ABCMdb

ABCA4 p.Arg1108Cys

None has been submitted yet.

Publications

PMID: 22247458 [PubMed] Cideciyan AV et al: "Macular function in macular degenerations: repeatability of microperimetry as a potential outcome measure for ABCA4-associated retinopathy trials."

No. Sentence Comment

42 Clinical and Molecular Characteristics of the ABCA4 Patients Patient Age (y)/Sex ABCA4 Mutation Clinical Diagnosis Visual Acuity* Kinetic Visual Field Extent (V-4e)†Allele 1 Allele 2 Foveal Fixation P1‡ 12/M N965S W821R STGD 20/20 97 P2‡ 17/F V989A IVS28ϩ5 GϾT STGD 20/100 90 P3 18/M G1961E R1129L§ STGD 20/100 105 P4 21/F R212C P68R STGD 20/125 101 P5 24/M P1511 del1ccgC R1705Q STGD 20/25 114 P6 31/M G863A R1108C STGD 20/25 105 P7 32/F IVS40ϩ5 GϾA V935A STGD 20/32 103 P8 34/M G1961E - CRD 20/32 98 P9 37/F R681X P309R STGD 20/20 109 P10 39/M G1961E C54Y§ STGD 20/40 101 P11‡ 42/F G1961E V256V STGD 20/32 105 P12‡ 46/F G1961E V256V STGD 20/32 106 P13 52/F G1961E P1380L STGD 20/40 105 P14 58/M D600E R18W§ STGD 20/40 84 Extrafoveal Fixation P15 11/M V256V T1526M CRD 20/200 102 P16 15/M C54Y IVS35ϩ2 TϾC STGD 20/200 96 P17‡ 16/F V989A IVS28ϩ5 GϾT STGD 20/100 100 P18‡ 16/M N965S W821R STGD 20/125 100 P19 19/F A1038V/L541P N965S STGD 20/400 90 P20 21/M G863A IVS35ϩ2 TϾC STGD 20/200 99 P21 22/F G1961E R152X STGD 20/50 104 P22 27/M G863A P1660S§ STGD 20/100 98 P23 27/F G1961E A1038V/L541P STGD 20/100 109 P24 29/M G1961E T1019M STGD 20/100 104 P25 33/M P1486L deletion of exon 7 STGD 20/400 98 P26 36/F G863A C1490Y STGD 20/100 93 P27 41/M A1038V/L541P - STGD 20/125 108 P28 49/F T1526M R2030Q STGD 20/125 98 P29 55/F W855X - STGD 20/160 87 P30 56/F G1961E IVS37ϩ1 GϾA§ STGD 20/125 89 P31 60/F G1961E M669 del2ccAT STGD 20/125 104 STGD, Stargardt disease; CRD, cone-rod dystrophy. Login to comment

PMID: 22229821 [PubMed] Duno M et al: "Phenotypic and genetic spectrum of Danish patients with ABCA4-related retinopathy."

No. Sentence Comment

58 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.5584 + 1G>A na IVS39 New D188 c.5461-10T>C na IVS38 c.5693G>A p.R1898H 40 Known D433 c.5882G>A p.G1961E 42 c.6005 + 1G>A na IVS43 Known D134 c.4667 + 2G>T na IVS32 c.6098 T>G p.L2033R 44 New D186 c.3322C>T p.R1108C 22 c.6386 + 1G>A na IVS46 New D182 c.6089G>A p.R2030Q 44 c.6386 + 1G>A na IVS46 New D189 c.2894A>G p.N965S 19 c.6478 A>G p.K2160E 47 New *p.L541P and p.A1038V might be located on the same allele. Login to comment
97 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773 + 5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005 + 1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773 + 3A>G* D110 p.[L541P+A1038V] c.5584 + 1G>A* D182 p.R2030Q c.6386 + 1G>A* D186 p.R1108C c.6386 + 1G>AA* D133 p.L510R IVS46 + 1G>A* Cone-rod dystrophy D134 c.4667 + 2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame. Login to comment
60 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.5584ߙ+ߙ1G>A na IVS39 New D188 c.5461-10T>C na IVS38 c.5693G>A p.R1898H 40 Known D433 c.5882G>A p.G1961E 42 c.6005ߙ+ߙ1G>A na IVS43 Known D134 c.4667ߙ+ߙ2G>T na IVS32 c.6098 T>G p.L2033R 44 New D186 c.3322C>T p.R1108C 22 c.6386ߙ+ߙ1G>A na IVS46 New D182 c.6089G>A p.R2030Q 44 c.6386ߙ+ߙ1G>A na IVS46 New D189 c.2894A>G p.N965S 19 c.6478 A>G p.K2160E 47 New *p.L541P and p.A1038V might be located on the same allele. Login to comment
100 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773ߙ+ߙ5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005ߙ+ߙ1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773ߙ+ߙ3A>G* D110 p.[L541P+A1038V] c.5584ߙ+ߙ1G>A* D182 p.R2030Q c.6386ߙ+ߙ1G>A* D186 p.R1108C c.6386ߙ+ߙ1G>AA* D133 p.L510R IVS46ߙ+ߙ1G>A* Cone-rod dystrophy D134 c.4667ߙ+ߙ2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame. Login to comment

PMID: 22328824 [PubMed] Roberts LJ et al: "Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients."

No. Sentence Comment

139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment

PMID: 20647261 [PubMed] Schindler EI et al: "Deducing the pathogenic contribution of recessive ABCA4 alleles in an outbred population."

No. Sentence Comment

54 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text). Login to comment
57 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text). Login to comment

PMID: 20398653 [PubMed] Chen B et al: "Analysis of autofluorescent retinal images and measurement of atrophic lesion growth in Stargardt disease."

No. Sentence Comment

82 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,þ1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, þ5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 þ 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND ¼ not done. Login to comment
81 ID# Age Years followed Visual Acuity AL Area (mm2 ) HF Area (mm2 ) ffERG Amplitudes (mV) ffERG IT (msec) ABCA4 Variants OD OS OD OS OD OS OD OS OD OS Rod Cone Rod Cone Rod Cone Rod Cone AI AII Group A S0047 53 2.83 20/40 20/40 31.60 33.85 0.20 0.07 304.0 125.4 392.9 143.3 69.5 29.3 72.7 29.3 NF NF S0023 49 3.26 20/160 20/160 9.92 12.67 1.24 1.49 292.1 52.2 272.4 46.4 77.9 36.8 78.3 35.2 L541P/A1038V NF S0050 78 2.71 20/250 20/160 2.02 0.07 1.21 0.67 355.0 82.2 373.1 87.2 76.7 34.1 76.7 34.8 S2255I IVS5,&#fe;1,G > C S0045 44 3.16 20/200 20/160 17.27 44.72 NM NM 177.0 55.7 201.9 50.0 85.3 41.5 87.7 39.9 L541P/A1038V R2107K S0018 35 2.28 20/200 20/250 4.31 2.53 NM NM ND ND ND ND ND ND ND ND G1961E S2255I S0033 63 2.35 20/800 20/400 15.51 12.09 1.30 0.22 168.2 53.0 180.9 45.4 96.3 38.0 101.0 38.4 R943Q IVS8,-9, T > C S0048 62 2.56 20/80 20/20 48.45 40.73 NM NM 119.7 69.5 213.9 54.6 71.2 35.6 80.6 35.2 R290Q K346T S0036 62 2.81 20/640 20/500 55.70 43.38 NM NM 174.8 41.1 158.1 50.8 106.6 38.5 102.3 35.2 R1129L Q234X S0029 62 2.81 20/40 20/80 57.62 61.25 NM NM 219.0 26.0 209.2 35.2 77.9 31.3 73.6 30.9 R2030Q NF S0024 43 3.20 20/25 20/25 4.91 3.91 4.18 1.48 98.2 23.7 148.0 36.2 84.0 33.2 85.5 33.6 NF NF S0078 35 1.17 20/100 20/125 5.64 5.39 0.70 0.83 230.1 106.7 187.6 108.8 71.2 34.1 64.6 34.1 IVS39-10,T > C NF S0032 64 2.56 20/250 20/320 8.67 3.67 0.67 0.74 273.2 75.5 235.1 114.7 87.9 30.5 72.7 30.1 R1108C L2027F S0051 52 1.90 20/25 20/20 32.78 29.23 NM NM ND ND ND ND ND ND ND ND E471K NF S0115 16 0.57 20/50 20/50 0.77 3.43 NM NM ND ND ND ND ND ND ND ND NF NF S0077 49 1.14 20/40 20/25 N/A 8.54 0.16 1.89 279.9 111.9 299.3 105.2 N/A N/A N/A N/A NF NF S0042 43 1.84 20/125 20/200 118.15 126.69 NM NM 122.3 27.7 114.8 29.3 85.7 36.4 89.6 36.0 S2255I E471K S0037 46 2.38 20/125 20/200 8.73 N/A 1.29 0.86 338.7 119.3 373.7 109.4 72.3 28.1 70.7 28.1 G1961E S2255I S0020 42 0.0 20/200 20/160 1.16 1.82 NM NM 140.4 43.2 159.9 45.8 81.3 31.3 71.5 29.3 NF NF S0041 44 0.0 20/200 20/160 4.73 7.09 0.96 1.36 260.5 65* 297.2 95.3 113.7 29.7 91.8 28.9 R1129L NF S0087 44 0.0 20/20 20/20 14.89 23.09 NM NM 180.9 66.8 182.2 78.0 76.1 32.9 72.2 32.9 IVS40, &#fe;5,G > A NF S0053 43 0.0 20/100 20/160 1.33 1.85 NM NM ND ND ND ND ND ND ND ND S2255I NF S0097 73 0.0 20/200 20/200 49.21 54.26 NM NM ND ND ND ND ND ND ND ND D1532E NF S0080 28 0.0 20/125 20/200 NA 0.98 0.56 0.03 333.1 117.2 325.1 121.4 80.2 32.5 82.6 32.9 E1122K S2255I S0210 49 0.0 20/160 20/200 0.21 NA NM NM 304.1 76.1 425.7 81.1 72.8 33.7 79.8 33.7 NF NF Group B S0133 30 0.0 20/125 20/32 0.51 0.01 387.1 123.7 374.8 105.1 65.4 32.9 65.0 32.9 NF NF S0046 49 0.0 20/160 20/160 1.48 1.68 491.2 148.9 494.9 145.3 72.7 30.1 77.3 29.7 P1380L G1961E S0141 40 0.0 20/13 20/32 1.88 0.41 389.0 156.5 343.5 150.6 70.8 33.3 69.7 34.4 NF NF S0058 61 0.0 20/50 20/50 1.48 1.52 ND ND ND ND ND ND ND ND NF NF S0149 16 0.0 20/80 20/100 1.59 0.62 285.0 87.4 333.4 115.3 62.6 32.5 61.4 32.5 NF NF S0083 15 0.0 20/13 20/13 0.17 0.48 441.1 144.2 472.0 155.5 74.4 33.3 71.6 33.3 G863A NF S0216 44 0.0 20/25 20/32 0.52 1.04 228.7 97.7 192.7 75.3 83.8 36.8 85.7 36.0 NF NF S0076 9 0.0 20/200 20/160 3.70 4.23 557.7 139.5 319.8 117.3 81.6 29.7 73.4 28.9 W1408R T1526M S0021 19 0.0 20/160 20/160 1.81 1.08 390.4 202.1 ND ND 63.3 29.3 ND ND L2027F W31R S0085 35 0.0 20/16 20/20 2.70 2.56 ND ND ND ND ND ND ND ND C54T R219T S0044 30 0.0 20/250 20/250 4.23 3.77 ND ND ND ND ND ND ND ND A1794D L2027F S0035 47 0.0 20/160 20/125 0.46 0.13 239.6 112.3 325.0 141.6 64.1 28.1 62.5 28.1 G863A E471K S0065 61 0.0 20/100 20/125 0.83 0.15 243.4 58.6 226.5 49.2 74.8 32.9 84.5 33.3 G1961E NF S0213 27 0.0 20/25 20/25 0.99 1.03 384.2 124.4 424.4 137.9 72.4 31.7 72.4 35.2 NF NF S0088 55 0.0 20/25 20/20 0.11 0.47 ND ND ND ND ND ND ND ND R1898H NF S0127 16 0.0 20/63 20/63 0.08 0.69 536.3 128.9 470.3 136.4 65.4 30.9 77.1 30.9 L541P/A1038V NF S0057 47 0.48 20/125 20/160 1.20 1.75 252.1 80.3 210.5 100.5 75.5 32.9 89.6 32.5 NF NF S0043 53 2.91 20/200 20/200 0.97 0.53 250.5 173.2 354.6 179.2 72.7 28.5 80.1 30.1 G1961E F873I S0101 37 1.1 20/40 20/20 0.14 0.25 382.2 159.7 422.7 156.7 70.5 32.5 74.0 32.9 A1038V IVS42 &#fe; 1,G > A S0027 17 2.18 20/50 20/50 1.60 2.12 196.3 36.3 198.0 51.0 84.7 32.9 98.8 35.3 NF NF S0104 20 1.19 20/160 20/200 0.05 0.12 237.4 77.7 440.1 88.7 63.0 30.9 64.6 30.1 NF NF S0110 26 1.02 20/200 20/125 0.65 0.56 333.8 94.5 349.4 98.7 68.9 32.1 68.9 32.5 R1129L NF S0049 34 2.13 20/50 20/200 0.76 0.92 374.4 97.2 344.0 90.5 81.0 32.9 65.8 33.7 R1129L NF S0075 22 1.06 20/63 20/125 0.40 0.69 454.5 114.0 452.7 122.8 77.5 32.1 75.5 32.9 G1961E NF S0039 36 2.2 20/160 20/100 0.15 0.13 347.7 137.1 395.8 142.0 80.1 31.3 61.7 30.9 M1V R2107H S0054 31 1.93 20/40 20/40 0.41 0.56 ND ND ND ND ND ND ND ND G1961E S2255I S0040 11 2.97 20/160 20/160 0.46 0.07 610.2 72.5 375.6 67.4 106.5 37.2 93.5 32.9 R572X N1805D S0028 54 2.73 20/16 20/16 1.04 1.54 425.5 105.8 386.3 107.8 83.4 34.4 84.1 34.8 L541P/A1038V R2030Q ND &#bc; not done. Login to comment

PMID: 19265867 [PubMed] Passerini I et al: "Novel mutations in of the ABCR gene in Italian patients with Stargardt disease."

No. Sentence Comment

57 Table 2 Summary of the mutations identified in the ABCR gene in our series of STGD Italian patients Patient Allele 1 mutation Allele 2 mutation S 1 R212C T1019M S 8 V1433I V1433I S 21 A1598D A1598D S 33 N96K G978D S 56 A1598D G1961E S 70 R212C T1019M S 71 W700X WT S 74 6750delA V767D S 77 G1961E WT S 82 Q21X G1961E S 106 C1177X G1961E S 107 C1177X G1961E S 114 T970P-F1015E - S 115 T970P-F1015E - S 120 N415K G1961E S 162 324-327insT 324-327insT S 181 W1408X G1961E S 190 C1177X A1598D S 201 G1961E WT S 202 Q21X T970P-F1015E S 213 M840R G1961E S 231 WT WT S 236 C1177X G1961E S 237 WT WT S 241 V256 splice WT S 246 IVS6-1g4t R1108C S 260 L2221P 5109delG-I156V S 321 IVS9 þ 1G4C S1099X S 328 IVS42 þ 4delG IVS35 þ 2t4c S 346 E2096K WT S 347 IVS28 þ 5g4a WT S 353 P1484S-G1961E P68L S 354 P1484S-G1961E P68L S 355 P1484S-G1961E P68L S 360 G1961E 5961delGGAC S 364 IVS35 þ 2t4c G1961E S 365 L541P/A1038V G1961E S 377 IVS42 þ 4delG IVS35 þ 2t4c S 380 R653C WT S 413 R212C T1019M S 414 A1598D G1961E S 417 G1078E G1961E S 438 R1055W WT S 440 4021ins24bp T1526M-G1961E S 449 W1479X L2140Q S 450 W1479X L2140Q S 474 W1461X G 1977S S 486 WT WT S 492 R1098C/L1970F 6548insTGAA S 528 T977P IVS40 þ 5g4a S 531 G690V Q1332X S 532 R572X L1473M-4733delGTTT S 535 IVS40 þ 5g4a 5917delG S 550 IVS40 þ 5g4a 6750delA S 555 250insCAAA WT S 556 250insCAAA WT S 575 N96H G1961E S 590 W821R IVS40 þ 5g4a S 592 V931M R1108C S 593 V767D R2030X Table 2 (Continued ) Patient Allele 1 mutation Allele 2 mutation S 594 G172S G1961E S 602 P1380L G1961E S 607 E616K L1580S-K2172R S 640 250insCAAA S1696N S 694 IVS35 þ 2t4c G1961E S 725 IVS13 þ 1g4a Q1376 splice S 731 L541P-A1038V G1961E S 755 N965S IVS40 þ 5g4a S 789 E1087K G1977S S 968 T1019M G1961E S 992 R212C G1961E Bold values indicate novel mutations. Login to comment

PMID: 19230850 [PubMed] Molday RS et al: "The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration."

No. Sentence Comment

134 Disease mutations, which are substituted in Stargardt disease, are shown in red italics - NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C); NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment
225 A subset of missense mutations reside in NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C, R1129L) and NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment

PMID: 19074458 [PubMed] Cideciyan AV et al: "ABCA4 disease progression and a proposed strategy for gene therapy."

No. Sentence Comment

127 And for an additional eight mutations (G818E, A1038V;L541P, E1087D, R1108C, E1122K, IVS40þ5G.A, L1940P and K2172R), we performed severity estimates recursively by using estimates established above. Login to comment
151 Estimated severity of ABCA4 alleles and their properties ABCA4 allele Delay of retina-wide disease initiation (years)a In vitro or in vivo studiesb Molecular structural localizationc C2150Y 225.8 NBD-2 A1038V;L541P 214.0 35, 38 ECD-1/NBD-1 IVS38-10 T.C 211.1 L244P 25.7 ECD-1 E1122K 23.5 NBD-1 C54Y 22.1 35 ECD-1 IVS35þ2 T.C 22.1 R602W 21.8 38 ECD-1 V1896D 21.8 TM12 L1940P 21.4 NBD-2 Truncation mutationsd 0.0 E1087D 2.8 NBD-1 R220C 3.9 ECD-1 A1598D 3.9 ECD-2 R1640Q 3.9 ECD-2 R1098C 4.9 NBD-1 P1380L 7.4 35 TM7 N965S 7.6 35 NBD-1 V1433I 8.6 ECD-2 R1108C 10.4 35 NBD-1 T1526M 14.5 35 ECD-2 R2030Q 14.5 NBD-2 L2027F 15.1 35,37 NBD-2 G818E 17.3 35 TM5/TM6 S100P 18.2 ECD-1 L1201R 18.2 NBD-1 R18W 18.5 Nt D600E 18.5 ECD-1 L11P 21.7 Nt D654N 25.3 36 ECD-1 K2172R 27.9 NBD-2 IVS40þ5 G.A 28.1 G1961E 37.9 35 NBD-2 G1961R 44.0 NBD-2 a Delay of retina-wide disease initiation relative to the standard of age 10.6 years. Login to comment

PMID: 18854780 [PubMed] Hwang JC et al: "Peripapillary atrophy in Stargardt disease."

No. Sentence Comment

73 Genetic testing revealed a single ABCA4 mutation R1108C. Login to comment

PMID: 17562343 [PubMed] Reinhard J et al: "Quantifying fixation in patients with Stargardt disease."

