ABCMdb

ABCC7 p.Arg555Lys

None has been submitted yet.

Publications

PMID: 16442101 [PubMed] Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."

No. Sentence Comment

311 [140] R555K Partially complements processing defect of CFTR F508 and increases wild-type and F508 channel activity. Login to comment

PMID: 12110684 [PubMed] DeCarvalho AC et al: "Mutations in the nucleotide binding domain 1 signature motif region rescue processing and functional defects of cystic fibrosis transmembrane conductance regulator delta f508."

No. Sentence Comment

103 Interestingly, the three ⌬F508 revertant mutations previously isolated using the STE6/CFTR system, R553Q, R553M, and R555K, are also located within the NBD1 signature motif (28, 29). Login to comment

PMID: 15528182 [PubMed] Lewis HA et al: "Impact of the deltaF508 mutation in first nucleotide-binding domain of human cystic fibrosis transmembrane conductance regulator on domain folding and structure."

No. Sentence Comment

73 We also investigated the effect of three suppressor mutations (G550E, R553Q, R555K) that have been observed to improve in vivo trafficking efficiency of STE6-CFTR chimeras containing the ⌬F508 mutation expressed in yeast (23-25). Login to comment
100 Crystal Structure of ⌬F508 hNBD1 Shows Minimal Conformational Changes but Substantive Changes in Surface Topography at the Putative Site of MSD1 Interaction-Crystals diffracting to a resolution of 2.3 Å were obtained for hNBD1-7a- ⌬F508, which contains seven mutations (F409L, F429S, F433L, G550E, R553Q, R555K, H667R) in addition to the deletion of Phe-508 (see Table II). Login to comment
139 The three suppressor mutations (G550E, R553Q, R555K) occur either in or immediately following the LSGGQ signature sequence at the N terminus of ␣-helix 5. Login to comment

PMID: 15619636 [PubMed] Thibodeau PH et al: "Side chain and backbone contributions of Phe508 to CFTR folding."

No. Sentence Comment

148 Note added in proof: Crystal structures of the human F508A missense NBD1 (with solublizing mutations F429S and H667R) and the corrected ∆F508 NBD1 (with three known suppressor mutations G550E, R553Q and R555K, and the solublizing mutations F409L, F429S, F433L and H667R) have been reported51. Login to comment

PMID: 15729345 [PubMed] Vergani P et al: "CFTR channel opening by ATP-driven tight dimerization of its nucleotide-binding domains."

No. Sentence Comment

85 c, Mutations at Arg 555 in NBD1 'tail` affect mean open burst (R555Q) and closed interburst (R555K) dwell times. Login to comment
90 b, Representative records from WT, single mutants R555K and T1246N, and double mutant R555K T1246N. Login to comment
97 Accordingly, the charge-conserving mutation R555K did not affect open burst duration (mean 0.39 ^ 0.04 s (n ¼ 26)). Login to comment
98 However, it substantially prolonged closed interburst duration (inversely related to opening rate) from 2.29 ^ 0.46 s (n ¼ 16) for WT to 8.53 ^ 1.23 s (n ¼ 15) for R555K (Fig. 2c, all measured at saturating [ATP]). Login to comment
99 On the basis of the evolutionary evidence suggesting the involvement of the side chain at this position in a conserved interaction (Fig. 2b), this slowing of channel opening could be explained if the R555K mutation were to weaken or remove a hydrogen bond between NBD1 and NBD2 that is absent in the closed, ground, state but present in the transition state for the channel opening reaction; the resulting destabilization of the transition state would increase the activation free energy (DG‡ ) for channel opening and hence decrease the opening rate. Login to comment
100 To quantify this suspected interaction between Arg 555 and Thr 1246 side chains (Fig. 2a), we applied double mutant-cycle analysis6,21 (see Supplementary Information), after mutating Arg 555 to Lys and Thr 1246 to Asn, both individually and jointly. Login to comment
102 If the two residues do not interact, the effects of mutating Arg 555 to Lys should be the same in a Thr 1246 background as in a T1246N background (and vice versa); that is, the effects of the single mutations should be independent and hence additive, and mutation-linked changes on parallel sides of the cycles should thus be equal. Login to comment
112 Current levels of the triple mutant R555K T1246N K1250R did not change when [ATP] was increased to 10 mM, indicating that 5 mM [ATP] was saturating. Login to comment
117 The apparent affinity for ATP was little influenced by the mutation R555K (R555K K0.5 ¼ 71 ^ 14 mM versus WT K0.5 ¼ 55 ^ 5 mM), but was reduced by the mutation T1246N (T1246N K0.5 ¼ 261 ^ 49 mM) by the same extent in the WT background as in the R555K background (R555K T1246N K0.5 ¼ 257 ^ 51 mM). Login to comment
124 The slowing of opening caused by the R555K mutation (Fig. 2c, above) corresponded to a 1.4 ^ 0.4kT increase in the activation energy barrier. Login to comment
133 Introducing the T1246N mutation into the K1250R background decreased Po, corresponding to destabilization of the open burst state by 2.5 ^ 1.0kT with respect to the closed state. However, adding the R555K mutation to T1246N-K1250R channels restored high stability of the open state (Fig. 4e, f). Login to comment
157 For constructs with very low Po (R555K and T1246N), we could not exclude the presence of unseen channels in the patch (even though the records lasted on average 6-7 min). Login to comment
158 The prolonged tib values we extract for R555K and T1246N channels are therefore most probably underestimates, and the real effects of the mutations are more severe (and, hence, jDDG‡ int(opening)j is actually larger) than the values we report. Login to comment

PMID: 15765539 [PubMed] Amaral MD et al: "Processing of CFTR: traversing the cellular maze--how much CFTR needs to go through to avoid cystic fibrosis?"

No. Sentence Comment

50 Although the simultaneous substitution of all four arginines by lysine (K) residues (4RK: R29K þ R516K þ R555K þ R766K) causes F508del-CFTR to function about one-third as efficiently as wt-CFTR, individual R/K substitutions at some of these positions, i.e., R29K30 and R555K,31 were also described as restoring F508del-CFTR function. Login to comment

PMID: 16246032 [PubMed] Vergani P et al: "Control of the CFTR channel's gates."

No. Sentence Comment

62 The WT, the two single mutants (in our case R555K and T1246N) and the double mutant (R555K/T1246N) form the corners of a thermodynamic cycle (Figure 3, inset). Login to comment
68 The R555K mutation did not significantly affect the apparent affinity, while the T1246N mutation reduced it to the same degree whether the residue at position 555 was Arg or Lys. Login to comment
69 The effects of the Thr to Asn mutation in WT and mutant (R555K) background are thus similar, yielding a negligible energetic coupling between the two target residues ( Gint(unbound-bound) = 0.3 ± 0.5kT). Login to comment
79 (A) Representative records from WT, single mutants R555K and T1246N, and double mutant R555K/T1246N, activated with 300 nM cAMP-dependent protein kinase and 5 mM ATP. Login to comment
83 The same mutation, however, when introduced in the non-hydrolytic background that also contained the R555K mutation, did not significantly alter the closed- to-open equilibrium. Login to comment

PMID: 17021796 [PubMed] Aleksandrov AA et al: "CFTR (ABCC7) is a hydrolyzable-ligand-gated channel."

No. Sentence Comment

144 In addition to these theoretical concerns, it is noted that the effect of the NBD1 signature mutation, R555K on the rate of opening is quite different from that reported previously by Teem et al. [74] and as measured in our laboratory. Login to comment

PMID: 17098864 [PubMed] Roxo-Rosa M et al: "Revertant mutants G550E and 4RK rescue cystic fibrosis mutants in the first nucleotide-binding domain of CFTR by different mechanisms."

No. Sentence Comment

0 Revertant mutants G550E and 4RK rescue cystic fibrosis mutants in the first nucleotide-binding domain of CFTR by different mechanisms Mo´ nica Roxo-Rosa*† , Zhe Xu‡ , Andre´ Schmidt*† , Ma´rio Neto*, Zhiwei Cai‡ , Cla´udio M. Soares§ , David N. Sheppard‡ , and Margarida D. Amaral*†¶ *Department of Chemistry and Biochemistry, Faculty of Sciences, University of Lisbon, Campo Grande, 1749-016 Lisbon, Portugal; †Centre of Human Genetics, National Institute of Health Dr. Ricardo Jorge, Avenida Padre Cruz, 1649-016 Lisbon, Portugal; ‡Department of Physiology, School of Medical Sciences, University of Bristol, Bristol BS8 1TD, United Kingdom; and §Institute of Chemistry and Biological Technology, New University of Lisbon, 2781-901 Oeiras, Portugal Communicated by Michael J. Welsh, University of Iowa College of Medicine, Iowa City, IA, September 22, 2006 (received for review June 9, 2006) The revertant mutations G550E and 4RK [the simultaneous mutation of four arginine-framed tripeptides (AFTs): R29K, R516K, R555K, and R766K] rescue the cell surface expression and function of F508del-cystic fibrosis (CF) transmembrane conductance regulator (-CFTR), the most common CF mutation. Login to comment
22 Moreover, Chang et al. (25) rescued the trafficking and function of F508del-CFTR with the simultaneous mutation of the four arginine-framed tripeptides (AFTs) (R29QR31, R516YR518, R553AR555, and R764RR766) present in CFTR termed 4RK (R29K, R516K, R555K, and R766K). Login to comment
37 47 ͉ 17891-17896 and 4RK act by different mechanisms. To explore this possibility, we tested the effects of G550E and 4RK on three additional CF mutations within NBD1: R560T, A561E, and V562I.ʈ We selected for study these CF mutants because (i) these residues constitute a hot spot for disease-causing mutations (seven mutations are associated with these three residues࿣ ); (ii) A561E and R560T are the second and fourth most frequent mutations among Portuguese and Irish CF patients, respectively (28); (iii) like G550E and R555K (one of the 4RK mutants), these mutations affect residues located between the LSGGQ and Walker B motifs of NBD1, which are highly conserved across species; and (iv) they all lie within the same ␣-helix (H5; G550-Y563) within the ATP-binding cassette ␣-subdomain of NBD1 (29, 30). Login to comment
185 Interestingly, different patterns of channel gating have been reported for R555K-CFTR. Login to comment
186 Teem et al. (24) demonstrated that R555K increases the activity of wt-CFTR by extending the duration of bursts without altering the closed time interval between bursts. Login to comment
187 In contrast, Vergani et al. (4) showed that R555K slows the rate of channel opening by markedly prolonging the closed time interval between bursts. Login to comment
190 Of note, the work of Hegedus et al. (40), who studied F508del-CFTR in cis with R29K and R555K (called 2RK), suggests that the stability of F508del-2RK-CFTR is temperature-dependent. Login to comment

PMID: 18463704 [PubMed] Serohijos AW et al: "Diminished self-chaperoning activity of the DeltaF508 mutant of CFTR results in protein misfolding."

