig. 4. Login to comment
148 The identified revertant mutations I539T, G550E, and R555K each partially res- Fig. 4. Login to comment

[hide] Molecular basis for the ATPase activity of CFTR. Arch Biochem Biophys. 2008 Aug 1;476(1):95-100. Epub 2008 Apr 8. Cheung JC, Kim Chiaw P, Pasyk S, Bear CE
Molecular basis for the ATPase activity of CFTR.
Arch Biochem Biophys. 2008 Aug 1;476(1):95-100. Epub 2008 Apr 8., [PMID:18417076]

Abstract [show]
CFTR is a member of the ABC (ATP binding cassette) superfamily of transporters. It is a multidomain membrane protein, which utilizes ATP to regulate the flux of its substrate through the membrane. CFTR is distinct in that it functions as a channel and it possesses a unique regulatory R domain. There has been significant progress in understanding the molecular basis for CFTR activity as an ATPase. The dimeric complex of NBD structures seen in prokaryotic ABC transporters, together with the structure of an isolated CF-NBD1, provide a unifying molecular template to model the structural basis for the ATPase activity of CFTR. The dynamic nature of the interaction between the NBDs and the R domain has been revealed in NMR studies. On the other hand, understanding the mechanisms mediating the transmission of information from the cytosolic domains to the membrane and the channel gate of CFTR remains a central challenge.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
107 The construct generated had several mutations to increase solubility of the domain (F409L, F429S, F433L, G550E, R553Q, R555K, H667R) in addition to the deletion of F508. Login to comment

[hide] Solubilizing mutations used to crystallize one CFT... Chem Biol. 2008 Jan;15(1):62-9. Pissarra LS, Farinha CM, Xu Z, Schmidt A, Thibodeau PH, Cai Z, Thomas PJ, Sheppard DN, Amaral MD
Solubilizing mutations used to crystallize one CFTR domain attenuate the trafficking and channel defects caused by the major cystic fibrosis mutation.
Chem Biol. 2008 Jan;15(1):62-9., [PMID:18215773]

Abstract [show]
Cystic fibrosis (CF) is caused by mutations in the CF transmembrane conductance regulator (CFTR) Cl(-) channel. F508del, the most frequent CF-causing mutation, disrupts both the processing and function of CFTR. Recently, the crystal structure of the first nucleotide-binding domain of CFTR bearing F508del (F508del-NBD1) was elucidated. Although F508del-NBD1 shows only minor conformational changes relative to that of wild-type NBD1, additional mutations (F494N/Q637R or F429S/F494N/Q637R) were required for domain solubility and crystallization. Here we show that these solubilizing mutations in cis with F508del partially rescue the trafficking defect of full-length F508del-CFTR and attenuate its gating defect. We interpret these data to suggest that the solubilizing mutations utilized to facilitate F508del-NBD1 production also assist folding of full-length F508del-CFTR protein. Thus, the available crystal structure of F508del-NBD1 might correspond to a partially corrected conformation of this domain.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 Some of these mutations represented sequence changes between human CFTR and CFTRs from other species, whereas others (G550E, R553Q, and R555K) had been previously identified as F508del-CFTR revertant mutations (Teem et al., 1996; deCarvalho et al., 2002; Chang et al., 1999). Login to comment
155 Comparison with Other Revertants Using the same cellular system employed to investigate the solubilizing mutations, we recently examined the mechanism of action of two other F508del-CFTR revertants, G550E and 4RK, the simultaneous mutation of four arginine-framed tripeptides (AFTs), R29K, R516K, R555K, and R766K (Roxo-Rosa et al., 2006). Login to comment

[hide] Defining the defect in F508 del CFTR: a soluble pr... Chem Biol. 2008 Jan;15(1):3-4. Deber CM, Cheung JC, Rath A
Defining the defect in F508 del CFTR: a soluble problem?
Chem Biol. 2008 Jan;15(1):3-4., [PMID:18215767]

Abstract [show]
Previously reported crystal structures of CFTR F508 del-NBD1 were determined in the presence of solubilizing mutations. In this issue of Chemistry & Biology, Pissarra et al. (2008) show that partial rescue of the trafficking and gating defects of full-length CFTR occurs in vivo upon recapitulation of the solubilizing F494N/Q637R or F428S/F494N/Q637R substitutions in cis with F508 del.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 The first human F508 del-NBD1 structure obtained carried seven additional mutations, three of which (suppressor mutations G550E, R553Q, and R555K) were known to rescue the F508 del-CFTR defect (Chang et al., 1999; DeCarvalho et al., 2002; Teem et al., 1996). Login to comment

[hide] Expression and intracellular processing of chimeri... Biochim Biophys Acta. 2000 Jan 3;1500(1):59-69. Pollet JF, Van Geffel J, Van Stevens E, Van Geffel R, Beauwens R, Bollen A, Jacobs P
Expression and intracellular processing of chimeric and mutant CFTR molecules.
Biochim Biophys Acta. 2000 Jan 3;1500(1):59-69., [PMID:10564718]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is a cyclic AMP-activated chloride channel comprising two membrane-spanning domains (MSDs), two nucleotide-binding domains (NBDs) and a unique regulatory (R) domain. The most frequent cystic fibrosis (CF) mutation, a deletion of Phe508 in NBD1, results in the retention of the DeltaF508 CFTR in the endoplasmic reticulum, as do many other natural or constructed mutations located within the first NBD. In order to further define the role of NBD1 in CFTR folding and to determine whether the higher frequency of mutations in NBD1 with respect to NBD2 results from its position in the molecule or is related to its primary sequence, we constructed and expressed chimeric CFTRs wherein NBD domains were either exchanged or deleted. Synthesis, maturation and activity of the chimeras were assessed by Western blotting and iodide efflux assay after transient or stable expression in COS-1 or CHO cells respectively. The data showed that deletion of NBD1 prevented transport of CFTR to the cytoplasmic membrane whereas deletion of NBD2 did not impair this process but resulted in an inactive chloride channel. On the other hand, substituting or inverting NBDs in the CFTR molecule impaired its processing. In addition, while the NBD1 R555K mutation is known to partially correct the processing of CFTR DeltaF508 and to increase activity of both wild-type and DeltaF508 individual channels, it showed no positive effect when introduced into the double NBD1 chimera. Taken together, these observations suggest that the proper folding process of CFTR results from complex interactions between NBDs and their surrounding domains (MSDs and/or R domain).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 In addition, while the NBD1 R555K mutation is known to partially correct the processing of CFTR vF508 and to increase activity of both wild-type and vF508 individual channels, it showed no positive effect when introduced into the double NBD1 chimera. Login to comment
127 Lanes: 1 = CHO-mock-transfected, 2 = CHO-CFTR WT, 3 = CHO-CFTR 4M, 4 = CHO-CFTR R555K, 5 = CHO-vNBD2 and 6 = T84 cell line as positive control (derived from human gastrointestinal tract and expressed naturally CFTR protein). Login to comment
128 (B) Iodide e¥ux assays were performed on con£uent CHO cells (as negative control) grown on a plastic support and on CHO cells expressing CFTR WT, CFTR 4M, CFTR 4M-vNBD2 and CFTR 4M-R555K molecules. Login to comment
134 Data points are means of triplicates with S.E.M. Table 2 Expression, maturation and activity of the CFTR variants used in this study CFTR variant Protein Function A B C Wild-type + + + + vF508 3 + 3 3 4M + + + + 4MN + + + + 4M-2UNBD1 3 + 3 3 4MN-2UNBD1 3 + 3 3 4M-R555K 3 + + + 4M-2U(NBD1+R555K) 3 + 3 3 4M-NBD2/NBD1 3 + 3 3 4MN-NBD2/NBD1 3 + 3 3 4M-2UNBD2 3 + 3 3 4MN-2UNBD2 3 + 3 3 4MvNBD1 + + 3 3 4MvNBD2 + + + 3 + indicates the presence and 3 the absence of a CFTR band of the size expected for the A, B and C forms in transiently expressing COS-1 cells. Login to comment
138 To further determine whether the misfolding of 2UNBD1 molecule resulted from the additive e¡ect of the NBD1 intrinsic instability, we looked for a reversion of this phenotype by the R555K mutation. Login to comment
140 The R555K mutation was then introduced into each NBD1 of the 2UNBD1 variant. Login to comment
142 Fig. 3, lane 15, shows that the R555K mutation did not reverse the processing block observed for the 2UNBD1 molecule, suggesting that this defect did not result from an additive e¡ect of the intrinsic NBD1 instability. Login to comment
159 In addition, the R555K mutation, known to reverse the processing abnormality due to the vF508 mutation, did not restore the processing of the 2UNBD1 variant. Login to comment

