ABCMdb

PMID: 10445036

Chang XB, Cui L, Hou YX, Jensen TJ, Aleksandrov AA, Mengos A, Riordan JR
Removal of multiple arginine-framed trafficking signals overcomes misprocessing of delta F508 CFTR present in most patients with cystic fibrosis.
Mol Cell. 1999 Jul;4(1):137-42., [PubMed]

Sentences

No. Mutations Sentence Comment

40 ABCC7 p.Arg555Lys ABCC7 p.Arg516Lys ABCC7 p.Arg29Lys ABCC7 p.Arg766Lys This band remains prominent in 3 of the 4 R→K variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12). Login to comment 41 ABCC7 p.Arg555Lys ABCC7 p.Arg516Lys ABCC7 p.Arg29Lys ABCC7 p.Arg766Lys This band remains prominent in 3 of the 4 R࢐K variants (R516K, R555K, and R766K; lanes 9, 10, and 11 respectively) but not in R29K (lane 8) or in 4RK (lane 12). Login to comment 42 ABCC7 p.Arg29Lys Arginine-Framed Tripeptide Trafficking Signals in CFTR significantly, however, bands of lower mobility are pro- (A) Schematic depiction of CFTR protein indicating approximate duced by the R29K and 4RK variants (lanes 8 and 12). Login to comment 43 ABCC7 p.Arg29Lys Arginine-Framed Tripeptide Trafficking Signals in CFTR significantly, however, bands of lower mobility are pro- (A) Schematic depiction of CFTR protein indicating approximate duced by the R29K and 4RK variants (lanes 8 and 12). Login to comment 81 ABCC7 p.Arg555Lys ABCC7 p.Arg516Lys ABCC7 p.Arg766Lys There was no detectable in- is enabled by the release from ER retention when thecrease in efflux rate from cells expressing ⌬F508 CFTR AFTs are inactivated.alone or with the R516K, R555K, or R766K mutation. Login to comment 82 ABCC7 p.Arg29Lys With ⌬F508/R29K, low rates of 36 Cl- efflux occurred at considerably delayed times after stimulation. Login to comment 84 ABCC7 p.Arg555Lys ABCC7 p.Arg516Lys ABCC7 p.Arg766Lys alone or with the R516K, R555K, or R766K mutation. Login to comment 85 ABCC7 p.Arg29Lys With DF508/R29K, low rates of 36 Cl2 efflux occurred at considerably delayed times after stimulation. Login to comment 127 ABCC7 p.Arg555Lys ABCC7 p.Arg516Lys ABCC7 p.Arg29Lys ABCC7 p.Arg766Lys The following oligonu-peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA. Login to comment 128 ABCC7 p.Arg29Lys R29K, CAATTTTGAGGAAAGGATACAAA shall et al., 1994; Zerhusen et al., 1999). Login to comment 129 ABCC7 p.Arg555Lys ABCC7 p.Arg516Lys ABCC7 p.Arg766Lys Hence, it is not CAGCGCCTGGAATTGTCAG and CTGACAATTCCAGGCGCTGTTT yet possible to know whether the AFTs may be "tucked- GTATCCTTTCCTCAAAATTG; R516K, CCTATGATGAATATAAATAC in" on maturation as a consequence of intramolecular AGAAGCCTCATC and GATGACGCTTCTGTATTTATATTCATCAT AGG; R555K, GGAGGTCAACGAGCAAAAATTTCTTTAGCAAGAGinteractions between domains of a single channel- and CTCTTGCTAAAGAAATTTTTGCTCGTTGACCTCC; and R766K,forming CFTR polypeptide or are due to intermolecular CTTCAGGCACGAAGGAAGCAGTCTCTCCTGAACC and GGTTCAGassociations between two or more pore-forming CFTR GACAGACTGCTTCCTTCGTGCTGAAG. Login to comment 130 ABCC7 p.Arg555Lys ABCC7 p.Arg516Lys ABCC7 p.Arg29Lys ABCC7 p.Arg766Lys The following oligonu- peptides contributing to an individual PKA-activated cleotides were used to introduce R29K, R516K, R555K, and R766K chloride channel has not been firmly established (Mar- into wild-type CFTR cDNA. Login to comment 131 ABCC7 p.Arg29Lys R29K, CAATTTTGAGGAAAGGATACAAA shall et al., 1994; Zerhusen et al., 1999). Login to comment 132 ABCC7 p.Arg555Lys ABCC7 p.Arg516Lys ABCC7 p.Arg766Lys Hence, it is not CAGCGCCTGGAATTGTCAG and CTGACAATTCCAGGCGCTGTTT yet possible to know whether the AFTs may be "tucked- GTATCCTTTCCTCAAAATTG; R516K, CCTATGATGAATATAAATAC in" on maturation as a consequence of intramolecular AGAAGCCTCATC and GATGACGCTTCTGTATTTATATTCATCAT AGG; R555K, GGAGGTCAACGAGCAAAAATTTCTTTAGCAAGAG interactions between domains of a single channel- and CTCTTGCTAAAGAAATTTTTGCTCGTTGACCTCC; and R766K, forming CFTR polypeptide or are due to intermolecular CTTCAGGCACGAAGGAAGCAGTCTCTCCTGAACC and GGTTCAG associations between two or more pore-forming CFTR GACAGACTGCTTCCTTCGTGCTGAAG. Login to comment