ABCMdb

ABCC7 p.Leu1065Pro

[switch to full view]
Comments [show]

II (maturation defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications

PMID: 10388469 [PubMed] Castaldo G et al: "Detection of five rare cystic fibrosis mutations peculiar to Southern Italy: implications in screening for the disease and phenotype characterization for patients with homozygote mutations."

No. Sentence Comment

46 aso dot-blot procedure for the analysis of the five "rare" cf mutations To analyze routinely the five mutations (i.e., L1065P, 711ϩ1G3T, R1158X, 4016insT, and G1244E) we set up a procedure based on a single multiplex PCR amplification followed by ASO dot-blot hybridization. Login to comment
49 Mutation Forward primer (5؅) Reverse primer (3؅) Wild-type oligo for ASO dot blota Mutated oligo for ASO dot blota L1065P (exon 17b) 5ЈTTCAAAGAATGGCACCAGTGT 3ЈATAACCTATAGAATGCAGCA 5ЈATGGACACTTCGTGCCT (52 °C) 5ЈTGGACACCTCGTGCCT (52 °C) 4016insT (exon 21) 5ЈAATGTTCACAAGGGACTCCA 3ЈCAAAAGTACCTGTTGCTCCA 5ЈAGTATTTATTTTTTCTGGAAC (52 °C) 5ЈGTATTTATTTTTTTCTGGAAC (52 °C) 711ϩ1G3T (intron 5) 5ЈATTTCTGCCTAGATGCTGGG 3ЈAACTCCGCCTTTCCAGTTGT 5ЈTTGATGAAGTATGTACCTAT (52 °C) 5ЈTTTGATGAATTATGTACCTAT (52 °C) R1158X (exon 19) 5ЈGCCCGACAAATAACCAAGTGA 3ЈGCTAACATTGCTTCAGGCT 5ЈTTCAGATGCGATCTGTGA (52 °C) 5ЈTTTCAGATGTGATCTGTGA (52 °C) G1244E (exon 20) 5ЈGGTCAGGATTGAAAGTGTGCA 3ЈCTATGAGAAAACTGCACTGGA 5ЈCCTCTTGGGAAGAACTGGA (53 °C) 5ЈCCTCTTGGAAAGAACTGGA (51 °C) a For each oligonucleotide, the optimal washing temperature of the filter is reported. Login to comment
53 Results The DGGE screening allowed us to identify 20 different mutations; five of these, i.e., R1158X, G1244E, 4016insT, 711ϩ1G3T, and L1065P, were observed with a frequency Ͼ1.0% among 396 CF alleles from Southern Italy. Login to comment
55 The homozygote (Fig. 1A) and heterozygote (Fig. 1B) patterns of exon 17b are clearly altered; sequence analysis revealed the L1065P mutation. Login to comment
57 The incidence of the L1065P mutation in our series of 396 CF chromosomes was 1.3%. Login to comment
58 One patient homozygous for L1065P showed a mild pulmonary and gastrointestinal form of CF, with a moderate pancreatic insufficiency and mild liver involvement. Login to comment
70 The sequence analysis revealed the L1065P mutation. Login to comment
87 An example of the improved ASO dot-blot procedure used to analyze the five mutations is shown in Fig. 3 for R1158X (Fig. 3A), L1065P (Fig. 3B), 4016insT (Fig. 3C), 711ϩ1G3T (Fig. 3D), and G1244EG3A (Fig. 3E). Login to comment
97 Mutation L1065P has been reported in ϳ3% of CF chromosomes (24) from Sicily (Southern Italy). Login to comment
107 Genotype 4016insT/4016insT R1158X/R1158X L1065P/L1065P Ethnic origin Southern Italy Southern Italy Southern Italy Present age 23 years Death at 20 years 18 years Age at diagnosis 2 years 3 months 1 year Meconium ileus No No No Nasal polyposis No No No Lung involvement Severe Very severe Mild FEV 1, % of predicted 38 18 62 Liver involvement Cholestasis Moderate Mild Pancreatic insufficiency Moderate Moderate Moderate Sweat chloride 70 mEq/L 98 mEq/L 93 mEq/L Table 3. Login to comment
109 CF mutation XV2c KM19 IVS18CA IVS17bTA IVS17bCA M470V R1158X 1 2 16 7 17 M L1065P 1 1 16 30 13 V 711ϩ1G3T 1 1 16 25 13 V 4016insT 2 1 16 30 13 V G1244EG3T 1 1 16 34 13 V showed haplotype 2, 2, 16, 45, 13, suggesting the recurrent origin of the mutation or a recombinant event (18, 22). Login to comment
129 The patient homozygous for R1158X (a nonsense mutation) and the patient homozygous for 4016insT (a frameshift mutation) showed very severe expression of CF (because the synthesis of the wild-type protein was suppressed) compared with the patient homozygous for L1065P, a missense mutation associated with the synthesis of a protein with a single amino acid substitution. Login to comment
135 For R1158X (A) and L1065P (B), 1 and 2 are heterozygotes for the mutation, 3 is a homozygote for the mutation, and 4 is a healthy control. Login to comment

PMID: 12007216 [PubMed] Bobadilla JL et al: "Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening."

No. Sentence Comment

110 Germany ∆F508 (71.8%) 1789+5G→A (0.9%) 87.6 76.7 17 5662/1316 Dörk et al. [1992]; Dörk et al. R553X (2.0%) 3272-26A→G (0.9%) [1994]; Tümmler et al. [1996]; N1303K (1.8%) W1282X (0.7%) Estivill et al. [1997]; Dörk et G542X (1.2%) 2143delT (0.7%) al. [2000] R347P (1.2%) 1078delT (0.6%) CFTRdele2,3 (1.2%) 2183AA→G (0.6%) 3849+10KbC→T (1.0%) 2184insA (0.6%) G551D (0.9% 3659delC (0.6%) 1717-1G→A (0.9%) Greece ∆F508 (52.9%) 3272-26A→G (0.8%) 82.2 67.6 22 2097/718 Kanavakis et al. [1995]; Estivill 621+1G→T (5.0%) R1070Q (0.8%) et al. [1997]; Tzetis et al. G542X (4.1%) W496X (0.7%) [1997]; Macek et al. [2002] N1303K (3.3%) 621+3A→G (0.7%) 2183AA→G (1.8%) ∆I507 (0.7%) 2789+5G→A (1.7%) W1282X (0.7%) E822X (1.6%) 574delA (0.7%) R117H (1.2%) 1677delTA (0.7%) R334W (1.1%) A46D (0.6%) R1158X (1.0%) 3120+1G→A (0.6%) G85E (1.0%) G551D (0.5%) Hungary ∆F508 (54.9%) W1282X (1.8%) 68.3 46.6 9 1133/976 CFGAC [1994]; Estivill et al. 1717-1G→A (1.9%) G542X (1.7%) [1997]; Macek et al. [2002] R553X (2.1%) N1303K (1.3%) Y1092X (1.8%) G551D (1.0%) S1196X (1.8%) Ireland ∆F508 (70.4%) G542X (1.0%) 82.1 67.4 7 801/509 CFGAC [1994]; Estivill et al. G551D (5.7%) 621+1G→T (0.8%) [1994] R117H (2.4%) 1717-1G→A (0.6%) R560T (1.2%) Italy ∆F508 (50.9%) ∆I507 (0.65%) 60.3 36.4 9 3524 Estivill et al. [1997] (total) G542X (3.1%) W1282X (0.62%) 1717-1G→A (1.6%) Y122K (0.59%) N1303K (1.4%) G551D (0.53%) R553X (0.94%) Italy ∆F508 (47.6%) R553X (1.3%) 87.1 75.9 15 225 Bonizzato et al. [1995] (Northeast) R1162X (9.8%) 2789+G→A (1.3%) 2183AA→G (9.3%) Q552X (1.3%) N1303K (4.0%) 621+1G→T (0.9%) G542X (2.7%) W1282X (0.9%) 711+5G→A (2.7%) 3132delTG (0.9%) 1717-1G→A (2.2%) 2790-2A→G (0.9%) G85E (1.3%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS583 Italy ∆F508 (56.4%) 711+1G→T (1.3%) 85.7 73.4 13 660/396 Castaldo et al. [1996]; Castaldo (southern) N1303K (6.8%) G1244E (1.3%) et al. [1999] G542X (5.7%) R1185X (1.3%) W1282X (3.8%) L1065P (1.3%) 1717-1G→A (2.3%) R553X (1.1%) 2183AA→G (1.9%) I148T (0.7%) 4016insT (1.8%) Latvia 1) DF508 (58.3%) 4) CFTRdele2,3 (2.8%) - - 6 36 Dörk et al. [2000]; Macek et al. 2) 3849+10KbC®T (8.3%) 5) W1282X (2.8%) [2002] 3) N1303K (5.6%) 6) 394delTT (2.8%) Lithuania ∆F508 (31.0%) N1303K (2.0%) 39.0 15.2 4 94 Dörk et al. [2000]; Macek et al. R553X (4.0%) CFTRdele2,3 (2.0%) [2002] Macedonia ∆F508 (54.3%) 711+3A→G (1.0%) 69.2 47.9 12 559/226 Petreska et al. [1998]; Dörk et G542X (4.2%) 3849G→A (1.0%) al. [2000]; Macek et al. N1303K (2.0%) 2184insA (0.9%) [2002] CFTRdele2,3 (1.3%) 457TAT→G (0.7%) 621+1G→T (1.3%) V139E (0.7%) 611-1G→T (1.2%) 1811+1G→C (0.6%) Netherlands ∆F508 (74.2%) R1162X (0.9%) 86.8 75.3 9 3167/1442 Gan et al. [1995]; Estiville et al. A455E (4.7%) S1251N (0.9%) [1997]; Collee et al. [1998] G542X (1.8%) N1303K (0.9%) 1717-1G→A (1.5%) W1282X (0.7%) R553X (1.2%) Norway ∆F508 (60.2%) G551D (1.2%) 69.8 48.7 6 410/242 Schwartz et al. [1994]; Estivill 394delTT (4.2%) G542X (0.6%) et al. [1997] R117H (3.0%) N1303K (0.6%) Poland ∆F508 (57.1%) CFTRdele2,3 (1.8%) 73.5 54.0 11 4046/1726 CFGAC [1994]; Estivill et al. 3849+10Kb C→T (2.7%) R560T (1.5%) [1997]; Dörk et al [2000]; G542X (2.6%) W1282X (0.7%) Macek et al. [2002] 1717-1G→A (2.4%) ∆I507 (0.5%) R553X (1.9%) G551D (0.5%) N1303K (1.8%) Portugal ∆F508 (44.7%) R334W (0.7%) 49.7 24.7 5 739/454 CFGAC [1994]; Estivill et al. G542X (1.6%) N1303K (0.7%) [1997] R1066C (2.0%) Romania ∆F508 (36.6%) G542X (1.4%) 51.5 26.5 11 224/74 CFGAC [1994]; Estivill et al. 2043delG (2.0%) R553X (1.4%) [1997]; Popa et al. [1997]; W1282X (1.7%) G576X (1.4%) Macek et al. [2002] 1717-2A→G (1.4%) 1898+1G→A (1.4%) I148T (1.4%) 2183AA→G (1.4%) 621+1G→T (1.4%) Russia ∆F508 (54.4%) 552insA (0.9%) 70.7 50.0 12 5073/2562 CFGAC [1994]; Estivill et al. CFTRdele2,3 (5.0%) G542X (0.9%) [1997]; Dörk et al. [2000]; R553X (3.5%) R334W (0.9%) Macek et al. [2002] 2183AA→G (1.3%) 1677delTA (0.8%) W1282X (1.0%) Y122X (0.5%) 394delTT (1.0%) 1367del5 (0.5%) (Continued) BOBADILLAETAL. Login to comment