[hide] Removal of multiple arginine-framed trafficking si... Mol Cell. 1999 Jul;4(1):137-42. Chang XB, Cui L, Hou YX, Jensen TJ, Aleksandrov AA, Mengos A, Riordan JR
Removal of multiple arginine-framed trafficking signals overcomes misprocessing of delta F508 CFTR present in most patients with cystic fibrosis.
Mol Cell. 1999 Jul;4(1):137-42., [PMID:10445036]

Abstract [show]
Many cystic fibrosis transmembrane conductance regulator (CFTR) mutants are recognized as aberrant by the quality control apparatus at the endoplasmic reticulum (ER) and are targeted for degradation. The mechanism whereby nascent chains are distinguished as either competent or incompetent for ER export has not been elucidated. Here we show that export-incompetent chains display multiple arginine-framed tripeptide sequences like the one recently identified in ATP-sensitive K+ channels. Replacement of arginine residues at positions R29, R516, R555, and R766 with lysine residues to inactivate four of these motifs simultaneously causes delta F508 CFTR, present in approximately 90% of CF patients, to escape ER quality control and function at the cell surface. Interference with recognition of these signals may be helpful in the management of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 This band remains prominent in 3 of the 4 R→K variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12). Login to comment
81 There was no detectable in- is enabled by the release from ER retention when thecrease in efflux rate from cells expressing ⌬F508 CFTR AFTs are inactivated.alone or with the R516K, R555K, or R766K mutation. Login to comment
127 The following oligonu-peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA. Login to comment
129 Hence, it is not CAGCGCCTGGAATTGTCAG and CTGACAATTCCAGGCGCTGTTT yet possible to know whether the AFTs may be "tucked- GTATCCTTTCCTCAAAATTG; R516K, CCTATGATGAATATAAATAC in" on maturation as a consequence of intramolecular AGAAGCCTCATC and GATGACGCTTCTGTATTTATATTCATCAT AGG; R555K, GGAGGTCAACGAGCAAAAATTTCTTTAGCAAGAGinteractions between domains of a single channel- and CTCTTGCTAAAGAAATTTTTGCTCGTTGACCTCC; and R766K,forming CFTR polypeptide or are due to intermolecular CTTCAGGCACGAAGGAAGCAGTCTCTCCTGAACC and GGTTCAGassociations between two or more pore-forming CFTR GACAGACTGCTTCCTTCGTGCTGAAG. Login to comment
41 This band remains prominent in 3 of the 4 R࢐K variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12). Login to comment
84 alone or with the R516K, R555K, or R766K mutation. Login to comment
130 The following oligonu- peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA. Login to comment
132 Hence, it is not CAGCGCCTGGAATTGTCAG and CTGACAATTCCAGGCGCTGTTT yet possible to know whether the AFTs may be "tucked- GTATCCTTTCCTCAAAATTG; R516K, CCTATGATGAATATAAATAC in" on maturation as a consequence of intramolecular AGAAGCCTCATC and GATGACGCTTCTGTATTTATATTCATCAT AGG; R555K, GGAGGTCAACGAGCAAAAATTTCTTTAGCAAGAG interactions between domains of a single channel- and CTCTTGCTAAAGAAATTTTTGCTCGTTGACCTCC; and R766K, forming CFTR polypeptide or are due to intermolecular CTTCAGGCACGAAGGAAGCAGTCTCTCCTGAACC and GGTTCAG associations between two or more pore-forming CFTR GACAGACTGCTTCCTTCGTGCTGAAG. Login to comment

[hide] Gout-causing Q141K mutation in ABCG2 leads to inst... Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5223-8. doi: 10.1073/pnas.1214530110. Epub 2013 Mar 14. Woodward OM, Tukaye DN, Cui J, Greenwell P, Constantoulakis LM, Parker BS, Rao A, Kottgen M, Maloney PC, Guggino WB
Gout-causing Q141K mutation in ABCG2 leads to instability of the nucleotide-binding domain and can be corrected with small molecules.
Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5223-8. doi: 10.1073/pnas.1214530110. Epub 2013 Mar 14., [PMID:23493553]

Abstract [show]
The multidrug ATP-binding cassette, subfamily G, 2 (ABCG2) transporter was recently identified as an important human urate transporter, and a common mutation, a Gln to Lys substitution at position 141 (Q141K), was shown to cause hyperuricemia and gout. The nature of the Q141K defect, however, remains undefined. Here we explore the Q141K ABCG2 mutation using a comparative approach, contrasting it with another disease-causing mutation in an ABC transporter, the deletion of Phe-508 (DeltaF508) in the cystic fibrosis transmembrane conductance regulator (CFTR). We found, much like in DeltaF508 CFTR, that the Q141K mutation leads to instability in the nucleotide-binding domain (NBD), a defect that translates to significantly decreased protein expression. However, unlike the CFTR mutant, the Q141K mutation does not interfere with the nucleotide-binding domain/intracellular loop interactions. This investigation has also led to the identification of critical residues involved in the protein-protein interactions necessary for the dimerization of ABCG2: Lys-473 (K473) and Phe-142 (F142). Finally, we have demonstrated the utility of using small molecules to correct the Q141K defect in expression and function as a possible therapeutic approach for hyperuricemia and gout.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
158 Here we tested homologous NBD mutations in Q141K ABCG2 and found the G188E mutation rescued Q141K expression, suggesting the Q141K mutation results in increased ABCG2 NBD instability. Login to comment
159 Interestingly, the R193K mutation, homologous to the suppressor mutation R555K in CFTR, didn`t increase Q141K ABCG2 expression; but did appear to decrease the insoluble fraction of Q141K protein (Fig. S6D). Login to comment