No. Sentence Comment

46 However, even in the presence of correcting mutants (G550E, R553Q, and R555K) [10,15-17] in our model of NBD1-DF508, we still observe a significant change in dynamics at the folding transition. Login to comment

PMID: 18597042 [PubMed] Mornon JP et al: "Atomic model of human cystic fibrosis transmembrane conductance regulator: membrane-spanning domains and coupling interfaces."

No. Sentence Comment

97 These mutations are actually located outside the NBD1 structure core, in the regulatory insertion (F409L, F429S, F433L) and extension (R667H), or in the signature sequence region (G550E, R553Q, R555K), whose local conformations in the crystal structure and in our model are perfectly superimposable. Login to comment

PMID: 18957373 [PubMed] Muallem D et al: "Review. ATP hydrolysis-driven gating in cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

99 The WT, the two single mutants (R555K and T1246N) and the double mutant (R555K T1246N) form the corners of a thermodynamic cycle (figure 4a). Login to comment
116 However, the same T to N mutation, when introduced in the R555K K1250R non-hydrolytic background, did not significantly alter the closed- to-open equilibrium. Login to comment
119 The apparent dissociation constant obtained from [ATP] dependence of opening rate is, for CFTR (Vergani et al. 2005), a reasonable estimate for the real dissociation constant for the ATP binding reaction WT CFTR R555K R555K T1246N T1246N 0.4 pA 20 s ∆∆int = ∆3-∆1 = ∆4-∆2 WT ∆1 ∆3 ∆2 ∆4 T1246N R555K R555K T1246N (a) (c) OH T H2N H2NNH2 + COOH NH R H2NCOOH WT CFTR H2NCOOH NH3 + K NH2 H2NCOOH O N R555K T1246N (b) Figure 4. Login to comment
139 The R555K mutation did not significantly affect apparent affinity, while the T1246N mutation reduced it to the same degree whether the residue at position 555 was WT R or mutant K. The effects of the T to N mutation in WT and mutant background are thus similar, yielding a negligible energetic coupling between the two target residues (DDGint(unbound-bound)Z0.3G0.5 kT). Login to comment
97 The WT, the two single mutants (R555K and T1246N) and the double mutant (R555K T1246N) form the corners of a thermodynamic cycle (figure 4a). Login to comment
114 However, the same T to N mutation, when introduced in the R555K K1250R non-hydrolytic background, did not significantly alter the closed- to-open equilibrium. Login to comment
117 The apparent dissociation constant obtained from [ATP] dependence of opening rate is, for CFTR (Vergani et al. 2005), a reasonable estimate for the real dissociation constant for the ATP binding reaction WT CFTR R555K R555K T1246N T1246N 0.4 pA 20 s ∆∆int = ∆3-∆1 = ∆4-∆2 WT ∆1 ∆3 ∆2 ∆4 T1246N R555K R555K T1246N (a) (c) OH T H2N H2NNH2 + COOH NH R H2NCOOH WT CFTR H2NCOOH NH3 + K NH2 H2NCOOH O N R555K T1246N (b) Figure 4. Login to comment
137 The R555K mutation did not significantly affect apparent affinity, while the T1246N mutation reduced it to the same degree whether the residue at position 555 was WT R or mutant K. The effects of the T to N mutation in WT and mutant background are thus similar, yielding a negligible energetic coupling between the two target residues (DDGint(unbound- bound)Z0.3G0.5 kT). Login to comment

PMID: 19176754 [PubMed] Du K et al: "Cooperative assembly and misfolding of CFTR domains in vivo."

No. Sentence Comment

186 Replacement of critical Arg with Lys residues in the MSD1 (R29K) and NBD1 (R516K and R555K) failed to revert the processing defect of M1(RK) and M1-N1(3RK) (Supplemental Figure S5), whereas it partially rescued the ⌬F508 CFTR ER retention (Owsianik et al., 2003; Roxo-Rosa et al., 2006). Login to comment

PMID: 19781595 [PubMed] Bisignano P et al: "Molecular dynamics analysis of the wild type and dF508 mutant structures of the human CFTR-nucleotide binding domain 1."

No. Sentence Comment

20 Structures were obtained by X-ray crystallography, at a resolution of 2.55 Å and 2.30 Å for WT and mutant, respectively. These structures are both characterized by the presence of seven mutations: F409L, F429S, F433L, G550E, R553Q, R555K and H667R which make them more soluble and therefore more easily crystallizable [6,7]. Login to comment
152 The chosen PDB entries,1XMJ and 2BBO, contain seven mutations, F409L, F429S, F433L, G550E, R553Q, R555K and H667R, that were introduced to the NBD1, wild type and dF508 used for this study, to facilitate the crystallization of the polypeptide [6]. Login to comment
154 It is interesting to notice that several of these mutations (F429S, G550E, R555K), have been identified as ''rescue`` mutations [18-20], that improve the expression of the defective dF508 CFTR. Login to comment

PMID: 19927121 [PubMed] Kanelis V et al: "NMR evidence for differential phosphorylation-dependent interactions in WT and DeltaF508 CFTR."

No. Sentence Comment

50 Resonance assignment of G550E/R553M/R555K NBD1-RE The weak intensity of many of the resonances and the limited stability of the WT NBD1-RE NMR samples precluded resonance assignment. Login to comment
51 Therefore, we used a variant of NBD1-RE containing the revertant mutations, G550E (DeCarvalho et al, 2002), R553M (Teem et al, 1993), and R555K (Teem et al, 1996). Login to comment
53 The G550E/R553M/R555K mutant NBD1-RE could be concentrated to B600 mM and was stable for 420 days, allowing NMR data for backbone resonance assignment to be recorded. Login to comment
54 More resonances are present in the spectra of the G550E/R553M/R555K mutant compared with WT NBD1-RE (Supplementary Figure 3), pointing to less severe broadening than in the spectra of WT protein because of differences in motion on the ms-ms timescale. Login to comment
55 Although not as extensive as observed for the WT NBD1-RE, spectra of the G550E/R553M/R555K mutant also show broadening, with some of the weak resonances having elevated R2 rates from ms-ms timescale motion (Supplementary Table 1). Login to comment
56 Relaxation data recorded on 360 and 550 mM samples of the G550E/R553M/R555K mutant were very similar for most residues, indicating that the elevated R2 rates are not caused by sample aggregation at high concentrations (Supplementary Table 1). Login to comment
57 Many resonances are weak, especially in the spectra of the lower concentrated sample of the G550E/ R553M/R555K mutant (i.e., Val562, Asp572, and Ser573), precluding reliable R2 values from being obtained for these residues. Login to comment
58 Importantly, for resonances observed for both the WT and G550E/R553M/R555K mutant forms of the protein, backbone chemical shifts are very similar (Supplementary Figure 3), allowing the straightforward transfer of assignments for most resonances. Login to comment
59 Using triple resonance experiments and specific labelling on Leu, the combination of Gly, Ser, Asp, and Asn residues, or aromatic residues, we have assigned 70% of the 1 HN and 15 N resonances in the G550E/R553M/R555K mutant and 60% of the 1 HN and 15 N resonances in WT NBD1-RE (Supplementary Figure 4a). Login to comment
79 The ribbon is coloured blue for residues for which we have resonance assignments, light grey for those not assigned, and dark grey for those assigned in the G550E/R553M/R555K mutant but not transferable to WT NBD1-RE. Login to comment
86 The secondary structures of the G550E/R553M/R555K mutant, WT, and DF508 NBD1-RE were determined using 1 HN and 15 N chemical shifts, as well as 13 Ca, 13 Cb, and 13 CO chemical shifts where available (Supplementary Figure 5). Login to comment
87 As expected from the similarity of the NMR spectra, secondary structures of the G550E/R553M/R555K mutant, WT, and DF508 NBD1-RE proteins are very similar and largely agree with that of the crystal structures. Login to comment
92 Interestingly, the unassigned residues in the G550E/ R553M/R555K mutant map to distinct regions on NBD1-RE (Supplementary Figure 4b). Login to comment
227 The significant destabilization of all forms of phosphorylated NBD1-RE (WT, DF508, and the G550E/R553M/R555K) precludes NMR resonance assignment required to further test this hypothesis. Login to comment
265 Although the exact positions of the species may change depending on the type of data used, these data reflect the relative positions of the G550E/R553M/R555K mutant, WT, and DF508 NBD1-RE proteins. Login to comment
291 Materials and methods Sample preparation NBD1 from murine CFTR (residues 389-673 or 389-653) with the WT sequence, lacking Phe508 (DF508), or containing the revertant mutations G550E, R553M, and R555K (G550E/R553M/R555K) (Teem et al, 1993, 1996; Roxo-Rosa et al, 2006), was expressed as a 6x-His-Smt (SUMO) (Mossessova and Lima, 2000) fusion at 16 1C in BL21(DE3) Codon Plus cells grown in minimal media with 15 N- NH4Cl, 13 C-glucose, and/or 70% 2 H2O as required for NMR studies, and purified using standard chromatographic techniques, as previously described (Lewis et al, 2004, 2005). Login to comment
294 The G550E/R553M/R555K NBD1-RE mutant was used only for backbone resonance assignment (see Results). Login to comment
295 Purified WT, DF508, and G550E/R553M/R555K mutant proteins were exchanged into NMR buffer containing 20 mM Na phos, pH 7.0, 150 mM NaCl, 5 mM MgCl2, ATP or AMP-PNP, with 2 or 4% (v/v) glycerol. Login to comment
319 Backbone H, N, C, and Ca, and side chain Cb assignments for G550E/R553M/R555K NBD1-RE were obtained from standard triple resonance TROSY-based experiments (Sattler et al, 1999; Kanelis et al, 2001) and a 15 N-edited NOESY-HSQC spectrum (200 ms) recorded on samples of 0.5-0.6 mM G550E/R553M/R555K NBD1-RE that were uniformly 15 N and 13 C labelled and fractionally 2 H labelled to B50%. Login to comment
326 NMR assignments NMR resonance assignments for G550E/R553M/R555K NBD1-RE, WT NBD1-RE, and DF508 NBD1-RE have been deposited in the BioMag Res Bank under the accession codes 16367, 16393, and 16394, respectively. Login to comment

PMID: 19944699 [PubMed] Lewis HA et al: "Structure and dynamics of NBD1 from CFTR characterized using crystallography and hydrogen/deuterium exchange mass spectrometry."