PMID: 15084222 [PubMed] D'Apice MR et al: "Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy."

No. Sentence Comment

55 These mutations included S4X (143 C to A), exon 1; S42F (257 C to T), exon 2; R117L (482 G to T), exon 4; S549R (1779 T to G), exon 11; 3667ins4, exon 19; A1006E (3149 C to A), exon17a; L1065P (3326 T to C), R1066C (3328 C to T), L1077P (3362 T to C), exon 17b. Login to comment
70 The microdeletion 4167delCTAAGCC in exon 22 was identified by DHPLC analysis in a CF patient who presents the L1065P (3326 T to C) mutation on the maternal chromosome. Login to comment
89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

PMID: 15176679 [PubMed] Decaestecker K et al: "Genotype/phenotype correlation of the G85E mutation in a large cohort of cystic fibrosis patients."

No. Sentence Comment

92 - Cystic fibrosis transmembrane conductance regulator genotypes of patients in the three study groups G85E PI PS Genotype Subjects n Genotype Subjects n Genotype Subjects n G85E/F508del# 34 F508del# /F508del# 58 F508del# /unknown 15 G85E/unknown 8 F508del# /unknown 2 F508del# /3849z10 kbCRT} 5 G85E/G542X# 5 F508del# /1717-1GR A 1 F508del# /R117H} 3 G85E/W1282X# 4 F508del# /N1303K# 1 T338I/L1065P 2 G85E/I507del# 3 F508del*/H139R 1 E585X/3272-26ARG} 2 G85E/R1162X# 3 F508del# /R1066C # 1 2183AARG/2789z5GRA 2 G85E/2183AARG 2 F508del# /G542X# 1 F508del# /711z5GRA 1 G85E/G85E 1 F508del# /712-1GRT 1 F508del# /D1152H} 1 G85E/E585X# 1 F508del# /621z1GRT 1 F508del# /1898z3ARG 1 G85E/711z1GRT# 1 F508del# /1898z1 1 F508del# /R347H} 1 G85E/712-1GRT# 1 Total 68 F508del# /2789z5GRA 1 G85E/621z1GRT# 1 2789z5GRA/? Login to comment

PMID: 15638824 [PubMed] Castaldo G et al: "Comprehensive cystic fibrosis mutation epidemiology and haplotype characterization in a southern Italian population."

No. Sentence Comment

2 Twelve mutations are peculiar to CF chromosomes from southern Italy: R1158X, 4016insT, L1065P and 711+1G>T are present in 6.3% of CF chromosomes in Campania; G1244E and 852del22 are present in 9.6% of CF chromosomes in Basilicata and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D are frequent in Puglia (19.6% of CF alleles). Login to comment
33 The 13 mutations in this panel are: F508del, N1303K, G542X, W1282X, 2183AA>G, 1717-1G>A, R553X, I148T, R1158X, 711+1G>T, 4016insT, L1065P and G1244E. Login to comment
49 In particular, 4016insT, R1158X, 711+1 G>T and L1065P had a cumulative frequency of 6.3% in CF chromosomes from Campania; G1244E and 852del22 a cumulative frequency of 9.6% in CF chromosomes from Basilicata; and 4382delA, 1259insA, I502T, 852del22, 4016insT, D579G, R1158X, L1077P and G1349D a cumulative frequency of 19.6% in CF chromosomes from Puglia. Login to comment
52 We also identified three homozygotes for G542X, three for 852del22, two for 2183AA>G, and one each for N1303K, 1717-1G>A, 4016insT, R553X, R1158X and L1065P. Login to comment
62 A procedure for the large-scale analysis of several mutations peculiar to southern Italy is also indicated Mutation Analytical CF alleles Campania Basilicata Puglia Total procedure n = 340 n = 52 n = 350 n = 742 DF508 55.6 55.8 46.8 51.5 N1303K 7.3 3.8 7.7 7.3 G542X 5.0 3.8 7.1 5.9 W1282X 3.5 3.8 0.6 2.2 2183 AA>G 2.3 5.8 0.8 1.9 852del22 0 5.8 3.2 1.9 3% agarose 1717-1G>A 2.3 1.9 1.1 1.8 4382delA 0 0 3.7 1.8 RE (Ear I -) 1259insA 0 0 3.1 1.5 4016insT 2.1 0 1.1 1.5 ASO R553X 1.5 0 1.7 1.5 R1158X 1.5 0 1.3 1.2 ASO or RE (Sfa N 1 -) L1077P 0.6 0 1.9 1.2 I502T 0.3 0 2.0 1.1 RE (Mse I -) 3849+10kbC>T 0 1.9 1.6 0.9 D579G 0 0 1.6 0.8 RE (Avr II +) G1244E 0.9 3.8 0.3 0.8 ASO or RE (Mbo II +) G1349D 0 0 1.7 0.8 RE (Sty I -) 2789+5 G>A 0.6 0 0.8 0.7 711+1 G>T 1.5 0 0 0.7 ASO L1065P 1.2 0 0 0.5 ASO or RE (Mnl I +) R347P 0.3 0 0.9 0.5 2522insC 0.9 0 0 0.4 E585X 0.6 0 0 0.3 G85E 0.6 0 0 0.3 G178R 0.6 0 0 0.3 D1152H 0.3 0 0.3 0.3 I148T-3195del6 0.6 0 0 0.3 I148T (alone) 0 0 0.3 0.1 R334W 0 0 0.3 0.1 DI507 0 0 0.3 0.1 I1005R 0 0 0.3 0.1 3272-26A>G 0.3 0 0 0.1 2711delT 0.3 0 0 0.1 L558S 0 1.9 0 0.1 W1063X 0 0 0.3 0.1 D110H 0.3 0 0 0.1 S549R (A>C) 0 1.9 0 0.1 2184insA 0.3 0 0 0.1 3131del22 0.3 0 0 0.1 R709N 0 0 0.3 0.1 A349V 0 0 0.3 0.1 4015insA 0 0 0.3 0.1 Y849X 0 1.9 0 0.1 Cumulative 91.6 92.1 91.7 91.5 Unknown 8.4 7.9 8.3 8.5 Total 100,0 100,0 100,0 100,0 RE: restriction enzyme (-/+: abolition or introduction of a RE site); ASO: allele specific oligonucleotide Figure 2 Multiplex denaturing gradient gel electrophoretic analysis of exons 8, 5 and 18 of the cystic fibrosis transmembrane regulator gene in a cystic fibrosis patient (case n. Login to comment
85 Present study case (n) Mutation references* Haplotype (n. of repeats) Other studies case (n) W1282X 16 17-7-17 26 1, 2, 3 1259insA 11 16-33-13 852del22 11 16-33-13 4016insT 11 16-30-13 I502T 8 16-30-13 L1065P 4 16-30-13 2522insC 4 23-30-13 2789+5G>A 2 17-7-17 9 1, 2, 3 D1152H 2 16-7-13 2711delT 1 16-45-13 2 3 D110H 1 16-32-13 Y849X 1 16-30-13 * References: 1: Morral et al., 1996 2: Claustres et al., 1996 3: Hughes et al., 1996b peculiar to Sardinia, is absent in our population (Rendine et al. 1997). Login to comment
86 However, 12 mutations (4016insT, R1158X, 711+1G>T, L1065P, G1244E, 4382delA, 1259insA, I502T, 852del22, D579G, L1077P and G1349D) have not been found (or have a low incidence) in populations from the British Isles (Cheadle et al. 1993; Ferec et al. 1992), Spain (Chillon et al. 1994; Casals et al. Login to comment
89 Other mutations appear to have originated in southern Italy and their frequency has probably been amplified through consanguineous marriages; for instance, 852del22, L1065P and others were identified in homozygosity in several CF patients in whom the haplotypes for the three polymorphisms analyzed were also homozygous. Login to comment

PMID: 15880796 [PubMed] Kerem E et al: "Pharmacological induction of CFTR function in patients with cystic fibrosis: mutation-specific therapy."