No. Sentence Comment

186 of PRL ABCA4 allel1 exon mut 1 ABCA4 allel2 exon mut 2 1 m 32 OD 2 0.4 0.0 90.0 211.0 1 48 L2241V n.f. OS 2 0.6 0.0 90.0 181.6 1 2 f 55 OD 29 0.1 9.7 60.3 9874.6 1 - - - - OS 29 0.1 6.8 67.5 68260.1 2 3 f 38 OD 16 0.05 6.4 73.7 4962.8 1 14 W663X 42 G1961E OS 7 0.4 0.0 90.9 143.5 1 4 m 23 OD 7 0.1 5.7 81.8 664.3 1 40 R1898H 43 G1975R OS 6 0.1 7.0 80.6 594.2 1 5 m 16 OD 7 0.05 7.4 81.0 1052.0 1 12+21 L541P+ 40 IVS40+5 OS 7 0.05 5.0 73.3 11500.0 1 A1038V G->A 6 m 34 OD 34 0.1 0.0 76.2 924.2 1 n.f. n.f. OS 34 0.1 0.0 74.3 1106.2 1 7 m 17 OD 11 0.1 3.1 79.1 3517.6 1 - - - - OS 11 0.1 3.6 70.0 2226.1 1 8 m 46 OD 14 0.5 3.6 80.6 3986.2 1 11 E471K 42 G1961E OS 14 0.2 3.7 58.3 40731.5 1 9 f 26 OD 15 0.1 6.0 70.5 3215.2 1 17 G863A n.f. OS 15 0.1 8.5 56.5 14734.9 1 10 f 19 OD 2 0.1 7.9 65.7 3260.0 1 3 P68L 36 S1689P OS 2 0.1 7.0 63.9 2964.8 1 11 f 34 OD 30 0.4 0.0 88.2 234.1 1 28 E1399K 42 G1961E OS 30 0.4 0.0 87.9 350.0 1 12 m 59 OD 5 0.1 5.2 79.2 1715.5 1 42 G1961E n.f. OS 5 0.1 4.4 75.0 3839.5 1 13 m 35 OD 20 0.05 9.7 72.9 8164.8 1 17 G863A 37 Q1750X OS 20 0.05 10.3 64.9 9820.4 1 14 m 43 OD 29 HM 16.0 58.5 18228.0 1 17 G863A 37 Q1750X OS 29 HM 15.6 42.1 14173.5 1 15 f 32 OD 10 0.05 6.5 61.3 10195.5 1 21 A1038V n.f. OS 10 0.05 5.0 56.7 7560.7 1 16 m 46 OD 4 0.05 8.5 51.1 8641.6 1 12+21 L541P+ 17 G863A OS 4 0.3 5.0 51.1 19827.1 1 A1038V 17 m 43 OD 3 0.5 0.0 90.7 190.9 1 - - - - OS 3 0.7 0.0 81.9 402.2 1 18 f 31 OD 27 1/15 9.8 69.3 2268.5 1 22 R1108C n.f. OS 27 0.1 17.2 60.9 4237.0 1 19 f 23 OD 5 0.05 6.0 72.9 3751.2 1 28 E1399K 43 G1977S OS 5 0.05 6.2 74.8 3578.9 1 20 f 16 OD 5 0.1 6.0 75.8 708.0 1 22 R1108C n.f. OS 5 0.1 5.4 82.4 449.6 1 21 m 38 OD 23 0.1 8.2 53.7 53733.8 2 - - - - OS 12 0.1 6.2 60.3 80873.8 2 22 m 40 OD 6 0.05 16.6 60.8 11677.8 1 14 R681X n.f. OS 6 0.1 10.0 60.6 5134.5 1 23 f 24 OD 3 0.1 6.7 90.5 577.8 1 6 G768T/ n.f. OS 3 0.1 7.1 83.6 3015.2 1 splice 24 m 13 OD 3 0.05 6.9 65.2 1882.7 1 - - - - OS 3 0.05 7.3 53.7 3844.3 1 25 f 39 OD 34 HM 7.0 54.3 24440.2 1 n.f. n.f. OS 34 1/60 10.6 77.6 1245.6 1 26 f 27 OD 2 0.2 0.0 91.8 127.4 1 17 G863A 28 Q1412X OS 2 0.6 0.0 94.9 69.2 1 27 m 25 OD 1 0.3 0.0 70.7 5670.4 1 n.f. n.f. OS 1 0.4 0.0 75.6 764.9 1 28 m 17 OD 3 0.2 0.8 67.3 4244.1 1 - - - - OS 3 0.3 0.0 80.6 2429.2 1 29 m 28 OD 2,5 0.1 5.4 80.8 795.0 1 - - - - OS 2,5 0.1 4.2 64.3 2101.1 1 30 f 27 OD 20 0.1 6.7 88.2 183.6 1 G1961E G1961E OS 20 0.1 10.9 81.0 448.2 1 Dis. dur., disease duration (years); HM, recognition of hand movements; VA, visual acuity in European decimals. Login to comment
183 of PRL ABCA4 allel1 exon mut 1 ABCA4 allel2 exon mut 2 1 m 32 OD 2 0.4 0.0 90.0 211.0 1 48 L2241V n.f. OS 2 0.6 0.0 90.0 181.6 1 2 f 55 OD 29 0.1 9.7 60.3 9874.6 1 - - - - OS 29 0.1 6.8 67.5 68260.1 2 3 f 38 OD 16 0.05 6.4 73.7 4962.8 1 14 W663X 42 G1961E OS 7 0.4 0.0 90.9 143.5 1 4 m 23 OD 7 0.1 5.7 81.8 664.3 1 40 R1898H 43 G1975R OS 6 0.1 7.0 80.6 594.2 1 5 m 16 OD 7 0.05 7.4 81.0 1052.0 1 12+21 L541P+ 40 IVS40+5 OS 7 0.05 5.0 73.3 11500.0 1 A1038V G->A 6 m 34 OD 34 0.1 0.0 76.2 924.2 1 n.f. n.f. OS 34 0.1 0.0 74.3 1106.2 1 7 m 17 OD 11 0.1 3.1 79.1 3517.6 1 - - - - OS 11 0.1 3.6 70.0 2226.1 1 8 m 46 OD 14 0.5 3.6 80.6 3986.2 1 11 E471K 42 G1961E OS 14 0.2 3.7 58.3 40731.5 1 9 f 26 OD 15 0.1 6.0 70.5 3215.2 1 17 G863A n.f. OS 15 0.1 8.5 56.5 14734.9 1 10 f 19 OD 2 0.1 7.9 65.7 3260.0 1 3 P68L 36 S1689P OS 2 0.1 7.0 63.9 2964.8 1 11 f 34 OD 30 0.4 0.0 88.2 234.1 1 28 E1399K 42 G1961E OS 30 0.4 0.0 87.9 350.0 1 12 m 59 OD 5 0.1 5.2 79.2 1715.5 1 42 G1961E n.f. OS 5 0.1 4.4 75.0 3839.5 1 13 m 35 OD 20 0.05 9.7 72.9 8164.8 1 17 G863A 37 Q1750X OS 20 0.05 10.3 64.9 9820.4 1 14 m 43 OD 29 HM 16.0 58.5 18228.0 1 17 G863A 37 Q1750X OS 29 HM 15.6 42.1 14173.5 1 15 f 32 OD 10 0.05 6.5 61.3 10195.5 1 21 A1038V n.f. OS 10 0.05 5.0 56.7 7560.7 1 16 m 46 OD 4 0.05 8.5 51.1 8641.6 1 12+21 L541P+ 17 G863A OS 4 0.3 5.0 51.1 19827.1 1 A1038V 17 m 43 OD 3 0.5 0.0 90.7 190.9 1 - - - - OS 3 0.7 0.0 81.9 402.2 1 18 f 31 OD 27 1/15 9.8 69.3 2268.5 1 22 R1108C n.f. OS 27 0.1 17.2 60.9 4237.0 1 19 f 23 OD 5 0.05 6.0 72.9 3751.2 1 28 E1399K 43 G1977S OS 5 0.05 6.2 74.8 3578.9 1 20 f 16 OD 5 0.1 6.0 75.8 708.0 1 22 R1108C n.f. OS 5 0.1 5.4 82.4 449.6 1 21 m 38 OD 23 0.1 8.2 53.7 53733.8 2 - - - - OS 12 0.1 6.2 60.3 80873.8 2 22 m 40 OD 6 0.05 16.6 60.8 11677.8 1 14 R681X n.f. OS 6 0.1 10.0 60.6 5134.5 1 23 f 24 OD 3 0.1 6.7 90.5 577.8 1 6 G768T/ n.f. OS 3 0.1 7.1 83.6 3015.2 1 splice 24 m 13 OD 3 0.05 6.9 65.2 1882.7 1 - - - - OS 3 0.05 7.3 53.7 3844.3 1 25 f 39 OD 34 HM 7.0 54.3 24440.2 1 n.f. n.f. OS 34 1/60 10.6 77.6 1245.6 1 26 f 27 OD 2 0.2 0.0 91.8 127.4 1 17 G863A 28 Q1412X OS 2 0.6 0.0 94.9 69.2 1 27 m 25 OD 1 0.3 0.0 70.7 5670.4 1 n.f. n.f. OS 1 0.4 0.0 75.6 764.9 1 28 m 17 OD 3 0.2 0.8 67.3 4244.1 1 - - - - OS 3 0.3 0.0 80.6 2429.2 1 29 m 28 OD 2,5 0.1 5.4 80.8 795.0 1 - - - - OS 2,5 0.1 4.2 64.3 2101.1 1 30 f 27 OD 20 0.1 6.7 88.2 183.6 1 G1961E G1961E OS 20 0.1 10.9 81.0 448.2 1 Dis. dur., disease duration (years); HM, recognition of hand movements; VA, visual acuity in European decimals. Login to comment

PMID: 17325179 [PubMed] Aleman TS et al: "Macular pigment and lutein supplementation in ABCA4-associated retinal degenerations."

No. Sentence Comment

61 Clinical and Molecular Characteristics of the Patients Patient Age (y)/Gender ABCA4 Mutation Visual Acuity* Refraction† Kinetic Visual Field Extent (V-4e)‡ Lutein Trial Participant?RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 -0.50 -0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 -1.00 -1.25 103 104 N 3 18/M ࿣ 20/20 20/125 -1.00 -1.00 126 105 N 4§ 19/F R1129L/L1940P 20/40 20/50 ϩ0.25 ϩ0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 -0.75 -0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 -1.25 -1.50 112 105 Y 7§ 26/M ࿣ 20/40 20/32 ϩ1.00 ϩ0.75 86 88 Y 8 30/F ࿣ 20/50 20/40 ϩ2.25 ϩ1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 -2.25 -3.50 99 93 Y 10 32/F V935A/IVS40ϩ5G3A 20/32 20/40 -0.75 -1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 -1.50 -1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 -3.00 -2.00 99 105 Y 13¶ 38/F V256V/G1961E 20/25 20/25 -1.00 -1.25 106 101 Y 14¶ 42/F V256V/G1961E 20/25 20/32 -0.50 -0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 ϩ0.75 ϩ0.25 108 103 N 16§ 49/M ࿣ 20/32 20/32 -4.50 -4.50 84 79 Y 17 56/M G1977S 20/25 20/25 -5.50 -5.50 99 109 N * Best corrected visual acuity. Login to comment
62 RE LE RE LE RE LE 1 18/M G863A/R943Q 20/32 20/32 afa;0.50 afa;0.50 109 105 Y 2 18/F E1087K/G1961E 20/25 20/25 afa;1.00 afa;1.25 103 104 N 3 18/M $f3; 20/20 20/125 afa;1.00 afa;1.00 126 105 N 4&#a7; 19/F R1129L/L1940P 20/40 20/50 af9;0.25 af9;0.25 90 93 Y 5 21/M P1511del1ccgC/R1705Q 20/25 20/25 afa;0.75 afa;0.25 103 107 Y 6 24/M T1019M/G1961E 20/50 20/200 afa;1.25 afa;1.50 112 105 Y 7&#a7; 26/M $f3; 20/40 20/32 af9;1.00 af9;0.75 86 88 Y 8 30/F $f3; 20/50 20/40 af9;2.25 af9;1.75 105 110 Y 9 30/M R1108C/R152Q 20/20 20/32 afa;2.25 afa;3.50 99 93 Y 10 32/F V935A/IVS40af9;5G3A 20/32 20/40 afa;0.75 afa;1.25 103 92 N 11 34/F R681X/R1300Q 20/20 20/20 afa;1.50 afa;1.75 110 96 N 12 37/M C54Y/G1961E 20/32 20/25 afa;3.00 afa;2.00 99 105 Y 13&#b6; 38/F V256V/G1961E 20/25 20/25 afa;1.00 afa;1.25 106 101 Y 14&#b6; 42/F V256V/G1961E 20/25 20/32 afa;0.50 afa;0.75 107 94 Y 15 47/F R1300Q/R2107H 20/32 20/20 af9;0.75 af9;0.25 108 103 N 16&#a7; 49/M $f3; 20/32 20/32 afa;4.50 afa;4.50 84 79 Y 17 56/M G1977S 20/25 20/25 afa;5.50 afa;5.50 99 109 N * Best corrected visual acuity. Login to comment

PMID: 16303926 [PubMed] Hargitai J et al: "Correlation of clinical and genetic findings in Hungarian patients with Stargardt disease."

No. Sentence Comment

89 Summarized Clinical and Genetic Data of Patients with STGD Patient Allele 1 Allele 2 Fishman OU Gender Age Duration VA OD VA OS FT OD (␮m) FT OS (␮m) MV OD (mm3 ) MV OS (mm3 ) 1 ND ND I M 18 10 0.42 0.50 90.00 76.00 1.70 1.67 2 L541P/A1038V ND III F 27 15 0.06 0.08 43.00 58.00 1.27 1.28 3 5917delG 5917delG II F 29 8 0.17 0.17 54.00 20.00 1.38 1.35 4 ND ND III F 42 14 0.10 0.10 91.00 71.00 1.60 1.59 5 V2050L ND II F 22 5 0.20 0.33 28.00 77.00 1.64 1.68 6 ND ND II F 17 2 1.00 0.71 156.00 141.00 2.55 2.6 7 IVS40ϩ5GϾA ND III M 28 13 0.10 0.06 71.00 92.00 1.61 1.61 8 L541P/A1038V G1961E II M 37 15 0.10 0.10 87.00 97.00 1.95 1.95 9 106delT G1961E II M 32 7 0.08 0.08 51.00 32.00 1.59 1.66 10 ND ND I F 55 17 0.25 0.56 160.00 170.00 1.72 1.82 11 L541P/A1038V G863A II F 15 3 0.25 0.33 67.00 68.00 1.78 1.76 12 IVS40ϩ5GϾA 5917delG III M 15 6 0.20 0.20 107.00 117.00 1.93 1.92 13 ND ND I M 27 2 0.38 0.33 56.00 86.00 2.01 1.97 14 G1886E G1961E II F 37 9 0.12 0.16 92.00 46.00 1.55 1.59 15 G1961E ND III F 20 5 0.30 0.20 49.00 34.00 1.43 1.53 16 ND ND II M 28 14 0.32 0.08 52.00 60.00 1.46 1.52 17 IVS40ϩ5GϾA 5917delG III M 27 5 0.10 0.10 97.00 92.00 1.76 1.71 18 L541P/A1038V D1532N III M 28 12 0.25 0.10 49.00 46.00 1.83 1.86 19 ND ND II F 31 11 0.10 0.13 67.00 72.00 1.55 1.49 20 L541P L541P/A1038V II F 15 5 0.10 0.10 28.00 34.00 1.63 1.65 21 L541P/A1038V G863A II F 25 2 0.20 0.62 94.00 81.00 1.92 1.94 22 L541P/A1038V ND II M 18 9 0.08 0.10 63.00 72.00 1.40 1.43 23 G1961E ND III F 34 9 0.16 0.16 16.00 23.00 1.31 1.56 24 ND ND II F 52 14 0.16 0.16 122.00 113.00 1.90 1.99 25 P68L L541P/A1038V III M 37 22 0.10 0.12 40.00 40.00 1.41 1.42 26 ND ND II F 18 11 0.20 0.25 59.00 72.00 1.42 1.47 27 L541P/A1038V G1961E II F 24 7 0.18 0.18 83.00 100.00 1.72 1.77 28 IVS40ϩ5GϾA 5917delG III M 15 7 0.10 0.16 38.00 46.00 1.30 1.41 29 R1108C R1108C II M 31 14 0.10 0.10 41.00 44.00 1.95 1.96 30 G1961E ND II M 28 6 0.33 0.56 91.00 129.00 1.98 2.04 31 ND ND II F 28 11 0.08 0.10 55.00 63.00 1.52 1.59 32 L541P/A1038V G863A II M 32 15 0.20 0.20 92.00 86.00 1.80 1.75 33 ND ND II F 27 4 0.25 0.20 66.00 75.00 1.72 1.76 34 ND ND II F 36 8 0.12 0.10 58.00 69.00 1.59 1.56 35 IVS40ϩ5GϾA IVS40ϩ5GϾA III F 19 6 0.10 0.10 62.00 53.00 1.67 1.65 Fishman OU, classification of patients by fundus photos in three categories according to Fishman et al.25 ND, not determined. Login to comment
87 Summarized Clinical and Genetic Data of Patients with STGD Patient Allele 1 Allele 2 Fishman OU Gender Age Duration VA OD VA OS FT OD (òe;m) FT OS (òe;m) MV OD (mm3 ) MV OS (mm3 ) 1 ND ND I M 18 10 0.42 0.50 90.00 76.00 1.70 1.67 2 L541P/A1038V ND III F 27 15 0.06 0.08 43.00 58.00 1.27 1.28 3 5917delG 5917delG II F 29 8 0.17 0.17 54.00 20.00 1.38 1.35 4 ND ND III F 42 14 0.10 0.10 91.00 71.00 1.60 1.59 5 V2050L ND II F 22 5 0.20 0.33 28.00 77.00 1.64 1.68 6 ND ND II F 17 2 1.00 0.71 156.00 141.00 2.55 2.6 7 IVS40af9;5Gb0e;A ND III M 28 13 0.10 0.06 71.00 92.00 1.61 1.61 8 L541P/A1038V G1961E II M 37 15 0.10 0.10 87.00 97.00 1.95 1.95 9 106delT G1961E II M 32 7 0.08 0.08 51.00 32.00 1.59 1.66 10 ND ND I F 55 17 0.25 0.56 160.00 170.00 1.72 1.82 11 L541P/A1038V G863A II F 15 3 0.25 0.33 67.00 68.00 1.78 1.76 12 IVS40af9;5Gb0e;A 5917delG III M 15 6 0.20 0.20 107.00 117.00 1.93 1.92 13 ND ND I M 27 2 0.38 0.33 56.00 86.00 2.01 1.97 14 G1886E G1961E II F 37 9 0.12 0.16 92.00 46.00 1.55 1.59 15 G1961E ND III F 20 5 0.30 0.20 49.00 34.00 1.43 1.53 16 ND ND II M 28 14 0.32 0.08 52.00 60.00 1.46 1.52 17 IVS40af9;5Gb0e;A 5917delG III M 27 5 0.10 0.10 97.00 92.00 1.76 1.71 18 L541P/A1038V D1532N III M 28 12 0.25 0.10 49.00 46.00 1.83 1.86 19 ND ND II F 31 11 0.10 0.13 67.00 72.00 1.55 1.49 20 L541P L541P/A1038V II F 15 5 0.10 0.10 28.00 34.00 1.63 1.65 21 L541P/A1038V G863A II F 25 2 0.20 0.62 94.00 81.00 1.92 1.94 22 L541P/A1038V ND II M 18 9 0.08 0.10 63.00 72.00 1.40 1.43 23 G1961E ND III F 34 9 0.16 0.16 16.00 23.00 1.31 1.56 24 ND ND II F 52 14 0.16 0.16 122.00 113.00 1.90 1.99 25 P68L L541P/A1038V III M 37 22 0.10 0.12 40.00 40.00 1.41 1.42 26 ND ND II F 18 11 0.20 0.25 59.00 72.00 1.42 1.47 27 L541P/A1038V G1961E II F 24 7 0.18 0.18 83.00 100.00 1.72 1.77 28 IVS40af9;5Gb0e;A 5917delG III M 15 7 0.10 0.16 38.00 46.00 1.30 1.41 29 R1108C R1108C II M 31 14 0.10 0.10 41.00 44.00 1.95 1.96 30 G1961E ND II M 28 6 0.33 0.56 91.00 129.00 1.98 2.04 31 ND ND II F 28 11 0.08 0.10 55.00 63.00 1.52 1.59 32 L541P/A1038V G863A II M 32 15 0.20 0.20 92.00 86.00 1.80 1.75 33 ND ND II F 27 4 0.25 0.20 66.00 75.00 1.72 1.76 34 ND ND II F 36 8 0.12 0.10 58.00 69.00 1.59 1.56 35 IVS40af9;5Gb0e;A IVS40af9;5Gb0e;A III F 19 6 0.10 0.10 62.00 53.00 1.67 1.65 Fishman OU, classification of patients by fundus photos in three categories according to Fishman et al.25 ND, not determined. Login to comment

PMID: 15696369 [PubMed] Yatsenko AN et al: "Evolution of ABCA4 proteins in vertebrates."