[hide] Effects of the gout-causing Q141K polymorphism and... Biochem Biophys Res Commun. 2013 Jul 19;437(1):140-5. doi: 10.1016/j.bbrc.2013.06.054. Epub 2013 Jun 22. Saranko H, Tordai H, Telbisz A, Ozvegy-Laczka C, Erdos G, Sarkadi B, Hegedus T
Effects of the gout-causing Q141K polymorphism and a CFTR DeltaF508 mimicking mutation on the processing and stability of the ABCG2 protein.
Biochem Biophys Res Commun. 2013 Jul 19;437(1):140-5. doi: 10.1016/j.bbrc.2013.06.054. Epub 2013 Jun 22., [PMID:23800412]

Abstract [show]
ABCG2 is an important multidrug transporter involved also in urate transport, thus its mutations can lead to the development of gout and may also alter general drug absorption, distribution and excretion. The frequent ABCG2 polymorphism, Q141K, is associated with an elevated risk of gout and has been controversially reported to reduce the plasma membrane expression and/or the transport function of the protein. In the present work we examined the stability and cellular processing of the Q141K ABCG2 variant, as well as that of the DeltaF142 ABCG2, corresponding to the DeltaF508 mutation in the CFTR (ABCC7) protein, causing cystic fibrosis. The processing and localization of full length ABCG2 variants were investigated in mammalian cells, followed by Western blotting and confocal microscopy, respectively. Folding and stability were examined by limited proteolysis of Sf9 insect cell membranes expressing these ABCG2 constructs. Stability of isolated nucleotide binding domains, expressed in and purified from bacteria, was studied by CD spectroscopy. We find that the Q141K variant has a mild processing defect which can be rescued by low temperature, a slightly reduced activity, and a mild folding defect, especially affecting the NBD. In contrast, the DeltaF142 mutant has major processing and folding defects, and no ATPase function. We suggest that although these mutations are both localized within the NBD, based on molecular modeling their contribution to the ABCG2 structure and function is different, thus rescue strategies may be devised accordingly.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 Therefore all these three mutations were introduced into the corresponding regions of the ABCG2 DF142 construct (3R: G188E, R191Q, and R193K). Login to comment

[hide] Rescue of functional DeltaF508-CFTR channels by co... FEBS Lett. 2003 Nov 6;554(1-2):173-8. Owsianik G, Cao L, Nilius B
Rescue of functional DeltaF508-CFTR channels by co-expression with truncated CFTR constructs in COS-1 cells.
FEBS Lett. 2003 Nov 6;554(1-2):173-8., [PMID:14596935]

Abstract [show]
The most frequent mutant variant of the cystic fibrosis transmembrane conductance regulator (CFTR), DeltaF508-CFTR, is misprocessed and subsequently degraded in the endoplasmic reticulum. Using the patch-clamp technique, we showed that co-expressions of DeltaF508-CFTR with the N-terminal CFTR truncates containing bi-arginine (RXR) retention/retrieval motifs result in a functional rescue of the DeltaF508-CFTR mutant channel in COS-1 cells. This DeltaF508-CFTR rescue process was strongly impaired when truncated CFTR constructs possessed either the DeltaF508 mutation or arginine-to-lysine mutations in RXRs. In conclusions, our data demonstrated that expression of truncated CFTR constructs could be a novel promising approach to improve maturation of DeltaF508-CFTR channels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
33 The base pair substitutions (underlined) were introduced using following oligonucleotides: for R29K mutation: 5P-GAAAGGATACAAACAGC- GCCTGGA (sense) and 5P-TCCAGGCGCTGTTTGTATCCTTTC (antisense); for R516K mutation: 5P-CTATGATGAATATAAATA- CAGAAGCGTC (sense) and 5P-GACGCTTCTGTATTTATATTC- ATCATAG (antisense); for R555K mutation: 5P-GGTCAACGAG- CAAAAATTTCTTTAGC (sense) and 5P-GCTAAAGAAATTTT- TGCTCGTTGACC (antisense). Login to comment
93 Co-expression of vF508-CFTR with mutated constructs, possessing R516K and R555K mutations either alone or in combination, led to an about two-fold decrease of vF508-CFTR-dependent current when compared to cells that co-expressed vF508-CFTR and WF2 (Table 1). Login to comment
97 The RR2 construct is identical to RR1 except for the presence of R516K and R555K mutations in RXRs. Login to comment
133 Arginine-to- lysine mutation in NBD1`s RXRs of truncated CFTR constructs (R516K and R555K mutations) strongly impairs their vF508-CFTR rescue properties. Login to comment

[hide] F508del CFTR with two altered RXR motifs escapes f... Biochim Biophys Acta. 2006 May;1758(5):565-72. Epub 2006 Mar 31. Hegedus T, Aleksandrov A, Cui L, Gentzsch M, Chang XB, Riordan JR
F508del CFTR with two altered RXR motifs escapes from ER quality control but its channel activity is thermally sensitive.
Biochim Biophys Acta. 2006 May;1758(5):565-72. Epub 2006 Mar 31., [PMID:16624253]

Abstract [show]
Most cystic fibrosis (CF) patients carry the F508del mutation in the CFTR chloride channel protein resulting in its misassembly, retention in the endoplasmic reticulum (ER), and proteasomal degradation. Therefore, characterization of the retention and attempts to rescue the mutant CFTR are a major focus of CF research. Earlier, we had shown that four arginine-framed tripeptide (AFT) signals in CFTR participate in the quality control. Now we have mutated these four AFTs in all possible combinations and found that simultaneous inactivation of two of them (R29K and R555K) is necessary and sufficient to overcome F508del CFTR retention. Immunofluorescence staining of BHK cells expressing this variant indicates that it matures and is routed to the plasma membrane. Acquisition of at least some wild-type structure was detected in the pattern of proteolytic digestion fragments. Functional activity at the cell surface was evident in chloride efflux assays. However, single channel activity of the rescued mutant measured in planar lipid bilayers diminished as temperature was increased from 30 to 37 degrees C. These findings support the idea that absence of Phe 508 causes not only a kinetic folding defect but also steady-state structural instability. Therefore effective molecular therapies developed to alleviate disease caused by F508del and probably other misprocessing mutants will require overcoming both their kinetic and steady-state impacts.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Now we have mutated these four AFTs in all possible combinations and found that simultaneous inactivation of two of them (R29K and R555K) is necessary and sufficient to overcome F508del CFTR retention. Login to comment
41 The PCR was performed according to standard Stratagene protocols using the same oligonucleotides employed to make the R29K and R555K substitutions previously [32]. Login to comment
176 In fact Teem et al. [42] had found that the R555K substitution alone restored a small F508del CFTR chloride current. Login to comment