No. Sentence Comment

58 C-D565G II DF508 D1507 S549R S549I S549N S549R S945D S945L H1054D G1061R L1065P R1066C R1066M L1077P H1085R N1303K G85E III G551D S492F V520F R553G R560T R560S Y569D IV R117H, R117C, R117P, R117L D1152H, L88S, G91R, E92K, Q98R, P205S, L206W, L227R, F311L, G314E, R334W, R334Q, I336K, T338I, L346P, R347C, R347H, R347L, R347P, L927P, R1070W, R1070Q V 3849 þ 10 kb C ! Login to comment

PMID: 16126774 [PubMed] Morea A et al: "Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility."

No. Sentence Comment

47 CFTR gene alterations were first scored by PCR and reverse dot blot (Chehab and Wall, 1992), targeted to the detection of the following mutations: ∆F508, G85E, 541∆C, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, 1078∆T, R347H, R352Q, ∆I507, 1609∆CA, E527G, 1717-1G→A, 1717-8G→A, G542X, R347P, S549N, S549R A→C, Q552X, R553X, A559T, D579G, Y577F, E585X, 1898+3A→G, 2183AA→G, R709X, 2789+5G→A, 3132∆TG, 3272-26A→G, L1077P, L1065P, R1070Q, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282R, W1282X, N1303K and 4016∇T. Login to comment

PMID: 16417523 [PubMed] Loo TW et al: "The chemical chaperone CFcor-325 repairs folding defects in the transmembrane domains of CFTR-processing mutants."

No. Sentence Comment

21 EXPERIMENTAL Construction and expression of mutants The cDNAs of wild-type and CL4 mutants (H1054D, G1061R, L1065P, R1066H, Q1071P, L1077P, H1085R and W1098R) were inserted into pcDNA3 vector (Invitrogen, Oakville, ON, Canada) as described previously [2]. Login to comment
51 Accordingly, HEK-293 cells were transfected with mutants H1054D, G1061R, L1065P, R1066H, Q1071P, L1077P, H1085R or W1098R cDNAs. Login to comment
62 Mutant L1065P was the only mutant that could not be rescued with CFcor-325 (Figure 2B). Login to comment

PMID: 18193900 [PubMed] Cheung JC et al: "Misfolding of the cystic fibrosis transmembrane conductance regulator and disease."

No. Sentence Comment

90 In some additional examples, a number of mutations found in the fourth intracellular loop (H1054D, G1061R, L1065P, R1066C/H/L, Q1071P, L1077P, H1085R, W1098R, M1101K/ R) also affect the biosynthetic processing of CFTR (although function was not tested) (73); some intracellular loop 4 mutants (F1052V, K1060T, A1067T, G1069R, R1070Q/W) can process CFTR to the complex-glycosylated ("Band C") form but have altered channel activity compared to wild type. Login to comment

PMID: 18305154 [PubMed] Serohijos AW et al: "Phenylalanine-508 mediates a cytoplasmic-membrane domain contact in the CFTR 3D structure crucial to assembly and channel function."

No. Sentence Comment

61 The wild-type peptide bound strongly, whereas the two mutations (L1065P and R1066C) that prevent conformational maturation (24) reduced this binding to control levels (Fig. 2B). Login to comment
73 CL4 peptide was nearly completely ablated by a folding mutation (L1065P) but only slightly diminished by one influencing channel function (G1069R). Login to comment
86 (A) Location of disease-associated mutations (L1065P, R1066C, and G1069R) at the NBD1/CL4 interface. Login to comment

PMID: 19897426 [PubMed] Picci L et al: "A 10-year large-scale cystic fibrosis carrier screening in the Italian population."

No. Sentence Comment

48 Forty-seven different CFTR mutations/gene alterations were chosen and analysed: ΔF508, G85E, 541delC, D110H, R117H, 621+1G→T, 711+5G→A, R334W, R334Q, T338I, R347H, R347P, R352Q, S466X, ΔI507, E527G, 1717-1G→A, 1717-8G→A, G542X, S549N, S549R A→C, G551D, Q552X, R553X, D579G, 1874insT, E585X, 1898+3A→G, 2183AA→G, 2184delA, R709X, 2789+5G→A, 3132delTG, 3199del6, 3272-26A→G, L1077P, L1065P, R1066H, M1101K, D1152H, R1158X, R1162X, 3849+10KbC→T, G1244E, W1282X, N1303K and 4016insT. Login to comment

PMID: 20233947 [PubMed] He L et al: "Restoration of domain folding and interdomain assembly by second-site suppressors of the DeltaF508 mutation in CFTR."

No. Sentence Comment

97 Therefore, we tested whether the suppressor mutations could also reverse the processing defects caused by disease-associated mutations (R1066C and L1065P; ref. 24) on the CL4 side of the NBD1/CL4 interface. Login to comment
98 Introduction of the 4S mutations into R1066C or the 3S mutations into L1065P did not promote CFTR maturation (Fig. 1B). Login to comment

PMID: 20657600 [PubMed] Giuliani R et al: "Identification of the second CFTR mutation in patients with congenital bilateral absence of vas deferens undergoing ART protocols."

No. Sentence Comment

58 INNO-LiPA CFTR19 INNO-LiPA CFTR17 INNO-LiPA CFTR Italian regional [delta]F508 621+1G>T 1259insA G542X 3849+10kbC>T 4016insT N1303K 2183AA>G 4382delA W1282X 394delTT 852del22 G551D 2789+5G> A R1162X D579G 1717-1G>A 3659delC G1244E R553X R117H G1349D CFTRdele2,3 (21 kb) R334W I502T [delta]I507 R347P L1065P 711+1G>T G85E R1158X 3272-26A>G 3905insT 1078delT T338I R560T A455E S549R(A>C) 1898+1G>A S1251N 2143delA 711+5G>A 991del5 I148T E60X D1152H 3199del6 3120+1G>A 2184delA 1898+3A>G, R1070Q Q552X Poli-T tract variations R1066H R347H 621+3A>G R334Q E217G Abbreviation: CFTR, cystic fibrosis transmembrane conductance regulator. Login to comment

PMID: 20837481 [PubMed] Pagant S et al: "Intragenic suppressing mutations correct the folding and intracellular traffic of misfolded mutants of Yor1p, a eukaryotic drug transporter."

No. Sentence Comment

84 We selected two mutations (G149R, located at the start of ICL1, and L1065P, located in ICL4 and predicted to participate directly in the NBD1-ICL4 interface) and introduced the equivalent mutations into Yor1p (Fig. 1A): Yor1p-G278R and Yor1p-I1084P, respectively. Login to comment

PMID: 21429822 [PubMed] Coiana A et al: "Preconceptional identification of cystic fibrosis carriers in the Sardinian population: A pilot screening program."

No. Sentence Comment

88 Mutation nomenclaturea Alleles (%) T338I (p.Thr338Ile) 26 (65.0) F508del (p.Phe508del) 9 (22.5) N1303K (p.Asn1303Lys) 1 (2.5) 2183AANG (c.2051_2052delAAinsG) 1 (2.5) 621+1GNT (c.489+1GNT) 1 (2.5) exon 2 del (c.54-5811_164+2187del8108ins182) 1 (2.5) R347P (p.Arg347Pro) 1 (2.5) The 3849+10kbCNT (c.3717+12191CNT), G85E (p.Gly85Glu), 2789+5GNA (c.2657+5GNA), W1282X (p.Trp1282X), G1244E (p.Gly1244Glu), 711+5GNA (c.579+5GNA), 711+1GNT (c.579+1GNA), 4016insT (p.Ser1297PhefsX5), G542X (p.Gly542X), 1717-1GNA (c.1585-1GNA), R553X (p.Arg553X), Q552X (p.Gln552X), G551D (p.Gly551Asp), S549R (ANC) (p.Ser549Arg), I507del (p.Ile507del), F508C (p.Phe508Cys), I502T (p.Ile502Thr), 1706del17 (p.Gln525LeufsX37), 1677delTA (p.Tyr515X), R117H (p.Arg117His), D1152H (p.Asp1152His), L1065P (p.Leu1065Pro), R1066H (p.Arg1066His), L1077P (p.Leu1077Pro), 4382delA (p.Glu1418ArgfsX14), R1162X (p.Arg1162X), R1158X (p.Arg1158X), 1259 insA (p.Gln378AlafsX4), 852del22 (p.Gly241GlufsX13), S912X (p.Ser912X), and 991del5bp (p.Asn287LysfsX19) mutations included in the CF panel were not detected in the population tested. Login to comment

PMID: 21182301 [PubMed] Loo TW et al: "The W232R suppressor mutation promotes maturation of a truncation mutant lacking both nucleotide-binding domains and restores interdomain assembly and activity of P-glycoprotein processing mutants."

