ABCMdb

ABCC7 p.Asn894Ala

Predicted by SNAP2:	A: N (53%), C: D (66%), D: D (59%), E: D (53%), F: D (75%), G: D (53%), H: D (63%), I: D (66%), K: D (53%), L: D (59%), M: D (66%), P: D (66%), Q: N (61%), R: D (53%), S: N (61%), T: N (66%), V: N (53%), W: D (80%), Y: D (59%),
Predicted by PROVEAN:	A: N, C: D, D: N, E: N, F: N, G: N, H: N, I: D, K: N, L: D, M: N, P: N, Q: N, R: N, S: N, T: N, V: D, W: N, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Most F508del-CFTR is targeted to degradation at an... Mol Cell Biol. 2005 Jun;25(12):5242-52. Farinha CM, Amaral MD
Most F508del-CFTR is targeted to degradation at an early folding checkpoint and independently of calnexin.
Mol Cell Biol. 2005 Jun;25(12):5242-52., [PMID:15923638]

Abstract [show]
Biosynthesis and folding of multidomain transmembrane proteins is a complex process. Structural fidelity is monitored by endoplasmic reticulum (ER) quality control involving the molecular chaperone calnexin. Retained misfolded proteins undergo ER-associated degradation (ERAD) through the ubiquitin-proteasome pathway. Our data show that the major degradation pathway of the cystic fibrosis transmembrane conductance regulator (CFTR) with F508del (the most frequent mutation found in patients with the genetic disease cystic fibrosis) from the ER is independent of calnexin. Moreover, our results demonstrate that inhibition of mannose-processing enzymes, unlike most substrate glycoproteins, does not stabilize F508del-CFTR, although wild-type (wt) CFTR is drastically stabilized under the same conditions. Together, our data support a novel model by which wt and F508del-CFTR undergo ERAD from two distinct checkpoints, the mutant being disposed of independently of N-glycosidic residues and calnexin, probably by the Hsc70/Hsp70 machinery, and wt CFTR undergoing glycan-mediated ERAD.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
208 As the N-glyconjugate is attached to asparagine residues 894 and 900 of CFTR, we replaced both these residues by either glutamine (N894Q and N900Q) or alanine (N894A and N900A) residues and studied the CFTR turnover of the resulting proteins on wt and F508del backgrounds when stably expressed in BHK cells as above. Login to comment
219 BHK cells stably expressing wt CFTR (A, lanes 1 to 5), N894A-N900A (WAA) (A, lanes 6 to 10), N894Q-N900Q (WQQ) (A, lanes 11 to 15), F508del-CFTR (B, lanes 1 to 5), F508del-N894A-N900A (FAA) (B, lanes 6 to 10), or F508del-N894Q-N900Q CFTR (FQQ) (B, lanes 11 to 15) were pulse-labeled and chased as before (Fig. 2) for 0 h (lanes 1, 6, and 11), 0.5 h (lanes 2, 7, and 12), 1 h (lanes 3, 8, and 13), 2 h (lanes 4, 9, and 14), and 3 h (lanes 5, 10, and 15). Login to comment
284 Asparagine residues at positions 894 and 900 were replaced by either two alanines (N894A and N900A) or two glutamines (N894Q and N900Q). Login to comment

[hide] Sequence-specific retention and regulated integrat... Mol Biol Cell. 2009 Jan;20(2):685-98. Epub 2008 Nov 19. Pitonzo D, Yang Z, Matsumura Y, Johnson AE, Skach WR
Sequence-specific retention and regulated integration of a nascent membrane protein by the endoplasmic reticulum Sec61 translocon.
Mol Biol Cell. 2009 Jan;20(2):685-98. Epub 2008 Nov 19., [PMID:19019984]

Abstract [show]
A defining feature of eukaryotic polytopic protein biogenesis involves integration, folding, and packing of hydrophobic transmembrane (TM) segments into the apolar environment of the lipid bilayer. In the endoplasmic reticulum, this process is facilitated by the Sec61 translocon. Here, we use a photocross-linking approach to examine integration intermediates derived from the ATP-binding cassette transporter cystic fibrosis transmembrane conductance regulator (CFTR) and show that the timing of translocon-mediated integration can be regulated at specific stages of synthesis. During CFTR biogenesis, the eighth TM segment exits the ribosome and enters the translocon in proximity to Sec61alpha. This interaction is initially weak, and TM8 spontaneously dissociates from the translocon when the nascent chain is released from the ribosome. Polypeptide extension by only a few residues, however, results in stable TM8-Sec61alpha photocross-links that persist after peptidyl-tRNA bond cleavage. Retention of these untethered polypeptides within the translocon requires ribosome binding and is mediated by an acidic residue, Asp924, near the center of the putative TM8 helix. Remarkably, at this stage of synthesis, nascent chain release from the translocon is also strongly inhibited by ATP depletion. These findings contrast with passive partitioning models and indicate that Sec61alpha can retain TMs and actively inhibit membrane integration in a sequence-specific and ATP-dependent manner.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Mutants encoding D924E, D924R, and A923D/D924V as well as glycosylation mutants were generated by standard techniques using PCR overlap extension as described previously (Carveth et al., 2002) using the following sense (and corresponding antisense) oligonucleotides: GGGGCTAGCACTCATAGTAGAAATA- ACAG(N894A), CATTCTAGAGCGAACAGCTATGCAGTGATTAT(N900A), and GACAAAGGGGCTAGCACTCATTCTAGAGCGAAC(N894A/N900A). Login to comment