[hide] Rescue of F508del CFTR: Commentary on "F508del CFT... Biochim Biophys Acta. 2006 May;1758(5):563-4. Epub 2006 Apr 7. Tummler B
Rescue of F508del CFTR: Commentary on "F508del CFTR with two altered RXR motifs escapes from ER quality control but its channel activity is thermally sensitive".
Biochim Biophys Acta. 2006 May;1758(5):563-4. Epub 2006 Apr 7., [PMID:16712779]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 doi:10.1016/j.bbamem.2006.03.033 Hegedus' finding also provides a clue why second-site mutations in the RXR motif in the dodecapetide of NBF1 such as R553Q, R553M and R555K partially corrected the F508del CFTR mutant phenotype in model systems [16] and in CF patients [17]. Login to comment

[hide] Requirements for efficient correction of DeltaF508... Cell. 2012 Jan 20;148(1-2):164-74. doi: 10.1016/j.cell.2011.11.023. Mendoza JL, Schmidt A, Li Q, Nuvaga E, Barrett T, Bridges RJ, Feranchak AP, Brautigam CA, Thomas PJ
Requirements for efficient correction of DeltaF508 CFTR revealed by analyses of evolved sequences.
Cell. 2012 Jan 20;148(1-2):164-74. doi: 10.1016/j.cell.2011.11.023., [PMID:22265409]

Abstract [show]
Misfolding of DeltaF508 cystic fibrosis (CF) transmembrane conductance regulator (CFTR) underlies pathology in most CF patients. F508 resides in the first nucleotide-binding domain (NBD1) of CFTR near a predicted interface with the fourth intracellular loop (ICL4). Efforts to identify small molecules that restore function by correcting the folding defect have revealed an apparent efficacy ceiling. To understand the mechanistic basis of this obstacle, positions statistically coupled to 508, in evolved sequences, were identified and assessed for their impact on both NBD1 and CFTR folding. The results indicate that both NBD1 folding and interaction with ICL4 are altered by the DeltaF508 mutation and that correction of either individual process is only partially effective. By contrast, combination of mutations that counteract both defects restores DeltaF508 maturation and function to wild-type levels. These results provide a mechanistic rationale for the limited efficacy of extant corrector compounds and suggest approaches for identifying compounds that correct both defective steps.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
18 Additional second-site revertant mutations I539T, G550E, R553M, and R555K, within the portion of CFTR NBD1 included in the chimera, were also identified (DeCarvalho et al., 2002; Teem et al., 1993, 1996). Login to comment
19 The R553M, I539T, and the combination of G550E-R553M-R555K (3M) mutations correct the folding and stability defects of the DF508 NBD1 domain in isolation (DeCarvalho et al., 2002; Hoelen et al., 2010; Pissarra et al., 2008; Qu et al., 1997; Thibodeau et al., 2010) but only partially restore maturation of the full-length mutant protein (Hoelen et al., 2010; Pissarra et al., 2008; Thibodeau et al., 2010). Login to comment
76 The R555K missense mutation F508 ICL4 ICL1 F508 A B 0 0.2 0.4 0.6 0.8 1 508 Consensus Walker B 389 673 Walker A 0 0.2 0.4 0.6 0.8 1 NBD1 508 TMD NBD R TMD2 NBD 1 1480 TMD NBD R TMD2 NBD Figure 2. Login to comment
90 R555K increased the folding yield of NBD1, 3.26- &#b1; 0.07-fold over wild-type (Figure 3A). Login to comment
91 The Tm of R555K NBD1 was 6.4 C higher than wild-type in 2 mM ATP. Login to comment
127 The surface view A B I539T G550E R553M R555K 3M WT F S466T L475Y F490L W496V Y517I C524A L526A D529F D537F Y563V A566P S573E P574A F575T E583G H609T 0 1 2 3 Relative Yield NBD1 ( -gal.) 25 30 35 40 45 0.0 0.5 1.0 Temperature (C ) Relative Turbitity 0 1 2 3 4 -5 0 5 10 WT F I539T I539T F S573E R555K D529F Relative Yield NBD1 ( -gal.) Tm Figure 3. Login to comment
158 Mirroring the maturation results, correction of either the NBD1 defect (I539T, R555K, red bars) or the ICL4-NBD1 defect (R1070W, white bar) alone provided only modest improvements of function. Login to comment
166 B C A B 0 1 2 3 0 1 2 Relative Yield NBD1 (b2;-gal.) Relative Yield CFTR (ELISA) WT ࢞F WT ƊF S466T L475Y F490L W496V Y517I C524A L526A D529F D537F Y563V A566P S573E P574A F575T E583G H609T 0 1 2 Relative Yield CFTR (ELISA) I539T G550E R553M R555K 3M Figure 4. Login to comment
172 See also Figure S5. (B) The influence of the 508-coupled mutations (green circles), four second-site suppressor mutations (I539T, G550E, R553M, and R555K) and three suppressors in combination (G550E, R553M, and R555K) (orange circles) on F508 background on relative maturation of full-length CFTR and relative NBD1 folding yield is correlated (green line, m = 0.75, R = 0.85). Login to comment
185 Previously identified second-site suppressor (I539T, G550E, R553M, R555K, and 3M) but not the 508-coupled mutants (D529F and S573E) increase the yield of DF508 NBD1. Login to comment
187 See also Table S2. (C) F508K, F508R, and F508K in combination with I539T, G550E, R553M, R555K, and 3M mutations increase folding yield of NBD1, but exhibit no corresponding increase in CFTR maturation yield (dark blue circles and line, m = 0.03, R = 0.40) (&#b1;SEM, n = 9 along x axis and n = 3 along y axis). Login to comment
219 When R1070W is combined with mutations that improve DF508 NBD1 folding yield, I539T, G550E, R553M, R555K, and 3M (open triangles), the correlation between NBD1 folding and CFTR maturation in the wild-type protein is restored (m = 0.77, R = 0.47, black line) (&#b1;SEM). Login to comment
233 D529F, S573E, and R555K mutations of human wild-type NBD1 were expressed and purified as previously described (Thibodeau et al., 2005). Login to comment

[hide] Functional Rescue of F508del-CFTR Using Small Mole... Front Pharmacol. 2012 Sep 26;3:160. doi: 10.3389/fphar.2012.00160. eCollection 2012. Molinski S, Eckford PD, Pasyk S, Ahmadi S, Chin S, Bear CE
Functional Rescue of F508del-CFTR Using Small Molecule Correctors.
Front Pharmacol. 2012 Sep 26;3:160. doi: 10.3389/fphar.2012.00160. eCollection 2012., [PMID:23055971]