No. Sentence Comment

122 In a recent study of four of the CFTR suppressor mutations located in NBD1 (I539T, G550E, R553M, and R555K), it was found that they only restored maturation of mutants that had processing mutations in NBD1 but not those that had processing mutations in other domains such as NBD2 (N1303K) or TMD2 (L1065P or R1066C) (66). Login to comment

PMID: 22439061 [PubMed] Mesoraca A et al: "The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis."

No. Sentence Comment

80 Through the use of DHPLC, all the exonic regions of the CFTR gene were analysed and through the technique 44 of the 53 couples were found to be negative, while for 9 couples, 9 rare mutations were identified which were not revealed in I level screening: R1066C, L1065P, L1077P (exon 17b), A1006E (exon 19), R75Q (exon 3), D537E (exon 11), W1134X (exon 18), R1145X (exon 18), C524X (exon 11). Login to comment
100 48 Journal of Prenatal Medicine 2010; 4 (3): 45-50 Table III Mutations found with II level screening through DHPLC Mutations of mutated alleles DF508 29 W1282X 3 N1303K 8 1717-1G®A 2 3659delC 1 G85E 1 2789 +5G®A 2 R553X 2 R1162X 1 R117H 1 G542X 3 Total 53Table I Mutations found through I level screeningMutations analysed with I level screening through OLA CFTR Mutations Position on the CFTR gene DF508 Exon 10 3849+10KbC®T Intron 19 R334W Exon 7 W1282X Exon 10 V520F Exon 10 3905insT Exon 20 N1303K Exon 21 3876delA Exon 20 1717-1G®A Exon 11 3659delC Exon 19 DI507 Exon 10 A455E Exon 9 G85E Exon 3 2789 +5G®A Exon 14 / Intron 14 2183AA®G Exon 13 1898+1G®A Exon 12 / Intron 12 R347P Exon 7 R347H Exon 7 R560T Exon 11 1078delT Exon 7 R553X Exon 11 711+1G®T Exon 5 / Intron 5 G551D Exon 11 R1162X Exon 19 S549R Exon 11 R117H Exon 4 S549N Exon 11 621+1G®T Exon 4 G542X Exon 11 394delTT Exon 3 3120+1G®ðA Exon 16/ Intron 16 2184delA Exon 13 Table II Mutations found through I level screening Mutations Positions on CFTR gene R1066C Exon 17 b L1065P Exon 17 b A1006E Exon 19 R75Q Exon 3 D537E Exon 11 W1134X Exon 18 W1145X Exon 18 L1077P Exon 17b C524X Exon 11 Total 9 The use of DHPLC (Denaturing High Performance Liquid Chromatography) in II level screening of the CFTR gene in Prenatal Diagnosis Journal of Prenatal Medicine 2010; 4 (3): 45-50 49 tion was to provide the couple with adequate counselling in order to better understand the genotype-phenotype correlation in the various associations of mutations. Login to comment

PMID: 10923036 [PubMed] Claustres M et al: "Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France."

No. Sentence Comment

107 f 306insA, W79X, R117C, P205S, L227R, I336K, 1248+1G>A, 1609delCA, 1717-8G>A, S549R(T>G), S549N, 1812-1G>A, P574H, 2176insC, R709X, E827X, D836Y, 3007delG, L1065P, L1077P, H1085R, M1101K, 4021insT. Login to comment

PMID: 8702904 [PubMed] Cotten JF et al: "Effect of cystic fibrosis-associated mutations in the fourth intracellular loop of cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

81 For example, levels of mature F1052V were similar to wild-type, whereas L1065P, R1070Q, and H1085R were similar to ⌬F508 in that they produced little mature protein (Fig. 2, A and B). Login to comment
80 For example, levels of mature F1052V were similar to wild-type, whereas L1065P, R1070Q, and H1085R were similar to DF508 in that they produced little mature protein (Fig. 2, A and B). Login to comment

PMID: 8662892 [PubMed] Seibert FS et al: "Disease-associated mutations in the fourth cytoplasmic loop of cystic fibrosis transmembrane conductance regulator compromise biosynthetic processing and chloride channel activity."

No. Sentence Comment

129 C: छ, WT; छϩ, R1066C; E, H1054D; µ, L1065P; Ⅺ, control; Ç, G1061R, Q, R1066H; É, R1066L. Login to comment
135 C: L, WT; L 1, R1066C; E, H1054D; &#b5;, L1065P; M, control; &#c7;, G1061R, Q, R1066H; &#c9;, R1066L. Login to comment

PMID: 7551394 [PubMed] Friedman KJ et al: "Screening Young syndrome patients for CFTR mutations."

No. Sentence Comment

78 Of the 13 Young syndrome patients, we identified one (Patient 5) who was het- CBAVD Dl152H D1270N G576A* R75Q* P67L Rl17H 3849 + 10 KB C > T G551S Rl17H Pancreatic Sufficient, Moderate Pulmonary Symptoms, Normal Sweat Chloride Concentrations Pancreatic Sufficient, Moderate Pulmonary Symptoms R347P 2789 + 5 G > A R334W G85E R347H R347L Rl17H G91R A455E S945L Y563N Q1291H R297Q R352Q L1065P 3850-3 T > G F1286S 3849 + 10 KB C > T TABLE 1 CFTR MUTATION SCREENING PANEL Severe M508 G551D R553X N1303K W1282X G542X 1717-1 G > A ~1507 R560T 3659deiC 621 + 1 G > T S549N TABLE 2 CLINICAL FEATURES OF YOUNG SYNDROME PATIENTS Patient Age Sweat CI- FEV, Paranasal Sputum No. Login to comment

PMID: 10876009 [PubMed] Castaldo G et al: "Prenatal diagnosis of cystic fibrosis: a case of twin pregnancy diagnosis and a review of 5 years' experience."

No. Sentence Comment

67 G, L1065P, 711 1 1G . Login to comment

PMID: 16635477 [PubMed] Lucarelli M et al: "A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene."

No. Sentence Comment

139 In this work, we found a limited subset of 13 mutations (not included in the PCR/OLA/SCS assay) in 7 CFTR exons, significantly improving the sensitivity of standard assays: D110H, R117C, and H139R (exon 4); R334L, T338I, and A349V (exon 7); S549R(A->C) (exon 11); Y849X (exon 14a); L997F (exon 17a); L1065P, R1066C, and L1077P (exon 17b); and G1244E (exon 20). Login to comment

PMID: 22973227 [PubMed] Patrick AE et al: "Development of CFTR Structure."

No. Sentence Comment

155 For instance, in the NBD-ICL4 interface, mutants in ICL4 including L1065P, R1066C, and A1067T alter trafficking and chloride channel function (Cotten et al., 1996; Seibert et al., 1996). Login to comment

PMID: 23055971 [PubMed] Molinski S et al: "Functional Rescue of F508del-CFTR Using Small Molecule Correctors."

No. Sentence Comment

53 Disease-causing mutations in the coupling helix of ICL4 that cause ER retention have been described (L1065P, R1066C, and G1069R), supporting the idea that this region mediates important interactions during folding (Mendoza et al., 2012). Login to comment

PMID: 23613805 [PubMed] Schippa S et al: "Cystic fibrosis transmembrane conductance regulator (CFTR) allelic variants relate to shifts in faecal microbiota of cystic fibrosis patients."