No. Sentence Comment

32 Comparing these hNBD1 structures to each other and to wild-type murine NBD1 (mNBD1) suggested that the overall fold of NBD1 was retained in the ΔF508 mutant and that structural changes were localized near the site of the deleted phenylalanine residue.5 However, three of these solubility-enhancing mutations (G550E/ R553Q/R555K) were known to be in vivo suppressors of the trafficking defect caused by the ΔF508 mutation.51-53 Compared to mNBD1, no significant structural perturbations were observed in the vicinity of these suppressor mutation sites in the crystal structures of hNBD1, suggesting that they act indirectly to suppress the effects of the ΔF508 mutation.5 Indeed, folding studies of a wider variety of hNBD1 variants, including several without trafficking-suppressor mutations, indicated that these mutations increase the thermodynamic stability of NBD1,5 which could account for improved folding and maturation in vivo. Login to comment
41 This structure was obtained from the same hNBD1-7a protein construct that yielded the previously reported ΔF508 structure, which has seven solubilizing mutations including the three trafficking-suppressor mutations G550E/R553Q/R555K. Login to comment
133 The structures harboring the G550E/R553Q/ R555K suppressor mutation set are shown in bright green (F508) and bright red (ΔF508). Login to comment
139 This region contains F508, the LSGGQ signature sequence (at residues 548-552), and the G550E/ R553Q/R555K suppressor mutation sites. Login to comment
300 The G550E/R553Q/ R555K mutation set has been demonstrated to suppress the defective trafficking of ΔF508-CFTR (Fig. 11).51-53 Based on detailed structural, dynamic, and thermodynamic considerations presented in section ST12 in the Supplementary Information, we conclude that these suppressor mutations are unlikely to directly reverse a cryptic structural Fig. 9. Login to comment
352 The trafficking-suppressor mutations (G550E/R553Q/R555K) overlap the LSGGQ signature sequence located at residues 548-552 in hNBD1. Login to comment

PMID: 20032308 [PubMed] Roy G et al: "Interplay between ER exit code and domain conformation in CFTR misprocessing and rescue."

No. Sentence Comment

6 R555K, a mutation that rescues ⌬F508 misprocessing, improves Sec24 association and enhances its post-ER stability. Login to comment
7 Using in situ limited proteolysis, we demonstrated a clear change in trypsin sensitivity in ⌬F508 NBD1, which is reversed, together with that of other domains, by low temperature, R555K or both. Login to comment
9 Low temperature and R555K are additive in improving ⌬F508 conformational maturation and processing. Login to comment
50 The pcDNA3.1(ϩ)-CFTR-⌬F508/R555K and pcDNA3.1(ϩ)- CFTR-⌬F508/DAA were constructed by introducing R555K and DAA, respectively, into pcDNA3.1(ϩ)-CFTR-⌬F508. Login to comment
51 The pcDNA3.1(ϩ)-CFTR-⌬F508/ R555K/DAA was constructed by introducing DAA into pcDNA3.1(ϩ)-CFTR- ⌬F508/R555K. Login to comment
53 Finally, the pcDNA3.1(ϩ)- CFTR-⌬F508/R29K/R555K was constructed by replacing the BspeI-HpaI fragment of pcDNA3.1(ϩ)-CFTR-⌬F508/R29K with the corresponding fragment from pcDNA3.1(ϩ)-CFTR-⌬F508/R555K. Login to comment
65 HEK293 cells stably expressing DAA, ⌬F508/DAA and ⌬F508/R555K CFTR were generated by transfecting HEK293 cells with specific CFTR expression plasmids and selecting in the presence of 400 ␮g/ml G418 (A. Login to comment
68 BHK cells stably expressing ⌬F508/R555K CFTR (BHK-⌬F/R555K) were generated by transfecting BHK cells with the CFTR expression plasmid and selecting with 400 ␮g/ml G418. Login to comment
207 R555K Rescues ⌬F508 CFTR by Improving Both Export and Post-ER Stability R555K, alone (Teem et al., 1996) or in combination with R29K (Hegedus et al., 2006) rescues ⌬F508 CFTR. Login to comment
208 We found that R29K does not improve ⌬F508 processing, nor does it contribute to ⌬F508 rescue when combined with R555K (2RK) in HEK293 cells and this is true at both 37 and 30°C (Figure 7A). Login to comment
209 In BHK cells, R29K alone inhibits ⌬F508 processing but only slightly enhances ⌬F508 processing when combined with R555K at 37°C (Supplemental Figure 2). Login to comment
210 Of note, in HEK293 cells, the combination of low temperature and R555K additively increases the processing of ⌬F508 based on the percent of total band C (Figure 7A), whereas the enhancement in processing by the combination of the two is much less in BHK cells (Supplemental Figure 2). Login to comment
211 Consistent with the role of the "DAD" motif as the ER exit code in the context of ⌬F508 CFTR, the enhanced processing of ⌬F508 CFTR by introducing R555K at both 37 and 30°C is abolished by further introduction of DAA mutation (Figure 7B). Login to comment
212 To probe the mechanism of R555K rescue of ⌬F508 CFTR, we first observed the kinetic accumulation of ⌬F508/R555K in bands B and C and compared it with that of ⌬F508. Login to comment
213 Although the rates of accumulation in band B are largely similar between the two forms of CFTR, R555K significantly increases the accumulation of ⌬F508 CFTR in band C (Figure 7C), suggesting increased export and/or post-ER stability. Login to comment
214 CHX chase indicated a moderate increase in the post-ER stability by R555K (Figure 7D), and CFTR quantitative co-immunoprecipitation revealed an increase in association with Sec24 (Figure 7E). Login to comment
215 These results suggest that R555K rescues ⌬F508 CFTR through enhancing both export and post-ER stability. Login to comment
216 Rescue of ⌬F508 CFTR by Low Temperature or R555K Is Accompanied by the Enhancement in Global Conformational Maturation We probed domain conformation of ⌬F508 CFTR after rescue with low temperature, R555K, or both using in situ limited proteolysis. Login to comment
220 The introduction of R555K has a similar effect (Figure 8Ac), suggesting that R555K substitution alters the folding of ⌬F508 CFTR in a way that achieves a comparable level of conformational maturation as the low-temperature rescue. Login to comment
221 Although "⌬F508, 30°C", "⌬F508/R555K," and "DAA" have comparable distribution between bands B and C, at the steady state, the relative intensity of the 37-kDa band is higher and the 42-kDa fragments are more resistant to tryp- Figure 5. Login to comment
233 Notably, when low temperature is combined with R555K in HEK293 cells, we have observed a dramatic increase in the trypsin resistance of the 42-kDa fragments and an increased relative intensity of the 37-kDa band, which together lead to a tryptic pattern similar to wild-type CFTR (Figure 8A, d and e). Login to comment
238 In contrast, R555K substitution results in a more uniform tryptic pattern (Figure 8Ah). Login to comment
239 Although the 30-kDa fragment typical of wild-type conformation is now clearly present (black arrowhead), the 34-kDa common band that is present in ⌬F508, DAA and wild-type CFTR is greatly diminished (Figure 8A, f-h, gray arrowheads), suggesting that R555K produces an additional conformational change in NBD2. Login to comment
240 The combination of low temperature and R555K did not produce additional conformational correction in NBD2 over what has been achieved by R555K alone (Figure 8A, h and i). Login to comment
241 Taken together, we show that rescue of ⌬F508 by low temperature or R555K is associated with improved conformational maturation in multiple domains. Login to comment
266 To test the relationship between ⌬F508 rescue and its domain conformation, we conducted in situ limited proteolysis on microsomes prepared from BHK-WT cells, BHK-⌬F cells incubated at 37 or 30°C, and BHK-⌬F/R555K cells. Login to comment
271 In contrast, BHK cells stably expressing ⌬F508/R555K showed a clear appearance of the 37-kDa bands at high trypsin concentrations (Figure 9Bd, black arrowhead). Login to comment
274 In contrast, R555K was able to restore the 50-kDa pattern to wild-type level. Login to comment
277 Parallel to the behavior of the amino terminal module, reducing temperature did not lead to the appearance of the 30-kDa fragment (Figure 9Bg) but R555K did (Figure 9Bh). Login to comment
284 R555K improves export and post-ER stability of ⌬F508 CFTR. Login to comment
285 (A) HEK293 cells were transiently transfected with ⌬F, ⌬F/ R29K, ⌬F/R555K and ⌬F/R29K/R555K (⌬F/ 2RK) and cultured at 37°C for 20 h (37°C), or further switched to 30°C and incubated for an additional 16 h (30°). Login to comment
290 (B) HEK293 cells were transiently transfected with ⌬F, ⌬F/R555K and ⌬F/ R555K/DAA CFTR. Login to comment
295 (C) HEK293 cells were transiently transfected with ⌬F or ⌬F/ R555K CFTR and incubated at 37°C for the indicated time. Login to comment
300 (D) CHX chase on HEK293 cells stably expressing ⌬F and ⌬F/R555K was performed and quantified as described in Figure 2. Login to comment
301 (E) HEK293 cells were transiently transfected with ⌬F or ⌬F/R555K. Login to comment
318 3) The pattern of ⌬F508 CFTR reverts to wild-type-like upon rescue by low temperature or R555K or both in HEK293 cells (Figure 8). Login to comment
326 Low temperature and R555K promote the conformational maturation of ⌬F508 CFTR in HEK293 cells. Login to comment
328 For ⌬F, 30°C and ⌬F/R555K, 30°C, cells were incubated at 30°C for 16 h before the preparation of microsomes. Login to comment
333 ⌬F508 CFTR has reduced coupling to Sec24, which is reversed by low temperature (Wang et al., 2004, 2008) or R555K (Figure 7E). Login to comment
337 We found that R29K does not contribute to ⌬F508 rescue in HEK 293 cells (Figure 7A) but slightly improves ⌬F508 rescue only in combination with R555K in BHK cells (Supplemental Figure 2). Login to comment
338 R555K rescues ⌬F508 CFTR by improving its coupling to COPII and moderately increasing its post-ER stability (Figure 7, D and E). Login to comment
343 Instead, like other second site mutations in NBD1, R555K and R553M substitutions might alter the conformation of CFTR in a way that repairs ⌬F508 conformation defects. Login to comment
344 The ER exit code "DAD", F508, and many ⌬F508 rescuing mutations (including R555K and R553M) reside in NBD1. Login to comment
346 This is partly attributable to the inclusion of multiple "solubilization mutations" into ⌬F508 NBD1 to facilitate its purification (Lewis et al., 2005), several of which, including R555K, rescue the ⌬F508 export and channel gating defects (Pissarra et al., 2008). Login to comment
361 Although ⌬F508 mutation initiates a global conformational change from NBD1, R555K, originating in same domain, reverses the global conformational defect. Login to comment
363 Reducing the temperature produces a similar effect on ⌬F508 CFTR conformation as R555K in HEK293 cells (Figure 8). Login to comment
377 Rescue maneuvers such as low temperature and R555K restore both its ER export (Figure 7E; Wang et al., 2004) and post-ER stability (Figure 7D; Sharma et al., 2001; Varga et al., 2008), and these processes are highly dependent upon the ER exit code "DAD" (Figures 6 and 7B). Login to comment
381 R555K improves the ER export (Figure 7E), post-ER stability (Figure 7D), and channel gating (Teem et al., 1996) of ⌬F508 CFTR. Login to comment
386 Combining R555K with low-temperature additively improves the conformational maturation of ⌬F508 CFTR (Figure 8) and its processing (Figure 7A) in HEK293 cells. Login to comment