No. Sentence Comment

130 As anticipated, the most frequently occurring STGD- associated missense ABCA4 alterations (R212C, L541P, D645N, G863A, A1038V, R1108C, R1380L, W1408R, T1526M, R1640W, G1961E, L2027F, and L2030Q) map to highly conserved regions. Login to comment

PMID: 15579991 [PubMed] Oh KT et al: "Electroretinographic findings in patients with Stargardt disease and fundus flavimaculatus."

No. Sentence Comment

165 In fact, the six most common HPRDCV, with the exception of His423Arg, (frameshift changes, Ala1038Val, Pro1380Leu, Arg1108Cys, Leu2027Phe) were observed with all three ERG classes: severe ERG derangements, mild ERG derangements, and normal ERG studies. Login to comment

PMID: 15192030 [PubMed] Stenirri S et al: "Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations."

No. Sentence Comment

35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment
34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment

PMID: 12515255 [PubMed] Ducroq D et al: "The ABCA4 gene in autosomal recessive cone-rod dystrophies."

No. Sentence Comment

30 Among these 13 patients, 2 were homozygotes (from two consanguineous families), 4 were compound heterozygotes, and 7 were Letters to the Editor 1481 Table 1 ABCA4 Mutations in Patients with CRD Patient ABCA4 ALLELE 1 ABCA4 ALLELE 2 OriginNucleotide Change Effect Nucleotide Change Effect 16 AAC 286 GAC N96D - - France 52 ATC 466 GTC I156V - - North Africa 57 ATC 466 GTC I156V GGG 1819 AGG G607R North Africa 51 CGA 455 CAA 5084ϩ1G/A R152Q Frameshift CGC 3323 TGC AGT 6764 ATT R1108C S2256I France 11 CGT 764 TGT R255C - - France 41 GCC 3113 GTC A1038V - - France 60 CTG 3602 CGG L1201R AGT 6764 ATT S2256I South Africa 21 CTC 5908 TTC L1970F - - France 30 AGT 6764 ATT S2256I - - Africa 48 GAA 3259 TAA E1087X - - France 2 2617 del CT Frameshift 2617 del CT Frameshift Portugal 5 571-2A/G Frameshift 571-2A/G Frameshift Morocco 61 CGG 4918 TGG R1602W GGC 5929 AGC G1977S England single heterozygotes (see table 1). Login to comment
31 Among these 13 patients, 2 were homozygotes (from two consanguineous families), 4 were compound heterozygotes, and 7 were Letters to the Editor 1481 Table 1 ABCA4 Mutations in Patients with CRD Patient ABCA4 ALLELE 1 ABCA4 ALLELE 2 Origin Nucleotide Change Effect Nucleotide Change Effect 16 AAC 286 GAC N96D - - France 52 ATC 466 GTC I156V - - North Africa 57 ATC 466 GTC I156V GGG 1819 AGG G607R North Africa 51 CGA 455 CAA 5084af9;1G/A R152Q Frameshift CGC 3323 TGC AGT 6764 ATT R1108C S2256I France 11 CGT 764 TGT R255C - - France 41 GCC 3113 GTC A1038V - - France 60 CTG 3602 CGG L1201R AGT 6764 ATT S2256I South Africa 21 CTC 5908 TTC L1970F - - France 30 AGT 6764 ATT S2256I - - Africa 48 GAA 3259 TAA E1087X - - France 2 2617 del CT Frameshift 2617 del CT Frameshift Portugal 5 571-2A/G Frameshift 571-2A/G Frameshift Morocco 61 CGG 4918 TGG R1602W GGC 5929 AGC G1977S England single heterozygotes (see table 1). Login to comment

PMID: 11726554 [PubMed] Shroyer NF et al: "Cosegregation and functional analysis of mutant ABCR (ABCA4) alleles in families that manifest both Stargardt disease and age-related macular degeneration."

No. Sentence Comment

97 Pedigree Maternal allele Paternal allele AMD relative A priori Cosegregation AR19 pGM, -6 0.5 - AR33 [W1408R; R1640W] R24H and D1532N mA, -16 0.5 Yes AR59 4232insTATG C1488R pGM, -6 0.5 No AR80 T1526M pGF, -5 0.5 - AR80 T1526M mGF, -7 0.5 Yes AR125 4947delC C1488R pGM, -7 0.5 Yes AR215 [H1406Y; V2050L] pGM, -5 0.5 - AR218 2160+1G→C G1961E mA, -8 0.5 No AR262 W821R pGGF, -7 0.25 No AR271 P68R E1087K mGA, -6 0.25 No AR335 D645N F608I mGM, -9 0.5 Yes AR382 R1108C mGM, -6 0.5 Yes AR389 E2096K 5714+5G→A pGM, -8 0.5 Yes AR397 5196+1G→A 5585-1G→A mA, -5 0.5 No AR410 A1038V 768G→T pC, -5 0.25 Yes AR422 pGM, -6 0.5 - AR423 P1380L D1532N pGF, -4 0.5 No AR468 P1380L P1380L mU, -9 0.5 Yes AR484 L2027F G550R mGU, -5 0.25 Yes AR562 R2107H 3050+5G→A pGU, -5 0.25 No AR643 5196+2T→C L2027F mU, -4 0.5 Yes AR661 P1380L C54Y mGF, -6 0.5 Yes AR669 664del13 pGF, -4 0.5 No AR534 W821R P1380L pGM, -7 0.5 Yes (17) Family 1 R212C I2113M mGM, I-2 0.5 Yes (27) Family 2 R1108C R2107H mGM, I-2 0.5 Yes (27) Family 3 R212C G1977S mGF, I-1 0.5 Yes (27) 10.25 15 unlikely to account for many of the remaining alleles (our unpublished observations). Login to comment
114 Sun et al. (28) reported substantial defects in protein expression or ATP binding of eight AMD-associated mutations (R212C, G863A, A1038V, R1108C, R1129L, P1380L, G1961E and L2027F) and an abnormal increase in the ATPase activity of the D2177N mutation, and they reported mild defects or wild-type activity within the sensitivity of the assay in four other AMD-associated variants (E471K, C1488R, T1526M and R1898H). Login to comment

PMID: 11527935 [PubMed] Briggs CE et al: "Mutations in ABCR (ABCA4) in patients with Stargardt macular degeneration or cone-rod degeneration."

No. Sentence Comment

89 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 ϩ 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 ϩ 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 ϩ 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 ϩ 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 ϩ 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 ϩ 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. Login to comment
88 ABCR Sequence Changes Found in 118 Patients with Stargardt and 8 with CRD Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 21 Null Mutations 071-004 Met1Val ATG 3 GTC Het None 035-002* Ser84(insCAAA)30 251ins4 Het IVS36 af9; 1G 3 A 034-039 Ser84(insCAAA)30 251ins4 Het Gly1961Glu 032-018 Arg152Ter23 CGA 3 TGA Het Arg2107Cys 032-005 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-039 Ala222(del13bp) 666del13 [AAAGACGGTGCGC] Het None 032-060 [Ser278(delT); Arg1300Gln] [832delT; CGA 3 CAA] Het Pro1486Leu 032-066* Lys356Ter AAG 3 TAG Het Gln1513(insC) 032-072 - IVS13 af9; 2T 3 C Het Val77Glu 032-073 Arg681Ter21 CGA 3 TGA Het Leu1388Pro 034-016 Ser1071(insGT)31 3212insGT Het None 032-065 Ser1071(insGT)31 3212insGT Het None 035-003 Ile1114(delC)5 3340delC Het Pro1380Leu 007-014* - IVS26 af9; 1G 3 A Het Asn1345(insCA) 007-014* Asn1345(insCA) 4034insCA Het IVS26 af9; 1G 3 A 032-066* Gln1513(insC) 4538insC Het Lys356Ter 032-010 Gln1513(insC) 4538insC Het None 032-024 Pro1570(delC)16 4710delC Het Gly1961Glu 032-016 Thr1721 (delAC) delete AC @ nt 5161 Het Thr1525Met 035-002* - IVS36 af9; 1G 3 A23 Het Ser84(insCAAA) 034-031 Leu1741(del11) 5194del11 [GTGGTGGGCAT] Het Gly1961Glu 032-051 Trp1772Ter TGG 3 TGA Het None 032-022 - IVS41-2delA Het Gly1961Glu 032-081* Val1973(delG) 5917delG Hom None 034-017 Gly2100(delG) 6300delG Het Gly1961Glu 55 Missense and One In-Frame Deletion 032-020 Cys54Tyr15 TGC 3 TAC Het Gly863Ala 035-012 Cys54Tyr15 TGC 3 TAC Het Arg1108Cys 071-007 Cys54Tyr15 TGC 3 TAC Het Val935Ala 071-003 Asn58Lys AAC 3 AAG Het Leu1201Arg 032-069 Ala60Val15 GCG 3 GTG Het None 032-028 Gly65Glu16 GGA 3 GAA Het None 032-072 Val77Glu GTG 3 CAG Het IVS13 af9; 2T 3 C 034-013 Gln190His CAG 3 CAC Het Gly1961Glu 032-076 Leu244Pro CTG 3 CCG Hom None 032-012 Pro309Arg CCA 3 CGA Het Arg1300Gln 032-054 Phe525Cys TTT 3 TGT Het Ile1846Thr 032-046 Arg537Cys CGT 3 TGT Het Val989Ala 034-038 Arg537Cys CGT 3 TGT Het Gly863Ala 032-095 Leu541Pro18 CTA 3 CCA Het None 034-022 Leu541Pro18 CTA 3 CCA Het Leu2027Phe 035-001 Leu541Pro18 CTA 3 CCA Het None 032-009 Leu541Pro18 CTA 3 CCA Het None 032-023 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 034-035 [Leu541Pro18 ; Ala1038Val27 ] [CTA 3 CCA; GCC 3 GTC] Het Gly863Ala 032-011 Ala549Pro GCC 3 CCC Het Gly1961Glu 032-044 Gly550Arg GGA 3 AGA Het None 032-085 Arg602Gln CGG 3 CAG Het Val643Met 032-090 Gly607Arg GGG 3 AGG Het Leu2027Phe 032-085 Val643Met GTG 3 ATG Het Arg602Gln 032-042 Val767Asp30 GTC 3 GAG Het Pro1486Leu 071-006 Val767Asp30 GTC 3 GAG Het Ile1562Thr 032-014 Leu797Pro CTG 3 CCG Het Pro1486Leu 032-038 Trp821Arg18 TGG 3 AGG Het None 034-045 Ile824Thr ATC 3 ACC Het Gly1961Glu 032-056 Gly863Ala5 GGA 3 GCA Het None 032-091 Gly863Ala5 GGA 3 GCA Het None 032-020 Gly863Ala5 GGA 3 GCA Het Cys54Tyr 032-023 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-011 Gly863Ala5 GGA 3 GCA Het Cys1488Arg 034-015 Gly863Ala5 GGA 3 GCA Het Thr1525Met 034-035 Gly863Ala5 GGA 3 GCA Het [Leu541Pro; Ala1038Val] 034-036 Gly863Ala5 GGA 3 GCA Het Cys2150Arg 034-038 Gly863Ala5 GGA 3 GCA Het Arg537Cys 071-007 Val935Ala GTA 3 GCA Het Cys54Tyr 032-043 Arg943Trp CGG 3 TGG Het Arg1108Leu 032-046 Val989Ala GTT 3 GCT Het Arg537Cys 071-005 Arg1108Cys18 CGC 3 TGC Het None IOVS, September 2001, Vol. 42, No. 10 ABCR in Stargardt Macular Degeneration Patient ID Mutations (Amino Acid Based) Sequence Change (Nucleotide Based) Het/Hom Other Sequence Changes 035-012 Arg1108Cys18 CGC 3 TGC Het Cys54Tyr 032-043 Arg1108Leu5 CGC 3 CTC Het Arg943Trp 032-097 Glu1122Lys18 GAG 3 AAG Het None 035-019 Glu1122Lys18 GAG 3 AAG Het None 071-003 Leu1201Arg15 CTG 3 CGG Het Asn58Lys 032-012 Arg1300Gln CGA 3 CAA Het Pro309Arg 032-068 Arg1300Gln CGA 3 CAA Het None 032-013 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-015 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 032-027 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 071-001 Pro1380Leu15 CCG 3 CTG Hom None 034-020 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-028 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 034-044 Pro1380Leu15 CCG 3 CTG Het Leu2027Phe 034-048 Pro1380Leu15 CCG 3 CTG Het Gly1961Glu 035-003 Pro1380Leu15 CCG 3 CTG Het Ile1114(delC) 032-073 Leu1388Pro CTG 3 CCG Het Arg681Ter 034-040 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 035-013 Trp1408Arg15 TGG 3 CGG Het Arg1640Trp 032-060 Pro1486Leu20 CCA 3 CTA Het [Ser278(delT); Arg1300Gln] 032-014 Pro1486Leu20 CCA 3 CTA Het Leu797Pro 032-025 Pro1486Leu20 CCA 3 CTA Het Asp1531Asn 032-042 Pro1486Leu20 CCA 3 CTA Het Val767Asp 034-011 Cys1488Arg15 TGC 3 CGC Het Gly863Ala 032-034 Cys1490Tyr15 TGC 3 TAC Het Ile1846Thr 032-084 Thr1525Met15 ACG 3 ATG Het Arg2139Trp 032-016 Thr1525Met15 ACG 3 ATG Het Thr1721(delAC) 032-021 Thr1525Met15 ACG 3 ATG Het None 032-041 Thr1525Met15 ACG 3 ATG Het None 034-015 Thr1525Met15 ACG 3 ATG Het Gly863Ala 032-049 Asp1531Asn15 GAC 3 AAC Het Gly1961Glu 034-019 Asp1531Asn15 GAC 3 AAC Het None 032-025 Asp1531Asn15 GAC 3 AAC Het Pro1846Leu 071-006 Ile1562Thr27 ATT 3 ACT Het Val767Asp 034-040 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 035-013 Arg1640Trp18 CGG 3 TGG Het Trp1408Arg 032-030* Arg1640Gln CGG 3 CAG Hom None 032-019 Pro1776Leu CCC 3 CTC Het Gly1961Glu 032-034 Ile1846Thr21 ATT 3 ACT Het Cys1490Tyr 032-054 Ile1846Thr21 ATT 3 ACT Het Phe525Cys 032-011 Gly1961Glu27 GGA 3 GAA Het Ala549Pro 032-013 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-015 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-019 Gly1961Glu27 GGA 3 GAA Het Pro1776Leu 032-022 Gly1961Glu27 GGA 3 GAA Het IVS41-2delA 032-024 Gly1961Glu27 GGA 3 GAA Het Pro1570(delC) 032-027 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-040 Gly1961Glu27 GGA 3 GAA Het None 032-049 Gly1961Glu27 GGA 3 GAA Het Asp1531Asn 034-013 Gly1961Glu27 GGA 3 GAA Het Gln190His 034-017 Gly1961Glu27 GGA 3 GAA Het Gly2100(delG) 034-021 Gly1961Glu27 GGA 3 GAA Het None 034-025 Gly1961Glu27 GGA 3 GAA Het None 034-028 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 034-031 Gly1961Glu27 GGA 3 GAA Het Leu1741(del11) 034-033 Gly1961Glu27 GGA 3 GAA Het None 034-039 Gly1961Glu27 GGA 3 GAA Het Ser84(insCAAA) 032-050 Gly1961Glu27 GGA 3 GAA Het None 034-045 Gly1961Glu27 GGA 3 GAA Het Ile824Thr 034-048 Gly1961Glu27 GGA 3 GAA Het Pro1380Leu 032-003 Gly1977Ser15 GGC 3 AGC Het Leu2027Phe 032-003 Leu2027Phe5 CTC 3 TTC Het Gly1977Ser 032-090 Leu2027Phe5 CTC 3 TTC Het Gly607Arg 034-006 Leu2027Phe5 CTC 3 TTC Het None 034-020 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 034-022 Leu2027Phe5 CTC 3 TTC Het Leu541Pro 034-044 Leu2027Phe5 CTC 3 TTC Het Pro1380Leu 035-011 Leu2027Phe5 CTC 3 TTC Het None 032-063 Arg2030Gln15 CGA 3 CAA Het None 032-093 Arg2030Gln15 CGA 3 CAA Het None 2232 Briggs et al. IOVS, September 2001, Vol. 42, No. 10 TABLE 1 (continued). Login to comment

PMID: 11385708 [PubMed] Paloma E et al: "Spectrum of ABCA4 (ABCR) gene mutations in Spanish patients with autosomal recessive macular dystrophies."

No. Sentence Comment

59 Pathogenic Mutations In the absence of a functional assay, it is difficult to relate the structural alteration with the TABLE 1. Summary of the Pathogenic Variants Found in the Screening of the ABCA4 Gene Family (NAS) Paternal allele (E) Maternal allele (E) Onset (years) Phenotype SB1 c.3211-3212insGT (22) R212C (6) 9 CRD M266 (2) c.4253+5G>A (28) L2060R (46) 7/4 CRD SM3 [R152Q (5); R2107H (46)] [R152Q (5); R2107H (46)] 7 STGD SZ2 L1940P (41) ND 8 STGD SM1 N1799D (38) ND 9 STGD SM2 c.2888delG (19) [R1055W (21); C.2588G>C (17)] 11 STGD SP1 ND ND 12 STGD SZ3 ND ND 12 STGD M280 N1805D (39) N1805D (39) 14 STGD SB2 (2) R1108C (22) L686S (14) 18/11 STGD SZ4 ND ND 20/28 FFM SP2 ND ND 21 FFM SM4 [T1253L (25); G1961E (42)] ND 38 FFM SZ1 L1940P (41) ND 28 FFM Novel putative pathogenic variants are depicted in bold type and their corresponding nucleotide changes are as follows: L686S=c.2057T>C; R1055W=c.3163C>T; T1253L=c.3758C>T; N1799D=c.5396A>G; N1805D=c.5413A>G; L1940P=c.5819T>C; L2060R=c.6179T>G. Login to comment
95 4) Mutation R1108C appears to show an even distribution (6/150 USA, 4/144 German, 1/55 French, and 1/14 Spanish patients). Login to comment

PMID: 11328755 [PubMed] Scholl HP et al: "L- and M-cone-driven electroretinograms in Stargardt's macular dystrophy-fundus flavimaculatus."

