ABCMdb

PMID: 26092729

Sabirzhanova I, Lopes Pacheco M, Rapino D, Grover R, Handa JT, Guggino WB, Cebotaru L
Rescuing Trafficking Mutants of the ATP-binding Cassette Protein, ABCA4, with Small Molecule Correctors as a Treatment for Stargardt Eye Disease.
J Biol Chem. 2015 Aug 7;290(32):19743-55. doi: 10.1074/jbc.M115.647685. Epub 2015 Jun 19., [PubMed]

Sentences

No. Mutations Sentence Comment

6 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Here, we have examined two disease-causing mutations in the NBD1 region of ABCA4, R1108C, and R1129C, which occur within regions of high similarity with CFTR, another ABC transporter gene, which is associated with cystic fibrosis. Login to comment 7 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys We show that R1108C and R1129C are both temperature-sensitive processing mutants that engage the cellular quality control mechanism and show a strong interaction with the chaperone Hsp 27. Login to comment 52 ABCA4 p.Arg1108Cys ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys ABCA4 p.Arg1129Cys Two ABCA4 mutations, R1108C and R1129C, were generated using a QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent Technologies) with the following oligos: for ABCA4 R1108C forward: TCCTGAAGTATTGCTCAGGCA, complement: TGCCTGAGCAATACTTCAGGA; for R1129C ABCA4 forward: AAGGGGACTGCATTGCCAT, complement: ATGGCAATGCAGTCCCCTT. Login to comment 53 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys The ABCA4 wild-type (wt), R1108C, and R1129C clones were each subcloned into the pcDNA5/FRT expression vector to generate stably transfected cells. Login to comment 54 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Flp-In HEK-293 cells were transfected with pcDNA5/ FRT carrying ABCA4 wt, R1108C, or R1129C according to manufacturer`s protocol (Flp-Inࡊ System, Life Technologies). Login to comment 57 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Hygromycin-resistant foci were isolated, expanded, and then analyzed for expression of ABCA4, R1108C, or R1129C by Western blotting. Login to comment 58 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Biotinylation-HEK 293 cells stably expressing ABCA4, R1108C, or R1129C were exposed to sulfo-NHS-SS-biotin (Thermo Scientific) for 30 min on ice, rinsed three times with glycine quenching buffer (200 mM glycine and 25 mM Tris/HCl, pH 8.0, in DPBS with calcium and magnesium), and solubilized in lysis buffer (150 mM NaCl, 50 mM Tris/HCl, 1% Nonidet P-40, and protease inhibitors). Login to comment 76 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys The effect of proteasome, aggresome, and autophagosome inhibitors (MG132, tubacin, and bafilomycin A1, respectively) on wt ABCA4, R1108C, and R1129C mutations was also studied. Login to comment 80 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys For this study, we focused on two disease-causing mutations in ABCA4, R1108C, and R1129C, both of which are known to be less abundant than the wt (35). Login to comment 85 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Fig. 2 shows that the steady-state protein levels of R1108C and R1129C were dramatically increased when cells were grown at reduced temperature. Login to comment 89 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Fig. 3 shows that wt ABCA4 protein levels remained relatively constant, whereas the R1108C and R1129C proteins levels were greatly diminished over an 8 h period, indicating that both mutants were unstable and rapidly degraded. Login to comment 91 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Although one might predict that blocking proteasomal degradation with MG-132 would lead to an increase in steady-state protein levels, as was seen for wt ABCA4, the steady-state protein expression of R1108C and R1129C actually decreased dramatically after treatment (Fig. 4). Login to comment 93 ABCA4 p.Arg1129Cys ABCA4 p.Arg1129Cys R1129C was particularly sensitive to tubacin treatment, increasing by nearly 2-fold (Fig. 5); for the R1129C mutant, the expressed protein actually exceeded that of wt ABCA4. Login to comment 94 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Only small changes in expressed protein levels occurred following bafilomycin A1 treatment in wt and R1108C ABCA4, whereas the level fell in the R1129C mutant (Fig. 6). Login to comment 101 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Two