Abstract [show]
High-throughput screens for small molecules that are effective in "correcting" the functional expression of F508del-CFTR have yielded several promising hits. Two such compounds are currently in clinical trial. Despite this success, it is clear that further advances will be required in order to restore 50% or greater of wild-type CFTR function to the airways of patients harboring the F508del-CFTR protein. Progress will be enhanced by our better understanding of the molecular and cellular defects caused by the F508del mutation, present in 90% of CF patients. The goal of this chapter is to review the current understanding of defects caused by F508del in the CFTR protein and in CFTR-mediated interactions important for its biosynthesis, trafficking, channel function, and stability at the cell surface. Finally, we will discuss the gaps in our knowledge regarding the mechanism of action of existing correctors, the unmet need to discover compounds which restore proper CFTR structure and function in CF affected tissues and new strategies for therapy development.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 The first stabilizing mutations were identified in the ABC conserved, canonical subdomains, and cluster in the b1;-helical subdomain (G550R, R553Q, R555K), in the b3; switch (F494N), and ATP binding core subdomain (Q637R). Login to comment
59 Similarly, the second site mutations, previously discussed with regard to their efficacy in stabilizing the isolated F508del-NBD1, i.e., the second site mutations in the ABC conserved core ATP binding subdomains (G550E, R553Q, and R555K) also promote improved processing of the full-length F508del-CFTR. Login to comment
62 Employing biophysical methods, including circular dichroism, dynamic light scattering,and fluorescence,both groups confirmed that the introduction of "stabilizing mutations" residing in the ABC b1;-helical subdomain (G550E, R553M, R555K) and the structural diverse region (I539T), fully corrects defects in kinetic and thermal stability of the isolated F508del-NBD1 domain. Login to comment

[hide] Pharmacological Correctors of Mutant CFTR Mistraff... Front Pharmacol. 2012 Oct 5;3:175. doi: 10.3389/fphar.2012.00175. eCollection 2012. Pedemonte N, Galietta LJ
Pharmacological Correctors of Mutant CFTR Mistrafficking.
Front Pharmacol. 2012 Oct 5;3:175. doi: 10.3389/fphar.2012.00175. eCollection 2012., [PMID:23060795]

Abstract [show]
The lack of phenylalanine 508 (DeltaF508 mutation) in the cystic fibrosis (CF) transmembrane conductance regulator (CFTR) Cl(-) channel represents the most frequent cause of CF, a genetic disease affecting multiple organs such as lung, pancreas, and liver. DeltaF508 causes instability and misfolding of CFTR protein leading to early degradation in the endoplasmic reticulum and accelerated removal from the plasma membrane. Pharmacological correctors of mutant CFTR protein have been identified by high-throughput screening of large chemical libraries, by in silico docking of virtual compounds on CFTR structure models, or by using compounds that affect the whole proteome (e.g., histone deacetylase inhibitors) or a single CFTR-interacting protein. The presence of multiple defects of the CFTR protein caused by the DeltaF508 mutation and the redundancy of quality control mechanisms detecting DeltaF508-CFTR as a defective protein impose a ceiling to the maximal effect that a single compound (corrector) may obtain. Therefore, treatment of patients with the most frequent CF mutation may require the optimized combination of two drugs having additive or synergic effects.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
144 The first type of mutation,such as I539T or R555K,increases the stability of NBD1. Login to comment

[hide] Correctors of DeltaF508 CFTR restore global confor... FASEB J. 2013 Feb;27(2):536-45. doi: 10.1096/fj.12-216119. Epub 2012 Oct 26. He L, Kota P, Aleksandrov AA, Cui L, Jensen T, Dokholyan NV, Riordan JR
Correctors of DeltaF508 CFTR restore global conformational maturation without thermally stabilizing the mutant protein.
FASEB J. 2013 Feb;27(2):536-45. doi: 10.1096/fj.12-216119. Epub 2012 Oct 26., [PMID:23104983]

Abstract [show]
Most cystic fibrosis is caused by the deletion of a single amino acid (F508) from CFTR and the resulting misfolding and destabilization of the protein. Compounds identified by high-throughput screening to improve DeltaF508 CFTR maturation have already entered clinical trials, and it is important to understand their mechanisms of action to further improve their efficacy. Here, we showed that several of these compounds, including the investigational drug VX-809, caused a much greater increase (5- to 10-fold) in maturation at 27 than at 37 degrees C (<2-fold), and the mature product remained short-lived (T(1/2) approximately 4.5 h) and thermally unstable, even though its overall conformational state was similar to wild type, as judged by resistance to proteolysis and interdomain cross-linking. Consistent with its inability to restore thermodynamic stability, VX-809 stimulated maturation 2-5-fold beyond that caused by several different stabilizing modifications of NBD1 and the NBD1/CL4 interface. The compound also promoted maturation of several disease-associated processing mutants on the CL4 side of this interface. Although these effects may reflect an interaction of VX-809 with this interface, an interpretation supported by computational docking, it also rescued maturation of mutants in other cytoplasmic loops, either by allosteric effects or via additional sites of action. In addition to revealing the capabilities and some of the limitations of this important investigational drug, these findings clearly demonstrate that DeltaF508 CFTR can be completely assembled and evade cellular quality control systems, while remaining thermodynamically unstable. He, L., Kota, P., Aleksandrov, A. A., Cui, L., Jensen, T., Dokholyan, N. V., Riordan, J. R. Correctors of DeltaF508 CFTR restore global conformational maturation without thermally stabilizing the mutant protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
148 A) èc;F508 with NBD1-stabilizing mutations: 4S, I539T/G550E/R553M/R555K; èc;RI, deletion of amino acid residues 404-435; 4PT, S422P/S434P/S492P/A534P/I539T. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... Cold Spring Harb Perspect Med. 2013 Feb 1;3(2):a009514. doi: 10.1101/cshperspect.a009514. Hunt JF, Wang C, Ford RC
Cystic fibrosis transmembrane conductance regulator (ABCC7) structure.
Cold Spring Harb Perspect Med. 2013 Feb 1;3(2):a009514. doi: 10.1101/cshperspect.a009514., [PMID:23378596]

Abstract [show]
Structural studies of the cystic fibrosis transmembrane conductance regulator (CFTR) are reviewed. Like many membrane proteins, full-length CFTR has proven to be difficult to express and purify, hence much of the structural data available is for the more tractable, independently expressed soluble domains. Therefore, this chapter covers structural data for individual CFTR domains in addition to the sparser data available for the full-length protein. To set the context for these studies, we will start by reviewing structural information on model proteins from the ATP-binding cassette (ABC) transporter superfamily, to which CFTR belongs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
163 One such set, called the Teem set, comprised three point mutations (G550E/ R553Q/R555K) that previously were shown to promote improved biogenesis of F508del CFTR in tissue cultures cells, presumably by improving the stability of the protein (Teem et al. 1993; DeCarvalho et al. 2002). Login to comment
236 Note that the structures shown here contain seven point mutations included in hNBD1 constructs because of their beneficial influence on yield during purification-F409L, F429S, F433L, G550E, R553Q, R555K, and H667R. Login to comment
275 A series of second-site mutations in NBD1 have parallel effects in rescuing the trafficking defect in CFTR in vivo (DeCarvalho et al. 2002; Pissarra et al. 2008; Aleksandrov et al. 2010) and inhibiting molten globule formation by isolated NBD1 in vitro (G550E/R553Q/R555K, F494N/Q637R, or V510D) (Protasevich et al. 2010; Wang et al. 2010). Login to comment