No. Sentence Comment

43 Characteristics of the Patients with SMD-FF Patient Sex Age (y) Age at Onset (y) VA CFC DF CV Exon (1) Mut (1) Exon (2) Mut (2) 1 M 32 29 0.6 Moderate ϩ Normal 48 L2241V NF 2 F 39 23 0.4 Moderate - Chaotic 14 W663X 42 G1961E 3 M 34 16 0.1 Moderate ϩ - 42 G1961E NF 4 M 49 17 0.1 Severe ϩ NP 6 G768T/splice 42 G1961E 5 F 36 35 0.6 Moderate ϩ VS (T) 6 C230S 42 G1961E 6 M 28 17 0.1 Mild ϩϩ INS 40 R1898H 43 G1975R 7 M 20 9 0.05 Moderate ϩϩ VS (P/D) 12 ϩ 21 L541P ϩ A1038V 40 IVS40 ϩ 5G 3 A 8 M 33 6 0.1 Mild - Chaotic NF NF 9 M 39 29 0.2 Moderate ϩ VS (P/D) 13 G607R 42 G1961E 10 M 38 22 0.1 Severe ϩ Chaotic NF NF 11 F 28 20 0.7 Mild ϩϩ INS 3 A60T 40 R1898H 12 M 46 30 0.5 Mild ϩ Chaotic 11 E471K 42 G1961E 13 F 25 11 0.1 Moderate ϩϩ S 17 G863A NF 14 F 51 41 0.8 Moderate ϩϩ NP 40 R1898H NF 15 F 23 17 0.1 Mild - Chaotic 3 P68L 36 S1689P 16 F 33 30 0.4 Mild - Chaotic 28 E1399K 42 G1961E 17 F 41 36 0.1 Severe ϩ VS (T) 29 F1440V 37 G1748R 18 M 59 54 0.1 Severe ϩ VS (P/D) 42 G1961E NF 19* M 35 15 0.05 Moderate ϩ Chaotic 17 G863A 37 Q1750X 20* M 43 14 HM Severe ϩϩ NP 17 G863A 37 Q1750X 21 F 46 16 0.1 Moderate ϩ NP NF NF 22 F 32 22 0.05 Moderate ϩ INS 21 A1038V NF 23 M 50 42 0.3 Severe ϩϩ VS (P/D) 12 ϩ 21 L541P ϩ A1038V 17 G863A 24 F 30 14 0.1 Moderate ϩϩ INS 17 G863A 40 IVS40 ϩ 5G 3 A 25 M 36 25 0.5 Moderate ϩϩ - 3 296INSA 21 A1038V 26 M 40 23 0.2 Moderate ϩ S 3 296INSA 42 G1961E 27 F 35 9 0.1 Severe ϩϩ VS (P/D) 22 R1108C NF 28 F 23 18 0.05 Mild ϩϩ S 28 E1399K 43 G1977S 29 F 25 18 0.2 Mild ϩ Chaotic 37 L1763P NF 30 F 16 11 0.1 Moderate ϩ Chaotic 22 R1108C NF 31 M 40 35 0.1 Moderate ϩϩ VS (P/D) 14 R681X NF 32 F 28 27 0.1 Moderate ϩ S 12 ϩ 21 L541P ϩ A1038V 21 A1038V 33 M 32 9 0.05 Severe ϩϩ Chaotic 28 Q1412X 45 R2077W 34 F 23 21 0.2 Moderate ϩ INS 6 G768T/splice NF 35 F 38 33 FC Moderate - Chaotic 17 G863A NF 36 F 39 10 HM Severe ϩϩ NP NF NF 37 F 13 8 0.1 Moderate ϩϩ S - - 38 F 27 25 0.2 Moderate ϩ Chaotic 17 G863A 28 Q1412X 39 M 16 15 0.1 Moderate ϩ VS (P/D) 12 ϩ 17 R572Q ϩ G863A 35 IVS35 ϩ 2T 3 A 40 M 27 26 0.6 Moderate - S 17 G863A NF 41 M 18 16 0.2 Moderate ϩ - - - 42 M 25 24 0.1 Mild - - NF NF 43 F 29 9 0.1 Moderate ϩ Chaotic 12 ϩ 21 L541P ϩ A1038V 42 G1961E 44 M 39 28 0.1 Mild - NP 6 N247S NF 45 F 23 12 0.05 Mild - NP 6 R212C 19 T959I 46 M 43 36 0.2 Moderate ϩ VS (P/D) 21 A1038V NF 47 M 21 18 0.4 Mild ϩϩ INS 28 Q1412X NF Shown are age at examination, age of onset, visual acuity, central fundus changes, and existence and distribution of the typical white-yellow flecks. Login to comment
44 Characteristics of the Patients with SMD-FF Patient Sex Age (y) Age at Onset (y) VA CFC DF CV Exon (1) Mut (1) Exon (2) Mut (2) 1 M 32 29 0.6 Moderate af9; Normal 48 L2241V NF 2 F 39 23 0.4 Moderate afa; Chaotic 14 W663X 42 G1961E 3 M 34 16 0.1 Moderate af9; - 42 G1961E NF 4 M 49 17 0.1 Severe af9; NP 6 G768T/splice 42 G1961E 5 F 36 35 0.6 Moderate af9; VS (T) 6 C230S 42 G1961E 6 M 28 17 0.1 Mild af9;af9; INS 40 R1898H 43 G1975R 7 M 20 9 0.05 Moderate af9;af9; VS (P/D) 12 af9; 21 L541P af9; A1038V 40 IVS40 af9; 5G 3 A 8 M 33 6 0.1 Mild afa; Chaotic NF NF 9 M 39 29 0.2 Moderate af9; VS (P/D) 13 G607R 42 G1961E 10 M 38 22 0.1 Severe af9; Chaotic NF NF 11 F 28 20 0.7 Mild af9;af9; INS 3 A60T 40 R1898H 12 M 46 30 0.5 Mild af9; Chaotic 11 E471K 42 G1961E 13 F 25 11 0.1 Moderate af9;af9; S 17 G863A NF 14 F 51 41 0.8 Moderate af9;af9; NP 40 R1898H NF 15 F 23 17 0.1 Mild afa; Chaotic 3 P68L 36 S1689P 16 F 33 30 0.4 Mild afa; Chaotic 28 E1399K 42 G1961E 17 F 41 36 0.1 Severe af9; VS (T) 29 F1440V 37 G1748R 18 M 59 54 0.1 Severe af9; VS (P/D) 42 G1961E NF 19* M 35 15 0.05 Moderate af9; Chaotic 17 G863A 37 Q1750X 20* M 43 14 HM Severe af9;af9; NP 17 G863A 37 Q1750X 21 F 46 16 0.1 Moderate af9; NP NF NF 22 F 32 22 0.05 Moderate af9; INS 21 A1038V NF 23 M 50 42 0.3 Severe af9;af9; VS (P/D) 12 af9; 21 L541P af9; A1038V 17 G863A 24 F 30 14 0.1 Moderate af9;af9; INS 17 G863A 40 IVS40 af9; 5G 3 A 25 M 36 25 0.5 Moderate af9;af9; - 3 296INSA 21 A1038V 26 M 40 23 0.2 Moderate af9; S 3 296INSA 42 G1961E 27 F 35 9 0.1 Severe af9;af9; VS (P/D) 22 R1108C NF 28 F 23 18 0.05 Mild af9;af9; S 28 E1399K 43 G1977S 29 F 25 18 0.2 Mild af9; Chaotic 37 L1763P NF 30 F 16 11 0.1 Moderate af9; Chaotic 22 R1108C NF 31 M 40 35 0.1 Moderate af9;af9; VS (P/D) 14 R681X NF 32 F 28 27 0.1 Moderate af9; S 12 af9; 21 L541P af9; A1038V 21 A1038V 33 M 32 9 0.05 Severe af9;af9; Chaotic 28 Q1412X 45 R2077W 34 F 23 21 0.2 Moderate af9; INS 6 G768T/splice NF 35 F 38 33 FC Moderate afa; Chaotic 17 G863A NF 36 F 39 10 HM Severe af9;af9; NP NF NF 37 F 13 8 0.1 Moderate af9;af9; S - - 38 F 27 25 0.2 Moderate af9; Chaotic 17 G863A 28 Q1412X 39 M 16 15 0.1 Moderate af9; VS (P/D) 12 af9; 17 R572Q af9; G863A 35 IVS35 af9; 2T 3 A 40 M 27 26 0.6 Moderate afa; S 17 G863A NF 41 M 18 16 0.2 Moderate af9; - - - 42 M 25 24 0.1 Mild afa; - NF NF 43 F 29 9 0.1 Moderate af9; Chaotic 12 af9; 21 L541P af9; A1038V 42 G1961E 44 M 39 28 0.1 Mild afa; NP 6 N247S NF 45 F 23 12 0.05 Mild afa; NP 6 R212C 19 T959I 46 M 43 36 0.2 Moderate af9; VS (P/D) 21 A1038V NF 47 M 21 18 0.4 Mild af9;af9; INS 28 Q1412X NF Shown are age at examination, age of onset, visual acuity, central fundus changes, and existence and distribution of the typical white-yellow flecks. Login to comment

PMID: 11328725 [PubMed] Webster AR et al: "An analysis of allelic variation in the ABCA4 gene."

No. Sentence Comment

102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
148 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His. Login to comment
103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
149 These included three nonconservative changes, Gly1961Glu, Arg1108Cys, and Arg212Cys, and five other changes that were conservative by our criteria, Leu541Pro, Ala1038Val, Pro1380Leu, Leu2027Phe, and Arg2107His. Login to comment

PMID: 11379881 [PubMed] Yatsenko AN et al: "Late-onset Stargardt disease is associated with missense mutations that map outside known functional regions of ABCR (ABCA4)."

No. Sentence Comment

65 Allele 1 nucleotide Amino acid Allele 2 Amino acid Age of change nucleotide change onset (years) AR129-08 37 AR140-01 6079C→T L2027F 3322C→T R1108C 36 AR204-04 35 AR280-03 6316C→T R2106C 6710insA T2237fs 35 AR311-04 4462T→C C1488R 35 AR336-03 2588G→C G863A 5898+1G→A E1966splice 39 AR343-06 2588G→C G863A 3322C→T R1108C 43 AR387-03 4919G→A R1640Q 2971G→C G991R 40 AR410-04 768G→T V256splice 3113C→T A1038V 38 AR440-03 6238-6239del2 bp S2080fs 44 AR448-01a 454C→T R152X 6089G→A R2030Q 52 AR452-04 2005-2006del2 bp M669fs 6089G→A R2030Q 40 AR455-05 [1622T→C;3113C→T] [L541P;A1038V] 43 AR474-02 36 AR516-01a 5196+1G→A I1732splice 3113C→T A1038V 47 AR518-03 3322C→T R1108C 35 AR540-01a 4685T→C I1562T 51 AR594-02a 5196+1G→A I1732splice 36 AR606-04 3322C→T R1108C 2588G→C G863A 39 AR608-02 1025-1038del14 bp D342fs 40 AR617-03 2827C→T R943W 39 AR632-02a 3386G→T R1129L 50 AR649-03 3303G→A W1101X 3113C→T A1038V 36 AR662-02a 1015T→G W339G 50 AR723-01a 3602T→G L1201R 65 Fig.1 Pedigrees of late-onset Stargardt disease families (filled symbols STGD1-affected individuals). Login to comment
71 Each of the two more common mutations, A1038V and R1108C, was identified in four disease chromosomes and together comprised 24% (8/33) of identified mutant alleles. Login to comment
87 Proband AR140-01 is a father with onset of STGD at 36 years and who carries two missense mutant alleles (L2027F, R1108C; Fig.1). Login to comment
134 Conversely, missense mutations located in other regions (e.g., missense mutations in late-onset STGD1) might retain some ABCR activity. This hypothesis is supported by the observations of Sun et al. (2000) that ABCR missense mutations located outside the known functional domains (L541P, G863A, A1038V, R1108C, R1129L, C1488R, R2106C) have a milder functional effect on expression and ATP-binding activity (1/3-2/3 activity of wild-type). Login to comment

PMID: 10958763 [PubMed] Rivera A et al: "A comprehensive survey of sequence variation in the ABCA4 (ABCR) gene in Stargardt disease and age-related macular degeneration."

No. Sentence Comment

80 Nucleotide alterations occurring in sim- Table 2 ABCA4 Mutations Found in Patients with STGD and AMD and in Controls EXON AND NUCLEOTIDE CHANGE EFFECT NO. OF ALLELES REFERENCE(S) STGD (288) AMD (400) Control (440) 3: 178GrA A60T 1 0 0 This study 179CrT A60E 1 0 0 This study 194GrA G65E 1 0 0 Fishman et al. (1999) 203CrT P68L 1 0 0 This study 214GrA G72R 1 0 0 This study 296insA Frameshift 2 0 0 This study 5: 454CrT R152X 1 0 0 This study 6: 634CrT R212C 1 0 0 Lewis et al. (1999) 688TrA C230S 1 0 0 This study 730delCT Frameshift 1 0 0 This study 740ArG N247S 1 0 0 This study 768GrT Splice 2 0 0 Maugeri et al. (1999) 8: 983ArT E328V 1a 0 0 This study 1086TrA Y362X 1 0 0 This study 10: 1317GrA W438X 1 0 0 This study 11: 1411GrA E471K 1 0 0 Lewis et al. (1999) 12: 1622TrC L541P 21a 1a 0 Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) 1715GrA R572Q 1a 0 0 Lewis et al. (1999) 13: 1819GrA G607R 1 0 0 This study 1903CrA Q635K 2a 0 0 This study 1903CrT Q635X 1 0 0 This study IVS13ϩ1GrA Splice 2 0 0 This study 14: 1957CrT R653C 1 0 0 This study 1988GrA W663X 1 0 0 This study 2041CrT R681X 4 0 0 Maugeri et al. (1999) 15: 2291GrA C764Y 1 0 0 This study 2292delT Frameshift 1a 0 0 This study 2295TrG S765R 1a 0 0 This study 16: 2564GrA W855X 1 0 0 Nasonkin et al. (1998) 17: 2588GrC Spliceb 17a 6 5 Allikmets et al. (1997a), Cremers et al. (1998), Lewis et al. (1999), Maugeri et al. (1999), Papaioannou et al. (2000) 18: 2701ArG T901A 0 2 0 This study 2741ArG H914A 0 0 1 This study 19: 2876CrT T959I 1 0 0 This study 20: IVS20ϩ5GrA Splice 1 0 0 This study 21: 3106GrA E1036K 1a 0 0 Nasonkin et al. (1998) 3113CrT A1038V 26a 4a 1 Allikmets et al. (1997a), Cremers et al. (1998), Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) T3187TrC S1063P 1 0 0 This study (Continued) 805 Table 2 Continued EXON AND NUCLEOTIDE CHANGE EFFECT NO. OF ALLELES REFERENCE(S) STGD (288) AMD (400) Control (440) 22: 3292CrT R1097C 1 0 0 This study 3322CrT R1108C 4 0 0 Rozet et al. (1998), Fishman et al. (1999), Lewis et al. (1999) 24: 3528insTGCA Frameshift 1 0 0 This study 25: 3808GrT E1270X 1 0 0 This study 27: 3898CrT R1300X 1 0 0 This study 28: IVS28ϩ5GrA Splice 1 0 0 This study 4139CrT P1380L 1 0 0 Lewis et al. (1999) 4195GrA E1399K 2 0 0 This study 4234CrT Q1412X 4 0 0 Maugeri et al. (1999) 29: 4289TrC L1430P 2 0 0 This study 4318TrG F1440V 1 0 0 This study 4328GrA R1443H 1 0 0 This study 30: 4457CrT P1486L 1 0 0 Lewis et al. (1999) 4463GrA C1488Y 1 0 0 This study 31: 4610CrT T1537M 1 0 0 This study 35: IVS35ϩ2TrA Splice 1 0 0 This study 36: 5065TrC S1689P 1 0 0 This study 5114GrT R1705L 1 0 0 This study IVS36ϩ1GrA Splice 1 0 0 This study 37: 5198TrC M1733T 0 0 1 This study 5242GrA G1748R 1 0 0 This study 5248CrT Q1750X 1 0 0 This study 5288TrC L1763P 1 0 0 This study 38: IVS38ϩ1GrA Splice 1 0 0 This study 40: 5653GrA E1885K 1 0 0 This study 5693GrA R1898H 5 2 1 Allikmets et al. (1997b), Lewis et al. (1999) IVS40ϩ5GrA Splice 8a 0 0 Cremers et al. (1998), Lewis et al. (1999), Maugeri et al. (1999) 42: 5882GrA G1961E 34 4 2 Allikmets et al. (1997b), Fishman et al. (1999), Lewis et al. (1999), Maugeri et al. (1999) 43: 5917delG Frameshift 3 0 0 This study 5923GrC G1975R 1 0 0 This study 5929GrA G1977S 1 0 0 Rozet et al. (1998), Lewis et al. (1999) 45: 6229CrG R2077G 1 0 0 This study 6229CrT R2077W 1 0 0 Allikmets et al. (1997a), Fishman et al. (1999), Lewis et al. (1999) 48: 6609CrA Y2203X 2 0 0 This study 6647GrT A2216V 0 0 1 This study a Mutation pairs occurring on a single haplotype. Login to comment
111 Likewise, for the intron 28 alteration, a spliced product Table 5 Patients with STGD Who Have Two Identified Disease Alleles AGE AT ONSET AND PATIENT MUTATION SEGREGATION IN FAMILY a Allele 1 Allele 2 5-9 years: STGD17 Q1412X R2077W Yes STGD88 G65E G1961E NA STGD93 G1961E G1961E Yes STGD99 L541P-A1038V G1961E Yes STGD100 L541P-A1038V IVS40ϩ5GrA Yes STGD108 Y362X IVS40ϩ5GrA Yes STGD109 L541P-A1038V W855X Yes STGD139b 5917delG 5917delG Yes STGD167 C1488Y IVS40ϩ5GrA Yes 10-14 years: STGD21 R681X R1898H NA STGD37 L541P-A1038V L541P-A1038V Yes STGD47/164 IVS13ϩ1GrA 2588GrC Yes STGD50 2588GrC A1038V NA STGD70 2588GrC IVS40ϩ5GrA NA STGD82 L541P-A1038V S1063P Yes STGD87 2588GrC Q1750X Yes STGD98 R212C T959I Yes STGD102 R572Q-2588GrC IVS35ϩ2TrA Yes STGD107 C764Y 3528ins4 Yes STGD120 L1430P L1430P NA STGD121 R1300X IVS40ϩ5GrA Yes STGD156 R1108C G1961E NA STGD159 R1108C Q1412X Yes STGD171 L541P-A1038V G1961E NA 15-19 years: STGD34 G768T G1961E Yes STGD39 L541P-A1038V R1443H NA STGD40/163 2588GrC E1885K Yes STGD45 E1399K G1977S Yes STGD59 R1898H G1975R NA STGD67 P68L S1689P Yes STGD75 Q635K IVS40ϩ5GrA Yes STGD111 2292delT-S765R G1961E Yes STGD114 Y2203X G1961E Yes STGD138 IVS13ϩ1GA 2588GrC Yes 20-24 years: STGD41 R681X G1961E Yes STGD63 A60T R1898H NA STGD86 296insA G1961E Yes STGD91 L541P-A1038V A1038V NA STGD113 L541P-A1038V 2588GrC Yes STGD118b IVS20ϩ5GrA G1961E Yes STGD119 L541P-A1038V G1961E Yes STGD122 L541P-A1038V G1961E Yes STGD135 W663X G1961E NA STGD147 IVS36ϩ1GrA G1961E Yes STGD168 L541P-A1038V G1961E NA 25-29 years: STGD62 G607R G1961E NA STGD71 296insA A1038V Yes STGD78 2588GrC Q1412X Yes STGD103 2588GrC IVS20ϩ5GrA Yes STGD116 L541P-A1038V G1961E Yes STGD139bb G1961E 5917delG Yes у30 years: STGD38 E471K G1961E Yes STGD68 E1399K G1961E Yes STGD69 L541P-A1038V 2588GrC NA STGD95 F1440V G1748R Yes STGD134 C230S G1961E NA STGD144 2588GrC R1705L NA STGD148 R1097C Y2203X NA STGD170 L541P-A1038V 2588GrC NA a NA p not applicable. Login to comment
156 These three alterations, in combination with five others (R681X, A1038V as noncomplex allele, R1108C, Q1412X, R1898H, and IVS40ϩ5GrA), account for 61.4% of the detectable disease chromosomes in the German patients with STGD. Login to comment

PMID: 10206579 [PubMed] Fishman GA et al: "Variation of clinical expression in patients with Stargardt dystrophy and sequence variations in the ABCR gene."