mutations were selected for study (italics/bold), R1108C and R1129C. Login to comment 103 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys B, HEK-293 cell lines stably expressing wild type (wt) ABCA4, R1108C, or R1129C. Login to comment 104 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys R1108C and R1129C show a reduced expression of ABCA4 when compared with wt ABCA4. Login to comment 106 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Rescuing ABCA4 Trafficking Mutants. AUGUST 7, 2015ߦVOLUME 290ߦNUMBER 32 JOURNAL OF BIOLOGICAL CHEMISTRY 19745 at SEMMELWEIS UNIV OF MEDICINE on December 4, R1108C and R1129C Have Heightened Interactions with Proteins Associated with Their Degradation-Folding of complex proteins such as ABCA4 relies on a series of chaperones. Login to comment 118 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Temperature sensitivity of wt ABCA4, R1108C, and R1129C. Login to comment 119 ABCA4 p.Arg1108Cys ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys ABCA4 p.Arg1129Cys HEK-293 cell lines stably expressing wild type (wt) ABCA4, R1108C, or R1129C were grown continuously at 37 &#b0;C or 27 &#b0;C. Growing cells with R1108C or R1129C at reduced temperature significantly increased the amount of ABCA4 expressed. Login to comment 124 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Disappearance of protein from wt ABCA4 and from R1108C and R1129C mutants. Login to comment 125 ABCA4 p.Arg1108Cys ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys ABCA4 p.Arg1129Cys HEK-293 cell lines stably expressing wt ABCA4, R1108C, or R1129C were treated with cycloheximide (25òe;g/ml) and harvested at 1, 2, 4, 6, or 8 h. The protein expressed from mutations R1108C and R1129C disappeared much faster than that from wt ABCA4 when protein translation was inhibited with cycloheximide, indicating that they are much less stable. Login to comment 128 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys 19746 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290ߦNUMBER 32ߦAUGUST 7, 2015 VCP binding is consistent with the data presented earlier, showing that R1108C and R1129C are preferentially degraded in the aggresome. Login to comment 139 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Proteasomal degradation pathway. HEK-293 cell lines stably expressing wt ABCA4, R1108C, or R1129C were treated for 16 h with increasing doses of proteasome inhibitor (MG-132). Login to comment 143 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Aggesomal degradation pathway. HEK-293 cell lines stably expressing wt ABCA4, R1108C, or R1129C were treated for 16 h with increasing doses of the aggresome inhibitor tubacin. Login to comment 146 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Lysosomal degradation pathway. HEK-293 cell lines stably expressing wt ABCA4, R1108C, or R1129C were treated for 16 h with increasing doses of the proton pump inhibitor of lysosomedegradation bafilomycin A. Login to comment 149 ABCA4 p.Arg1129Cys We next applied C3 and noted a more robust response, a nearly 2-fold increase, with the R1129C mutation showing the greatest response (Fig. 10). Login to comment 153 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Like C3, another Class I corrector, C18, also produced a robust response, achieving a b03;2-fold maximum increase in protein expression with the R1108C and R1129C mutants (Fig. 12A). Login to comment 158 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Quality control protein interactions with ABCA4, R1108C, and R1129C; total lysate (TL), and co-immunoprecipitate (IP). Login to comment 160 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys As a control, ABCA4 was immunoprecipitated with anti-ABCA4 antibody in the wt, R1108C, and R1129C cell lines. Login to comment 177 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Fig. 12B shows that VX-809 was able to rescue both R1108C and R1129C. Login to comment 180 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys VX-809 Reduces the Interactions of R1108C and R1129C with Proteins Associated with Their Degradation-Figs. Login to comment 183 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Interestingly, both correctors reduced the binding of wt (Fig. 16), R1108C (Fig. 17), and R1129C (Fig. 18) to HDAC6. Login to comment 192 