[hide] Dynamics intrinsic to cystic fibrosis transmembran... Cold Spring Harb Perspect Med. 2013 Mar 1;3(3):a009522. doi: 10.1101/cshperspect.a009522. Chong PA, Kota P, Dokholyan NV, Forman-Kay JD
Dynamics intrinsic to cystic fibrosis transmembrane conductance regulator function and stability.
Cold Spring Harb Perspect Med. 2013 Mar 1;3(3):a009522. doi: 10.1101/cshperspect.a009522., [PMID:23457292]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) requires dynamic fluctuations between states in its gating cycle for proper channel function, including changes in the interactions between the nucleotide-binding domains (NBDs) and between the intracellular domain (ICD) coupling helices and NBDs. Such motions are also linked with fluctuating phosphorylation-dependent binding of CFTR's disordered regulatory (R) region to the NBDs and partners. Folding of CFTR is highly inefficient, with the marginally stable NBD1 sampling excited states or folding intermediates that are aggregation-prone. The severe CF-causing F508del mutation exacerbates the folding inefficiency of CFTR and leads to impaired channel regulation and function, partly as a result of perturbed NBD1-ICD interactions and enhanced sampling of these NBD1 excited states. Increased knowledge of the dynamics within CFTR will expand our understanding of the regulated channel gating of the protein as well as of the F508del defects in folding and function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
200 Many of the suppressor mutations, like G550E, R553Q, and R555K (Teem et al. 1993, 1996), which are relatively distant from the F508 position, increase NBD1 thermal stability and reverse some of the processing and functional defects, presumably without reverting the surface changes caused by deletion of F508. Login to comment

[hide] Bithiazole correctors rescue CFTR mutants by two d... Biochemistry. 2013 Aug 6;52(31):5161-3. doi: 10.1021/bi4008758. Epub 2013 Jul 22. Loo TW, Bartlett MC, Clarke DM
Bithiazole correctors rescue CFTR mutants by two different mechanisms.
Biochemistry. 2013 Aug 6;52(31):5161-3. doi: 10.1021/bi4008758. Epub 2013 Jul 22., [PMID:23865422]

Abstract [show]
Better correctors are needed to repair cystic fibrosis transmembrane conductance regulator (CFTR) processing mutants that cause cystic fibrosis. Determining where the correctors bind to CFTR would aid in the development of new correctors. A recent study reported that the second nucleotide-binding domain (NBD2) was involved in binding of bithiazole correctors. Here, we show that bithiazole correctors could also rescue CFTR mutants that lacked NBD2. These results suggest that bithiazoles rescue CFTR mutants by two different mechanisms.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
24 It should be noted, however, that the ƊNBD2 CFTR used in this study was different from that used by Okiyoneda et al.18 The ƊNBD2 CFTR constructs in our study did not contain the G550E, R553Q, R555K, and F494N mutations or the three hemagglutinin tags in the fourth extracellular loop that could influence CFTR corrector interactions. Login to comment

[hide] Revertants, low temperature, and correctors reveal... Chem Biol. 2013 Jul 25;20(7):943-55. doi: 10.1016/j.chembiol.2013.06.004. Farinha CM, King-Underwood J, Sousa M, Correia AR, Henriques BJ, Roxo-Rosa M, Da Paula AC, Williams J, Hirst S, Gomes CM, Amaral MD
Revertants, low temperature, and correctors reveal the mechanism of F508del-CFTR rescue by VX-809 and suggest multiple agents for full correction.
Chem Biol. 2013 Jul 25;20(7):943-55. doi: 10.1016/j.chembiol.2013.06.004., [PMID:23890012]

Abstract [show]
Cystic fibrosis is mostly caused by the F508del mutation, which impairs CFTR protein from exiting the endoplasmic reticulum due to misfolding. VX-809 is a small molecule that rescues F508del-CFTR localization, which recently went into clinical trial but with unknown mechanism of action (MoA). Herein, we assessed if VX-809 is additive or synergistic with genetic revertants of F508del-CFTR, other correctors, and low temperature to determine its MoA. We explored and integrated those various agents in combined treatments, showing how they add to each other to identify their complementary MoA upon correction of F508del-CFTR. Our experimental and modeling data, while compatible with putative binding of VX-809 to NBD1:ICL4 interface, also indicate scope for further synergistic F508del-CFTR correction by other compounds at distinct conformational sites/cellular checkpoints, thus suggesting requirement of combined therapies to fully rescue F508del-CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
23 Herein, we explored the MoA of VX-809 by analyzing its synergistic/additive effect with those of previously characterized genetic revertants, which rescue F508del-CFTR by causing different effects: 4RK affecting traffic (Roxo-Rosa et al., 2006), G550E (Roxo-Rosa et al., 2006) and R555K increasing channel gating by strengthening the NBD1:NBD2 dimer interface, and R1070W (Serohijos et al., 2008) and V510D (Wang et al., 2007a; Loo et al., 2010) by filling the NBD1:ICL4 interface. Login to comment
36 VX-809 Adds to VRT-325 and Corr-4a to Rescue F508del-CFTR but Exhibits Variable Effects on Genetic Revertants In order to characterize the rescue mechanism of VX-809 on F508del-CFTR, we then tested the effect of incubating it together with VRT-325 and Corr-4a on BHK cells stably expressing this mutant alone or in cis with the following genetic revertants: (1) 4RK (where the four AFTs were simultaneously mutated to lysines), (2) G550E, (3) R1070W, (4) V510D, or (5) R555K (Figures 1A-1E). Login to comment
41 Interestingly, however, analysis of the effects of the three compounds upon the revertants showed that VX-809 (but neither VRT-325 nor Corr-4a) is additive to G550E or R555K in correcting F508del-CFTR (by 38% and 32%, respectively), strongly suggesting that VX-809 acts differently from these two revertants. Login to comment
57 Effect of Small Molecule Correctors on F508del-CFTR and Genetic Revertants (A-F) BHK cell lines stably expressing CFTR bearing F508del alone (A) or in cis with 4RK (B), G550E (C), R1070W (D), V510D (E), and R555K (F) were incubated for 24 hr with 6.7 mM VRT-325, 10 mM Corr-4a, or 3 mM VX-809 alone or in combination. Login to comment
87 Rescue of F508del-CFTR by Low Temperature Is Additive to Genetic Revertants To learn more about how low temperature rescues F508del-CFTR, we assessed its combined effect with that of the above genetic revertants: G550E, R1070W, 4RK, V510D, and R555K (Figures 4A and 4B). Login to comment
88 Results show that low temperature further increases processing levels of F508del-CFTR by the five genetic revertants, namely, V510D, G550E, R1070W, 4RK, and R555K, by an additional 35%, 65%, 38%, 27%, and 22%, respectively (compare gray and black bars in Figure 4B). Login to comment
164 Indeed, VX-809 (in contrast to either VRT-325 or Corr-4a) adds to the rescue by G550E and R555K (both acting at the NBD1:NBD2 interface), indicating that the compound and these two revertants probably correct distinct conformational cues of F508del-CFTR. Login to comment
165 In contrast, the additive effect of VX-809 to R1070W and V510D is rather modest, thus suggesting that this corrector acts more similarly to R1070W/V510D than to G550E/R555K. Login to comment
197 Moreover, the observed synergy of G550E or R555K with VX-809, but not VRT-325, is consistent with this model in which VRT-325 acts on the NBD1:NBD2 dimerization interface (also supported by the synergy between R1070W and VRT-325). Login to comment
210 Our data also show that low temperature, similar to chemical correctors, further increases processing levels of F508del-CFTR by the five genetic revertants, although to variable levels: V510D (by an additional 35%), G550E (65%), R1070W (38%), 4RK (27%), and R555K (22%). Login to comment
214 Although 4RK can also be claimed to impact on F508del-CFTR folding (namely, through its two NBD1 changes: R516K and especially R555K), this is somewhat disproven by the additive effects of 4RK with G550E (Figure 4), the latter truly correcting F508del-NBD1 folding, as assessed by channel gating (Farinha and Amaral, 2005; Rosser et al., 2008; Roxo-Rosa et al., 2006). Login to comment
231 EXPERIMENTAL PROCEDURES Cells and Culture Conditions BHK cell lines expressing F508del-4RK (R29K/R516K/R555K/R716K)-, F508del-G550E-, F508del-R1070W-, F508del-V510D-, F508del-R555K-, F508del-V510D/G550E-, F508del-G550E/R1070W-, DAA (D567A)-, 4RK- DAA-, DD/AA (D565A, D567A)-, 4RK-DD/AA-, and R560T-CFTR were produced and cultured as previously described (Roxo-Rosa et al., 2006). Login to comment