No. Sentence Comment

70 Clinical Features of Patients With ABCR Gene Mutations* Patient No./ Sex/Age, y Clinical Phenotype Vision Silent Choroid Central Scotoma MutationOD OS 1/M/19 I 20/200 20/200 ND + Thr300Asn, exon 8 2/M/44 I 20/25 20/15 - + Cys1488Arg, exon 30 3/M/35 I 20/100 20/100 ND + Gly1961Glu, exon 42 Cys2150Tyr, exon 47 4/M/44 I 20/200 20/200 - + Gly1961Glu, exon 42 5/F/28 I 20/80 20/100 - + Gly1961Glu, exon 42 Gly65Glu, exon 3 6/M/36 I 20/25 20/200 - + Gly1961Glu, exon 42 Arg2077Trp, exon 45 7/F/44 I 20/200 20/200 - + Gly1961Glu, exon 42 8/M/41 I 20/200 20/200 - + Gly1961Glu, exon 42 9/F/32 I 20/25 20/30 - + Gly1961Glu, exon 42 10/F/36 I 20/50 20/200 - + Gly1961Glu, exon 42 11/M/31 I 20/200 20/200 - + Gly1961Glu, exon 42 Ala1038Val, exon 21 Leu541Pro, exon 12 12/M/35 I 20/200 20/200 - + Arg2107His, exon 46 Leu1729Pro, exon 36 13/M/22 II 20/200 20/200 + + 1bp del (g), codon 448, exon 10 14/F/9 II 20/200 20/40 ND + 9bp del, codon 1760/1761, exon 37 1bp ins (c), codon 1513, exon 30 15/M/19 II 10/120 10/160 + + 1bp ins (c), codon 1513, exon 30 Ala60Val, exon 3 16/M/25 II 20/200 20/200 + ND Ser974Pro, exon 20 17/F/12 II 20/200 20/200 ND + 2884 del (c), exon 19 18/F/73 II 20/30 20/25 + Paracentral scotoma 5bp del, codon 505, exon 11 19/F/35 II 10/160 10/120 ND + Val849Ala, exon 16 20/F/48 II 20/400 20/400 + +; Mild peripheral restriction Val849Ala, exon 16 Arg2107His, exon 46 21/M/54 II 20/200 20/200 + + Arg2030stop, exon 44 22/M/28 II 20/400 20/400 + + His2128Arg, exon 46 23/F/34 III 10/400 10/225 Diffuse hyperfluorescence ND Arg2038Trp, exon 44 24/F/53 III 10/700 10/600 Diffuse hyperfluorescence and notable choroidal atrophy + Arg1108Cys, exon 22 25/F/54 III 10/350 3/350 Diffuse hyperfluorescence +; Mild concentric restriction Tyr1652Asp, exon 35 Arg2107His, exon 46 26/M/57 III 20/50 20/80 ND ND Splice donor GϾA, exon 24 27/F/65 III 1/225 1/225 Diffuse choroidal atrophy Temporal islands Gly1961Glu, exon 42 frameshift del, codons 1620-1622, exon 35† 28/M/32 III 20/400 20/400 Diffuse hyperfluorescence +; Peripheral restriction Ala1038Val, exon 21 Leu541Pro, exon 12 Donor splice, exon 30 29/M/46 III 10/225 10/225 ND +; Peripheral restriction Trp1408Leu, exon 28 Ser206Arg, exon 6 Arg2107His, exon 46 *M indicates male; F, female; ND, angiography or visual field testing not done; +, present; and -, absent. Login to comment

PMID: 9973280 [PubMed] Lewis RA et al: "Genotype/Phenotype analysis of a photoreceptor-specific ATP-binding cassette transporter gene, ABCR, in Stargardt disease."

No. Sentence Comment

76 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196ϩ1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196ϩ2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585-1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714ϩ5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898ϩ1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005ϩ1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253ϩ5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160ϩ1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539ϩ1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS ϭ frameshift. Login to comment
110 Seven mutant alleles, including six missense amino acid substitutions and one splice-site mutation (G863A, A1038V, R1108C, T1526M, G1961E, L2027F, and 5714ϩ5GrA) accounted for 41% of the disease-causing mutations identified in this cohort. Login to comment
111 In three instances, identical codons were affected by different base-pair substitutions, yielding different predicted missense amino acid substitutions (R572Q and R572P; R1129C and R1129L) or a missense substitution and a stop codon (R2030Q and R2030X). Login to comment
139 Different families with the same combination of alleles (e.g., AR326 and AR391, both with genotype L2027F/T1526M; AR376 and AR393, both with genotype A1038V/R1108C) usually have similar ages at onset, as was shown for Figure 4 Pedigree AR33, a family with STGD that manifests a pseudodominant inheritance pattern. Login to comment
178 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET ‫ע‬ SD (YEARS)Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 ‫ע‬ 12.7 51961GrA AR307 10 A1038V AR290 16 5714ϩ5GrA AR314 25 5898ϩ1GrT AR336 39 A1038V R572P AR321 6 12.5 ‫ע‬ 6.9 S1071L AR358 6 L1970F AR428 6 5196ϩ2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 ‫ע‬ 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 ‫ע‬ 4.5 C75G AR427 12 C1490Y AR370 13 2160ϩ1GrC AR218 14 4253ϩ5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 ‫ע‬ 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade. Login to comment
77 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196af9;1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196af9;2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585afa;1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714af9;5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898af9;1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005af9;1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253af9;5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160af9;1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539af9;1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS afd; frameshift. Login to comment
140 Different families with the same combination of alleles (e.g., AR326 and AR391, both with genotype L2027F/T1526M; AR376 and AR393, both with genotype A1038V/R1108C) usually have similar ages at onset, as was shown for Figure 4 Pedigree AR33, a family with STGD that manifests a pseudodominant inheritance pattern. Login to comment
179 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET cf2; SD (YEARS) Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 cf2; 12.7 51961GrA AR307 10 A1038V AR290 16 5714af9;5GrA AR314 25 5898af9;1GrT AR336 39 A1038V R572P AR321 6 12.5 cf2; 6.9 S1071L AR358 6 L1970F AR428 6 5196af9;2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 cf2; 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 cf2; 4.5 C75G AR427 12 C1490Y AR370 13 2160af9;1GrC AR218 14 4253af9;5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 cf2; 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade. Login to comment

PMID: 21911583 [PubMed] Zernant J et al: "Analysis of the ABCA4 gene by next-generation sequencing."

No. Sentence Comment

64 Mother is a carrier of a frequent c.3322Cb0e;T (p.R1108C) mutation. Login to comment

PMID: 23143460 [PubMed] Downes SM et al: "Detection rate of pathogenic mutations in ABCA4 using direct sequencing: clinical and research implications."

No. Sentence Comment

28 In 5 of the 11 patients, the identification of 2 pathogenic mutations confirmed the historical diagnosis and all had chorioretinal atro- Table. Results From Direct Sequencing of the ABCA4 Gene in 50 Patients Subject No. Change 1 Change 2 Phase Segregation Age at Onset, y Phenotype Grade, Macula Flecks/ Cones/Rodsa Additional Variants Conclusion Nucleotide Amino Acid Nucleotide Amino Acid 1 1Ab0e;G M1V 2588Gb0e;C G863A In trans Unaffected parents carriers 30 STGD maf9;/0/0 R2030Q 3 PVs 2 161Gb0e;A C54Y 2588Gb0e;C G863A In trans Affected sibling with same mutations 12 STGD m/0/0 0 2 PVs 3 161Gb0e;A C54Y 5882Gb0e;A G1961E NK NK 18 STGD m/0/0 0 2 PVs 4 634Cb0e;T R212C 4457Cb0e;T P1486L In trans Unaffected parents carriers 17 STGD m/0/0 0 2 PVs 5 2588Gb0e;C G863A 4469Gb0e;A C1490Y NK NK 48 STGD maf9;/0/1 0 2 PVs 6 2971Gb0e;C G991R 4254-2Ab0e;G Splice NK NK 21 STGD m/0/0 0 2 PVs 7 2971Gb0e;C G991R 3602Tb0e;G L1201R NK NK 18 STGD maf9;af9;/NP/NP V643M (likely), G885E (likely), G1441D (unlikely), V2244V (highly likely) b0e;2 PVs 8 3322Cb0e;T R1108C 768Gb0e;T V256V NK NK 13 STGD maf9;af9;/1/1 0 2 PVs 9 3322Cb0e;T R1108C 6079Cb0e;T L2027F NK NK 26 STGD maf9;/0/0 0 2 PVs 10 3386Gb0e;T R1129L 4469Gb0e;A C1490Y In trans Unaffected parents carriers 15 STGD maf9;/0/0 R152Q (unlikely) 2 PVs (continued) ARCH OPHTHALMOL/VOL 130 (NO. 11), NOV 2012 WWW.ARCHOPHTHALMOL.COM 1486 phy on current clinical examination, consistent with progression of the disorder.5 One of the 11 patients with chorioretinal atrophy (subject 40) had a single stop codon, again strongly supporting the original clinical diagnosis. Six of the 11 patients did not have pathogenic mutations in ABCA4. Login to comment

PMID: 23499370 [PubMed] Fujinami K et al: "A longitudinal study of stargardt disease: clinical and electrophysiologic assessment, progression, and genotype correlations."

No. Sentence Comment

89 Clinical Data and Molecular Genetic Status of 59 Patients With Stargardt Disease Pt Onset (y) Age (y) logMAR VA Variants Identifieda BL FU BL FU 1 16 17 26 0.0/1.0 0.0/0.48 c.768G>T / p.Gly863Ala / p.Arg943Gln 2 15 17 25 0.78/0.78 1.0/1.0 p. Arg1443His 3 11 18 27 0.78/1.0 1.0/1.0 p.Trp439* / p.Gly863Ala / p.Leu1970Phe 4 19 21 32 0.78/0.78 1.0/1.0 p.Leu2027Phe 5 10 22 30 0.48/0.48 1.0/0.78 p.Gly863Ala / p.Arg943Gln / c.5461-10 T>C 6 18 26 37 0.78/1.0 1.0/1.0 p.Pro1380Phe 7 25 28 40 0.78/1.0 1.3/0.78 ND 8 24 29 38 1.0/0.78 1.0/1.0 p.Phe418Ser / p.Leu2027Phe 9 24 31 44 1.0/1.0 1.3/1.0 c.4253&#fe;5 G>T / p.Gly1507Arg 10 26 32 44 0.78/0.78 1.0/1.0 p.Cys1490Tyr / p.Arg2030Gln 11 31 34 46 0.18/0.3 0.6/0.7 ND 12 17 35 47 1.0/1.0 1.0/1.0 p.Asn96His 13 23 35 45 1.0/0.3 1.0/0.48 p.Gly1513Profs*1554 14 33 37 48 0.18/1.48 1.0/1.3 ND 15 38 40 51 0.18/0.78 1.0/1.0 p.Arg2107His 16 42 43 53 0.0/0.0 1.0/1.0 ND 17 22 48 59 1.0/1.0 1.0/1.0 p.Cys54Tyr 18 20 49 59 1.0/0.6 1.0/1.0 p.Pro1380Leu / p.Gly1961Glu 19 35 50 61 1.0/0.3 1.0/1.0 p.Arg1108Cys 20 25 56 67 1.3/0.18 1.0/1.0 p.Trp439* / p.Gly863Ala 21 48 59 71 1.0/0.78 1.0/1.0 p. Ile156 Val / p. Cys1455Arg / p. Phe1839Ser 22 21 22 31 0.3/1.0 1.0/1.0 p.Arg2107His 23 21 23 33 1.0/1.0 1.0/1.0 p.Gly863Ala 24 48 64 73 0.0/1.0 0.18/3.0 p.Tyr1652* 25 17 19 29 0.78/0.3 1.0/1.0 c.5461-10 T>C 26 17 21 33 1.0/0.78 1.0/1.0 ND 27 27 53 66 1.78/1.78 1.3/1.0 p.Ser1071Cysfs*1084 28 5 14 21 0.78/0.78 1.0/1.0 p.Arg408* / p.Val675lle 29 9 15 27 1.08/1.08 1.0/1.0 p.Cys2150Tyr 30 14 24 32 1.0/0.78 1.0/1.0 ND 31 18 28 39 1.0/1.0 1.0/1.0 p.Gly863Ala / p.Arg1108Cys / p.Arg943Gln 32 14 29 37 1.0/1.0 1.0/1.0 p.Arg653Cys / p.Arg2030Gln 33 19 29 40 1.0/1.0 1.0/1.08 ND 34 34 40 49 0.3/0.48 1.0/1.0 p.Gly863Ala / p.Glu1087Lys 35 25 43 54 1.0/1.0 1.0/1.0 p.Cys54Tyr / p.Gly863Ala 36 38 60 69 1.0/1.0 1.3/1.08 p.Val931Met / c.5461-10 T>C 37 10 11 20 1.0/0.78 1.3/1.3 p.Pro1380Leu 38 10 15 23 1.0/1.0 1.3/1.3 p.Ser1071Cysfs*1084 / p.Pro1380Leu 39 24 25 38 1.56/0.3 2.0/2.0 c.5461-10 T>C / c.5714&#fe;5 G>A 40 18 26 36 1.3/1.3 2.0/1.3 ND 41 32 33 45 0.48/0.48 1.0/1.0 ND 42 32 35 46 1.3/0.0 3.0/1.0 p.Cys54Tyr 43 30 35 45 0.48/0.48 2.0/1.3 ND 44 15 41 49 1.3/1.3 2.0/1.3 p.Asn965Ser 45 8 8 20 0.78/0.78 1.0/1.0 p.Thr1019Met 46 10 11 23 1.0/1.0 1.0/1.0 p.Thr1019Met 47 8 12 24 2.0/1.56 1.78/1.48 p.Cys2150Tyr 48 17 18 26 1.0/0.78 1.3/1.0 c.5461-10 T>C / p.Leu2027Phe 49 8 21 33 1.3/1.3 2.0/2.0 p.Asp574Aspfs*582 50 8 27 39 2.0/1.56 1.78/1.48 c.5461-10 T>C 51 24 31 43 1.18/1.18 1.08/1.3 p.Arg1640Trp / p.Leu2027Phe Continued on next page respective electrophysiologic traces appear in Figure 2. Login to comment

PMID: 23953153 [PubMed] Fujinami K et al: "Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function."

No. Sentence Comment

141 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency 2 c.71G>A, p.Arg24His 1 0.36% 2 c.161G>A, p.Cys54Tyr 3 1.07% 3 c.223T>G, p.Cys75Gly 1 0.36% 5 c.455G>A, p.Arg152Gln 1 0.36% 5 c.454C>T, p.Arg152* 1 0.36% 5 c.466 A>G, p.Ile156Val 2 0.71% 6 c.634C>T, p. Arg212Cys 3 1.07% 6 c.656G>C, p.Arg219Thr 1 0.36% 6 c.666_678delAAAGACGGTGCGC, p.Lys223_Arg226delfs 2 0.71% 6 c.768G>T, Splicing site 4 1.42% 8 c.1037A>C, p.Lys346Thr 1 0.36% 10 c.1222C>T, p.Arg408* 3 1.07% 12 c.1622T>C, p.Leu541Pro 2 0.71% 12 c.1648 G>T, p.Gly550* 1 0.36% 13 c.1804C>T, p.Arg602Trp 1 0.36% 13 c.1817G>A, p.Gly606Asp 1 0.36% 13 c.1922G>C, p.Cys641Ser 1 0.36% Int 13 c.1937&#fe;1G>A, Splicing site 2 0.71% 14 c.1957C>T, p.Arg653Cys 2 0.71% 17 c.2588G>C, p.Gly863Ala 19 6.79% 18 c.2701A>G, p.Thr901Ala 1 0.36% 19 c.2791G>A, p.Val931Met 2 0.71% 19 c.2894A>G, p.Asn965Ser 1 0.36% 20 c.2966T>C, p.Vla989Ala 3 1.07% 20 c.2971G>C, p.Gly991Arg 2 0.71% 21 c.3056C>T, p.Thr1019Met 1 0.36% 21 c.3113C>T, p.Ala1038Val 3 1.07% 21 c.3064G>A, p.Glu1022Lys 2 0.71% 22 c.3211_3212insGT, p.Ser1071Cysfs 6 2.14% 22 c.3259G>A, p.Glu1087Lys 4 1.43% 22 c.3292C>T, p.Arg1098Cys 1 0.36% 22 c.3322C>T, p.Arg1108Cys 5 1.79% 22 c.3323G>A, p.Arg1108His 1 0.36% 23 c.3364G>A, p.Glu1122Lys 1 0.36% 23 c.3386G>A, p.Arg1129His 1 0.36% 24 c.3602T>G, p.Leu1201Arg 3 1.07% 27 c.3898C>T, p.Arg1300* 2 0.71% 28 c.4139C>T, p.Pro1380Leu 14 5.00% 28 c.4222T>C, p.Trp1408Arg 1 0.36% 28 c.4234C>T, p.Gly1412* 1 0.36% 28 c.4253&#fe;5G>T, Splice site 1 0.36% 28 c.4253&#fe;4C>T, Splice site 1 0.36% 29 c.4283C>T, p.Thr1428Met 1 0.36% 29 c.4319T>C, p.Phe1440Ser 1 0.36% 29 c.4462T>C, p.Cys1488Arg 1 0.36% 30 c.4469G>A, p.Cys1490Tyr 5 1.79% 30 c.4537_4538insC, p.Gly1513Profs 1 0.36% 31 c.4577C>T, p.Thr1526Met 2 0.71% 33 c.4715C>T, p.Thr1572Met 1 0.36% Continued on next page TABLE 3. Login to comment

PMID: 23982839 [PubMed] Fujinami K et al: "ABCA4 gene screening by next-generation sequencing in a British cohort."

