ABCMdb

ABCC7 p.Asp924Arg

ClinVar:	c.2770G>A , p.Asp924Asn ? , not provided
CF databases:	c.2770G>A , p.Asp924Asn (CFTR1) ? , This substitution, located in a transmembrane domain, involves a residue conserved among species and affects the charge of the CFTR protein. It was found in the father of a fetus having hyperechogenic bowel. The man had a Polish origin. There was no family history of CF. The fetus inherited the mutation but no other anomaly was detected after scanning of almost all the CFTR coding regions and screening for 3849+10kbC->T and 1811+1.6kbA->G. The outcome of the pregnancy is still unknown. c.2770G>T , p.Asp924Tyr (CFTR1) ? ,
Predicted by SNAP2:	A: N (66%), C: N (53%), E: N (72%), F: D (66%), G: N (57%), H: D (71%), I: D (71%), K: D (66%), L: D (59%), M: D (66%), N: N (61%), P: D (75%), Q: D (63%), R: D (71%), S: N (66%), T: N (61%), V: D (63%), W: D (85%), Y: D (71%),
Predicted by PROVEAN:	A: N, C: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, R: N, S: N, T: N, V: N, W: D, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Cystic fibrosis-associated mutations at arginine 3... J Biol Chem. 1999 Feb 26;274(9):5429-35. Cotten JF, Welsh MJ
Cystic fibrosis-associated mutations at arginine 347 alter the pore architecture of CFTR. Evidence for disruption of a salt bridge.
J Biol Chem. 1999 Feb 26;274(9):5429-35., 1999-02-26 [PMID:10026154]

Abstract [show]
Arginine 347 in the sixth transmembrane domain of cystic fibrosis transmembrane conductance regulator (CFTR) is a site of four cystic fibrosis-associated mutations. To better understand the function of Arg-347 and to learn how mutations at this site disrupt channel activity, we mutated Arg-347 to Asp, Cys, Glu, His, Leu, or Lys and examined single-channel function. Every Arg-347 mutation examined, except R347K, had a destabilizing effect on the pore, causing the channel to flutter between two conductance states. Chloride flow through the larger conductance state was similar to that of wild-type CFTR, suggesting that the residue at position 347 does not interact directly with permeating anions. We hypothesized that Arg-347 stabilizes the channel through an electrostatic interaction with an anionic residue in another transmembrane domain. To test this, we mutated anionic residues (Asp-924, Asp-993, and Glu-1104) to Arg in the context of either R347E or R347D mutations. Interestingly, the D924R mutation complemented R347D, yielding a channel that behaved like wild-type CFTR. These data suggest that Arg-347 plays an important structural role in CFTR, at least in part by forming a salt bridge with Asp-924; cystic fibrosis-associated mutations disrupt this interaction.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Interestingly, the D924R mutation complemented R347D, yielding a channel that behaved like wild-type CFTR. Login to comment
119 Single-channel I-V relationships for R347E (OL and OB states), R347H (OL and OB states), R347K, R347D/D924R, and wild-type CFTR at pHc 6.0. n ϭ 2-4 at each data point. Login to comment
148 The Phenotype of R347D Is Suppressed by the D924R Mutation-The data suggest that Arg-347 and Lys-347 may stabilize the structure of the pore; in their absence, the channel "flickers" between two conductance states. Login to comment
154 We studied the conductance properties of the following double mutants: R347D/D924R, R347D/D993R, and R347E/E1104R. Login to comment
161 In contrast to the other double mutants, the R347D/D924R mutant did not display the pHc-dependent flicker found in the R347D single mutant (Fig. 5, A and B), and there was no effect of pH on open-channel variance (Fig. 5B). Login to comment
163 These data suggest that the D924R mutation compensates for or rescues the phenotype of the R347D mutation. Login to comment
164 This result predicts that the D924R mutation alone (with Arg at position 347) would generate an unstable channel with at least two open conductance states. Login to comment
165 Fig. 6 shows that the D924R single mutant displayed multiple (ϳ3) conductance states that appeared to be pHc-independent. Login to comment
179 A, single-channel current tracings from excised, inside-out membrane patches containing R347E/E1104R, R347D/D924R, and R347D/D993R. Login to comment
181 B, current variance of R347E/E1104R, R347D/D924R, and R347D/D993R at the indicated pHc was collected as in Fig. 3. Login to comment
199 Second, and more importantly, we found that a second-site complementary mutation at position 924 (D924R) largely eliminated the pHc-dependent flickering phenotype of the R347D mutation and restored current amplitude to near wild-type values. Login to comment
202 As predicted, we found that the D924R mutant displayed erratic flickery, pHc-independent behavior. Login to comment
204 The pHc independence of D924R is also consistent with the hypothesis that Asp-924 is the site of protonation in the residue 347 mutants. Login to comment
207 The studies of R347D/D924R are consistent with a salt bridge between Arg-347 and Asp-924 and thus an interaction between M6 and M8. Login to comment