[hide] On the structural organization of the intracellula... Int J Biochem Cell Biol. 2014 Jul;52:7-14. doi: 10.1016/j.biocel.2014.01.024. Epub 2014 Feb 7. Moran O
On the structural organization of the intracellular domains of CFTR.
Int J Biochem Cell Biol. 2014 Jul;52:7-14. doi: 10.1016/j.biocel.2014.01.024. Epub 2014 Feb 7., [PMID:24513531]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is a multidomain membrane protein forming an anion selective channel. Mutations in the gene encoding CFTR cause cystic fibrosis (CF). The intracellular side of CFTR constitutes about 80% of the total mass of the protein. This region includes domains involved in ATP-dependent gating and regulatory protein kinase-A phosphorylation sites. The high-resolution molecular structure of CFTR has not yet been solved. However, a range of lower resolution structural data, as well as functional biochemical and electrophysiological data, are now available. This information has enabled the proposition of a working model for the structural architecture of the intracellular domains of the CFTR protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1241 However, as the native preparation of NBD1 and NBD2 tend to precipitate at relatively low concentration (>2.5 mg/ml; Galeno et al., 2011; Galfr&#e8; et al., 2012), to obtain protein concentrations compatible with the crystallization conditions, three to seven revertant mutations (F409L, F429S, F433L, G550E, R553Q, R555K, H667R, Roxo-Rosa et al., 2006; F429S, F494N, Q637R, Pissarra et al., 2008) have been introduced into the NBD1. Login to comment

[hide] Biosynthesis of cystic fibrosis transmembrane cond... Int J Biochem Cell Biol. 2014 Jul;52:26-38. doi: 10.1016/j.biocel.2014.03.020. Epub 2014 Mar 28. Pranke IM, Sermet-Gaudelus I
Biosynthesis of cystic fibrosis transmembrane conductance regulator.
Int J Biochem Cell Biol. 2014 Jul;52:26-38. doi: 10.1016/j.biocel.2014.03.020. Epub 2014 Mar 28., [PMID:24685677]

Abstract [show]
The cystic fibrosis transmembrane conductance regulator (CFTR) is a cAMP-regulated chloride (Cl(-)) channel. Mutations of its gene lead to the disease of cystis fibrosis (CF) among which the most common is the deletion of phenylalanine at position 508 (Phe508del). CFTR is a multi-domain glycoprotein whose biosynthesis, maturation and functioning as an anion channel involve multi-level post-translational modifications of CFTR molecules and complex folding processes to reach its native, tertiary conformation. Only 20-40% of the nascent chains achieve folded conformation, while the remaining molecules are targeted for degradation by endoplasmic reticulum, lysosomes, or autophagy. A large number of mutations causing CF impair processing of CFTR. Growing knowledge of CFTR biosynthesis has enabled understanding the cellular basis of CF and has brought to light various potential targets for novel, promising therapies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1442 Mutations located in NBD1, such as I539T, G550E, R553M/Q and R555K, as well as R1070W in CL4 of MSD2 promote Phe508del-CFTR maturation and trafficking to the cell surface and also restore channel activity (DeCarvalho et al., 2002; Teem et al., 1993, 1996; Thibodeau et al., 2010). Login to comment

[hide] Enhancing the Potency of F508del Correction: A Mul... J Pharmacol Clin Toxicol. 2013 Aug 28;1(1):1007. Kirby EF, Heard AS, Wang XR
Enhancing the Potency of F508del Correction: A Multi-Layer Combinational Approach to Drug Discovery for Cystic Fibrosis.
J Pharmacol Clin Toxicol. 2013 Aug 28;1(1):1007., [PMID:24855632]

Abstract [show]
With better understanding of the cellular and molecular pathophysiology underlying cystic fibrosis (CF), novel drugs are being developed that specifically target the molecular defects of the cystic fibrosis transmembrane conductance regulator (CFTR), a cAMP-activated chloride channel on the plasma membrane that causes CF. Starting with cell-based high-throughput screening, small molecules have been identified that are able to fix specific molecular defects of various disease-causing CFTR mutants. With the successful development of ivacaftor, a "potentiator" that enhances CFTR chloride channel activity, new types of small-molecule compounds that "correct" the misfolding and misprocessing of the most common CF-causing mutation, F508del, are actively being sought for. Recent studies focused on the potential mechanisms of action of some of the investigational CFTR "correctors" shed new light on how the F508del mutant can be targeted in an attempt to ameliorate the clinical symptoms associated with CF. A multi-layer combinational approach has been proposed to achieve the high-potency correction necessary for significant clinical outcome. The mechanistic insights obtained from such studies will shape the future therapeutics development for the vast majority of CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 In contrast, combined second-site suppressor mutations R553K/R555K (2RK) in NBD1 not only alter the protease susceptibility of NBD1 but also that of other domains of F508del CFTR. Login to comment

[hide] Decoding F508del misfolding in cystic fibrosis. Biomolecules. 2014 May 6;4(2):498-509. doi: 10.3390/biom4020498. Wang XR, Li C
Decoding F508del misfolding in cystic fibrosis.
Biomolecules. 2014 May 6;4(2):498-509. doi: 10.3390/biom4020498., [PMID:24970227]