No. Sentence Comment

55 1 c.161G>A p.C54Y DC c.2297G>T p.G766V DC 2 2 c.223T>G p.C75G DC c.5088C>G p.S1696R DC 2 3 c.740A>C p.N247T DC c.1433T>C p.I478T B c.2345G>A p.W782* DC 2 4 c.768G>T Splice site DC 1 5 c.1222C>T p.R408* DC c.2568C>A p.Y856* DC 2 6 c.1804C>T p.R602W DC c.859-9T>C Splice site PDC 2 7 c.1805G>A p.R602Q DC c.5113C>T p.R1705W DC 2 8 c.1922G>C p.C641S DC 1 9 c.1957C>T p.R653C DC 1 10 c.1957C>T p.R653C DC 1 11 c.2588G>C p.G863A DC c.655A>T p.R219* DC 2 Allele 2 (p.R219*) was APEX-false-negative 12 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 13 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 14 c.2588G>C p.G863A DC 1 15 c.2588G>C p.G863A DC 1 16 c.2894A>G p.N965S DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 17 c.3064G>A p.E1022K DC c.6729&#fe;4_&#fe;18delAGTTGGCCCTGGGGC Splice site DC 2 18 c.3064G>A p.E1022K DC 1 19 c.3208_3209insGT p.S1071fs DC c.2942C>T p.P981L DC c.6529G>A p.D2177N B 2 20 c.3208_3209insGT p.S1071fs DC c.1519G>T p.D507Y DC 2 21 c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 2 22 c.3208_3209insGT p.S1071fs DC 1 23 c.3292C>T p.R1098C DC c.3299T>A p.I1100N DC 2 24 c.3322C>T p.R1108C DC c.4978delC p.L1661* DC 2 25 c.3386G>A p.R1129H DC c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 3 Allele 2 (p.S1071fs) was APEX false-negative and allele 1 (p.R1129H) was NGS false-negative 26 c.4139C>T p.P1380L DC c.3191-1G>T Splice site DC 2 27 c.4139C>T p.P1380L DC c.3398T>C p.I1133T PDC 2 28 c.4139C>T p.P1380L DC c.4070C>A p.A1357E DC 2 29 c.4139C>T p.P1380L DC c.4773G>C Splice site DC 2 30 c.4139C>T p.P1380L DC 1 31 c.4139C>T p.P1380L DC 1 32 c.4139C>T p.P1380L DC 1 33 c.4234C>T p.Q1412* DC 1 34 c.4319T>C p.F1440S DC 1 35 c.4328G>A p.R1443H DC c.180delG p.M61fs DC 2 36 c.4469G>A p.C1490Y DC c.1726G>C p.D576H DC 2 37 c.4469G>A p.C1490Y DC 1 38 c.4537_4538insC p.Q1513fs DC c.5578C>T p.R1860W DC 2 Allele 1 (p.Q1513fs) was NGS-false-negative 39 c.4577C>T p.T1526M DC 1 T ABLE 2. Continued Pt Allele 1 Detected by APEX Allele 2 Detected by NGS Allele 3 Detected by NGS Total N of DC Variants Comments DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. Login to comment
56 40 c.4926C>G p.S1642R DC c.5041_5055del GTGGTTGCCATCTGC p.V1681_C1685del DC 2 41 c.4956T>G p.Y1652* DC 1 42 c.5018&#fe;2T>C Splice site DC 1 43 c.5461-10T>C DC c.6385A>G p.S2129G PDC 2 44 c.5461-10T>C DC 1 45 c.5461-10T>C DC 1 46 c.5461-10T>C DC 1 47 c.5461-10T>C DC 1 48 c.5461-10T>C DC 1 49 c.5461-10T>C DC 1 50 c.5461-10T>C DC 1 51 c.5585-1G>A Splice site DC 1 52 c.5714&#fe;5G>A Splice site DC c.6209C>G p.T2070R DC 2 53 c.5882G>A p.G1961E DC c.2686A>G p.K896E B 1 54 c.5882G>A p.G1961E DC c.3050&#fe;1G>C Splice site DC 2 55 c.5882G>A p.G1961E DC c.3392delC/3393C>G p.A1131Gfs DC 2 56 c.5882G>A p.G1961E DC c.4539&#fe;2T>G Splice site DC 2 57 c.5882G>A p.G1961E DC c.4552A>C p.S1518R DC 2 58 c.5882G>A p.G1961E DC c.5899-2delA Splice site DC 2 59 c.5882G>A p.G1961E DC 1 60 c.6079C>T p.L2027F DC c.1906C>T p.Q636* DC 2 61 c.6079C>T p.L2027F DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 62 c.6079C>T p.L2027F DC c.3370G>T p.D1124Y DC 2 63 c.6079C>T p.L2027F DC 1 64 c.6089G>A p.R2030Q DC c.4326C>A p.N1442K DC 2 65 c.6445C>T p.R2149* DC 1 66 c.6709A>C p.T2237P DC c.5899-3_5899-2delTA Splice site DC 2 67 c.2971G>C p.G991R B c.4538A>G p.Q1513R DC 1 68 c.3602T>G p.L1201R B c.1749G>C p.K583N DC 1 69 c.3602T>G p.L1201R B c.1982_1983insG p.A662fs DC 1 70 c.3602T>G p.L1201R B c.2972G>T p.G991V DC 1 71 c.4685T>C p.I1562T B c.3289A>T p.R1097* DC 1 72 c.6320G>A p.R2107H B c.2510T>C p.L837P DC 1 73 c.6320G>A p.R2107H B c.4352&#fe;1G>A Splice site DC 1 74 c.2701A>G p.T901A B 0 75 c.3602T>G p.L1201R B 0 76 c.4283C>T p.T1428M B 0 77 c.466A>G p.I156V B 0 78 c.466A>G p.I156V B 0 79 c.4715C>T p.T1572M B 0 Putative novel variants are shown in italics. Login to comment
62 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 3 c.161G>A p.C54Y 1 1 [ [ Lewis RA, et al. 11 Tol. 0.11 PRD 0.994 No change 1/13006 db SNP (rs150774447) 3 c.223T>G p.C75G 1 2 [ [ Lewis RA, et al. 11 Del. NA POD 0.603 No change ND 5 c.466A>G p.I156V 2 77, 78 [ [ Papaioannou M, et al. 16 Tol. 0.46 B 0.003 No change 16/13006 db SNP (rs112467008) Benign 6 c.655A>T p.R219* 1 11 [ Xi Q, et al. 27 ND 6 c.740A>C p.N247T 1 3 [ [ APEX Del. NA B 0.135 No change ND 6 c.768G>T Splice site 1 4 [ [ Klevering BJ, et al. 22 Tol. 0.56 NA Don. 70.4 58 Site broken (17.51) ND 9 c.1222C>T p.R408* 1 5 [ [ Webster AR, et al. 7 ND 12 c.1726G>C p.D576H 1 36 [ Downs K, et al. 25 POD 0.688 Acc. 68.1 39.1 Site broken (42.54) 1/13006 13 c.1804C>T p.R602W 1 6 [ [ Lewis RA, et al. 11 Del. 0.00 B 0.129 No change ND db SNP (rs 6179409) 13 c.1805G>A p.R602Q 1 7 [ [ Webster AR, et al. 7 Del. 0.04 PRD 0.513 Acc. 48.9 77.9 New site (&#fe;59.14) 2/13006 db SNP (rs61749410) 13 c.1906C>T p.Q636* 3 12, 13, 60 [ Zernant J, et al. 5 No change 1/13006 db SNP (rs145961131) 13 c.1922G>C p.C641S 1 8 [ [ Stenirri S, et al. 24 Del. 0.00 No change ND db SNP (rs61749416) 14 c.1957C>T p.R653C 2 9, 10 [ [ Rivera A, et al. 17 Del. 0.00 PRD 0.999 No change ND db SNP (rs61749420) 17 c.2588G>C p.G863A/ p.DelG863 5 11, 12, 13, 14, 15 [ [ Lewis RA, et al. 11 / Maugeri A, et al. 29 Del. 0.00 PRD 0.996 No change 68/13006 db SNP (rs76157638) 18 c.2701A>G p.T901A 1 74 [ [ APEX Tol. 0.82 B 0.008 23/13006 db SNP (rs139655975) Benign 19 c.2894A>G p.N965S 1 16 [ [ Lewis RA, et al. 11 Del. 0.03 PRD 0.981 Acc. 53.4 82.3 New site (&#fe;54.26) ND db SNP (rs201471607) 20 c.2971G>C p.G991R 1 67 [ [ Yatsenko AN, et al. 13 Del. 0.02 PRD 0.999 No change 28/13006 db SNP (rs147484266) Benign 22 c.3064G>A p.E1022K 2 17, 18 [ [ Webster AR, et al. 7 Del. 0.00 PRD 1.000 No change ND db SNP (rs61749459) 22 c.3208_3209insGT p.S1071fs 5 19, 20, 21, 22, 25 [ [ APEX ND False-negative in APEX in patient 25 22 c.3292C>T p.R1098C 1 23 [ [ Rivera A, et al. 17 Del. NA PRD 0.999 No change ND 22 c.3322C>T p.R1108C 3 16, 24, 61 [ [ Rozet JM, et al. 10 Del. 0.00 PRD 0.986 No change 1/13006 db SNP (rs61750120) False-negative in APEX in patients 16 and 61 23 c.3386G>A p.R1129H 1 25 [ Zernant J, et al. 5 PRD 0.989 No change ND False-negative in NGS in patient 25 24 c.3602T>G p.L1201R 4 72, 73, 74, 79 [ [ Lewis RA, et al. 11 Tol. 0.37 B 0.052 Don. 61.3 73.7 New site (20.08) 416/13006 db SNP (rs61750126) Benign 28 c.4139C>T p.P1380L 7 30, 31, 32, 33, 34, 35, 36 [ [ Lewis RA, et al. 11 Del. 0.01 B 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4234C>T p.Q1412* 1 33 [ [ Rivera A, et al. 17 ND db SNP (rs61750137) 29 c.4283C>T p.T1428M 1 76 [ [ APEX Tol. 0.15 B 0.010 No change 2/13006 db SNP (rs1800549) Benign 29 c.4319T>C p.F1440S 1 34 [ [ Lewis RA, et al. 11 Del. 0.00 POD 0.744 No change ND dbSNP (rs61750141) 29 c.4326C>A p.N1442K 1 64 [ Zernant J, et al. 5 Tol. NA POD 0.374 No change ND 29 c.4328G>A p.R1443H 1 35 [ [ Rivera A, et al. 17 Del. 0.02 PRD 0.999 No change 1/13006 dbSNP (rs61750142) IVS29 c.4352&#fe;1G>A Splice site 1 73 [ Zernant J, et al. 5 Don. 82.3 55.4 WT site broken (32.62) ND 30 c.4469G>A p.C1490Y 2 36, 37 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.994 No change ND dbSNP (rs61751402) 30 c.4538A>G p.Q1513R 1 67 [ Webster AR, et al. 7 Tol. NA Benign 0.043 Acc. 91.7 62.8 Site broken (31.55) ND T ABLE 3. Continued Exon/ IVS Nucleotide Substitution Protein Change/ Effect N of Alleles Identified Pt Method Previous Report SIFT Polyphen 2 HSF Matrix Allele Freq. by EVS Reference Comment APEX NGS Pred. Tol. Index (0-1) Pred. Login to comment
109 Three variants (p.R219*, p.R1108C, and p.S1071fs) found by NGS, were not identified by APEX at the prescreening stage despite being represented on the array (''APEX false-negative``; Table 2, patients 11, 16, 25, and 61). Login to comment
132 It recently has been proposed that intronic and synonymous variants may account for a significant proportion of the remaining disease-causing variants not identified with exomic NGS.5,39 There were two ''NGS false negative`` variants (p.R1129H and p.Q1513fs) and three ''APEX false negative`` variants (p.R219*, p.R1108C, and p.S1071fs) in our cohort. Login to comment
136 Two of those variants, p.R1108C, and p.S1071fs, were detected by APEX in other patients (Table 2). Login to comment

PMID: 24011517 [PubMed] Utz VM et al: "Identification of three ABCA4 sequence variations exclusive to African American patients in a cohort of patients with Stargardt disease."

No. Sentence Comment

65 Patient 1 was heterozygous for a second c.3322C>T missense mutation in exon 21 (p.R1108C), which was present in 4% of our patients and not unique to the African American subset (Table 2). Login to comment
87 Molecular Characteristics of Individual African American Patients with Stargardt Disease: Percentage of the Remaining Population, with the Specific Sequence Variations Identified Pt cDNA (Protein Product) % Popn (n &#bc; 75) cDNA (Protein Product) % Popn (n &#bc; 75) cDNA (Protein Product) % Popn (n &#bc; 75) 1 c.3602T>G (p.L1201R 0 c.3322C>T (p.R1108C) 4 2 c.3602T>G (p.L1201R) 0 3 c.3602T>G (p.L1201R) 0 c.4537delC (p.Q1513fsX1525) 0 c.5077G>A (p.V1693I) 0 4 c.3899G>A (p.R1300Q) 0 5 c.3899G>A (p.R1300Q) 0 c.618C>T (p.S207S) 0 c.2546T>C (p.V849A) 0 6 c.3899G>A (p.R1300Q) 0 c. Login to comment

PMID: 24550365 [PubMed] Huang WC et al: "Inner and outer retinal changes in retinal degenerations associated with ABCA4 mutations."

No. Sentence Comment

74 Characteristics of the ABCA4-Related Retinal Disease Patients Patient Age at Visits, y Sex Allele 1 Allele 2 Previous Report*ߤ P1 9, 12 M E341G F608I P2 9, 15 M R681X C2150Y P28* P3ߥ 12 M N965S W821R P1ߤ P4 13, 16 M V256V T1526M P21*, P15ߤ P5 14, 20 F W1408R IVS40&#fe;5 G>A P49* P6ߥ 16 F V989A IVS28&#fe;5 G>T P17ߤ P7ߥ 16 M N965S W821R P18ߤ P8 18, 20 F Y362X IVS38-10 T>C P9ߥ 18 F V989A IVS28&#fe;5 G>T P10 18, 22 M G1961E R1129L P3ߤ P11 20 M R1640Q c.5174_5175insG P12ߥ 20 M G1961E G1961E/P68L P13 22, 25 M G863A IVS35&#fe;2 T>C P20ߤ P14 22, 24 F G1961E R152X P12*, P21ߤ P15ߥ 23 M G1961E G1961E/P68L P16 25, 27 M G1961E R152X P11* P17 26, 32 F L1940P R1129L P64* P18 27, 34 F R1925G A1038V/L541P P19 27, 29 M c.4530_4531insC R1705Q P52*, P5ߤ P20 28, 30 F G1961E A1038V/L541P P23ߤ P21 31, 35 M T1019M G1961E P34* P22ߥ 32, 37 M P1486L Deletion of exon 7 P25ߤ P23 33, 35 M G863A R1108C P29*, P6ߤ P24 34, 37 F IVS40&#fe;5 G>A V935A P32*, P7ߤ P25 34 M G1961E &#a7; P8ߤ P26 37, 43 F C54Y G863A P4* P27 39, 44 F G863A C1490Y P30*, P26ߤ P28 40 M G1961E C54Y P7*, P10ߤ P29 41 F IVS38-10 T>C E1087D P59* P30ߥ 43, 47 F G1961E V256V P23*, P11ߤ P31ߥ 47, 51 F P1486L Deletion of exon 7 P32 47 M Y245X Y245X P20* P33ߥ 48, 51 F G1961E V256V P22*, P12ߤ P34 48, 50 F c.3208_3209insTG IVS40&#fe;5 G>A P35 50, 54 M V1433I L2027F P50* P36ߥ 52, 55 F T1526M R2030Q P55*, P28ߤ P37 53, 59 F G1961E P1380L P47*, P13ߤ P38ߥ 53, 61 M L1940P IVS40&#fe;5 G>A P61* P39 58 M D600E R18W P2*, P14ߤ P40 59, 62 M E1122K G1961E P44* P41 59, 62 F R1640Q G1961E P58* P42ߥ 62 F T1526M R2030Q P54* P43ߥ 64, 68 M L1940P IVS40&#fe;5 G>A P62* P44 68 F R1108C IVS40&#fe;5 G>A P42* P45 71 F IVS38-10 T>C &#a7; Novel variants are bold and italicized. Login to comment

PMID: 24677105 [PubMed] Burke TR et al: "Quantitative fundus autofluorescence in recessive Stargardt disease."

No. Sentence Comment

85 [L541P; A1038V]; p.L2027F 733 749 3.9 4.0 36 F 20 7 0.88 1.00 II II p.R1640W 571 552 3.4 3.8 37 F 12 3 0.80 0.80 I I p.R1108C; p.Q1412* 536 501 1.7 1.7 * All subjects were white, except for patients 10, 22, and 36 who were Indian, Hispanic, and black, respectively. Login to comment

PMID: 24713488 [PubMed] Bertelsen M et al: "Generalized choriocapillaris dystrophy, a distinct phenotype in the spectrum of ABCA4-associated retinopathies."

No. Sentence Comment

123 Summary of Detected Potential Pathogenic Variants (Known and Novel [in Bold Face]) Found in the ABCA4 Gene of Patients With Generalized Choriocapillaris Dystrophy Patient Method Mutation 1 Mutation 2 Nucleotide Protein Nucleotide Protein D513 NGS c.203C>T p.P68L c.2894A>G p.N965S D514 Microarray, NGS c.2894A>G p.N965S c.5461-10T>C - D516 NGS c.4926C>G p.S1642R c.5041_5055del p.V1681_C1685del D517 NGS c.5169C>G p.Y1723* c.6079C>T p.L2027F D137 Microarray, NGS c.2894A>G p.N965S c.2894A>G p.N965S D801 Microarray, NGS c.6386&#fe;1G>A Aberrant splicing c.4234C>T p.Q1412* D109 Microarray c.2894A>G p.N965S c.4234C>T p.Q1412* D040 Microarray c.6229C>T p.R2077W c.6229C>T p.R2077W D159 Microarray c.3113C>T p.L541P/A1038V c.3113C>T p.L541P/A1038V D129 Microarray c.2894A>G p.N965S c.3322C>T p.R1108C D115 Microarray c.2894A>G p.N965S c.3113C>T p.L541P/A1038V D033 Microarray c.2894A>G p.N965S c.2041C>T p.R681* D023 Microarray c.203C>T p.P68L c.3329-2A>G Aberrant splicing D001 Microarray c.666_678del p.K223_R226delfs c.4667&#fe;2T>C Aberrant splicing D147 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D162 Microarray c.3329-2A>G Aberrant splicing c.6089G>A p.R2030Q D022 Microarray, HRM c.4462T>C p.C1488R c.4102C>T p.R1368C D112 Microarray, HRM c.2894A>G p.N965S c.1529T>G p.L510R D108 Microarray, HRM c.1648G>A p.G550R c.4102C>T p.R1368C D107 Microarray c.666_678del p.K223_R226delfs c.2588G>C p.G863A D070 Microarray c.2588G>C p.G863A c.2588G>C p.G863A D116 Microarray c.2300T>A p.V767D c.5461-10T>C - D135 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D117 Microarray, HRM c.3191-2A>G Aberrant splicing c.2408delG p.G803fs D186 Microarray, HRM c.3322C>T p.R1108C c.6386&#fe;1G>A Aberrant splicing D173 Microarray, HRM c.4469G>A p.C1490Y c.2915C>A p.T972N TABLE 3. Login to comment
124 In Silico Analysis of ABCA4 Variants Detected in This Study Using Alamut 2.2 Software cDNA Variant Protein Variant Effect on Protein Function AGVGD Class SIFT Prediction Effect on Protein PPH2 Prediction Effect on Protein TASTER Prediction Effect on Splicing Missense variants c.203C>T p.P68L C65 Deleterious Probably damaging Disease causing c.1529T>G p.L510R C65 Deleterious Benign Polymorphism c.1622T>C p.L541P Reduced ATP binding mislocali- zation26,27 C65 Deleterious Probably damaging Disease causing c.1648G>A p.G550R C65 Deleterious Possibly damaging Disease causing New acceptor site c.2300T>A p.V767D Reduced protein28 C65 Deleterious Benign Disease causing c.2588G>C p.G863A Reduced protein level, reduced ATP binding, reduced ATPase activity26 C55 Deleterious Possibly damaging Disease causing Predicted change at acceptor site 1 bp upstream: 11.1%, creating a new stronger acceptor 3 bp downstream c.2894A>G p.N965S Reduced ATP binding26 C45 Deleterious Probably damaging Disease causing New acceptor site c.2915C>A p.T972N C55 Deleterious Probably damaging Disease causing c.3113C>T p.A1038V Reduced ATP binding, reduced ATP hydrolysis26 C65 Deleterious Benign Disease causing c.3322C>T p.R1108C Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing c.4102C>T p.R1368C C65 Deleterious Probably damaging Disease causing c.4462T>C p.C1488R C65 Deleterious Possibly damaging Disease causing c.4469G>A p.C1490Y Misfolding, mislocali- zation27 C65 Deleterious Probably damaging Disease causing Cryptic donor strongly activated c.4926C>G p.S1642R C25 Deleterious Benign Disease causing c.6079C>T p.L2027F Reduced ATP binding26,29 C15 Deleterious Probably damaging Disease causing c.6089G>A p.R2030Q C35 Deleterious Probably damaging Disease causing c.6229C>T p.R2077W Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing Deletion/frame-shift/stop variants c.666_678del p.K223_ R226delfs c.2041C>T p.R681* c.2408delG p.G803fs c.4234C>T p.Q1412* c.5041_5055del p.V1681_ C1685del c.5169C>G p.Y1723* Splicing affecting variants c.3191-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.3329-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.4667&#fe;2T>C Predicted change at donor site 2 bps upstream: 100% generalized choriocapillaris dystrophy have the occasional hallmarks of early Stargardt disease, such as vermillion fundus, fundus hyperautofluorescence, and a dark choroid on fluorescein angiograms. Login to comment

PMID: 25082885 [PubMed] Alapati A et al: "Molecular diagnostic testing by eyeGENE: analysis of patients with hereditary retinal dystrophy phenotypes involving central vision loss."