PMID: 20150177 [PubMed] Atwell S et al: "Structures of a minimal human CFTR first nucleotide-binding domain as a monomer, head-to-tail homodimer, and pathogenic mutant."

No. Sentence Comment

226 The 389-678(F409L, F429S, F433L, G550E, R553Q, R555K, H667R) (hNBD1-7a) structures are shown without (dark blue) and with the DF508 mutation (light blue) (H. Lewis, in preparation). Login to comment

PMID: 20233947 [PubMed] He L et al: "Restoration of domain folding and interdomain assembly by second-site suppressors of the DeltaF508 mutation in CFTR."

No. Sentence Comment

27 These suppressor mutations (I539T, G550E, R553M/Q, and R555K) promote ⌬F508-CFTR maturation and trafficking to the cell surface, and also restore channel activity (16). Login to comment
28 The R555K mutation alone increases the channel activity of both WTand ⌬F508-CFTR by extending the open-channel burst duration (15). Login to comment
72 RESULTS Suppressor mutations restore folding mutations in NBD1 but not elsewhere Four suppressor mutations (I539T, G550E, R553M, and R555K) were originally found to rescue ⌬F508-CFTR maturation in a yeast mating screen using STE6/CFTR chimeras (14-16). Login to comment
79 B, C) HEK293 cells were transiently transfected with CFTR variants with maturation-compromising mutations introduced in different domains, in the presence or absence of single or combined suppressor mutations (4S: I539T/G550E/R4553M/R555K; 3S: G550E/R553M/R555K). Login to comment
84 Among these four suppressor mutations, R555K had the largest effect in promoting ⌬F508-CFTR maturation, while R553M had the least effect. Login to comment
85 The addition of G550E and R553M to R555K (3S) further increased its maturation, but no additional effect was detected by the addition of the fourth mutation I539T (4S) (Fig. 1A). Login to comment
112 Stable BHK cells overexpressing WT-CFTR and ⌬F508-CFTR with and without 4 suppressor mutations (I539T/G550E/R553M/R555K, ⌬F/ 4S) were pulse labeled with 100 ␮Ci/ml [35 S] methionine for 20 min, followed by 0, 1, 2, and 4 h chase. Login to comment
124 To test whether these NBD/CL interfaces not formed in ⌬F508-CFTR could be restored by the suppressor mutations, the 4 combined suppressor mutations, I539T/G550E/R553M/R555K (4S) were introduced into the ⌬F508-CFTR constructs with the Cys pairs at the potential interfaces. Login to comment
139 HEK293 cells were transiently transfected with Cys-less ⌬F508-CFTR in the presence or absence of suppressor mutations I539T/G550E/R553M/R555K, with Cys pairs introduced at CL2/NBD2 (A) or CL4/NBD1 (B) interfaces. Login to comment
146 However, when suppressor mutations (3S: G550E/R553M/R555K) were introduced into the N-half ⌬F508-CFTR, they did not promote complex glycosylation of the C half (Fig. 5A, lane 4), as they did in full-length CFTR (Fig. 1). Login to comment
154 HEK293 cells were transiently transfected with 1172X-CFTR or ⌬F508-1172X-CFTR in the presence or absence of single or combined suppressor mutations (4S: I539T/G550E/R4553M/R555K; 3S: G550E/R553M/R555K). Login to comment
162 N halves were either WT or carried the ⌬F508 mutation, in the absence or presence of suppressor mutations (3S: G550E/R553M/R555K). Login to comment

PMID: 20590134 [PubMed] Loo TW et al: "The V510D suppressor mutation stabilizes DeltaF508-CFTR at the cell surface."

No. Sentence Comment

64 It was recently reported that rescue of ΔF508-CFTR byother suppressor mutations inNBD1(I539T,G550E,R553M, R555K) was drastically reduced in wild-type CFTR lacking NBD2 (ΔNBD2) (20). Login to comment
129 A similar effect was observed when the combination of four NBD1 suppressormutations(I539T,G550E,R553M,R555K) was introduced into ΔF508-CFTR (20). Login to comment

PMID: 20667826 [PubMed] Thibodeau PH et al: "The cystic fibrosis-causing mutation deltaF508 affects multiple steps in cystic fibrosis transmembrane conductance regulator biogenesis."

No. Sentence Comment

34 Printed in the U.S.A. NOVEMBER 12, 2010•VOLUME 285•NUMBER 46 JOURNAL OF BIOLOGICAL CHEMISTRY 35825 G550E, R553Q, and R555K (19-21). Login to comment
104 The introduction of the single mutations, G550E, R553M or R553Q, and R555K, has previously been shown to partially rescue the ⌬F508 trafficking defect in CFTR and restore channel activity at the plasma membrane (Fig. 1A) (19-21). Login to comment
131 Disruption of the RXR by substitution of Arg-555 with lysine showed no discernible effects on wild type CFTR maturation. Login to comment
142 The introduction of the -3M mutations (G550E, R553M, R555K) rescues the trafficking defects associated with the ⌬F508 mutation and restores near wild type function. Login to comment
178 The substitution of R555A, R555G, and R555T resulted in a marked reduction in the formation of band C CFTR, whereas the R555K, as measured by Western blotting of transiently transfected HEK-293 cells displays near wild type CFTR maturation. Login to comment

PMID: 20687133 [PubMed] Protasevich I et al: "Thermal unfolding studies show the disease causing F508del mutation in CFTR thermodynamically destabilizes nucleotide-binding domain 1."

No. Sentence Comment

44 hNBD1 Nameb Termini / Mutationsc Tm d DTm ¼ Tm D508 - Tm wt ( C) PDB ID 1 hNBD1-D(RI,RE) 2935c46917 387-646[D405-436] 57.7 þ 0.2 2PZE 1 (F508del)hNBD1D (RI,RE) 2935c47217 387-646[D405-436, F508del] 51.5 þ 0.3 À6.2 þ 0.3 2PZF 2 387-646[D405-436, V510D] 60.2 þ 0.4 2 387-646[D405-436, V510D, F508del] 53.0 þ 0.1 À7.2 þ 0.4 3 387-646[D405-436, F494N, Q637R] 59.2 3 387-646[D405-436, F494N, Q637R, F508del] 52.8 À6.4 4 387-646[D405-436, G550E, R553Q, R555K] 61.7 4 387-646[D405-436, G550E, R553Q, R555K,F508del] 55.7 À6.0 5 387-678[D405-436] 58.1 5 387-678[D405-436, F508del] 51.7 À6.2 6 hNBDI-315 2935c38217 389-678[F429S, F494N, Q637R] 49.8 þ 0.3 6 hNBDI-3F508del15 2935c37117 389-678[F429S, F494N, Q637R, F508del] 43.6 þ 0.1 À6.3 þ 0.3 2BBS 7 389-678[F429S, F494N, L636E5, Q637R] 50.5 þ 0.2 7 389-678[F429S, F494N, L636E, Q637R, F508del] 44.9 À6.2 þ 0.2 a DSC conducted at 1 mg/mL protein. Login to comment

PMID: 20687163 [PubMed] Wang C et al: "Integrated biophysical studies implicate partial unfolding of NBD1 of CFTR in the molecular pathogenesis of F508del cystic fibrosis."

No. Sentence Comment

26 Moreover, three second-site mutations, selected by Teem and coworkers to reverse the in vivo trafficking defect caused by F508del,37 appeared to stabilize hNBD1 against chemical unfolding.15 Because this ''Teem suppressor triplet`` (G550E, R553Q, and R555K) does not significantly alter the structure of F508del-hNBD1,18 its effect increasing the thermodynamic stability of hNBD1 seems likely to be responsible for reversing the deleterious effects of the F508del mutation. Login to comment
155 Second-Site Solubilizing/Suppressor Mutations Delay the Initial Unfolding Transition Figure 4 shows the isothermal denaturation behavior of F508del-hNBD1-D(RI,RE) constructs harboring additional point mutations known to suppress the trafficking defect caused by the F508del mutation.32,37,39,40 The G550E, R553Q, and R555K mutations in the Teem suppressor triplet were isolated in vivo using a selection for mutations restoring the export of a yeast CFTR homolog bearing the equivalent of the F508del mutation. Login to comment
179 This research program led to the identification of several point mutations that improve the solubility and yield of purified hNBD1, including the Teem suppressor triplet (G550E, R553Q, and R555K) isolated as suppressors of the in vivo trafficking defect of F508del-CFTR.37 However, surprisingly, the other efficacious solubilizing mutations chosen exclusively on the basis of polarity and consistency with the CFTR sequence profile also generally suppress the defective in vivo trafficking of F508del-CFTR.32,39 This correlation is readily explained if the initial unfolding transition in hNBD1 (left side of Fig. 5) controls both aggregation of the purified domain in vitro and aberrant ER retention and degradation of intact CFTR in vivo. Login to comment

PMID: 20837481 [PubMed] Pagant S et al: "Intragenic suppressing mutations correct the folding and intracellular traffic of misfolded mutants of Yor1p, a eukaryotic drug transporter."