Abstract [show]
The functional deficiency of the cystic fibrosis transmembrane conductance regulator (CFTR), a plasma membrane chloride channel, leads to the development of cystic fibrosis. The deletion of a phenylalanine at residue 508 (F508del) is the most common cause of CFTR misfolding leading to the disease. The F508del misfolding originates in the first nucleotide-binding domain (NBD1), which induces a global conformational change in CFTR through NBD1's interactions with other domains. Such global misfolding produces a mutant chloride channel that is impaired in exocytic trafficking, peripheral stability, and channel gating. The nature and atomic details of F508del misfolding have been subject to extensive research during the past decade. Current data support a central role for NBD1 in F508del misfolding and rescue. Many cis-acting NBD1 second-site mutations rescue F508del misfolding in the context of full-length CFTR. While some of these mutations appear to specifically counteract the F508del-induced misfolding, others release certain inherent conformational constraints of the human wild-type CFTR. Several small-molecule correctors were recently found to act on key interdomain interfaces of F508del CFTR. Potential rational approaches have been proposed in an attempt to develop highly effective small molecule modulators that improve the cell surface functional expression of F508del CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 This NBD1 conformational defect is fully correctable by revertant mutation R555K [24] or by low-temperature incubation in permissive cell lines, which is accompanied by conformational rescue in other CFTR domains [8]. Login to comment

[hide] Restoration of NBD1 thermal stability is necessary... J Mol Biol. 2015 Jan 16;427(1):106-20. doi: 10.1016/j.jmb.2014.07.026. Epub 2014 Jul 30. He L, Aleksandrov AA, An J, Cui L, Yang Z, Brouillette CG, Riordan JR
Restoration of NBD1 thermal stability is necessary and sufficient to correct F508 CFTR folding and assembly.
J Mol Biol. 2015 Jan 16;427(1):106-20. doi: 10.1016/j.jmb.2014.07.026. Epub 2014 Jul 30., [PMID:25083918]

Abstract [show]
Cystic fibrosis transmembrane conductance regulator (CFTR) (ABCC7), unique among ABC exporters as an ion channel, regulates ion and fluid transport in epithelial tissues. Loss of function due to mutations in the cftr gene causes cystic fibrosis. The most common cystic-fibrosis-causing mutation, the deletion of F508 (DeltaF508) from the first nucleotide binding domain (NBD1) of CFTR, results in misfolding of the protein and clearance by cellular quality control systems. The DeltaF508 mutation has two major impacts on CFTR: reduced thermal stability of NBD1 and disruption of its interface with membrane-spanning domains (MSDs). It is unknown if these two defects are independent and need to be targeted separately. To address this question, we varied the extent of stabilization of NBD1 using different second-site mutations and NBD1 binding small molecules with or without NBD1/MSD interface mutation. Combinations of different NBD1 changes had additive corrective effects on F508 maturation that correlated with their ability to increase NBD1 thermostability. These effects were much larger than those caused by interface modification alone and accounted for most of the correction achieved by modifying both the domain and the interface. Thus, NBD1 stabilization plays a dominant role in overcoming the DeltaF508 defect. Furthermore, the dual target approach resulted in a locked-open ion channel that was constitutively active in the absence of the normally obligatory dependence on phosphorylation by protein kinase A. Thus, simultaneous targeting of both the domain and the interface, as well as being non-essential for correction of biogenesis, may disrupt normal regulation of channel function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 2PT, S492P/A534P/I539T; 4PT, 2PT + S422P/S434P; 3SS, G550E/R553M/R555K; 4SS, 3SS + I539T; ƊRI, deletion of RI amino acids 404-435; combo, ƊRI + 2PT + 3SS. Login to comment
66 S492P/I539T; 5-G550E/R553Q/R555K; 6-combo. Login to comment
75 Based on our single mutation analysis, the Tm difference between G550E/R553Q/R555K and G550E/R553M/R555K is less than 1 &#b0;C. Fig. 3. Login to comment
96 The S492P and I539T substitutions had additive affects such that ƊTm increased to 4.4 &#b0;C, and ƊTm was further increased to 8.4 &#b0;C when the additional mutations A534P/G550E/R553M/R555K were introduced. Login to comment

[hide] Deletion of Phenylalanine 508 in the First Nucleot... J Biol Chem. 2015 Sep 18;290(38):22862-78. doi: 10.1074/jbc.M115.641134. Epub 2015 Jul 6. Chong PA, Farber PJ, Vernon RM, Hudson RP, Mittermaier AK, Forman-Kay JD
Deletion of Phenylalanine 508 in the First Nucleotide-binding Domain of the Cystic Fibrosis Transmembrane Conductance Regulator Increases Conformational Exchange and Inhibits Dimerization.
J Biol Chem. 2015 Sep 18;290(38):22862-78. doi: 10.1074/jbc.M115.641134. Epub 2015 Jul 6., [PMID:26149808]

Abstract [show]
Deletion of Phe-508 (F508del) in the first nucleotide-binding domain (NBD1) of the cystic fibrosis transmembrane conductance regulator (CFTR) results in destabilization of the domain, intramolecular interactions involving the domain, and the entire channel. The destabilization caused by F508del manifests itself in defective channel processing and channel gating defects. Here, we present NMR studies of the effect of F508del and the I539T stabilizing mutation on NBD1 dynamics, with a view to understanding these changes in stability. Qualitatively, F508del NMR spectra exhibit significantly more peak broadening than WT spectra due to the enhanced intermediate time scale (millisecond to microsecond) motions in the mutant. Unexpectedly, studies of fast (nanosecond to picosecond) motions revealed that F508del NBD1 tumbles more rapidly in solution than WT NBD1. Whereas F508del tumbles at a rate nearly consistent with the monomeric state, the WT protein tumbles significantly more slowly. Paramagnetic relaxation enhancement experiments confirm that NBD1 homodimerizes in solution in the expected head-to-tail orientation. NMR spectra of WT NBD1 reveal significant concentration-dependent chemical shift perturbations consistent with NBD1 dimerization. Chemical shift analysis suggests that the more rapid tumbling of F508del is the result of an impaired ability to dimerize. Based on previously published crystal structures and NMR spectra of various NBD1 mutants, we propose that deletion of Phe-508 affects Q-loop conformational sampling in a manner that inhibits dimerization. These results provide a potential mechanism for inhibition of channel opening by F508del and support the dimer interface as a target for cystic fibrosis therapeutics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Evidence that NBD1 destabilization is problematic for proper processing was provided by NBD1-thermostabilizing mutations distant from the F508del site, including G550E, R553Q, R555K, and deletion of the RI. Login to comment
363 Interestingly, the combined suppressor mutations I539T, G550E, R553M, and R555K have a bigger positive effect on F508del CFTR when NBD2 is present (58), suggesting the importance of the NBD interaction and hinting that these NBD1-stabilizing mutations may also improve the ability of F508del NBD1 to dimerize with NBD2. Login to comment