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys It is not surprising that VCP binds to wt ABCA4 FIGURE 9. Effect of C4 on wt ABCA4 and the mutants R1108C and R1129C. Login to comment 194 ABCA4 p.Arg1129Cys The greatest effect was on the R1129C mutant. Ezrin was used as the loading control. Login to comment 195 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys FIGURE 10. Effect of C3 on wt ABCA4 and the mutants R1108C and R1129C. Login to comment 197 ABCA4 p.Arg1129Cys The greatest effect was on the wt and the R1129C mutant. Ezrin was used as the loading control. Login to comment 206 ABCA4 p.Arg1129Cys The greatest effect was on the wt and the R1129C mutant. Login to comment 212 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys 19750 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 290ߦNUMBER 32ߦAUGUST 7, 2015 observations from our experiments here support our contention that R1108C and R1129C are degraded by the aggresome. Login to comment 221 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys This chaperone bound avidly to both R1108C and R1129C. Login to comment 230 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Thus, enhanced HSP 27 binding to the ABCA4 mutants could FIGURE 13. Effect of the combination of C18 d19; C4 on wt ABCA4 and the mutants R1108C and R1129C. Login to comment 231 ABCA4 p.Arg1108Cys The HEK-293 cell line stably expressing wt ABCA4 was treated with increasing individual doses of C18af9;C4 for 16 h. The data are normalized to 0 òe;M. *, p b0d; 0.05. n afd; 3-4. Note that C18 af9; C4 did not signficantly increase the steady-state protein levels of the wt or R1108C mutant. Login to comment 232 ABCA4 p.Arg1129Cys There was a small effect on the R1129C mutant, but the overall effect was much less pronounced than that of C18 alone. Ezrin was used as the loading control. Login to comment 233 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys FIGURE 14. Effect of the combination of C18 d19; C3 on wt ABCA4 and the mutants R1108C and R1129C. Login to comment 238 ABCA4 p.Arg1108Cys ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys ABCA4 p.Arg1129Cys Although the precise defects in the structure of R1108C and R1129C are not known, given the similarity in the way that èc;F508-CFTR and these ABCA4 mutants interact with the cellular quality-control mechanism, we hypothesized that correctors that could rescue èc;F508-CFTR might also rescue R1108C and R1129C. Login to comment 241 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys FIGURE 15. Effect of VX-809 on the levels of wt ABCA4 and the mutants R1108C and R1129C at the cell surface.Note that treatment produced an increase in protein expression at the cell surface. Login to comment 256 ABCA4 p.Arg1108Cys As mentioned above, ABCA4 is a retinylidene-phosphatidylethanolamine transporter that facilitates the recycling of all- FIGURE 17. Effect of C18 and VX-809 on the binding of R1108C ABCA4 to Hsp 27 and HDAC6; total lysate (TL) and co-immunoprecipitate (IP). Login to comment 257 ABCA4 p.Arg1108Cys HEK 293 cell lines expressing R1108C were treated with C18 or VX-809, and ABCA4 was immunoprecipitated with anti-ABCA4 antibody. Western blotting was performed with anti-ABCA4, anti-HDAC6, and anti-HSP27 antibodies. HDAC6 showed reduced binding after treatment with C18 or VX-809; HSP27 binding was increased slightly after treatment with C18 or VX-809. Data are normalized to untreated control values. Login to comment 260 ABCA4 p.Arg1129Cys FIGURE 18. Effect of C18 and VX-809 on the binding of wt and mutant R1129C to Hsp 27 and HDAC6; total lysate (TL) and co-immunoprecipitate (IP). Login to comment 261 ABCA4 p.Arg1129Cys HEK 293 cell lines expressing R1129C were treated with C18 or VX-809, and ABCA4 was immunoprecipitated with anti-ABCA4 antibody as a control. Login to comment 268 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys Thus, increased plasma membrane levels of both R1108C and R1129C suggests that the restoration of protein stability by VX-809 is sufficient to allow the mutant proteins to pass or avoid the checkpoints, and proceed to the plasma membrane. Login to comment 275 ABCA4 p.Arg1108Cys ABCA4 p.Arg1129Cys We show that R1108C and R1129C in NBD1 are both temperature-sensitive processing mutants that engage the cellular quality control mechanism via a strong interaction with the chaperone Hsp 27. Login to comment