No. Sentence Comment

37 Patient Sex Age (years) CFTR allele, = CFTR allele, R Criterion I(a) Criterion II (1 = severe, 0 = mild)(b) Pancreatic status(d) FEV1% BMI 1 M 17 F508del M1V 2 (1) 1 65 17.91 2 F 23 F508del Y569D 2 (1) 0 97 18.66 3 (s1)(c) F 20 P1013L F508del 2 (0) 0 87 18.67 4 M 11 F508del L997F (without R117L) 2 0 0 110 21.33 5 (s1)(c) M 11 P1013L F508del 2 (0) 0 100 23.14 6 M 8 R553X F508del 2 1 0 80 15.87 7 M 3 F508del unknown 2 (0) 0 nd nd 8 F 33 F508del F508del 1 1 1 73 18.61 9 M 10 F508del L1077P 2 1 0 94 19.79 10 M 9 F508del G542X 2 1 1 100 16.00 11 F 9 4167delCTAAGCC L1065P 3 nd 1 76 14.57 12 F 14 R117C (without (TG)12T5) F508del 2 0 0 94 18.44 13 F 11 F508del 991del5 2 1 1 109 17.80 14 M 42 (TG)12T5 F508del 2 0 0 106 23.78 15 (s2)(c) M 9 F508del F508del 1 1 1 82 15.45 16 M 10 F508del R347P 2 (0) 0 89 15.91 17 (s2)(c) F 6 F508del F508del 1 1 1 110 15.20 18 (s3)(c) M 39 2789+5G.A N1303K 3 nd 0 105 19.33 19 (s3)(c) F 41 2789+5G.A N1303K 3 nd 0 80 19.47 20 F 26 N1303K W1282X 3 nd 1 90 19.57 21 M 7 CFTRdele2,3 (21 kb) N1303K 3 nd 1 107 12.85 22 F 9 F508del L997F (without R117L) 2 0 0 113 25.21 23 M 7 P5L W1282X 3 nd 0 89 22.31 24 M 9 2789+5G.A F508del 2 (1) 1 97 15.60 25 F 2 F508del F508del 1 1 1 nd nd 26 F 32 N1303K N1303K 3 nd 1 107 21.22 27 M 14 L1065R T338I 3 nd 0 116 21.50 28 M 12 711+3A.G S549R(A.C) 3 nd 0 97 20.00 29 M 13 unknown R117H (without (TG)12T5) 3 nd 0 104 19.36 30 M 14 F508del G542X 2 1 1 84 21.87 31 F 13 F508del F508del 1 1 1 85 18.00 32 F 41 2789+5G.A N1303K 3 nd 1 84 21.08 33 F 21 L1065P F508del 2 (0) 0 62 18.29 34 F 50 D1152H F508del 2 (0) 0 63 23.74 35 M 29 F508del 2790-2A.G 2 (1) 0 92 24.46 36 F 45 unknown W1282X 3 nd 0 69 23.42 a (Hm = 1; Ht = 2; N = 3). Login to comment
62 Class I, II or III: G542X, W1282X, F508del, N1303K, L1065P, L1077P, Y569D, S549R(A.C). Login to comment

PMID: 23891399 [PubMed] Van Goor F et al: "Effect of ivacaftor on CFTR forms with missense mutations associated with defects in protein processing or function."