[hide] Evidence for direct CFTR inhibition by CFTR(inh)-1... Biochem J. 2008 Jul 1;413(1):135-42. Caci E, Caputo A, Hinzpeter A, Arous N, Fanen P, Sonawane N, Verkman AS, Ravazzolo R, Zegarra-Moran O, Galietta LJ
Evidence for direct CFTR inhibition by CFTR(inh)-172 based on Arg347 mutagenesis.
Biochem J. 2008 Jul 1;413(1):135-42., 2008-07-01 [PMID:18366345]

Abstract [show]
CFTR (cystic fibrosis transmembrane conductance regulator) is an epithelial Cl- channel inhibited with high affinity and selectivity by the thiazolidinone compound CFTR(inh)-172. In the present study, we provide evidence that CFTR(inh)-172 acts directly on the CFTR. We introduced mutations in amino acid residues of the sixth transmembrane helix of the CFTR protein, a domain that has an important role in the formation of the channel pore. Basic and hydrophilic amino acids at positions 334-352 were replaced with alanine residues and the sensitivity to CFTR(inh)-172 was assessed using functional assays. We found that an arginine-to-alanine change at position 347 reduced the inhibitory potency of CFTR(inh)-172 by 20-30-fold. Mutagenesis of Arg347 to other amino acids also decreased the inhibitory potency, with aspartate producing near total loss of CFTR(inh)-172 activity. The results of the present study provide evidence that CFTR(inh)-172 interacts directly with CFTR, and that Arg347 is important for the interaction.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 CFTR form CFTRinh-172 Ki (μM) Hill coefficient I- influx (mM/s) n Wild-type 1.32 + - 0.25 1.03 + - 0.07 0.1336 + - 0.0107 10 S341A 0.57 + - 0.17 1.21 + - 0.37 0.0297 + - 0.0064 4 T338A 3.20 + - 0.86 1.13 + - 0.20 0.1260 + - 0.0225 4 R347A 44.98 + - 4.71** 0.91 + - 0.04 0.1288 + - 0.0154 7 R334A 2.39 + - 0.74 0.93 + - 017 0.0313 + - 0.062 4 A349S 1.23 + - 0.41 1.11 + - 0.25 0.1500 + - 0.011 4 R347D >50 Not determined 0.1160 + - 0.0136 7 R347D/D924R >50 Not determined 0.1008 + - 0.0504 4 R347C >50 Not determined 0.1437 + - 0.0123 4 Mock 0.003 + - 0.001 10 introduced a mutation at position 349 (an alanine residue replaced by a serine residue). Login to comment
134 Because Arg347 is believed to be involved in the formation of a salt bridge with Asp924 [25], we also tested the CFTR mutants D924A and D924R. Login to comment
136 To further investigate the importance of the salt bridge, we generated a double mutant, R347D/D924R, in which the positions of the charged amino acids are inverted. Login to comment
137 Interestingly, in contrast with D924R, the double mutant was able to transport anions but showed a low sensitivity to CFTRinh-172, with an estimated Ki greater than 50 μM (Figures 2A and 2B), similar to that of the single R347D mutant. Login to comment
138 We evaluated the maturation of the D924R mutant by immunoprecipitation followed by Western blot analysis or in vitro phosphorylation (Figure 2C). Login to comment
141 In contrast with R347D, the D924R mutation produced a partial defect in maturation, with increased band B intensity compared with band C. Interestingly, this defect seemed to be corrected in the double mutant R347D/D924R (Figure 2C). Login to comment
145 In contrast with all other constructs, D924A and D924R did not show a significant I- transport compared with mock-transfected cells. Login to comment
146 (B) CFTRinh-172 dose-response relationships for wild-type, R347D and R347D/D924R CFTR. Login to comment
200 Indeed, D924R causes a reduced amount of fully glycosylated protein (band C) that may indicate that the mutant protein is less stable. Login to comment
202 Interestingly, when we generated the double mutant R347D/D924R, in which the positions of positive and negative charges are inverted but the salt bridge is maintained [25], we Figure 6 Patch-clamp analysis of CFTR inhibition by CFTRinh-172 (A and C) Superimposed membrane currents recorded from cells expressing wild-type and the R347A mutant at membrane potentials between -100 and +100 mV. Login to comment
208 On the other hand, we found that the double mutant R347D/D924R did not behave as the wild-type CFTR in terms of CFTRinh-172 sensitivity but was more similar to single Arg347 mutants. Login to comment