No. Sentence Comment

39 Mutations and Unknown Variants Detected in Patients With Central Vision Loss Patient Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Molecular Diagnosis Late-onset retinal degeneration NA CTRP5 NA NA NA NA NA NA Sorsby fundus dystrophy Patient 1 TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 Positive Patient 2 TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 Positive Patient 3 TIMP3 5 c.610A>T p.Ser204Cys Het Mut Positive Doyne honeycomb dystrophy Patient 1 EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut Positive Patient 2 EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut Positive Patient 3 EFEMP1 IVS10 c.IVS10-14C>T None Het vAR/us NA NA Unconfirmed Best macular dystrophy Patient 1 BEST1 2 c.28G>A p.Ala10Thr Het Mut Positive Patient 2 BEST1 2 c.47C>T p.Ser16Phe Het Mut Positive Patient 3 BEST1 2 c.72G>T p.Trp24Cys Het Mut Positive Patient 4 BEST1 3 c.240C>A p.Phe80Leu Het Mut Positive Patient 5 BEST1 3 c.240C>A p.Phe80Leu Het Mut Positive Patient 6 BEST1 4 c.248G>C p.Gly83Ala Het vAR/us Probably damaging 1 Positive Patient 7 BEST1 4 c.277T>C p.Trp93Arg Het vAR/us Probably damaging 1 Positive Patient 8 BEST1 4 c.279G>C p.Trp93Cys Het Mut Positive Patient 9 BEST1 6 c.652C>T p.Arg218Cys Het Mut Positive Patient 10 BEST1 6 c.652C>T p.Arg218Cys Het Mut Positive Patient 11 BEST1 6 c.680A>G p.Tyr227Cys Het Mut Positive Patient 12 BEST1 6 c.741G>A p.Arg218His Het Mut Positive Patient 13 BEST1 6 c.741G>A p.Arg218His Het Mut Positive Patient 14 BEST1 7 c.727G>A p.Ala243Thr Het Mut Positive Patient 15 BEST1 7 c.727G>A p.Ala243Thr Het Mut Positive Patient 16 BEST1 7 c.728C>T p.Ala243Val Het Mut Positive Patient 17 BEST1 7 c.728C>T p.Ala243Val Het Mut Positive Patient 18 BEST1 8 c.880C>T p.Leu294Phe Het vAR/us Probably damaging 1 Positive Patient 19 BEST1 8 c.887A>G p.Asn296Ser Het Mut Positive Patient 20 BEST1 8 c.903T>G p.Asp301Glu Het Mut Positive Patient 21 BEST1 8 c.903T>G p.Asp301Glu Het Mut Positive Patient 22 BEST1 8 c.910G>A p.Asp304Asn Het Mut Positive Patient 23 BEST1 8 c.925T>C p.Trp309Arg Het vAR/us Probably damaging 1 Positive Patient 24 BEST1 8 c.929T>C p.Ile310Thr Het Mut Positive Patient 25, case 3 BEST1 4 c.250T>G p.Phe84Val Het vAR/us Probably damaging 1 Positive Pattern dystrophy Patient 1 ABCA4 6 c.634C>T p.Arg212Cys Het Mut Positive ABCA4 30 c.4469G>A p.Cys1490Tyr Het Mut Patient 2 ABCA4 17 c.2588G>C p.Gly863Ala Het Mut Unconfirmed Patient 3 ABCA4 IVS26 c.3862&#fe;3A>G Abnormal splicing Het vAR/us Unconfirmed Patient 4 PRPH2 1 c.271T>A p.Tyr91Asn Het vAR/us Probably damaging 0.909 Positive PRPH2 1 c.310-313del(AT) p.Ile104Val Het Mut Patient 5, case 6 PRPH2 1 c.422A>G p.Tyr141Cys Het Mut Positive Patient 6 PRPH2 1 c.422A>G p.Tyr141Cys Het Mut Positive Patient 7 PRPH2 1 c.515G>A p.Arg172Gln Het Mut Positive Patient 8 PRPH2 2 c.583C>T p.Arg195Stop Het Mut Positive Patient 9 PRPH2 2 c.629C>G p.Pro210Arg Het Mut Positive Patient 10 PRPH2 2 c.635G>C p.Ser212Thr Het Mut Positive Patient 11 PRPH2 2 c.683C>T p.Thr228Ile Het Mut Positive Patient 12 PRPH2 2 c.708C>G p.Tyr236Stop Het Mut Positive Patient 13, case 4 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive TABLE 2. Continued Patient Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Molecular Diagnosis Patient 14 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 15 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 16 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut Positive Patient 17, case 2 ABCA4 IVS38 c.5461-10T>C None Het Mut Unconfirmed Patient 18 PRPH2 2 c.584G>A p.Arg195Gln Het vAR/us Probably damaging 1 Positive Cone-rod dystrophy Patient 1, dominant GUCY2D 13 c.2512C>T p.Arg838Cys Het Mut Positive Patient 2, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 3, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 4, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive Patient 5, dominant GUCY2D 13 c.2513G>A p.Arg838His Het Mut Positive CRX 3 c.607T>C p.Ser213Pro Het vAR/us Probably damaging 0.999 Patient 6, recessive ABCA4 2 c.156T>G p.His52Gln Het vAR/us Probably damaging 0.998 Positive ABCA4 3 c.161G>A p.Cys54Tyr Het Mut ABCA4 28 c.4169T>C p.Leu1390Pro Het Mut Patient 7, recessive ABCA4 16 c.2385C>T p.Ser795Arg Het vAR/us Probably damaging 0.99 Positive ABCA4 IVS40 c.5714&#fe;5G>A Splice Het Mut Patient 8, recessive ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut Positive ABCA4 45 c.6221G>T p.Gly2074Val Het vAR/us Probably damaging 1 Patient 9, recessive ABCA4 IVS42 c.5898&#fe;1G<A Splice Het Mut Positive ABCA4 IVS42 c.5899-2delA Splice Het Mut Patient 10, recessive ABCA4 5 c.559C>T p.Arg187Cys Het Mut Positive ABCA4 40 c.5645T>C p.Met1882Thr Het Mut Patient 11, recessive ABCA4 6 c.768G>T p.Val256Val (abnlspl) Het Mut Positive ABCA4 31 c.4577C>T p.Thr1526Met Het Mut Patient 12, recessive ABCA4 12 c.1622T>C p.Leu541Pro Het Mut Positive ABCA4 21 c.3113C>T p.Ala1038Val Het Mut ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut ABCA4 22 c.3322C>T p.Arg1108Cys Het Mut Patient 13, recessive ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut Positive ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut Patient 14, recessive ABCA4 13 c.1927G>A p.Val643Met Het Mut Positive ABCA4 24 c.3602T>G p.Leu1201Arg Het Mut ABCA4 36 c.5186T>C p.Leu1729Pro Het Mut Patient 15, recessive ABCA4 23 c.3364G>A p.Glu1122Lys Het Mut Positive ABCA4 48 c.6529G>A p.Asp2177Asn Het Mut Patient 16, recessive ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut Positive ABCA4 28 c.4222T>C p.Trp1408Arg Het Mut Patient 17, recessive ABCA4 11 c.1532G>A p.Arg511His Het Mut Unconfirmed Patient 18, recessive ABCA4 27 c.3899G>A p.Arg1300Gln Het vAR/us Benign 0.143 Unconfirmed Patient 19, recessive ABCA4 13 c.1933G>A p.Asp645Asn Het Mut Unconfirmed Patient 20, recessive ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut Unconfirmed Patient 21, recessive ABCA4 IVS7 c.859-9T>C Unknown Hom vAR/us NA NA Unconfirmed Molecular Diagnostic Testing by eyeGENE IOVS j September 2014 j Vol. 55 j No. 9 j were screened for the p.Arg838His mutation in GUCY2D, and mutations in the CRX, ELOVL4, PRPH2, and/or ABCA4 genes. Login to comment
116 Mutations or Unknown Variants Detected in Patients With Central Vision Loss Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Frequency* Variant ID Late-onset retinal degeneration CTRP5 NA NA NA NA NA NA NA NA NA Sorsby fundus dystrophy TIMP3 1 c.113C>G p.Ser38Cys Het vAR/us Probably damaging 1 2 TIMP3 5 c.610A>T p.Ser204Cys Het Mut 1 CM941325/ rs137853298 Doyne honeycomb dystrophy EFEMP1 9 c.1033C>T p.Arg345Trp Het Mut 2 CM990504 EFEMP1 IVS10 c.IVS10-14C>T None Het vAR/us NA NA 1 Best macular dystrophy BEST1 2 c.28G>A p.Ala10Thr Het Mut 1 CM982017 BEST1 2 c.47C>T p.Ser16Phe Het Mut 1 CM010520 BEST1 2 c.72G>T p.Trp24Cys Het Mut 1 CM982018 BEST1 3 c.240C>A p.Phe80Leu Het Mut 2 CM004423 BEST1 4 c.248G>C p.Gly83Ala Het vAR/us Probably damaging 1 1 BEST1 4 c.277T>C p.Trp93Arg Het vAR/us Probably damaging 1 1 BEST1 4 c.279G>C p.Trp93Cys Het Mut 1 rs28940273/ CM982021 BEST1 6 c.652C>T p.Arg218Cys Het Mut 2 CM982023 BEST1 6 c.680A>G p.Tyr227Cys Het Mut 1 CM982024 BEST1 6 c.741G>A p.Arg218His Het Mut 2 CM003486 BEST1 7 c.727G>A p.Ala243Thr Het Mut 2 CM004434 BEST1 7 c.728C>T p.Ala243Val Het Mut 2 rs28940570/ CM00841 BEST1 8 c.880C>T p.Leu294Phe Het vAR/us Probably damaging 1 1 BEST1 8 c.887A>G p.Asn296Ser Het Mut 1 CM010524 BEST1 8 c.903T>G p.Asp301Glu Het Mut 2 CM991243 BEST1 8 c.910G>A p.Asp304Asn Het Mut 1 CM024219 BEST1 8 c.925T>C p.Trp309Arg Het vAR/us Probably damaging 1 1 BEST1 8 c.929T>C p.Ile310Thr Het Mut 1 CM000843 BEST1 4 c.250T>G p.Phe84Val Het vAR/us Probably damaging 1 1 Pattern dystrophy ABCA4 6 c.634C>T p.Arg212Cys Het Mut 1 rs61750200 ABCA4 17 c.2588G>C p.Gly863Ala Het Mut 1 CM970003/ rs76157638 ABCA4 IVS26 c.3862&#fe;3A>G Abnormal splicing Het vAR/us 1 NA ABCA4 30 c.4469G>A p.Cys1490Tyr Het Mut 1 CM990056/ rs61751402 ABCA4 IVS38 c.5461-10T>C None Het Mut 1 CS057513 PRPH2 1 c.271T>A p.Tyr91Asn Het vAR/us Probably damaging .909 1 PRPH2 1 c.310-313del(AT) p.Ile104Val Het Mut 1 NA/Deletion PRPH2 1 c.422A>G p.Tyr141Cys Het Mut 2 CM010125/ rs61755781 PRPH2 1 c.515G>A p.Arg172Gln Het Mut 1 CM930637/ rs61755792 PRPH2 2 c.583C>T p.Arg195Stop Het Mut 1 CM032999 PRPH2 2 c.629C>G p.Pro210Arg Het Mut 1 CM941210 PRPH2 2 c.635G>C p.Ser212Thr Het Mut 1 CM971289/ rs61755801 PRPH2 2 c.683C>T p.Thr228Ile Het Mut 1 TMP_ESP_6_ 42672248 PRPH2 2 c.708C>G p.Tyr236Stop Het Mut 1 rs61755813 PRPH2 IVS2 c.828&#fe;3A>T Splice Het Mut 4 CS010139 PRPH2 2 c.584G>A p.Arg195Gln Het vAR/us Probably damaging 1 1 TABLE 3. Continued Gene Exon DNA Change Protein Change Genotype Result PolyPhen Description PolyPhen Score Frequency* Variant ID Cone-rod dystrophy ABCA4 2 c.156T>G p.His52Gln Het vAR/us Probably damaging 0.998 1 ABCA4 3 c.161G>A p.Cys54Tyr Het Mut 1 CM990012/ rs150774447 ABCA4 28 c.4169T>C p.Leu1390Pro Het Mut 1 CM014810/ rs61752430 ABCA4 16 c.2385C>T p.Ser795Arg Het vAR/us Probably damaging 0.99 1 ABCA4 IVS40 c.5714&#fe;5G>A Splice Het Mut 1 CS982057 ABCA4 27 c.3899G>A p.Arg1300Gln Het vAR/us Benign 0.143 1 ABCA4 32 c.4661A>G p.Glu1554Gly Het vAR/us Benign 0.326 1 ABCA4 30 c.4383G>A p.Trp1461Stop Het Mut 1 Stop/NA ABCA4 IVS38 c.5461-10T>C None Het Mut NA NA 2 CS057513 ABCA4 22 c.3259G>A p.Glu1087Lys Het Mut 1 CM970008/ rs61751398 ABCA4 42 c.5882G>A p.Gly1961Glu Het Mut 2 CM970016/ rs1800553 ABCA4 45 c.6221G>T p.Gly2074Val Het vAR/us Probably damaging 1 1 ABCA4 IVS42 c.5898&#fe;1G<A Splice Het Mut 1 CS011524 ABCA4 IVS42 c.5899-2delA Splice Het Mut 1 rs3112831 CRX 3 c.607T>C p.Ser213Pro Het vAR/us Probably damaging 0.999 1 ABCA4 5 c.559C>T p.Arg187Cys Het Mut 1 COSM913472 ABCA4 40 c.5645T>C p.Met1882Thr Het Mut 1 rs4147830 ABCA4 6 c.768G>T p.Val256Val (abnlspl) Het Mut 1 CM990057/ rs61750152 ABCA4 31 c.4577C>T p.Thr1526Met Het Mut 1 rs62645944 ABCA4 11 c.1532G>A p.Arg511His Het Mut 1 rs140482171 ABCA4 12 c.1622T>C p.Leu541Pro Het Mut 1 CM990022/ rs61751392 ABCA4 21 c.3113C>T p.Ala1038Val Het Mut 1 CM970006/ rs61751374 ABCA4 12 c.1622T>C p.Leu541Pro Hom Mut 2 CM990022/ rs61751392 ABCA4 21 c.3113C>T p.Ala1038Val Hom Mut 2 CM970006/ rs61751374 ABCA4 22 c.3322C>T p.Arg1108Cys Het Mut 1 CM990039/ rs61750120 ABCA4 13 c.1927G>A p.Val643Met Het Mut 1 CM014293/ rs61749417/ rs143548435 ABCA4 24 c.3602T>G p.Leu1201Arg Het Mut 1 CM990042/ rs61750126 ABCA4 36 c.5186T>C p.Leu1729Pro Het Mut 1 CM990062/ rs61750567 ABCA4 13 c.1933G>A p.Asp645Asn Het Mut 1 rs617494181933 ABCA4 23 c.3364G>A p.Glu1122Lys Het Mut 1 CM990041 ABCA4 48 c.6529G>A p.Asp2177Asn Het Mut 1 CM970023/ rs1800555 ABCA4 35 c.4918C>T p.Arg1640Trp Het Mut 2 CM983728/ rs61751404 ABCA4 28 c.4222T>C p.Trp1408Arg Het Mut 1 CM990048/ rs61750135 GUCY2D 13 c.2512C>T p.Arg838Cys Het Mut 1 rs61750172 GUCY2D 13 c.2513G>A p.Arg838His Het Mut 5 CM012606/ rs61750173 ABCA4 IVS7 c.859-9T>C Unknown Hom vAR/us NA NA 1 ABCA4 42 c.5882G>A p.Gly1961Glu Hom Mut 1 CM970016/ rs1800553 ABCA4 43 c.5917delG Deletion Hom Mut 1 RISN_ABCR: c.5917delG Molecular Diagnostic Testing by eyeGENE IOVS j September 2014 j Vol. 55 j No. 9 j Six patients with late-onset retinal pathology and drusen had well-characterized clinical data. Login to comment

PMID: 25139735 [PubMed] Lee W et al: "The external limiting membrane in early-onset Stargardt disease."

No. Sentence Comment

85 Summary of Demographic, Clinical and Genetic Characteristics Patient Age, y Ethnicity BCVA Snellen, logMAR Fishman Stage FFERG Group Flecks Estimated Disease Duration, yߤ ABCA4 Disease-Associated Alleles OD OS Allele 1 Allele 2 P1 10 Caucasian 20/30 (0.18) 20/25 (0.01) 1 1 Early 1 p.E160* p.R1108C P2 10 Caucasian 20/70 (0.54) 20/80 (0.60) 2 2 Early-late 0.5 p. Login to comment
89 [L541P;A1038V] p.L2027F P8 10 Caucasian 20/40 (0.30) 20/80 (0.60) 1 1 None-early 1 p.R1108C p.Q1412* P9 14 Caucasian 20/100 (0.70) 20/100 (0.70) 2 1 Early-late 0.5 p.T972N p.L2027F P10 9 Caucasian 20/150 (0.88) 20/400 (1.30) 2 1 Late ND c.5312&#fe;1G>A p.R2030* P11 15 Caucasian 20/200 (1.00) 20/200 (1.00) 2 2 Mid-late 3 p.L2027F p.R2077W P12 5 Caucasian 20/30 (0.18) 20/40 (0.30) 1 n/a ND c.5018&#fe;2T>C p.G1961E P13 10 Caucasian 20/200 (1.00) 20/200 (1.00) 2 2 Mid 4 p. Login to comment

PMID: 25342616 [PubMed] Duncker T et al: "Correlations among near-infrared and short-wavelength autofluorescence and spectral-domain optical coherence tomography in recessive Stargardt disease."