No. Sentence Comment

249 Remarkably, all suppressing mutations identified (I539T, G550E, R553M, and R555K) by this study are located within the NBD1 domain itself. Login to comment

PMID: 21576373 [PubMed] Szollosi A et al: "Mutant cycles at CFTR's non-canonical ATP-binding site support little interface separation during gating."

No. Sentence Comment

239 Site-1 mutations affect channel closing, likely by affecting the relative stability of open states In contrast to composite site-2 mutations R555K and T1246N (Vergani et al., 2005, but compare Teem et al., 1996), in positions equivalent to T460 and L1353, all site-1 mutations studied here had relatively small effects on channel gating, consistent with the notion that the gating cycle is driven by the catalytic cycle at composite site 2. Login to comment

PMID: 21594797 [PubMed] Schmidt A et al: "Biochemical and biophysical approaches to probe CFTR structure."

No. Sentence Comment

30 Subsequently, in a screen for suppressor mutations of the F508del defect, the original R553Q suppressor mutation was identified as were I539T, G550E, R553Q, and R555K (18, 19). Login to comment

PMID: 21594798 [PubMed] Kanelis V et al: "NMR spectroscopy to study the dynamics and interactions of CFTR."

No. Sentence Comment

78 (b) HSQC spectrum of the G550E/R553M/R555K mutant NBD1-RE (398-673). Login to comment
102 The interacting peptide is in red and the NBD1-RE structure is colored blue for residues for which we have resonance assignments, light grey for those not assigned, and dark grey for those assigned in the G550E/R553M/R555K mutant but not transferable to WT NBD1-RE (19). Login to comment
134 The solubility of mNBD1 is greatly improved by the inclusion of the RE (14), which transiently populates helical structures that interact with NBD1 (19, 20), and incorporation of the revertant mutations, G550E, R553M, and R555K (43-45), yielding an NBD1-RE construct that is sufficiently soluble for NMR assignment experiments. Login to comment
140 Higher concentrations of glycerol and lower temperatures further stabilize the protein, but increase the viscosity of the solution, leading to Table 25.1 List of preferred CFTR constructs for NMR studies Construct Boundaries "Solubilizing" mutations mNBD1-RE 389-673 G550E, R553M, R555K hNBD1a 387-404, 437-646 None hNBD1-REa 387-404, 437-678 None hNBD1-RE 389-678 F494N hNBD1-RE 389-678 F429S, F494N, Q637R aThe RI (residues 405-436) have been deleted in these constructs. Login to comment
187 HSQC spectra recorded on samples specifically 15N labeled on Leu residues, aromatic residues (Phe, Tyr, and Trp), or the combination of Gly, Ser, Asp, and Asn residues were used to assist in identification of residue type in order to achieve 70% assignment of the G550E, R553M, R555K mutant NBD1-RE, which were then transferred to the WT protein (19), as the level of uniformity of lineshapes was greater for the G550E, R553M, R555K mutant than either WT or F508del (compare Fig. 25.2b, c). Login to comment

PMID: 21602569 [PubMed] Yu W et al: "Probing conformational rescue induced by a chemical corrector of F508del-cystic fibrosis transmembrane conductance regulator (CFTR) mutant."

No. Sentence Comment

259 In the context of the full-length F508del-CFTR protein, the substitution of R553 M, or the substitution of arginine to lysine at position 555, led to partial rescue of the primary processing defect, and hence, these were originally described as "suppressor" mutations (24, 25). Login to comment
264 In addition, Thibodeau et al. (28) showed that in the context of the full-length protein, F508del-NBD1 exhibited enhanced protease sensitivity (in limited proteolysis studies) relative to WT-CFTR-NBD1 and further that the solubilizing mutations (G550E, R553M, and R555K) conferred protease resistance to F508del-NBD1. Login to comment

PMID: 21182301 [PubMed] Loo TW et al: "The W232R suppressor mutation promotes maturation of a truncation mutant lacking both nucleotide-binding domains and restores interdomain assembly and activity of P-glycoprotein processing mutants."

No. Sentence Comment

121 Suppressor mutations can rescueΔF508-CFTRbya variety ofmechanisms.Examplesinclude removal of the ER retention signals (arginine-framed trafficking motif mutations; R29K, R516K, R555K, and R766K) (61, 62), introduction of a combination of CFTR suppressor mutations (F949/Q637R or F29S/F494N/Q637R) that increase solubility of NBD1(63),orintroductionofsuppressormutationssuchasV510D (TMD1) (64) and R1070W(TMD2) (65) that restore NBD1-TMD2 interactions. Login to comment
122 In a recent study of four of the CFTR suppressor mutations located in NBD1 (I539T, G550E, R553M, and R555K), it was found that they only restored maturation of mutants that had processing mutations in NBD1 but not those that had processing mutations in other domains such as NBD2 (N1303K) or TMD2 (L1065P or R1066C) (66). Login to comment
329 It appears that the ΔF508 mutation inhibits folding of NBD1 and its ability to stably associate with other domains resulting in altered CFTR-chaperone interactions, ER retention,andenhanceddegradation(65).Second-sitesuppressor mutations in NBD1 (such as I539T/G550E/R553M/R555K) can restore interdomain assembly (65, 66) to yield a more stable ΔF508-CFTR molecule (64, 66). Login to comment

PMID: 22722932 [PubMed] Hudson RP et al: "Conformational changes relevant to channel activity and folding within the first nucleotide binding domain of the cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

315 A similar argument can be made for an underlying allosteric mechanism of suppression by the "3M" (G550E/R553M/R555K) mutations (17) which can improve CFTR processing in the absence of F508; even though they do not directly address the structural changes at the Phe-508 site, these mutations apparently change the equilibrium distribution of conformations accessed by NBD1 to be more similar to that of wild-type. Login to comment
313 A similar argument can be made for an underlying allosteric mechanism of suppression by the "3M" (G550E/R553M/R555K) mutations (17) which can improve CFTR processing in the absence of F508; even though they do not directly address the structural changes at the Phe-508 site, these mutations apparently change the equilibrium distribution of conformations accessed by NBD1 to be more similar to that of wild-type. Login to comment

PMID: 22680785 [PubMed] Liu X et al: "Thermal instability of DeltaF508 cystic fibrosis transmembrane conductance regulator (CFTR) channel function: protection by single suppressor mutations and inhibiting channel activity."

No. Sentence Comment

5 Thermal inactivation of ΔF508 was mitigated by each of five suppressor mutations, I539T, R553M, G550E, R555K, and R1070W, but each exerted unique effects on the severity of, and recovery from, thermal inactivation. Login to comment
13 Consistent with this hypothesis, low-temperature rescued ΔF508 CFTR channels exposed to 37 °C exhibit a markedly reduced metabolic half-life (t1/2 < 4 h versus t1/2 > 24 h for wt CFTR14-17,21 ) and rapid thermal inactivation of chloride channel function.5,22 ΔF508 CFTR folding defects can also be suppressed to varying degrees by a variety of second-site mutations in NBD1.4,8,18,23-30 I539T, occurring naturally in many CFTR orthologs, improved the maturation of ΔF508 CFTR at 37 °C,4,25,30 but actually reduced open probability (Po) determined in detached patches.9 Another, R555K, modestly improved protein processing but also increased Po of ΔF508 CFTR channels in detached patches. Login to comment
18 We identified unique functional signatures for five second-site mutations, four in NBD1 (I539T, G550E, R553M, and R555K) and one in the fourth intracellular loop (ICL4, R1070W), and also investigated the relation of thermal stability to variations in channel gating brought about by intracellular cAMP, CFTR potentiators, and CFTR inhibitors. Login to comment
125 In contrast, pairing ΔF508 with R555K, a mutation that has been reported to be somewhat more effective than R553M at improving NBD1 folding and protein maturation,4,6,24 resulted in a channel that, although unable to sustain the initial increase in conductance evoked at 37 °C, was inactivated only slightly and returned to its prewarming level relatively rapidly when superfusate temperature was returned to 22 °C. Login to comment
137 (B) R555K/ΔF508 CFTR (n = 5). Login to comment
146 There was no apparent correlation of the functional phenotype of the double mutant channels at 37 °C with the improvements reported for NBD1 folding and protein maturation,4,6 but the partial protection from thermal inactivation by R555K and G550E suggested that the effects might be correlated with the induction of increased Po.8,24 R553M, however, had been reported by Teem et al.24 not to increase Po of ΔF508 channels (34-36 °C), so we investigated the behavior of the double mutant in inside-out patches. Login to comment
154 Pairing R1070W and a second NBD1 suppressor, R555K, with ΔF508, however, resulted in thermal stability that was indistinguishable from that of wt CFTR (Figure 7B). Login to comment
170 (B) Following stimulation, an oocyte expressing R555K/R1070W/ΔF508 CFTR (n = 4) was warmed to 37 °C for 10 min twice. After cooling to 22 °C, the oocyte was exposed to 10 μM CF172. Login to comment
247 Similarly, G550E, R555K, and R1070W; when combined individually with ΔF508, improved protein maturation at 37 °C to at most 18% of wt,4,6 but nevertheless significantly improved the thermal stability of the double mutant channels. Login to comment
251 The three NBD1, second-site mutations that fully or partially protected ΔF508 CFTR channels from thermal inactivation at 37 °C, R553M, R555K, and G550E, share a common effect on ΔF508 CFTR channel function. Login to comment
254 Mendoza et al.6 reported that these three NBD1 suppressor mutations increased the yield of folded ΔF508 NBD1 in a cell-based assay from 0% (R553M) to 60% (R555K), although even a 60% increase represented less than 20% of the yield of wt protein under the same conditions. Login to comment
256 A fourth NBD1 suppressor mutation, I539T, in contrast to G550E, R553M, and R555K, is predicted to lie within an unstructured linker connecting two α-helical portions of NBD1. Login to comment
259 Recovery from partial inactivation was also seen with R555K and G550E, but unlike I539T, both of these second-site mutations also resulted in persistent, steady-state conductance at 37 °C. Login to comment
266 Like G550E, R553M, and R555K, this second-site mutation has been associated with increased open probability of the double mutant,7 an effect attributed to a partial improvement in the interaction between NBD1 and ICL4.29,57 Combining the ICL4 mutation with an NBD1 suppressor mutation on the ΔF508 background (R555K/R1070W/ΔF508), however, fully restored wt-like thermal stability at 37 °C, an "additive" effect similar to that reported by Mendoza et al 6 in their study of the effect of these mutations on NBD1 folding and ΔF508 CFTR protein yield. Login to comment

PMID: 22406676 [PubMed] Aleksandrov AA et al: "Allosteric modulation balances thermodynamic stability and restores function of DeltaF508 CFTR."