[hide] Mutations at arginine 352 alter the pore architect... J Membr Biol. 2008 Mar;222(2):91-106. Epub 2008 Apr 18. Cui G, Zhang ZR, O'Brien AR, Song B, McCarty NA
Mutations at arginine 352 alter the pore architecture of CFTR.
J Membr Biol. 2008 Mar;222(2):91-106. Epub 2008 Apr 18., [PMID:18421494]

Abstract [show]
Arginine 352 (R352) in the sixth transmembrane domain of the cystic fibrosis transmembrane conductance regulator (CFTR) previously was reported to form an anion/cation selectivity filter and to provide positive charge in the intracellular vestibule. However, mutations at this site have nonspecific effects, such as inducing susceptibility of endogenous cysteines to chemical modification. We hypothesized that R352 stabilizes channel structure and that charge-destroying mutations at this site disrupt pore architecture, with multiple consequences. We tested the effects of mutations at R352 on conductance, anion selectivity and block by the sulfonylurea drug glipizide, using recordings of wild-type and mutant channels. Charge-altering mutations at R352 destabilized the open state and altered both selectivity and block. In contrast, R352K-CFTR was similar to wild-type. Full conductance state amplitude was similar to that of wild-type CFTR in all mutants except R352E, suggesting that R352 does not itself form an anion coordination site. In an attempt to identify an acidic residue that may interact with R352, we found that permeation properties were similarly affected by charge-reversing mutations at D993. Wild-type-like properties were rescued in R352E/D993R-CFTR, suggesting that R352 and D993 in the wild-type channel may interact to stabilize pore architecture. Finally, R352A-CFTR was sensitive to modification by externally applied MTSEA+, while wild-type and R352E/D993R-CFTR were not. These data suggest that R352 plays an important structural role in CFTR, perhaps reflecting its involvement in forming a salt bridge with residue D993.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
24 The D924R mutation in TM8 complemented the R347D mutation, reverting the channel to WT behavior, allowingtheauthorstoconcludethatR347functionsatleastin part by forming a salt bridge with D924 (Cotten and Welsh 1999). Login to comment
265 Also, near the predicted cytoplasmic end of the CFTR pore, substitutions of the arginine at position 347 by any residue other than lysine destabilized the pore structure, while the double mutation R347D/ D924R recovered open state stability, suggesting that R347 formed a salt bridge with D924 in the wild-type channel (Cotten and Welsh 1999). Login to comment

