ABCMdb

PMID: 19019984

Pitonzo D, Yang Z, Matsumura Y, Johnson AE, Skach WR
Sequence-specific retention and regulated integration of a nascent membrane protein by the endoplasmic reticulum Sec61 translocon.
Mol Biol Cell. 2009 Jan;20(2):685-98. Epub 2008 Nov 19., [PubMed]

Sentences

No. Mutations Sentence Comment

43 ABCC7 p.Asp924Val MATERIALS AND METHODS Plasmid Construction CFTR expression plasmids encoding wild-type and D924V mutant have been described previously (Carveth et al., 2002) and encode a methionine ATG translation start codon followed by CFTR residues Glu838 to Tryp1204. Login to comment 46 ABCC7 p.Asp924Arg ABCC7 p.Asp924Val ABCC7 p.Asn894Ala ABCC7 p.Asn894Ala ABCC7 p.Asn900Ala ABCC7 p.Asn900Ala ABCC7 p.Ala923Asp ABCC7 p.Asp924Glu Mutants encoding D924E, D924R, and A923D/D924V as well as glycosylation mutants were generated by standard techniques using PCR overlap extension as described previously (Carveth et al., 2002) using the following sense (and corresponding antisense) oligonucleotides: GGGGCTAGCACTCATAGTAGAAATA- ACAG(N894A), CATTCTAGAGCGAACAGCTATGCAGTGATTAT(N900A), and GACAAAGGGGCTAGCACTCATTCTAGAGCGAAC(N894A/N900A). Login to comment 219 ABCC7 p.Asp924Val In both wild-type (WT) and D924V mutants, TM8 photocross-links were observed during initial stages of translocon insertion at truncations 957 and 967 (Figure 8). Login to comment 220 ABCC7 p.Asp924Val However, photoadducts to D924V decreased abruptly at truncation sites beyond residue 967 (Figure 8B), and no peptidyl-tRNA-independent photocross-links to residue 913 were observed (Figure 8A). Login to comment 221 ABCC7 p.Asp924Val Thus, the D924V mutant leaves the proximity of Sec61 at an earlier stage of synthesis than its wild-type counterpart and fails to exhibit peptidyl-tRNA-independent TM8-Sec61␣ interactions. Login to comment 222 ABCC7 p.Asp924Glu ABCC7 p.Asp924Glu When Asp924 was converted to glutamate, D924E, nascent chains truncated at residue 977 also continued to cross-link Sec61␣ after puromycin treatment, albeit to a lesser extent than wild type (Figure 9, A and B). Login to comment 223 ABCC7 p.Asp924Arg This was not simply due to the presence of a charged residue, because arginine substitution (D924R) reduced photocross-linking in tethered nascent chains and also eliminated Sec61␣ pho- tocross-linking after peptidyl-tRNA cleavage (Figure 9B). Login to comment 226 ABCC7 p.Asp924Val ABCC7 p.Ala923Asp We therefore moved the aspartate group 1 residue toward the N terminus to position 923 (A923D and D924V), which would be located at approxi- Figure 8. Login to comment 228 ABCC7 p.Asp924Val (A) Photocross-linking to integration intermediates (residues 837-977) containing WT and mutant (D924V) TM8 revealed similar UV-dependent photoadducts (upward arrowheads) for truncations 957 and 967 that disappeared after puromycin treatment. Login to comment 230 ABCC7 p.Asp924Val At truncations 977 and 987, photoadducts to WT TM8 increased in intensity and were peptidyl-tRNA independent (lanes 14 and 15 and 20 and 21), whereas photoadducts were absent for the D924V mutant (lanes 17, 18, 23, and 24). Login to comment 231 ABCC7 p.Asp924Val (B) Immunoprecipitation of photoadducts with Sec 61␣ antisera confirmed that the D924V mutation decreases Sec61␣ cross-linking at the same stage of synthesis when photocross-linking to WT TM8 becomes independent of the peptidyl-tRNA bond. Login to comment 250 ABCC7 p.Asp924Gln (A) Photocross-linking to CFTR integration intermediates (residues 837-977) containing the ␧-ANB-Lys probe at residue 913 in which Asp924 was mutated to glutamine (E), arginine (R), or valine (V). Login to comment 255 ABCC7 p.Asp924Val ABCC7 p.Ala923Asp A923D, D924V mutations decreased Sec61␣ photocross-linking (to residue 913) after puromycin treatment (compare lane 4 with lane 10) but significantly increased the peptidyl-tRNA-independent photocross-linking to residue 912 (lanes 2 and 8). Login to comment 283 ABCC7 p.Asp924Val Moreover, translocation termination is accomplished by both WT TM8 and the D924V mutant (Carveth et al., 2002), but integration is delayed only when an acidic residue is present. Login to comment