No. Sentence Comment

237 A striking feature of the strong stabilizing effect of the proline substitutions was the essentially absolute dependence on the I539T substitution. This dependence contrasts the positive effects on ΔF508 CFTR maturation of other second site changes that are not wholly dependent on I539 T, such as those near the NBD1 signature sequence (G550E/R553M/R555K) and the RI. Login to comment

PMID: 22265408 [PubMed] Rabeh WM et al: "Correction of both NBD1 energetics and domain interface is required to restore DeltaF508 CFTR folding and function."

No. Sentence Comment

26 Both the R mutations (G550E, R553Q, and R555K) and S mutations (F409L, F429S, F433L, F494N, and H667R) could partially rescue the DF508 CFTR folding and functional defect (Lewis et al., 2005; Pissarra et al., 2008; Teem et al., 1993, 1996) and were assumed to stabilize the domain either alone or in combinations (1S, 3S, R, R1S, and R4S; see Figure 1B). Login to comment

PMID: 22210114 [PubMed] Dong Q et al: "Human-mouse cystic fibrosis transmembrane conductance regulator (CFTR) chimeras identify regions that partially rescue CFTR-DeltaF508 processing and alter its gating defect."

No. Sentence Comment

120 (i) A genetic approach identified second-site suppressor mutations, including I539T, G550E, R553M/Q, and R555K (18-21, 25, 26). Login to comment
167 Other examples are the G550E and R555K mutations, which also partially rescued CFTR-ΔF508 processing and increased the Po by lengthening the burst duration. Login to comment

PMID: 21965669 [PubMed] Wang W et al: "Thermally unstable gating of the most common cystic fibrosis mutant channel (DeltaF508): "rescue" by suppressor mutations in nucleotide binding domain 1 and by constitutive mutations in the cytosolic loops."

No. Sentence Comment

46 For example, Hegedus et al. have shown that eliminating two arginine-based motifs (RXR) from ⌬F508-CFTR (e.g. R29K and R555K) promotes maturation of ⌬F508, but channel activity in lipid bilayers is highly thermally unstable (i.e. inactivates at physiologic temperature) (42). Login to comment
65 The ⌬F508-CFTR construct with NBD1 suppressor mutations (G550E, R553M, R555K (3M/⌬F508)) was provided by Dr. Phillip Thomas (University of Texas Southwestern Medical Center, Dallas). Login to comment
137 Suppressor Mutations in NBD1 Correct Misfolding and Stabilize ⌬F508-CFTR Channel Activity at 36.5 °C-We have shown recently that three suppressor mutations (G550E, R553M, R555K (3M/⌬F508)) in NBD1 correct ⌬F508-CFTR maturation and misfolding and markedly increase its channel activity in excised patches at room temperature (43). Login to comment
180 Cells expressing G550E/R553M/R555K/⌬F508 (3M/⌬F508) were grown at 37 °C. Login to comment

PMID: 19766125 [PubMed] Moran O et al: "Model of the cAMP activation of chloride transport by CFTR channel and the mechanism of potentiators."

No. Sentence Comment

57 Disruption of the binding site on NBD1 and NBD2 by mutations R555K and T1246N, respectively, yield an approximation of the independent equilibrium constants, KATP1 ¼ 71 mM and KATP2 ¼ 261 mM (Vergani et al., 2005). Login to comment
59 Disruption of the binding site on NBD1 and NBD2 by mutations R555K and T1246N, respectively, yield an approximation of the independent equilibrium constants, KATP1 &#bc; 71 mM and KATP2 &#bc; 261 mM (Vergani et al., 2005). Login to comment

PMID: 19477416 [PubMed] Kim Chiaw P et al: "Functional rescue of DeltaF508-CFTR by peptides designed to mimic sorting motifs."

No. Sentence Comment

18 Previously, Teem and Welsh determined that second site revertant mutations in an endogenous RXR motif, proximal to the ABC signature sequence in NBD1 (including R553M and R555K in the motif: R553 AR555 ), partially restored trafficking of deltaF508-CFTR, suggesting that the motif in this region has particular functional significance (Teem et al., 1993, 1996). Login to comment
51 The current studies focus on the RXR motif residing in NBD1, proximal to the ABC signature motif and starting at the arginine at position 553, as it has been implicated in ER retrieval of deltaF508-CFTR with mutations R553M/Q or R555K leading to the enhanced surface expression of the major mutant (Teem et al., 1993, 1996). Login to comment

PMID: 18555011 [PubMed] Liu Y et al: "Mild processing defect of porcine DeltaF508-CFTR suggests that DeltaF508 pigs may not develop cystic fibrosis disease."

No. Sentence Comment

149 The identified revertant mutations I539T, G550E, and R555K each partially res- Fig. 4. Login to comment
148 The identified revertant mutations I539T, G550E, and R555K each partially res- Fig. 4. Login to comment

PMID: 18417076 [PubMed] Cheung JC et al: "Molecular basis for the ATPase activity of CFTR."

No. Sentence Comment

107 The construct generated had several mutations to increase solubility of the domain (F409L, F429S, F433L, G550E, R553Q, R555K, H667R) in addition to the deletion of F508. Login to comment

PMID: 18215773 [PubMed] Pissarra LS et al: "Solubilizing mutations used to crystallize one CFTR domain attenuate the trafficking and channel defects caused by the major cystic fibrosis mutation."

No. Sentence Comment

23 Some of these mutations represented sequence changes between human CFTR and CFTRs from other species, whereas others (G550E, R553Q, and R555K) had been previously identified as F508del-CFTR revertant mutations (Teem et al., 1996; deCarvalho et al., 2002; Chang et al., 1999). Login to comment
155 Comparison with Other Revertants Using the same cellular system employed to investigate the solubilizing mutations, we recently examined the mechanism of action of two other F508del-CFTR revertants, G550E and 4RK, the simultaneous mutation of four arginine-framed tripeptides (AFTs), R29K, R516K, R555K, and R766K (Roxo-Rosa et al., 2006). Login to comment

PMID: 18215767 [PubMed] Deber CM et al: "Defining the defect in F508 del CFTR: a soluble problem?"

No. Sentence Comment

18 The first human F508 del-NBD1 structure obtained carried seven additional mutations, three of which (suppressor mutations G550E, R553Q, and R555K) were known to rescue the F508 del-CFTR defect (Chang et al., 1999; DeCarvalho et al., 2002; Teem et al., 1996). Login to comment

PMID: 10564718 [PubMed] Pollet JF et al: "Expression and intracellular processing of chimeric and mutant CFTR molecules."

No. Sentence Comment

6 In addition, while the NBD1 R555K mutation is known to partially correct the processing of CFTR vF508 and to increase activity of both wild-type and vF508 individual channels, it showed no positive effect when introduced into the double NBD1 chimera. Login to comment
127 Lanes: 1 = CHO-mock-transfected, 2 = CHO-CFTR WT, 3 = CHO-CFTR 4M, 4 = CHO-CFTR R555K, 5 = CHO-vNBD2 and 6 = T84 cell line as positive control (derived from human gastrointestinal tract and expressed naturally CFTR protein). Login to comment
128 (B) Iodide e¥ux assays were performed on con£uent CHO cells (as negative control) grown on a plastic support and on CHO cells expressing CFTR WT, CFTR 4M, CFTR 4M-vNBD2 and CFTR 4M-R555K molecules. Login to comment
134 Data points are means of triplicates with S.E.M. Table 2 Expression, maturation and activity of the CFTR variants used in this study CFTR variant Protein Function A B C Wild-type + + + + vF508 3 + 3 3 4M + + + + 4MN + + + + 4M-2UNBD1 3 + 3 3 4MN-2UNBD1 3 + 3 3 4M-R555K 3 + + + 4M-2U(NBD1+R555K) 3 + 3 3 4M-NBD2/NBD1 3 + 3 3 4MN-NBD2/NBD1 3 + 3 3 4M-2UNBD2 3 + 3 3 4MN-2UNBD2 3 + 3 3 4MvNBD1 + + 3 3 4MvNBD2 + + + 3 + indicates the presence and 3 the absence of a CFTR band of the size expected for the A, B and C forms in transiently expressing COS-1 cells. Login to comment
138 To further determine whether the misfolding of 2UNBD1 molecule resulted from the additive e¡ect of the NBD1 intrinsic instability, we looked for a reversion of this phenotype by the R555K mutation. Login to comment
140 The R555K mutation was then introduced into each NBD1 of the 2UNBD1 variant. Login to comment
142 Fig. 3, lane 15, shows that the R555K mutation did not reverse the processing block observed for the 2UNBD1 molecule, suggesting that this defect did not result from an additive e¡ect of the intrinsic NBD1 instability. Login to comment
159 In addition, the R555K mutation, known to reverse the processing abnormality due to the vF508 mutation, did not restore the processing of the 2UNBD1 variant. Login to comment

PMID: 10445036 [PubMed] Chang XB et al: "Removal of multiple arginine-framed trafficking signals overcomes misprocessing of delta F508 CFTR present in most patients with cystic fibrosis."