[hide] Atomic model of human cystic fibrosis transmembran... Cell Mol Life Sci. 2008 Aug;65(16):2594-612. Mornon JP, Lehn P, Callebaut I
Atomic model of human cystic fibrosis transmembrane conductance regulator: membrane-spanning domains and coupling interfaces.
Cell Mol Life Sci. 2008 Aug;65(16):2594-612., [PMID:18597042]

Abstract [show]
We describe herein an atomic model of the outward-facing three-dimensional structure of the membrane-spanning domains (MSDs) and nucleotide-binding domains (NBDs) of human cystic fibrosis transmembrane conductance regulator (CFTR), based on the experimental structure of the bacterial transporter Sav1866. This model, which is in agreement with previous experimental data, highlights the role of some residues located in the transmembrane passages and directly involved in substrate translocation and of some residues within the intracellular loops (ICL1-ICL4) making MSD/NBD contacts. In particular, our model reveals that D173 ICL1 and N965 ICL3 likely interact with the bound nucleotide and that an intricate H-bond network (involving especially the ICL4 R1070 and the main chain of NBD1 F508) may stabilize the interface between MSD2 and the NBD1F508 region. These observations allow new insights into the ATP-binding sites asymmetry and into the molecular consequences of the F508 deletion, which is the most common cystic fibrosis mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
187 Subsequent mutagenesis work involving acidic residues located in different TM helices has shown that the D924R mutation could complement the R347D mutation, suggesting that these two residues may form a salt bridge. Login to comment

[hide] Sequence-specific retention and regulated integrat... Mol Biol Cell. 2009 Jan;20(2):685-98. Epub 2008 Nov 19. Pitonzo D, Yang Z, Matsumura Y, Johnson AE, Skach WR
Sequence-specific retention and regulated integration of a nascent membrane protein by the endoplasmic reticulum Sec61 translocon.
Mol Biol Cell. 2009 Jan;20(2):685-98. Epub 2008 Nov 19., [PMID:19019984]

Abstract [show]
A defining feature of eukaryotic polytopic protein biogenesis involves integration, folding, and packing of hydrophobic transmembrane (TM) segments into the apolar environment of the lipid bilayer. In the endoplasmic reticulum, this process is facilitated by the Sec61 translocon. Here, we use a photocross-linking approach to examine integration intermediates derived from the ATP-binding cassette transporter cystic fibrosis transmembrane conductance regulator (CFTR) and show that the timing of translocon-mediated integration can be regulated at specific stages of synthesis. During CFTR biogenesis, the eighth TM segment exits the ribosome and enters the translocon in proximity to Sec61alpha. This interaction is initially weak, and TM8 spontaneously dissociates from the translocon when the nascent chain is released from the ribosome. Polypeptide extension by only a few residues, however, results in stable TM8-Sec61alpha photocross-links that persist after peptidyl-tRNA bond cleavage. Retention of these untethered polypeptides within the translocon requires ribosome binding and is mediated by an acidic residue, Asp924, near the center of the putative TM8 helix. Remarkably, at this stage of synthesis, nascent chain release from the translocon is also strongly inhibited by ATP depletion. These findings contrast with passive partitioning models and indicate that Sec61alpha can retain TMs and actively inhibit membrane integration in a sequence-specific and ATP-dependent manner.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
46 Mutants encoding D924E, D924R, and A923D/D924V as well as glycosylation mutants were generated by standard techniques using PCR overlap extension as described previously (Carveth et al., 2002) using the following sense (and corresponding antisense) oligonucleotides: GGGGCTAGCACTCATAGTAGAAATA- ACAG(N894A), CATTCTAGAGCGAACAGCTATGCAGTGATTAT(N900A), and GACAAAGGGGCTAGCACTCATTCTAGAGCGAAC(N894A/N900A). Login to comment
223 This was not simply due to the presence of a charged residue, because arginine substitution (D924R) reduced photocross-linking in tethered nascent chains and also eliminated Sec61␣ pho- tocross-linking after peptidyl-tRNA cleavage (Figure 9B). Login to comment