No. Sentence Comment

91 [L541P;A1038V] 5 14 22.4 F White Brown 0.8 0.8 p.R212C 3 15 20.2 M White Brown 0.9 0.9 p.G1961E p.P1380L 1 16 27.6 M Arabic Brown 0.0 0.0 p.R1300* p.R2106C 3 17 26.8 M White Blue 0.5 0.5 p.G1961E c.3050&#fe;5G>A 1 18 24.9 F White Hazel 0.9 0.9 p.G1961E p.C2150R 5 19 13.2 M White Blue 0.9 1.0 p.W821R p.C2150Y 3 20 61.0 F White Green 2.0 0.0 c.250_251insCAAA 2 21 36.3 F White Blue 1.3 0.1 p.N1799D 1 22 14.1 F White Green 1.0 0.9 p.R1108C p.Q1412* 2 23 18.6 M White Brown 0.9 0.9 p.G1961E p.A1773V 3 24 53.3 F White Blue 0.3 (0.2) p.R2077W 2 BCVA values in parenthesis indicate fellow eyes that were not included in the study. Login to comment

PMID: 26092729 [PubMed] Sabirzhanova I et al: "Rescuing Trafficking Mutants of the ATP-binding Cassette Protein, ABCA4, with Small Molecule Correctors as a Treatment for Stargardt Eye Disease."

No. Sentence Comment

6 Here, we have examined two disease-causing mutations in the NBD1 region of ABCA4, R1108C, and R1129C, which occur within regions of high similarity with CFTR, another ABC transporter gene, which is associated with cystic fibrosis. Login to comment
7 We show that R1108C and R1129C are both temperature-sensitive processing mutants that engage the cellular quality control mechanism and show a strong interaction with the chaperone Hsp 27. Login to comment
52 Two ABCA4 mutations, R1108C and R1129C, were generated using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) with the following oligos: for ABCA4 R1108C forward: TCCTGAAGTATTGCTCAGGCA, complement: TGCCTGAGCAATACTTCAGGA; for R1129C ABCA4 forward: AAGGGGACTGCATTGCCAT, complement: ATGGCAATGCAGTCCCCTT. Login to comment
53 The ABCA4 wild-type (wt), R1108C, and R1129C clones were each subcloned into the pcDNA5/FRT expression vector to generate stably transfected cells. Login to comment
54 Flp-In HEK-293 cells were transfected with pcDNA5/ FRT carrying ABCA4 wt, R1108C, or R1129C according to manufacturer`s protocol (Flp-Inࡊ System, Life Technologies). Login to comment
57 Hygromycin-resistant foci were isolated, expanded, and then analyzed for expression of ABCA4, R1108C, or R1129C by Western blotting. Login to comment
58 Biotinylation-HEK 293 cells stably expressing ABCA4, R1108C, or R1129C were exposed to sulfo-NHS-SS-biotin (Thermo Scientific) for 30 min on ice, rinsed three times with glycine quenching buffer (200 mM glycine and 25 mM Tris/HCl, pH 8.0, in DPBS with calcium and magnesium), and solubilized in lysis buffer (150 mM NaCl, 50 mM Tris/HCl, 1% Nonidet P-40, and protease inhibitors). Login to comment
76 The effect of proteasome, aggresome, and autophagosome inhibitors (MG132, tubacin, and bafilomycin A1, respectively) on wt ABCA4, R1108C, and R1129C mutations was also studied. Login to comment
80 For this study, we focused on two disease-causing mutations in ABCA4, R1108C, and R1129C, both of which are known to be less abundant than the wt (35). Login to comment
85 Fig. 2 shows that the steady-state protein levels of R1108C and R1129C were dramatically increased when cells were grown at reduced temperature. Login to comment
89 Fig. 3 shows that wt ABCA4 protein levels remained relatively constant, whereas the R1108C and R1129C proteins levels were greatly diminished over an 8 h period, indicating that both mutants were unstable and rapidly degraded. Login to comment
91 Although one might predict that blocking proteasomal degradation with MG-132 would lead to an increase in steady-state protein levels, as was seen for wt ABCA4, the steady-state protein expression of R1108C and R1129C actually decreased dramatically after treatment (Fig. 4). Login to comment
94 Only small changes in expressed protein levels occurred following bafilomycin A1 treatment in wt and R1108C ABCA4, whereas the level fell in the R1129C mutant (Fig. 6). Login to comment
101 Two mutations were selected for study (italics/bold), R1108C and R1129C. Login to comment
103 B, HEK-293 cell lines stably expressing wild type (wt) ABCA4, R1108C, or R1129C. Login to comment
104 R1108C and R1129C show a reduced expression of ABCA4 when compared with wt ABCA4. Login to comment
106 Rescuing ABCA4 Trafficking Mutants. AUGUST 7, 2015ߦVOLUME 290ߦNUMBER 32 JOURNAL OF BIOLOGICAL CHEMISTRY 19745 at SEMMELWEIS UNIV OF MEDICINE on December 4, R1108C and R1129C Have Heightened Interactions with Proteins Associated with Their Degradation-Folding of complex proteins such as ABCA4 relies on a series of chaperones. Login to comment
118 Temperature sensitivity of wt ABCA4, R1108C, and R1129C. Login to comment
119 HEK-293 cell lines stably expressing wild type (wt) ABCA4, R1108C, or R1129C were grown continuously at 37 &#b0;C or 27 &#b0;C. Growing cells with R1108C or R1129C at reduced temperature significantly increased the amount of ABCA4 expressed. Login to comment
124 Disappearance of protein from wt ABCA4 and from R1108C and R1129C mutants. Login to comment
125 HEK-293 cell lines stably expressing wt ABCA4, R1108C, or R1129C were treated with cycloheximide (25òe;g/ml) and harvested at 1, 2, 4, 6, or 8 h. The protein expressed from mutations R1108C and R1129C disappeared much faster than that from wt ABCA4 when protein translation was inhibited with cycloheximide, indicating that they are much less stable. Login to comment
128 19746 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290ߦNUMBER 32ߦAUGUST 7, 2015 VCP binding is consistent with the data presented earlier, showing that R1108C and R1129C are preferentially degraded in the aggresome. Login to comment
139 Proteasomal degradation pathway. HEK-293 cell lines stably expressing wt ABCA4, R1108C, or R1129C were treated for 16 h with increasing doses of proteasome inhibitor (MG-132). Login to comment
143 Aggesomal degradation pathway. HEK-293 cell lines stably expressing wt ABCA4, R1108C, or R1129C were treated for 16 h with increasing doses of the aggresome inhibitor tubacin. Login to comment
146 Lysosomal degradation pathway. HEK-293 cell lines stably expressing wt ABCA4, R1108C, or R1129C were treated for 16 h with increasing doses of the proton pump inhibitor of lysosomedegradation bafilomycin A. Login to comment
153 Like C3, another Class I corrector, C18, also produced a robust response, achieving a b03;2-fold maximum increase in protein expression with the R1108C and R1129C mutants (Fig. 12A). Login to comment
158 Quality control protein interactions with ABCA4, R1108C, and R1129C; total lysate (TL), and co-immunoprecipitate (IP). Login to comment
160 As a control, ABCA4 was immunoprecipitated with anti-ABCA4 antibody in the wt, R1108C, and R1129C cell lines. Login to comment
177 Fig. 12B shows that VX-809 was able to rescue both R1108C and R1129C. Login to comment
180 VX-809 Reduces the Interactions of R1108C and R1129C with Proteins Associated with Their Degradation-Figs. Login to comment
183 Interestingly, both correctors reduced the binding of wt (Fig. 16), R1108C (Fig. 17), and R1129C (Fig. 18) to HDAC6. Login to comment
192 It is not surprising that VCP binds to wt ABCA4 FIGURE 9. Effect of C4 on wt ABCA4 and the mutants R1108C and R1129C. Login to comment
195 FIGURE 10. Effect of C3 on wt ABCA4 and the mutants R1108C and R1129C. Login to comment
212 19750 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290ߦNUMBER 32ߦAUGUST 7, 2015 observations from our experiments here support our contention that R1108C and R1129C are degraded by the aggresome. Login to comment
221 This chaperone bound avidly to both R1108C and R1129C. Login to comment
230 Thus, enhanced HSP 27 binding to the ABCA4 mutants could FIGURE 13. Effect of the combination of C18 d19; C4 on wt ABCA4 and the mutants R1108C and R1129C. Login to comment
231 The HEK-293 cell line stably expressing wt ABCA4 was treated with increasing individual doses of C18af9;C4 for 16 h. The data are normalized to 0 òe;M. *, p b0d; 0.05. n afd; 3-4. Note that C18 af9; C4 did not signficantly increase the steady-state protein levels of the wt or R1108C mutant. Login to comment
233 FIGURE 14. Effect of the combination of C18 d19; C3 on wt ABCA4 and the mutants R1108C and R1129C. Login to comment
238 Although the precise defects in the structure of R1108C and R1129C are not known, given the similarity in the way that èc;F508-CFTR and these ABCA4 mutants interact with the cellular quality-control mechanism, we hypothesized that correctors that could rescue èc;F508-CFTR might also rescue R1108C and R1129C. Login to comment
241 FIGURE 15. Effect of VX-809 on the levels of wt ABCA4 and the mutants R1108C and R1129C at the cell surface.Note that treatment produced an increase in protein expression at the cell surface. Login to comment
256 As mentioned above, ABCA4 is a retinylidene-phosphatidylethanolamine transporter that facilitates the recycling of all- FIGURE 17. Effect of C18 and VX-809 on the binding of R1108C ABCA4 to Hsp 27 and HDAC6; total lysate (TL) and co-immunoprecipitate (IP). Login to comment
257 HEK 293 cell lines expressing R1108C were treated with C18 or VX-809, and ABCA4 was immunoprecipitated with anti-ABCA4 antibody. Western blotting was performed with anti-ABCA4, anti-HDAC6, and anti-HSP27 antibodies. HDAC6 showed reduced binding after treatment with C18 or VX-809; HSP27 binding was increased slightly after treatment with C18 or VX-809. Data are normalized to untreated control values. Login to comment
268 Thus, increased plasma membrane levels of both R1108C and R1129C suggests that the restoration of protein stability by VX-809 is sufficient to allow the mutant proteins to pass or avoid the checkpoints, and proceed to the plasma membrane. Login to comment
275 We show that R1108C and R1129C in NBD1 are both temperature-sensitive processing mutants that engage the cellular quality control mechanism via a strong interaction with the chaperone Hsp 27. Login to comment

PMID: 26103963 [PubMed] Boulanger-Scemama E et al: "Next-generation sequencing applied to a large French cone and cone-rod dystrophy cohort: mutation spectrum and new genotype-phenotype correlation."

No. Sentence Comment

104 + Highly - - - Novel CIC04965 Ad CRX NM_000554.4 Het 4 c.608_609del p.(S203Ffs*32) + - - - - Novel CIC3750 simplex CRX NM_000554.4 Het 3 c.121C>T p.(R41W) + Highly Prd D Dc (Swain et al. 1997) (rs104894672) CIC06321 simplex + RPGRIP1 NM_020366.3 Ho 14 c.2021C>A p.(P674H) + Highly Prd T Dc Novel CIC00190 simplex AIPL1 NM_014336.4 Het 5 c.769C>T p.(L257F) + Moderately Prd D Dc Novel AIPL1 NM_014336.4 Het 5 c.767T>G p.(I256S) + Moderately B D Dc Novel Lower confidence d CIC00162 Ar ABCA4 NM_000350.2 Het 31 c.4546_4547del p.(Q1516Afs*38) + - - - - Novel ABCA4 NM_000350.2 Het 16 c.2463G>A p.(W821*) + - - - - Novel CIC05987 Ar ABC4A NM_000350.2 Het 22 c.3295T>C p.(S1099P) + Highly Pd D Dc (Fumagalli et al. 2001) (rs61750119) [87] ABC4A NM_000350.2 Het 22 c.3322C>T p.(R1108C) Np - - - - (Briggs et al. 2001) [88] CIC06694 simplex ABC4A NM_000350.2 Het IVS36 c.5196+1G>A r.(spl?) Login to comment
105 Np - - - - (Kitiratschky et al. 2008) ABC4A NM_000350.2 Het 22 c.3322C>T p.(R1108C) Np - - - - (Briggs et al. 2001) [86] CIC02712 simplex + PDE6C NM_006204.3 Het 10 c.1325T>A p.(M442K) Np Moderately Pd D Dc Novel PDE6C NM_006204.3 Het 10 c.1375C>G p.(Q459E) Weakly B T Dc Novel CIC00597 simplex GUCY2D NM_000180.3 Het 14 c.2747T>C p.(I916T) + Moderately Prd D Dc (De Castro-Mir&#f3; et al. 2014) [89] CIC06352 simplex GUCA1A NM_000409.3 Het 3 c.149C>T p.(P50L) Np Moderately B T Dc (Downes et al. 2001) (rs104893968) [90] CIC07188 simplex PROM1 NM_006017.2 Het 12 c.1354dup p.(Y452Lfs*13) Np - - - - (Pras et al. 2009) PROM1 NM_006017.2 Het IVS 12 c.1454+2>C r.(spl?) Login to comment

PMID: 26207301 [PubMed] Park JC et al: "Objective Analysis of Hyperreflective Outer Retinal Bands Imaged by Optical Coherence Tomography in Patients With Stargardt Disease."

No. Sentence Comment

54 14 33 F 20/200 2 p.[(L541P;A1038V(;)I1684N)] 15 41 F 20/25&#fe;1 2 p.[(V989A)];[(V989A)] 16 45 F 20/25 2 p.[(I975M(;)K1978E)] 17 45 M 20/200 2 p.[(R1108C;Q876P)];[(Q876P)] 18 47 F 20/200 2 p.[(R1108C(;)G1961E)] 19 48 M 20/253 2 p.[(G1961E)];[(G1961E)] 20 48 M 20/100 2 p.[(G863A)];[(G863A)] BCVA, best-corrected visual acuity; ''?`` indicates that the second mutation was not identified. Login to comment

PMID: 26311262 [PubMed] Noupuu K et al: "Recessive Stargardt disease phenocopying hydroxychloroquine retinopathy."

No. Sentence Comment

53 [5461-10T > C] P2 55, F White 20/20 20/20 Mottling + flecks Mottling + flecks p. [A1357V]; [G1961E] P3 57, M African-American 20/20 20/20 BEM + flecks BEM + flecks p. [R2107H] P4 10, F White 20/30 20/25 BEM + flecks BEM + flecks p. [E160*]; [R1108C] P5 26, F African-American 20/30 20/20 Mottling + flecks Mottling + flecks p. [R2107H]; [E526A] P6 19, F Asian-Caucasian 20/25 20/25 BEM BEM p. [R602W] P7 26, M African-Arab 20/20 20/20 BEM BEM p. [R1300*]; [R2106C] P8 25, M White 20/20 20/40 BEM BEM p. [Q1003*]; [G1961E] Abbreviations: M male, F female, BCVA best-corrected visual acuity, OD right eye, OS left eye, BEM bull`s eye maculopathy Fig. 1 Thinning of the parafoveal region with relative foveal sparing presenting as the hydroxychloroquine retinopathy- associated parafoveal outer retina thinning phenotype in patients with recessive Stargardt disease (STGD1). Login to comment

PMID: 26551331 [PubMed] Duncker T et al: "Quantitative Fundus Autofluorescence and Optical Coherence Tomography in ABCA4 Carriers."

No. Sentence Comment

62 Continued Subject Sex Age Race/ Ethnicity Relationship to Proband ABCA4 Mutation BCVA, logMAR Eye Segmented qAF8 OD OS OD OS S38.3 M 50.9 White Father p.C2150Y 0.00 0.00 OS 336 380 S39.3 F 42.5 White Mother c.5714&#fe;5G>A 0.00 0.00 n/a 462 393 S39.4 F 18.4 White Sister c.5714&#fe;5G>A 0.00 0.00 n/a 222 212 S40.2 F 50.1 White Mother p.R2030Q 0.00 0.00 OD 433 n/a S40.3 M 48.8 White Father p.K1547* 0.00 0.00 OS n/a 477 S41.2 F 60.3 White Mother p.C54Y 0.00 0.00 OS n/a n/a S42.2 F 44.5 White Mother p.Q1412* 0.10 0.00 OS 264 291 S42.3 M 44.2 White Father p.R1108C 0.30 0.18 OD 264 232 S43.2 F 44.9 White Mother p.G1961E 0.00 0.00 OS 404 n/a S44.3 M 37.1 Asian Father c.4248_4250del 0.00 0.00 OD 307 317 S45.2 F 66.3 White Mother p.N965Y 0.18 0.40 n/a n/a n/a S45.3 M 68.0 White Father p.P1486L 0.00 0.00 n/a n/a n/a S46 M 32.3 White Spouseߤ p.T897I 0.12 0.12 OD 194 200 BCVA, best-corrected visual acuity; logMAR, logarithm of the minimum angle of resolution; OD, right eye; OS, left eye; qAF8, average quantitative autofluorescence of the 8 measurement sites from all available images per eye; n/a, not available. Login to comment
75 [W1408R;R1640W] 1.00 1.00 n/a n/a P 33.1&#a7; M 23.0 White p.R2030Q p.G1961E 1.00 1.00 334 347 P 34.1 M 46.9 White p.C1490Y p.G1961E 0.40 0.30 376 384 P 35.1ߥ M 24.8 White c.3050&#fe;5G>A p.G1961E 0.00 0.00 381 451 P 36.1ߥ F 29.3 Hispanic p.L541P p.G1961E 0.40 0.40 479 487 P 37.1ߤ F 24.7 White p.G1961E p.C2150R 0.88 0.88 405 396 P 38.1&#a7; M 11.7 White p.W821R p.C2150Y 0.40 0.40 306 n/a P 39.1 F 12.8 White p.P1380L c.5714&#fe;5G>A 0.60 0.40 558 573 P 39.2 M 14.1 White p.P1380L c.5714&#fe;5G>A 0.88 0.88 395 462 P 40.1ߤ F 16.2 White p.K1547* p.R2030Q 0.70 0.40 481 513 P 41.1 F 19.0 White p.C54Y 0.88 0.88 n/a n/a P 42.1ߤ F 13.0 White p.R1108C p.Q1412* 1.30 1.00 511 528 P 43.1ߤ M 17.4 White p.A1773V p.G1961E 0.88 0.88 340 366 P 44.1 M 14.0 Asian p.R408* c.4248_4250del 1.30 1.30 n/a n/a P 44.2 F 7.0 Asian p.R408* c.4248_4250del 1.30 1.30 n/a n/a P 45.1 F 42.4 White p.N965Y p.P1486L 0.10 0.40 n/a n/a BCVA, best-corrected visual acuity; logMAR, logarithm of the minimum angle of resolution; OD, right eye; OS, left eye; qAF8, average quantitative autofluorescence of the 8 measurement sites from all available images per eye; n/a, not available. Login to comment