No. Sentence Comment

40 This band remains prominent in 3 of the 4 R→K variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12). Login to comment
81 There was no detectable in- is enabled by the release from ER retention when thecrease in efflux rate from cells expressing ⌬F508 CFTR AFTs are inactivated.alone or with the R516K, R555K, or R766K mutation. Login to comment
127 The following oligonu-peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA. Login to comment
129 Hence, it is not CAGCGCCTGGAATTGTCAG and CTGACAATTCCAGGCGCTGTTT yet possible to know whether the AFTs may be "tucked- GTATCCTTTCCTCAAAATTG; R516K, CCTATGATGAATATAAATAC in" on maturation as a consequence of intramolecular AGAAGCCTCATC and GATGACGCTTCTGTATTTATATTCATCAT AGG; R555K, GGAGGTCAACGAGCAAAAATTTCTTTAGCAAGAGinteractions between domains of a single channel- and CTCTTGCTAAAGAAATTTTTGCTCGTTGACCTCC; and R766K,forming CFTR polypeptide or are due to intermolecular CTTCAGGCACGAAGGAAGCAGTCTCTCCTGAACC and GGTTCAGassociations between two or more pore-forming CFTR GACAGACTGCTTCCTTCGTGCTGAAG. Login to comment
41 This band remains prominent in 3 of the 4 R࢐K variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12). Login to comment
84 alone or with the R516K, R555K, or R766K mutation. Login to comment
130 The following oligonu- peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA. Login to comment
132 Hence, it is not CAGCGCCTGGAATTGTCAG and CTGACAATTCCAGGCGCTGTTT yet possible to know whether the AFTs may be "tucked- GTATCCTTTCCTCAAAATTG; R516K, CCTATGATGAATATAAATAC in" on maturation as a consequence of intramolecular AGAAGCCTCATC and GATGACGCTTCTGTATTTATATTCATCAT AGG; R555K, GGAGGTCAACGAGCAAAAATTTCTTTAGCAAGAG interactions between domains of a single channel- and CTCTTGCTAAAGAAATTTTTGCTCGTTGACCTCC; and R766K, forming CFTR polypeptide or are due to intermolecular CTTCAGGCACGAAGGAAGCAGTCTCTCCTGAACC and GGTTCAG associations between two or more pore-forming CFTR GACAGACTGCTTCCTTCGTGCTGAAG. Login to comment

PMID: 23493553 [PubMed] Woodward OM et al: "Gout-causing Q141K mutation in ABCG2 leads to instability of the nucleotide-binding domain and can be corrected with small molecules."

No. Sentence Comment

158 Here we tested homologous NBD mutations in Q141K ABCG2 and found the G188E mutation rescued Q141K expression, suggesting the Q141K mutation results in increased ABCG2 NBD instability. Login to comment
159 Interestingly, the R193K mutation, homologous to the suppressor mutation R555K in CFTR, didn`t increase Q141K ABCG2 expression; but did appear to decrease the insoluble fraction of Q141K protein (Fig. S6D). Login to comment

PMID: 23800412 [PubMed] Saranko H et al: "Effects of the gout-causing Q141K polymorphism and a CFTR DeltaF508 mimicking mutation on the processing and stability of the ABCG2 protein."

No. Sentence Comment

113 Therefore all these three mutations were introduced into the corresponding regions of the ABCG2 DF142 construct (3R: G188E, R191Q, and R193K). Login to comment

PMID: 14596935 [PubMed] Owsianik G et al: "Rescue of functional DeltaF508-CFTR channels by co-expression with truncated CFTR constructs in COS-1 cells."

No. Sentence Comment

33 The base pair substitutions (underlined) were introduced using following oligonucleotides: for R29K mutation: 5P-GAAAGGATACAAACAGC- GCCTGGA (sense) and 5P-TCCAGGCGCTGTTTGTATCCTTTC (antisense); for R516K mutation: 5P-CTATGATGAATATAAATA- CAGAAGCGTC (sense) and 5P-GACGCTTCTGTATTTATATTC- ATCATAG (antisense); for R555K mutation: 5P-GGTCAACGAG- CAAAAATTTCTTTAGC (sense) and 5P-GCTAAAGAAATTTT- TGCTCGTTGACC (antisense). Login to comment
93 Co-expression of vF508-CFTR with mutated constructs, possessing R516K and R555K mutations either alone or in combination, led to an about two-fold decrease of vF508-CFTR-dependent current when compared to cells that co-expressed vF508-CFTR and WF2 (Table 1). Login to comment
97 The RR2 construct is identical to RR1 except for the presence of R516K and R555K mutations in RXRs. Login to comment
133 Arginine-to- lysine mutation in NBD1`s RXRs of truncated CFTR constructs (R516K and R555K mutations) strongly impairs their vF508-CFTR rescue properties. Login to comment

PMID: 16624253 [PubMed] Hegedus T et al: "F508del CFTR with two altered RXR motifs escapes from ER quality control but its channel activity is thermally sensitive."

No. Sentence Comment

3 Now we have mutated these four AFTs in all possible combinations and found that simultaneous inactivation of two of them (R29K and R555K) is necessary and sufficient to overcome F508del CFTR retention. Login to comment
41 The PCR was performed according to standard Stratagene protocols using the same oligonucleotides employed to make the R29K and R555K substitutions previously [32]. Login to comment
176 In fact Teem et al. [42] had found that the R555K substitution alone restored a small F508del CFTR chloride current. Login to comment

PMID: 16712779 [PubMed] Tummler B et al: "Rescue of F508del CFTR: Commentary on "F508del CFTR with two altered RXR motifs escapes from ER quality control but its channel activity is thermally sensitive"."

No. Sentence Comment

23 doi:10.1016/j.bbamem.2006.03.033 Hegedus' finding also provides a clue why second-site mutations in the RXR motif in the dodecapetide of NBF1 such as R553Q, R553M and R555K partially corrected the F508del CFTR mutant phenotype in model systems [16] and in CF patients [17]. Login to comment

PMID: 22265409 [PubMed] Mendoza JL et al: "Requirements for efficient correction of DeltaF508 CFTR revealed by analyses of evolved sequences."

No. Sentence Comment

18 Additional second-site revertant mutations I539T, G550E, R553M, and R555K, within the portion of CFTR NBD1 included in the chimera, were also identified (DeCarvalho et al., 2002; Teem et al., 1993, 1996). Login to comment
19 The R553M, I539T, and the combination of G550E-R553M-R555K (3M) mutations correct the folding and stability defects of the DF508 NBD1 domain in isolation (DeCarvalho et al., 2002; Hoelen et al., 2010; Pissarra et al., 2008; Qu et al., 1997; Thibodeau et al., 2010) but only partially restore maturation of the full-length mutant protein (Hoelen et al., 2010; Pissarra et al., 2008; Thibodeau et al., 2010). Login to comment
76 The R555K missense mutation F508 ICL4 ICL1 F508 A B 0 0.2 0.4 0.6 0.8 1 508 Consensus Walker B 389 673 Walker A 0 0.2 0.4 0.6 0.8 1 NBD1 508 TMD NBD R TMD2 NBD 1 1480 TMD NBD R TMD2 NBD Figure 2. Login to comment
90 R555K increased the folding yield of NBD1, 3.26- &#b1; 0.07-fold over wild-type (Figure 3A). Login to comment
91 The Tm of R555K NBD1 was 6.4 C higher than wild-type in 2 mM ATP. Login to comment
127 The surface view A B I539T G550E R553M R555K 3M WT F S466T L475Y F490L W496V Y517I C524A L526A D529F D537F Y563V A566P S573E P574A F575T E583G H609T 0 1 2 3 Relative Yield NBD1 ( -gal.) 25 30 35 40 45 0.0 0.5 1.0 Temperature (C ) Relative Turbitity 0 1 2 3 4 -5 0 5 10 WT F I539T I539T F S573E R555K D529F Relative Yield NBD1 ( -gal.) Tm Figure 3. Login to comment
158 Mirroring the maturation results, correction of either the NBD1 defect (I539T, R555K, red bars) or the ICL4-NBD1 defect (R1070W, white bar) alone provided only modest improvements of function. Login to comment
166 B C A B 0 1 2 3 0 1 2 Relative Yield NBD1 (b2;-gal.) Relative Yield CFTR (ELISA) WT ࢞F WT ƊF S466T L475Y F490L W496V Y517I C524A L526A D529F D537F Y563V A566P S573E P574A F575T E583G H609T 0 1 2 Relative Yield CFTR (ELISA) I539T G550E R553M R555K 3M Figure 4. Login to comment
172 See also Figure S5. (B) The influence of the 508-coupled mutations (green circles), four second-site suppressor mutations (I539T, G550E, R553M, and R555K) and three suppressors in combination (G550E, R553M, and R555K) (orange circles) on F508 background on relative maturation of full-length CFTR and relative NBD1 folding yield is correlated (green line, m = 0.75, R = 0.85). Login to comment
185 Previously identified second-site suppressor (I539T, G550E, R553M, R555K, and 3M) but not the 508-coupled mutants (D529F and S573E) increase the yield of DF508 NBD1. Login to comment
187 See also Table S2. (C) F508K, F508R, and F508K in combination with I539T, G550E, R553M, R555K, and 3M mutations increase folding yield of NBD1, but exhibit no corresponding increase in CFTR maturation yield (dark blue circles and line, m = 0.03, R = 0.40) (&#b1;SEM, n = 9 along x axis and n = 3 along y axis). Login to comment
219 When R1070W is combined with mutations that improve DF508 NBD1 folding yield, I539T, G550E, R553M, R555K, and 3M (open triangles), the correlation between NBD1 folding and CFTR maturation in the wild-type protein is restored (m = 0.77, R = 0.47, black line) (&#b1;SEM). Login to comment
233 D529F, S573E, and R555K mutations of human wild-type NBD1 were expressed and purified as previously described (Thibodeau et al., 2005). Login to comment

PMID: 23055971 [PubMed] Molinski S et al: "Functional Rescue of F508del-CFTR Using Small Molecule Correctors."

No. Sentence Comment

34 The first stabilizing mutations were identified in the ABC conserved, canonical subdomains, and cluster in the b1;-helical subdomain (G550R, R553Q, R555K), in the b3; switch (F494N), and ATP binding core subdomain (Q637R). Login to comment
59 Similarly, the second site mutations, previously discussed with regard to their efficacy in stabilizing the isolated F508del-NBD1, i.e., the second site mutations in the ABC conserved core ATP binding subdomains (G550E, R553Q, and R555K) also promote improved processing of the full-length F508del-CFTR. Login to comment
62 Employing biophysical methods, including circular dichroism, dynamic light scattering,and fluorescence,both groups confirmed that the introduction of "stabilizing mutations" residing in the ABC b1;-helical subdomain (G550E, R553M, R555K) and the structural diverse region (I539T), fully corrects defects in kinetic and thermal stability of the isolated F508del-NBD1 domain. Login to comment

PMID: 23060795 [PubMed] Pedemonte N et al: "Pharmacological Correctors of Mutant CFTR Mistrafficking."

No. Sentence Comment

144 The first type of mutation,such as I539T or R555K,increases the stability of NBD1. Login to comment

PMID: 23104983 [PubMed] He L et al: "Correctors of DeltaF508 CFTR restore global conformational maturation without thermally stabilizing the mutant protein."