[hide] The V510D suppressor mutation stabilizes DeltaF508... Biochemistry. 2010 Aug 3;49(30):6352-7. Loo TW, Bartlett MC, Clarke DM
The V510D suppressor mutation stabilizes DeltaF508-CFTR at the cell surface.
Biochemistry. 2010 Aug 3;49(30):6352-7., 2010-08-03 [PMID:20590134]

Abstract [show]
Deletion of Phe508 (DeltaF508) in the first nucleotide-binding domain (NBD1) of CFTR causes cystic fibrosis. The mutation severely reduces the stability and folding of the protein by disrupting interactions between NBD1 and the second transmembrane domain (TMD2). We found that replacement of Val510 with acidic residues (but not neutral or positive residues) promoted maturation of DeltaF508-CFTR with V510D more efficiently than V510E. Promotion of DeltaF508-CFTR maturation did not require NBD2 as introduction of V510D into a DeltaNBD2/DeltaF508-CFTR mutant restored maturation to levels similar to that of full-length protein. The V510D mutation increased the half-life of mature DeltaF508-CFTR at the cell surface by about 5-fold to resemble the half-life of wild-type CFTR. It was also observed that introduction of the V510R/R1070D mutations into DeltaF508-CFTR also promoted maturation whereas the V510D/R1070A mutations did not. We propose that the V510D mutation in NBD1 promotes maturation and stabilizes DeltaF508-CFTR at the cell surface through formation of a salt bridge with Arg1070 in TMD2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
160 It was found that mutation of Arg347 to neutral amino acids or Asp destabilized channel function but the D924R mutation complemented R347D to yield a channel that behaved like wild-type CFTR. Login to comment

[hide] Two salt bridges differentially contribute to the ... J Biol Chem. 2013 Jul 12;288(28):20758-67. doi: 10.1074/jbc.M113.476226. Epub 2013 May 24. Cui G, Freeman CS, Knotts T, Prince CZ, Kuang C, McCarty NA
Two salt bridges differentially contribute to the maintenance of cystic fibrosis transmembrane conductance regulator (CFTR) channel function.
J Biol Chem. 2013 Jul 12;288(28):20758-67. doi: 10.1074/jbc.M113.476226. Epub 2013 May 24., [PMID:23709221]