No. Sentence Comment

44 None M1V A46D E56K P67L R74W G85E E92K D110E D110H R117C R117H E193K L206W R334W I336K T338I S341P R347H R347P R352Q A455E L467P S492F F508del V520F A559T R560S R560T A561E Y569D D579G R668C L927P S945L S977F L997F F1052V H1054D K1060T L1065P R1066C R1066H R1066M A1067T R1070Q R1070W F1074L L1077P H1085R M1101K D1152H S1235R D1270N N1303K 0 100 200 300 400 500 600 * * * CFTR Mutation mRNA (% Normal CFTR) Fig. 1. Login to comment
64 Mutant CFTR form CFTR processing Mature/total % Normal CFTR Normal 0.89 &#b1; 0.01 100.0 &#b1; 18.5 G85E -0.05 &#b1; 0.04 -1.0 &#b1; 0.9 R560S 0.00 &#b1; 0.00 0.0 &#b1; 0.0 R1066C 0.02 &#b1; 0.01 0.0 &#b1; 0.0 S492F 0.00 &#b1; 0.00 0.1 &#b1; 0.1 R560T 0.01 &#b1; 0.01 0.2 &#b1; 0.1 V520F 0.05 &#b1; 0.03 0.3 &#b1; 0.2 M1101K 0.05 &#b1; 0.03 0.3 &#b1; 0.1 A561E 0.08 &#b1; 0.04 0.5 &#b1; 0.2 R1066M 0.02 &#b1; 0.02 0.5 &#b1; 0.4 N1303K 0.02 &#b1; 0.02 0.5 &#b1; 0.3 A559T 0.16 &#b1; 0.09 0.6 &#b1; 0.2 M1V 0.06 &#b1; 0.06 0.7 &#b1; 0.6 Y569D 0.11 &#b1; 0.04 0.6 &#b1; 0.2 R1066H 0.08 &#b1; 0.02a 0.7 &#b1; 0.2a L1065P 0.05 &#b1; 0.05 1.0 &#b1; 0.8 L467P 0.10 &#b1; 0.07 1.2 &#b1; 0.8 L1077P 0.08 &#b1; 0.04 1.5 &#b1; 0.6 A46D 0.21 &#b1; 0.08 1.9 &#b1; 0.5a E92K 0.06 &#b1; 0.05 1.9 &#b1; 1.3 H1054D 0.09 &#b1; 0.04 1.9 &#b1; 0.8 F508del 0.09 &#b1; 0.02a 2.3 &#b1; 0.5a H1085R 0.06 &#b1; 0.01a 3.0 &#b1; 0.7a I336K 0.42 &#b1; 0.05a 6.5 &#b1; 0.7a L206W 0.35 &#b1; 0.10a 6.8 &#b1; 1.7a F1074L 0.52 &#b1; 0.03a 10.9 &#b1; 0.6a A455E 0.26 &#b1; 0.10a 11.5 &#b1; 2.5a E56K 0.29 &#b1; 0.04a 12.2 &#b1; 1.5a R347P 0.48 &#b1; 0.04a 14.6 &#b1; 1.8a R1070W 0.61 &#b1; 0.04a 16.3 &#b1; 0.6a P67L 0.36 &#b1; 0.04a 28.4 &#b1; 6.8a R1070Q 0.90 &#b1; 0.01a 29.5 &#b1; 1.4a S977F 0.97 &#b1; 0.01a 37.3 &#b1; 2.4a A1067T 0.78 &#b1; 0.03a 38.6 &#b1; 6.1a D579G 0.72 &#b1; 0.02a 39.3 &#b1; 3.1a D1270N 1.00 &#b1; 0.00a,c 40.7 &#b1; 1.2a S945L 0.65 &#b1; 0.04a 42.4 &#b1; 8.9a L927P 0.89 &#b1; 0.01a,b 43.5 &#b1; 2.5a,b R117C 0.87 &#b1; 0.02a,b 49.1 &#b1; 2.9a,b T338I 0.93 &#b1; 0.03a,b 54.2 &#b1; 3.7a,b L997F 0.90 &#b1; 0.04a,b 59.8 &#b1; 10.4a,b D110H 0.97 &#b1; 0.01a,b 60.6 &#b1; 1.5a,b S341P 0.79 &#b1; 0.02a 65.0 &#b1; 4.9a,b R668C 0.94 &#b1; 0.03a,b 68.5 &#b1; 1.9a,b R74W 0.78 &#b1; 0.01a 69.0 &#b1; 2.7a,b D110E 0.92 &#b1; 0.05a,b 87.5 &#b1; 9.5a,b R334W 0.91 &#b1; 0.05a,b 97.6 &#b1; 10.0a,b K1060T 0.87 &#b1; 0.02a,b 109.9 &#b1; 28.0a,b R347H 0.96 &#b1; 0.02a,c 120.7 &#b1; 2.8a,b S1235R 0.96 &#b1; 0.00a,c 139.0 &#b1; 9.0a,b E193K 0.84 &#b1; 0.02a,b 143.0 &#b1; 17.1a,b R117H 0.86 &#b1; 0.01a,b 164.5 &#b1; 34.2a,b R352Q 0.98 &#b1; 0.01a,b 179.9 &#b1; 8.0a,c F1052V 0.90 &#b1; 0.01a,b 189.9 &#b1; 33.1a,b D1152H 0.96 &#b1; 0.02a,c 312.0 &#b1; 45.5a,b Notes to Table 1: Quantification of steady-state CFTR maturation expressed as the mean (&#b1;SEM; n = 5-9) ratio of mature CFTR to total CFTR (immature plus mature) or level of mature mutant CFTR relative to mature normal-CFTR (% normal CFTR) in FRT cells individually expressing CFTR mutations. Login to comment
74 Because the level of CFTR mRNA was similar across the panel of cell lines tested, the range in baseline activity and ivacaftor response likely reflects the severity of the functional defect and/or the 0 50 100 150 200 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L E56K P67L R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V Baseline With ivacaftor * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Chloride transport (% Normal) Mutant CFTR form 0 100 200 300 400 S341P R347P L467P S492F A559T A561E Y569D L1065P R1066C R1066M L1077P M1101K N1303K R560S L927P R560T H1085R V520F E92K M1V F508del H1054D I336K A46D G85E R334W T338I R1066H R352Q R117C L206W R347H S977F S945L A455E F1074L P67L E56K R1070W D110H D579G D110E R1070Q L997F A1067T E193K R117H R74W K1060T R668C D1270N D1152H S1235R F1052V * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * * Mature CFTR (% Normal) Mutant CFTR form A B Fig. 2. Login to comment
82 Mutation Patientsa Chloride transport (bc;A/cm2 ) Chloride transport (% normal) EC50 Baseline With ivacaftor Baseline With ivacaftor Fold increase over baselineb Normal 204.5 &#b1; 33.3 301.3 &#b1; 33.8c 100.0 &#b1; 16.3 147.3 &#b1; 16.5c 1.5 266 &#b1; 42 G551D 1282 1.5 &#b1; 0.7 113.2 &#b1; 13.0c 1.0 &#b1; 0.5 55.3 &#b1; 6.3c 55.3 312 &#b1; 73 F1052V 12 177.3 &#b1; 13.7 410.2 &#b1; 11.3c 86.7 &#b1; 6.7 200.7 &#b1; 5.6c 2.3 177 &#b1; 14 S1235R ND 160.6 &#b1; 25.7 352.1 &#b1; 43.4c 78.5 &#b1; 12.6 172.2 &#b1; 21.2c 2.2 282 &#b1; 104 D1152H 185 117.3 &#b1; 23.0 282.7 &#b1; 46.9c 57.4 &#b1; 11.2 138.2 &#b1; 22.9c 2.4 178 &#b1; 67 D1270N 32 109.5 &#b1; 20.5 209.5 &#b1; 27.4c 53.6 &#b1; 10.0 102.4 &#b1; 13.4c 1.9 254 &#b1; 56 R668C 45 99.0 &#b1; 9.4 217.6 &#b1; 11.7c 48.4 &#b1; 4.6 106.4 &#b1; 5.7c 2.2 517 &#b1; 105 K1060T ND 89.0 &#b1; 9.8 236.4 &#b1; 20.3c 43.5 &#b1; 4.8 115.6 &#b1; 9.9c 2.7 131 &#b1; 73 R74W 25 86.8 &#b1; 26.9 199.1 &#b1; 16.8c 42.5 &#b1; 13.2 97.3 &#b1; 8.2c 2.3 162 &#b1; 17 R117H 739 67.2 &#b1; 13.3 274.1 &#b1; 32.2c 32.9 &#b1; 6.5 134.0 &#b1; 15.7c 4.1 151 &#b1; 14 E193K ND 62.2 &#b1; 9.8 379.1 &#b1; 1.1c 30.4 &#b1; 4.8 185.4 &#b1; 1.0c 6.1 240 &#b1; 20 A1067T ND 55.9 &#b1; 3.2 164.0 &#b1; 9.7c 27.3 &#b1; 1.6 80.2 &#b1; 4.7c 2.9 317 &#b1; 214 L997F 27 43.7 &#b1; 3.2 145.5 &#b1; 4.0c 21.4 &#b1; 1.6 71.2 &#b1; 2.0c 3.3 162 &#b1; 12 R1070Q 15 42.0 &#b1; 0.8 67.3 &#b1; 2.9c 20.6 &#b1; 0.4 32.9 &#b1; 1.4c 1.6 164 &#b1; 20 D110E ND 23.3 &#b1; 4.7 96.4 &#b1; 15.6c 11.4 &#b1; 2.3 47.1 &#b1; 7.6c 4.1 213 &#b1; 51 D579G 21 21.5 &#b1; 4.1 192.0 &#b1; 18.5c 10.5 &#b1; 2.0 93.9 &#b1; 9.0c 8.9 239 &#b1; 48 D110H 30 18.5 &#b1; 2.2 116.7 &#b1; 11.3c 9.1 &#b1; 1.1 57.1 &#b1; 5.5c 6.2 249 &#b1; 59 R1070W 13 16.6 &#b1; 2.6 102.1 &#b1; 3.1c 8.1 &#b1; 1.3 49.9 &#b1; 1.5c 6.2 158 &#b1; 48 P67L 53 16.0 &#b1; 6.7 88.7 &#b1; 15.7c 7.8 &#b1; 3.3 43.4 &#b1; 7.7c 5.6 195 &#b1; 40 E56K ND 15.8 &#b1; 3.1 63.6 &#b1; 4.4c 7.7 &#b1; 1.5 31.1 &#b1; 2.2c 4.0 123 &#b1; 33 F1074L ND 14.0 &#b1; 3.4 43.5 &#b1; 5.4c 6.9 &#b1; 1.6 21.3 &#b1; 2.6c 3.1 141 &#b1; 19 A455E 120 12.9 &#b1; 2.6 36.4 &#b1; 2.5c 6.3 &#b1; 1.2 17.8 &#b1; 1.2c 2.8 170 &#b1; 44 S945L 63 12.3 &#b1; 3.9 154.9 &#b1; 47.6c 6.0 &#b1; 1.9 75.8 &#b1; 23.3c 12.6 181 &#b1; 36 S977F 9 11.3 &#b1; 6.2 42.5 &#b1; 19.1c 5.5 &#b1; 3.0 20.8 &#b1; 9.3c 3.8 283 &#b1; 36 R347H 65 10.9 &#b1; 3.3 106.3 &#b1; 7.6c 5.3 &#b1; 1.6 52.0 &#b1; 3.7c 9.8 280 &#b1; 35 L206W 81 10.3 &#b1; 1.7 36.4 &#b1; 2.8c 5.0 &#b1; 0.8 17.8 &#b1; 1.4c 3.6 101 &#b1; 13 R117C 61 5.8 &#b1; 1.5 33.7 &#b1; 7.8c 2.9 &#b1; 0.7 16.5 &#b1; 3.8c 5.7 380 &#b1; 136 R352Q 46 5.5 &#b1; 1.0 84.5 &#b1; 7.8c 2.7 &#b1; 0.5 41.3 &#b1; 3.8c 15.2 287 &#b1; 75 R1066H 29 3.0 &#b1; 0.3 8.0 &#b1; 0.8c 1.5 &#b1; 0.1 3.9 &#b1; 0.4c 2.6 390 &#b1; 179 T338I 54 2.9 &#b1; 0.8 16.1 &#b1; 2.4c 1.4 &#b1; 0.4 7.9 &#b1; 1.2c 5.6 334 &#b1; 38 R334W 150 2.6 &#b1; 0.5 10.0 &#b1; 1.4c 1.3 &#b1; 0.2 4.9 &#b1; 0.7c 3.8 259 &#b1; 103 G85E 262 1.6 &#b1; 1.0 1.5 &#b1; 1.2 0.8 &#b1; 0.5 0.7 &#b1; 0.6 NS NS A46D ND 2.0 &#b1; 0.6 1.1 &#b1; 1.1 1.0 &#b1; 0.3 0.5 &#b1; 0.6 NS NS I336K 29 1.8 &#b1; 0.2 7.4 &#b1; 0.1c 0.9 &#b1; 0.1 3.6 &#b1; 0.1c 4 735 &#b1; 204 H1054D ND 1.7 &#b1; 0.3 8.7 &#b1; 0.3c 0.8 &#b1; 0.1 4.2 &#b1; 0.1c 5.3 187 &#b1; 20 F508del 29,018 0.8 &#b1; 0.6 12.1 &#b1; 1.7c 0.4 &#b1; 0.3 5.9 &#b1; 0.8c 14.8 129 &#b1; 38 M1V 9 0.7 &#b1; 1.4 6.5 &#b1; 1.9c 0.4 &#b1; 0.7 3.2 &#b1; 0.9c 8.0 183 &#b1; 85 E92K 14 0.6 &#b1; 0.2 4.3 &#b1; 0.8c 0.3 &#b1; 0.1 2.1 &#b1; 0.4c 7.0 198 &#b1; 46 V520F 58 0.4 &#b1; 0.2 0.5 &#b1; 0.2 0.2 &#b1; 0.1 0.2 &#b1; 0.1 NS NS H1085R ND 0.3 &#b1; 0.2 2.1 &#b1; 0.4 0.2 &#b1; 0.1 1.0 &#b1; 0.2 NS NS R560T 180 0.3 &#b1; 0.3 0.5 &#b1; 0.5 0.1 &#b1; 0.1 0.2 &#b1; 0.2 NS NS L927P 15 0.2 &#b1; 0.1 10.7 &#b1; 1.7c 0.1 &#b1; 0.1 5.2 &#b1; 0.8c 52.0 313 &#b1; 66 R560S ND 0.0 &#b1; 0.1 -0.2 &#b1; 0.2 0.0 &#b1; 0.0 -0.1 &#b1; 0.1 NS NS N1303K 1161 0.0 &#b1; 0.0 1.7 &#b1; 0.3 0.0 &#b1; 0.0 0.8 &#b1; 0.2 NS NS M1101K 79 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1077P 42 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066M ND 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R1066C 100 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS L1065P 25 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS Y569D 9 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS A561E ND 0.0 &#b1; 0.1 0.0 &#b1; 0.1 0.0 &#b1; 0.0 0.0 &#b1; 0.1 NS NS A559T 43 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S492F 16 0.0 &#b1; 0.0 1.7 &#b1; 1.2 0.0 &#b1; 0.0 0.8 &#b1; 0.6 NS NS L467P 16 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS R347P 214 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 0.0 &#b1; 0.0 NS NS S341P 9 0.0 &#b1; 0.0 0.2 &#b1; 0.2 0.0 &#b1; 0.0 0.1 &#b1; 0.1 NS NS a Number of individuals with the individual mutation in the CFTR-2 database (www.CFTR2.org). Login to comment

PMID: 24513531 [PubMed] Moran O et al: "On the structural organization of the intracellular domains of CFTR."

No. Sentence Comment

1378 Two mutations in ICL4, L1065P and R1066C, prevent correct CFTR maturation (Seibert et al., 1996; Cotten et al., 1996). Login to comment

PMID: 25033378 [PubMed] LaRusch J et al: "Mechanisms of CFTR functional variants that impair regulated bicarbonate permeation and increase risk for pancreatitis but not for cystic fibrosis."