No. Sentence Comment

148 A) èc;F508 with NBD1-stabilizing mutations: 4S, I539T/G550E/R553M/R555K; èc;RI, deletion of amino acid residues 404-435; 4PT, S422P/S434P/S492P/A534P/I539T. Login to comment

PMID: 23378596 [PubMed] Hunt JF et al: "Cystic fibrosis transmembrane conductance regulator (ABCC7) structure."

No. Sentence Comment

163 One such set, called the Teem set, comprised three point mutations (G550E/ R553Q/R555K) that previously were shown to promote improved biogenesis of F508del CFTR in tissue cultures cells, presumably by improving the stability of the protein (Teem et al. 1993; DeCarvalho et al. 2002). Login to comment
236 Note that the structures shown here contain seven point mutations included in hNBD1 constructs because of their beneficial influence on yield during purification-F409L, F429S, F433L, G550E, R553Q, R555K, and H667R. Login to comment
275 A series of second-site mutations in NBD1 have parallel effects in rescuing the trafficking defect in CFTR in vivo (DeCarvalho et al. 2002; Pissarra et al. 2008; Aleksandrov et al. 2010) and inhibiting molten globule formation by isolated NBD1 in vitro (G550E/R553Q/R555K, F494N/Q637R, or V510D) (Protasevich et al. 2010; Wang et al. 2010). Login to comment

PMID: 23457292 [PubMed] Chong PA et al: "Dynamics intrinsic to cystic fibrosis transmembrane conductance regulator function and stability."

No. Sentence Comment

200 Many of the suppressor mutations, like G550E, R553Q, and R555K (Teem et al. 1993, 1996), which are relatively distant from the F508 position, increase NBD1 thermal stability and reverse some of the processing and functional defects, presumably without reverting the surface changes caused by deletion of F508. Login to comment

PMID: 23865422 [PubMed] Loo TW et al: "Bithiazole correctors rescue CFTR mutants by two different mechanisms."

No. Sentence Comment

24 It should be noted, however, that the ƊNBD2 CFTR used in this study was different from that used by Okiyoneda et al.18 The ƊNBD2 CFTR constructs in our study did not contain the G550E, R553Q, R555K, and F494N mutations or the three hemagglutinin tags in the fourth extracellular loop that could influence CFTR corrector interactions. Login to comment

PMID: 23890012 [PubMed] Farinha CM et al: "Revertants, low temperature, and correctors reveal the mechanism of F508del-CFTR rescue by VX-809 and suggest multiple agents for full correction."

No. Sentence Comment

23 Herein, we explored the MoA of VX-809 by analyzing its synergistic/additive effect with those of previously characterized genetic revertants, which rescue F508del-CFTR by causing different effects: 4RK affecting traffic (Roxo-Rosa et al., 2006), G550E (Roxo-Rosa et al., 2006) and R555K increasing channel gating by strengthening the NBD1:NBD2 dimer interface, and R1070W (Serohijos et al., 2008) and V510D (Wang et al., 2007a; Loo et al., 2010) by filling the NBD1:ICL4 interface. Login to comment
36 VX-809 Adds to VRT-325 and Corr-4a to Rescue F508del-CFTR but Exhibits Variable Effects on Genetic Revertants In order to characterize the rescue mechanism of VX-809 on F508del-CFTR, we then tested the effect of incubating it together with VRT-325 and Corr-4a on BHK cells stably expressing this mutant alone or in cis with the following genetic revertants: (1) 4RK (where the four AFTs were simultaneously mutated to lysines), (2) G550E, (3) R1070W, (4) V510D, or (5) R555K (Figures 1A-1E). Login to comment
41 Interestingly, however, analysis of the effects of the three compounds upon the revertants showed that VX-809 (but neither VRT-325 nor Corr-4a) is additive to G550E or R555K in correcting F508del-CFTR (by 38% and 32%, respectively), strongly suggesting that VX-809 acts differently from these two revertants. Login to comment
57 Effect of Small Molecule Correctors on F508del-CFTR and Genetic Revertants (A-F) BHK cell lines stably expressing CFTR bearing F508del alone (A) or in cis with 4RK (B), G550E (C), R1070W (D), V510D (E), and R555K (F) were incubated for 24 hr with 6.7 mM VRT-325, 10 mM Corr-4a, or 3 mM VX-809 alone or in combination. Login to comment
87 Rescue of F508del-CFTR by Low Temperature Is Additive to Genetic Revertants To learn more about how low temperature rescues F508del-CFTR, we assessed its combined effect with that of the above genetic revertants: G550E, R1070W, 4RK, V510D, and R555K (Figures 4A and 4B). Login to comment
88 Results show that low temperature further increases processing levels of F508del-CFTR by the five genetic revertants, namely, V510D, G550E, R1070W, 4RK, and R555K, by an additional 35%, 65%, 38%, 27%, and 22%, respectively (compare gray and black bars in Figure 4B). Login to comment
164 Indeed, VX-809 (in contrast to either VRT-325 or Corr-4a) adds to the rescue by G550E and R555K (both acting at the NBD1:NBD2 interface), indicating that the compound and these two revertants probably correct distinct conformational cues of F508del-CFTR. Login to comment
165 In contrast, the additive effect of VX-809 to R1070W and V510D is rather modest, thus suggesting that this corrector acts more similarly to R1070W/V510D than to G550E/R555K. Login to comment
197 Moreover, the observed synergy of G550E or R555K with VX-809, but not VRT-325, is consistent with this model in which VRT-325 acts on the NBD1:NBD2 dimerization interface (also supported by the synergy between R1070W and VRT-325). Login to comment
210 Our data also show that low temperature, similar to chemical correctors, further increases processing levels of F508del-CFTR by the five genetic revertants, although to variable levels: V510D (by an additional 35%), G550E (65%), R1070W (38%), 4RK (27%), and R555K (22%). Login to comment
214 Although 4RK can also be claimed to impact on F508del-CFTR folding (namely, through its two NBD1 changes: R516K and especially R555K), this is somewhat disproven by the additive effects of 4RK with G550E (Figure 4), the latter truly correcting F508del-NBD1 folding, as assessed by channel gating (Farinha and Amaral, 2005; Rosser et al., 2008; Roxo-Rosa et al., 2006). Login to comment
231 EXPERIMENTAL PROCEDURES Cells and Culture Conditions BHK cell lines expressing F508del-4RK (R29K/R516K/R555K/R716K)-, F508del-G550E-, F508del-R1070W-, F508del-V510D-, F508del-R555K-, F508del-V510D/G550E-, F508del-G550E/R1070W-, DAA (D567A)-, 4RK- DAA-, DD/AA (D565A, D567A)-, 4RK-DD/AA-, and R560T-CFTR were produced and cultured as previously described (Roxo-Rosa et al., 2006). Login to comment

PMID: 24513531 [PubMed] Moran O et al: "On the structural organization of the intracellular domains of CFTR."

No. Sentence Comment

1241 However, as the native preparation of NBD1 and NBD2 tend to precipitate at relatively low concentration (>2.5 mg/ml; Galeno et al., 2011; Galfr&#e8; et al., 2012), to obtain protein concentrations compatible with the crystallization conditions, three to seven revertant mutations (F409L, F429S, F433L, G550E, R553Q, R555K, H667R, Roxo-Rosa et al., 2006; F429S, F494N, Q637R, Pissarra et al., 2008) have been introduced into the NBD1. Login to comment

PMID: 24685677 [PubMed] Pranke IM et al: "Biosynthesis of cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

1442 Mutations located in NBD1, such as I539T, G550E, R553M/Q and R555K, as well as R1070W in CL4 of MSD2 promote Phe508del-CFTR maturation and trafficking to the cell surface and also restore channel activity (DeCarvalho et al., 2002; Teem et al., 1993, 1996; Thibodeau et al., 2010). Login to comment

PMID: 24855632 [PubMed] Kirby EF et al: "Enhancing the Potency of F508del Correction: A Multi-Layer Combinational Approach to Drug Discovery for Cystic Fibrosis."

No. Sentence Comment

67 In contrast, combined second-site suppressor mutations R553K/R555K (2RK) in NBD1 not only alter the protease susceptibility of NBD1 but also that of other domains of F508del CFTR. Login to comment

PMID: 24970227 [PubMed] Wang XR et al: "Decoding F508del misfolding in cystic fibrosis."

No. Sentence Comment

41 This NBD1 conformational defect is fully correctable by revertant mutation R555K [24] or by low-temperature incubation in permissive cell lines, which is accompanied by conformational rescue in other CFTR domains [8]. Login to comment

PMID: 25083918 [PubMed] He L et al: "Restoration of NBD1 thermal stability is necessary and sufficient to correct F508 CFTR folding and assembly."

No. Sentence Comment

45 2PT, S492P/A534P/I539T; 4PT, 2PT + S422P/S434P; 3SS, G550E/R553M/R555K; 4SS, 3SS + I539T; ƊRI, deletion of RI amino acids 404-435; combo, ƊRI + 2PT + 3SS. Login to comment
66 S492P/I539T; 5-G550E/R553Q/R555K; 6-combo. Login to comment
75 Based on our single mutation analysis, the Tm difference between G550E/R553Q/R555K and G550E/R553M/R555K is less than 1 &#b0;C. Fig. 3. Login to comment
96 The S492P and I539T substitutions had additive affects such that ƊTm increased to 4.4 &#b0;C, and ƊTm was further increased to 8.4 &#b0;C when the additional mutations A534P/G550E/R553M/R555K were introduced. Login to comment

PMID: 26149808 [PubMed] Chong PA et al: "Deletion of Phenylalanine 508 in the First Nucleotide-binding Domain of the Cystic Fibrosis Transmembrane Conductance Regulator Increases Conformational Exchange and Inhibits Dimerization."

No. Sentence Comment

38 Evidence that NBD1 destabilization is problematic for proper processing was provided by NBD1-thermostabilizing mutations distant from the F508del site, including G550E, R553Q, R555K, and deletion of the RI. Login to comment
363 Interestingly, the combined suppressor mutations I539T, G550E, R553M, and R555K have a bigger positive effect on F508del CFTR when NBD2 is present (58), suggesting the importance of the NBD interaction and hinting that these NBD1-stabilizing mutations may also improve the ability of F508del NBD1 to dimerize with NBD2. Login to comment