Abstract [show]
Previous studies have identified two salt bridges in human CFTR chloride ion channels, Arg(352)-Asp(993) and Arg(347)-Asp(924), that are required for normal channel function. In the present study, we determined how the two salt bridges cooperate to maintain the open pore architecture of CFTR. Our data suggest that Arg(347) not only interacts with Asp(924) but also interacts with Asp(993). The tripartite interaction Arg(347)-Asp(924)-Asp(993) mainly contributes to maintaining a stable s2 open subconductance state. The Arg(352)-Asp(993) salt bridge, in contrast, is involved in stabilizing both the s2 and full (f) open conductance states, with the main contribution being to the f state. The s1 subconductance state does not require either salt bridge. In confirmation of the role of Arg(352) and Asp(993), channels bearing cysteines at these sites could be latched into a full open state using the bifunctional cross-linker 1,2-ethanediyl bismethanethiosulfonate, but only when applied in the open state. Channels remained latched open even after washout of ATP. The results suggest that these interacting residues contribute differently to stabilizing the open pore in different phases of the gating cycle.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 However, subconductance states are dominant events with short burst durations in CFTR channels bearing known salt bridge mutations, such as R352A, R347H, D993R, and D924R (13, 14). Login to comment
82 RESULTS Arg347 Forms a Salt Bridge with Asp924 but Does Not Stabilize the Full Open State-Although Cotten and Welsh first reported that arginine 347 of TM6 forms a salt bridge with aspartic acid 924 of TM8, their results suggested that the double mutation R347D/D924R rescued the channel to a stable open state that exhibits a smaller single channel amplitude, which is reminiscent of the s2 open state of WT-CFTR (14). Login to comment
89 A, representative current samples of WT-, R347A-, R347D-, D924R-, R347K-, and R347D/D924R-CFTR were recorded from excised inside-out patch from Xenopus oocytes with 150 mM Clafa; symmetrical solution in the presence of 1 mM Mg-ATP and 50 nM PKA at VM afd; afa;100 mV (n afd; 4-6 for each mutant). Login to comment
96 D924R-CFTR exhibits all three open states in contrast to R347A- and R347D-CFTR, although the stability of the open state is compromised; indeed, the fractional occupancies of both s1 and s2 states are greatly increased in this mutant (Fig. 2B). Login to comment
97 The charge-swapping double mutant R347D/D924R-CFTR exhibited a long stable s2 state with occasional brief openings to s1 and f. Login to comment
109 We therefore hypothesized that Arg347 might also interact with Asp993 to rescue the CFTR channel pore to a stable f state and tested this hypothesis in three double mutants; TABLE 1 Summary of the effects of mutations studied Mutant Main features of open bursts Impact on f state R347A Emphasizes s1 state, brief transitions to s2 and f Can reach f but not stable R347D Emphasizes s1 state, no transitions to s2 and f Cannot reach f D924R Brief transitions to all conductance levels Can reach f but not stable R347K Wild type-like Wild type-like R347D/D924R Emphasizes s2 state, rare and brief transitions to f Can reach f but not stable R352E Opens to all 3 levels; s1 much more stable than in WT, s2 unstable, f unstable Can reach f but not stable D993R Opens to all 3 levels, but none are stable Can reach f but not stable R352E/D993R Wild type-like, with increased transitions to s1 and s2; slightly reduced single-channel conductance Wild type-like R352E/D924R Opens to all 3 levels, but none are stable Can reach f but not stable R347D/D993R Very stable s2; rare and brief transitions to both s1 and f Can reach f but not stable R347A/R352A Opens to all 3 levels; s1 much more stable than in WT, s2 unstable, f unstable Can reach f but not stable R347D/D924R/D993R Opens to all 3 levels; s1 much more stable than in WT, s2 relatively stabilized, f unstable Can reach f but not stable R347D/D924R/R352E/D993R Primarily flickers between s2 and f; s1 much more stable than in WT, slightly reduced single channel conductance Can reach f but not stable FIGURE 3. Login to comment
111 A, representative current samples of R352E/D993R-, R352E/D924R-, and R347D/D993R-CFTR recorded from excised inside-out patches with the same conditions as Fig. 2 (n afd; 3-6 for each mutant). Login to comment
115 Whereas the single channel behavior of R352E/D924R was similar to that of R352E alone, with multiple unstable open states, suggesting that Arg352 and Asp924 do not interact, R347D/D993R was much more like R347D/D924R, with the s2 state dominant (compare Figs. 3 and 2). Login to comment
116 R347D/ D993R-CFTR is able to transition to the f state but sojourns there are even more brief than those seen for the R347D/ D924R. Login to comment
121 In the R347D/ D924R mutant, the positive charge at Arg347 is no longer available to interact with Asp993 . Login to comment
124 This was tested in the triple mutant R347D/D924R/D993R (Fig. 4, A and B). Login to comment
125 Unlike the two double mutants described above (R347D/D924R and R347D/ D993R), the triple mutant exhibited roughly equal occupancy of s1,s2,andfstates;theoccupancyofthes2statewasnotasstableas in either double mutant. Login to comment
141 However, the quadruple mutant R347D/D924R/D993R/R352E did not completely rescue WT behavior (Fig. 4, A and B). Login to comment
146 Representative current samples of R347A/R352A-, R347D/D924R/D993R-, and R347D/D924R/D993R/R352E-CFTR were recorded under the same conditions as in Fig. 3 (n afd; 5-6 for each mutant) (A). Login to comment