No. Sentence Comment

269 67 SNPs (125GtoC, 1716G.A, 1717-1G.A, 1898+1G.A, 2183AA.G, 2184delA, 2789+5G.A, 3120+1G.A, 3659delC, 3849+10kbC.T, 621+ 1G.T, 711+5G.A, A455E, D110H, D1152H, D1270N, D443Y, D579G, F1052V, F1074L, F508C, F508del, G1069R, G1244E, G1349D, G178R, G542X, G551D, G551S, I1131L/V, I148T, I336K/T, I507del, I807M, IVS8T5, K1180T, L1065P, L967S, L997F, M1V, M470V, M952I, M952T, N1303K, P67L, Q1463Q, R1070Q, R1162X, R117C, R117H, R170H, R258G, R297Q, R31C, R352Q, R553X, R668C, R74W, R75Q, S1235R, S1255P, S485R, S977F, T338I, T854T, V201M, W1282X) were multiplexed into 6 wells; 14 SNPs (S492F, S945L, R74Q, R560T, R1162L, G85E, I1027T, R334W, R347P, G576A, 711+1G.T, 1001+11C.T, P1290P, 3199del6) were ascertained separately via TaqMan Gene Expression Assays, with repeat confirmation of all positive results. Login to comment

PMID: 25287046 [PubMed] Mornon JP et al: "Full-open and closed CFTR channels, with lateral tunnels from the cytoplasm and an alternative position of the F508 region, as revealed by molecular dynamics."

No. Sentence Comment

357 Moreover, a large ''hot spot`` region for natural CFTR mutations is located at the NBD1:ICL4 interface, involving (1) six ICL4 positions (H1054D, G1061R, L1065P, R1066H/R1066C, F1074L, and L1077P), which line the path followed by F508 during the MD1 conformational transition from its initial to its final position, and (2) seven positions in NBD1 (S492F, I507del, F508del, V520F, A559T, R560K/R560T, and A561E) (Fig. 7c). Login to comment

PMID: 25304080 [PubMed] Dell'Edera D et al: "Analysis of cystic fibrosis gene mutations in children with cystic fibrosis and in 964 infertile couples within the region of Basilicata, Italy: a research study."

No. Sentence Comment

59 As mentioned before, molecular screening Table 2 Comparison between the results obtained in this study and those obtained in a previous study Castaldo et al. [14] Mutations observed in the present study F508del 55.8% (29) 48.62% (141) N1303K 3.8% (2) 9.31% (27) G542X 3.8% (2) 8.96% (26) W1282X 3.8% (2) 1.03% (3) 2183AA>G 5.8% (3) 2.76% (8) R1162X 0 0 1717-1G>A 1.9% (1) 0 T338I 0 0 R347P 0 0.69% (2) 711+5G>A 0 0 852del22 5.8% (3) 1.03% (3) 4382delA 0 0.69% (2) 1259insA 0 0.34% (1) 4016insT 0 0.34% (1) R553X 0 0.34% (1) R1158X 0 0 L1077P 0 1.03% (3) I502T 0 0 3849+10kbC>T 1.9% (1) 0.34% (1) D579G 0 0.69% (2) G1244E 3.8% (2) 0 G1349D 0 0.34% (1) 2789+5G>A 0 1.03% (3) 711+1G>T 0 0 L1065P 0 0 2522insC 0 0 E585X 0 0 G85E 0 0 G178R 0 0 D1152H 0 3.10% (9) I148T-3195del6 0 0 I148T (alone) 0 4.48% (13) R334W 0 0 DI507 0 0.69% (2) I1005R 0 0 3272-26A>G 0 0 2711delT 0 0 L558S 1.9% (1) 0.34% (1) W1063X 0 0 D110H 0 0 S549R (A>C) 1.9% (1) 0.69% (2) 2184insA 0 0 3131del22 0 0 Table 2 Comparison between the results obtained in this study and those obtained in a previous study (Continued) R709N 0 0 A349V 0 0 4015insA 0 0 Y849X 1.9% (1) 0.34% (1) G551D 0 1.03% (3) 621+3A>G 0 0.34% (1) E831X 0 0 I507del 0 0.69% (2) IVS8 TG12/t5 0 1.03% (3) H139R (A->G) 0 0.34% (1) 1248+1G>A 0 0.34% (1) R74W;V201M;D1270N 0 0.69% (2) S1455X 0 0.34% (1) dele 2,3 (21kb) 0 0.34% (1) 991del5 0 0.34% (1) UNKNOWN 7 %(4) 4.83% (14) F508C 0 0.69% (2) TOTAL 52 290 of CF is highly recommended in the USA by the National Institutes of Health Consensus Development Conference Statement on genetic testing for cystic fibrosis [17]. Login to comment
79 The test has a sensitivity and a specificity of more than Table 3 List of 60 mutations in the cystic fibrosis transmembrane regulator gene (specificity 100%) F508del I507del F508C 621+1G>T D110H E585X G1349D I502T 1706del17 1677delTA R117H H139R 1898+1G>A 4015delA G542X 1717-1G>A Q552X 852del22 G178R 1898+3A>G G551D S549R(A>C) 2183AA>G T338I 991del5 1898+5G>T N1303K 4016insT 3849+10kb C>T R347P R334W 2184insA G85E 711+5G>A 711+1G>T 1259insA R347H 2522insC 2789+5G>A W1282X G1244E R1066H R352Q 3120+1G>A I148T 3199del6 S912X R1158X 1717-8G>A R1066C R1162X 4382delA D1152H L1077P D579G 3272-26A>G L1065P R553X PoliT: 5T, 7T, 9T 1874insT 3659delC 99%. Login to comment

PMID: 25583415 [PubMed] Terlizzi V et al: "Clinical expression of patients with the D1152H CFTR mutation."

No. Sentence Comment

85 Legacy name Protein name CDNA name Patients Homozygous for the D1152Ha D1152H p.Asp1152His c.3454GNC 7 Compound heterozygous for class I-II-III mutationsa : 74 F508del p.Phe508del c.1521_1523delCTT 43 G542X p.Gly542X c.1624GNT 7 N1303K p.Asn1303Lys c.3909CNG 4 1717-1GNA No protein name c.1585-1GNA 4 R1158X p.Arg1158X c.3472CNT 4 2183AANG p.Lys684SerfsX38 c.2051_2052delAAinsG 2 W1282X p.Trp1282X c.3846GNA 2 711 + 1GNT No protein name c.579 + 1GNT 1 Y849X p.Tyr849X c.2547CNA 1 L1065P p.Leu1065Pro c.3194 TNC 1 4016insT p.Ser1297PhefsX5 c.3884_3885insT 1 R1066H p.Arg1066His c.3197GNA 2 R1066C p.Arg1066Cys c.3196CNT 1 4382delA p.Glu1418ArgfsX14 c.4251delA 1 Compound heterozygous for class IV-V mutationsa : 8 (TG)12T5 No protein name Not available 2 2789 + 5GNA No protein name c.2657 + 5GNA 1 D579G p.Asp579Gly c.1736ANG 1 [R74W;V201M; D1270N] No protein name Not available 1 3849 + 10KbCNT No protein name c.3717 + 12191CNT 1 R347H p.Arg347His c.1040GNA 1 R347P p.Arg347Pro c.1040GNC 1 a Protein name and cDNA name from the CFTR2 database (http://www.http. com//www.cftr2) and http://www.genet.sickkids.on.ca/Home.html. Login to comment

PMID: 25674778 [PubMed] Baker MW et al: "Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study."

No. Sentence Comment

15 Correspondence: Mei W. Baker (mwbaker@wisc.edu) Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study Mei W. Baker, MD1,2 , Anne E. Atkins, MPH2 , Suzanne K. Cordovado, PhD3 , Miyono Hendrix, MS3 , Marie C. Earley, PhD3 and Philip M. Farrell, MD, PhD1,4 Table 1ߒ CF-causing or varying consequences mutations in the MiSeqDx IUO Cystic Fibrosis System c.1521_1523delCTT (F508del) c.2875delG (3007delG) c.54-5940_273ߙ+ߙ10250del21kb (CFTRdele2,3) c.3909C>G (N1303K) c.3752G>A (S1251N) Mutations that cause CF when combined with another CF-causing mutation c.1624G>T (G542X) c.2988ߙ+ߙ1G>A (3120ߙ+ߙ1G->A) c.3964-78_4242ߙ+ߙ577del (CFTRdele22,23) c.613C>T (P205S) c.1021T>C (S341P) c.948delT (1078delT) c.2988G>A (3120G->A) c.328G>C (D110H) c.200C>T (P67L) c.1397C>A (S466X(C>A)) c.1022_1023insTC (1154insTC) c.2989-1G>A (3121-1G->A) c.3310G>T (E1104X) c.3937C>T (Q1313X) c.1397C>G (S466X(C>G)) c.1081delT (1213delT) c.3140-26A>G (3272-26A->G) c.1753G>T (E585X) c.658C>T (Q220X) c.1466C>A (S489X) c.1116ߙ+ߙ1G>A (1248ߙ+ߙ1G->A) c.3528delC (3659delC) c.178G>T (E60X) c.115C>T (Q39X) c.1475C>T (S492F) c.1127_1128insA (1259insA) c.3659delC (3791delC) c.2464G>T (E822X) c.1477C>T (Q493X) c.1646G>A (S549N) c.1209ߙ+ߙ1G>A (1341ߙ+ߙ1G->A) c.3717ߙ+ߙ12191C>T (3849ߙ+ߙ10kbC->T) c.2491G>T (E831X) c.1573C>T (Q525X) c.1645A>C (S549R) c.1329_1330insAGAT (1461ins4) c.3744delA (3876delA) c.274G>A (E92K) c.1654C>T (Q552X) c.1647T>G (S549R) c.1393-1G>A (1525-1G->A) c.3773_3774insT (3905insT) c.274G>T (E92X) c.2668C>T (Q890X) c.2834C>T (S945L) c.1418delG (1548delG) c.262_263delTT (394delTT) c.3731G>A (G1244E) c.292C>T (Q98X) c.1013C>T (T338I) c.1545_1546delTA (1677delTA) c.3873ߙ+ߙ1G>A (4005ߙ+ߙ1G->A) c.532G>A (G178R) c.3196C>T (R1066C) c.1558G>T (V520F) c.1585-1G>A (1717-1G->A) c.3884_3885insT (4016insT) c.988G>T (G330X) c.3197G>A (R1066H) c.3266G>A (W1089X) c.1585-8G>A (1717-8G->A) c.273ߙ+ߙ1G>A (405ߙ+ߙ1G->A) c.1652G>A (G551D) c.3472C>T (R1158X) c.3611G>A (W1204X) c.1679ߙ+ߙ1.6kbA>G (1811ߙ+ߙ1.6kbA->G) c.274-1G>A (406-1G->A) c.254G>A (G85E) c.3484C>T (R1162X) c.3612G>A (W1204X) c.1680-1G>A (1812-1G->A) c.4077_4080delTGTTinsAA (4209TGTT->AA) c.2908G>C (G970R) c.349C>T (R117C) c.3846G>A (W1282X) c.1766ߙ+ߙ1G>A (1898ߙ+ߙ1G->A) c.4251delA (4382delA) c.595C>T (H199Y) c.1000C>T (R334W) c.1202G>A (W401X) c.1766ߙ+ߙ3A>G (1898ߙ+ߙ 3A->G) c.325_327delTATinsG (457TAT->G) c.1007T>A (I336K) c.1040G>A (R347H) c.1203G>A (W401X) c.2012delT (2143delT) c.442delA (574delA) c.1519_1521delATC (I507del) c.1040G>C (R347P) c.2537G>A (W846X) c.2051_2052delAAinsG (2183AA->G) c.489ߙ+ߙ1G>T (621ߙ+ߙ 1G->T) c.2128A>T (K710X) c.1055G>A (R352Q) c.3276C>A (Y1092X (C>A)) c.2052delA (2184delA) c.531delT (663delT) c.3194T>C (L1065P) c.1657C>T (R553X) c.3276C>G (Y1092X (C>G)) c.2052_2053insA (2184insA) c.579ߙ+ߙ1G>T (711ߙ+ߙ 1G->T) c.3230T>C (L1077P) c.1679G>A (R560K) c.366T>A (Y122X) c.2175_2176insA (2307insA) c.579ߙ+ߙ3A>G (711ߙ+ߙ 3A->G) c.617T>G (L206W) c.1679G>C (R560T) - c.2215delG (2347delG) c.579ߙ+ߙ5G>A (711ߙ+ߙ 5G->A) c.1400T>C (L467P) c.2125C>T (R709X) - c.2453delT (2585delT) c.580-1G>T (712-1G->T) c.2195T>G (L732X) c.223C>T (R75X) - c.2490ߙ+ߙ1G>A (2622ߙ+ߙ1G->A) c.720_741delAGGGAG AATGATGATGAAGTAC (852del22) c.2780T>C (L927P) c.2290C>T (R764X) - c.2583delT (2711delT) c.1364C>A (A455E) c.3302T>A (M1101K) c.2551C>T (R851X) - c.2657ߙ+ߙ5G>A (2789ߙ+ߙ5G->A) c.1675G>A (A559T) c.1A>G (M1V) c.3587C>G (S1196X) - Mutations/variants that were validated in this study are in bold. CF, cystic fibrosis. Table 1ߒ Continued on next page reduce carrier detection and potentially improve the positive predictive value (PPV), the NBS goals of equity and the highest possible sensitivity become more difficult to achieve. Login to comment

PMID: 25835118 [PubMed] Sisman G et al: "Mutation analysis of PRSS1, SPINK1 and CFTR gene in patients with alcoholic and idiopathic chronic pancreatitis: A single center study."

No. Sentence Comment

45 DNA samples were multiplied by multiplex PCR with a CF 22Mut and CF 14Mut+Tn strip assay kit which has 36 common mutations of the CFTR gene (DF508, DI507, F508C, I502T, 1706del17, 1677del TA, G542X, 1717-1G>A, R553X, Q552X, G551D, S549R(A>C), N1303K, 4016insT, R1162X, R1158X, W1282X, G1244E, 2789+5G>A, 2183AA>G, 711+5G>A, 711+1G>T, G85E, 3849+10kbC>T, 621+1G>T, R117H, D1152H, L1065P, R1066H, L1077P, 4382delA, 1259insA, 852del22, R347P, T338I, S912X and Allele5T-7T-9T). Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

385 [Gly576Ala;Arg668Cys] D579G c.1736A>G CF-PS varying clinical consequence p.Asp579Gly E585X c.1753G>T CF-PI CF-causing p.Glu585* H609L c.1826A>T CFTR-RD nd p.His609Leu A613T c.1837G>A CF-PS nd p.Ala613Thr D614G c.1841A>G CF-PS unknown significance p.Asp614Gly 2143delT c.2012delT CF-PS CF-causing p.Leu671* 2183AA>G c.2051_2052delAAinsG CF-PI,CF-PS CF-causing p.Lys684SerfsX38 2184insA c.2052_2053insA CF-PI CF-causing p.Gln685ThrfsX4 R709X c.2125C>T CF-PI CF-causing p.Arg709* L732X c.2195T>G CF-PI CF-causing p.Leu732* R764X c.2290C>T CF-PI CF-causing p.Arg764* Q779X c.2335C>T uncertain: CF-PI and/or CF-PS nd p.Gln779* E831X c.2491G>T CF-PS CF-causing p.Glu831* Y849X c.2547C>A CF-PI CF-causing p.Tyr849* ex14b-17bdel c.2620-674_3367+198del9858 CF-PI nd 2789+5G>A c.2657+5G>A CF-PI,CF-PS CF-causing 2790-2A>G c.2658-2A>G CF-PS nd S912L c.2735C>T uncertain: found only with an unknown allele in trans nd p.Ser912Leu S945L c.2834C>T CF-PS CF-causing p.Ser945Leu S977F c.2930C>T CFTR-RD varying clinical consequence p.Ser977Phe L997F c.2991G>C CF-PS,CFTR-RD,CBAVD non CF-causing p.Leu997Phe ex17a-18del c.2988+1173_3468+2111del8600 CF-PI nd P1013L c.3038C>T CFTR-RD nd p.Pro1013Leu Y1032C c.3095A>G CFTR-RD nd p.Tyr1032Cys 3272-26A>G c.3140-26A>G CF-PS CF-causing L1065P c.3194T>C CF-PI,CF-PS CF-causing p.Leu1065Pro L1065R c.3194T>G uncertain: CF-PI and/or CF-PS nd p.Leu1065Arg R1066C c.3196C>T CF-PI CF-causing p.Arg1066Cys R1066H c.3197G>A CF-PI CF-causing p.Arg1066His G1069R c.3205G>A uncertain: found only with an unknown allele in trans varying clinical consequence p.Gly1069Arg Continued on next page of 0.021). Login to comment

PMID: 26014425 [PubMed] Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."

No. Sentence Comment

83 In several countries, when at least one Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name 3121-1G4A c.2989-1G4A 3199del6 (3195del6) c.3067_3072delATAGTG p.Ile1023_Val1024del 3272-26 A4G c.3140-26 A4G L1065P c.3194 T4C p.Leu1065Pro R1066C c.3196C4T p.Arg1066Cys R1066H c.3197G4A p.Arg1066His L1077P c.3230 T4C p.Leu1077Pro W1089X c.3266G4A p.Trp1089* Y1092X c.3276C4A p.Tyr1092* E1104X c.3310G4T p.Glu1104* R1158X c.3472C4T p.Arg1158* S1196X c.3587C4G p.Ser1196* W1204X(3743G4A) c.3611G4A p.Trp1204* W1204X(3744G4A) c.3612G4A p.Trp1204* 3791delC c.3659delC p.Thr1220Lysfs*8 3849+10kbC4T c.3718-2477C4T p.(?) Login to comment

PMID: 26209275 [PubMed] Cui G et al: "Murine and human CFTR exhibit different sensitivities to CFTR potentiators."

No. Sentence Comment

306 However, recent data indicating that VX-770 potentiates channels bearing multiple disease-causing mutations, spread across CFTR, and that VX-770 potentiates one mutant but not another one in the same domain (for example, VX-770 potentiated TM mutants T338I- and R347H- but not S341P- and E92K-CFTR and potentiated cytoplasmic loop mutants E193K- and K1060T- but not R1066M- and L1065P-CFTR) do not support this conclusion (30, 38). Login to comment