ABCC7 p.Ala923Asp
| ClinVar: |
c.2769C>T
,
p.Ala923=
?
, Uncertain significance
c.2768C>A , p.Ala923Asp D , Likely pathogenic |
| Predicted by SNAP2: | C: N (53%), D: D (85%), E: D (80%), F: D (71%), G: N (53%), H: D (80%), I: D (66%), K: D (85%), L: D (71%), M: D (71%), N: D (66%), P: D (85%), Q: D (71%), R: D (85%), S: N (87%), T: N (93%), V: D (63%), W: D (85%), Y: D (75%), |
| Predicted by PROVEAN: | C: N, D: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, R: N, S: N, T: N, V: N, W: D, Y: N, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Sequence-specific retention and regulated integrat... Mol Biol Cell. 2009 Jan;20(2):685-98. Epub 2008 Nov 19. Pitonzo D, Yang Z, Matsumura Y, Johnson AE, Skach WR
Sequence-specific retention and regulated integration of a nascent membrane protein by the endoplasmic reticulum Sec61 translocon.
Mol Biol Cell. 2009 Jan;20(2):685-98. Epub 2008 Nov 19., [PMID:19019984]
Abstract [show]
A defining feature of eukaryotic polytopic protein biogenesis involves integration, folding, and packing of hydrophobic transmembrane (TM) segments into the apolar environment of the lipid bilayer. In the endoplasmic reticulum, this process is facilitated by the Sec61 translocon. Here, we use a photocross-linking approach to examine integration intermediates derived from the ATP-binding cassette transporter cystic fibrosis transmembrane conductance regulator (CFTR) and show that the timing of translocon-mediated integration can be regulated at specific stages of synthesis. During CFTR biogenesis, the eighth TM segment exits the ribosome and enters the translocon in proximity to Sec61alpha. This interaction is initially weak, and TM8 spontaneously dissociates from the translocon when the nascent chain is released from the ribosome. Polypeptide extension by only a few residues, however, results in stable TM8-Sec61alpha photocross-links that persist after peptidyl-tRNA bond cleavage. Retention of these untethered polypeptides within the translocon requires ribosome binding and is mediated by an acidic residue, Asp924, near the center of the putative TM8 helix. Remarkably, at this stage of synthesis, nascent chain release from the translocon is also strongly inhibited by ATP depletion. These findings contrast with passive partitioning models and indicate that Sec61alpha can retain TMs and actively inhibit membrane integration in a sequence-specific and ATP-dependent manner.
Comments [show]
None has been submitted yet.
No. Sentence Comment
46 Mutants encoding D924E, D924R, and A923D/D924V as well as glycosylation mutants were generated by standard techniques using PCR overlap extension as described previously (Carveth et al., 2002) using the following sense (and corresponding antisense) oligonucleotides: GGGGCTAGCACTCATAGTAGAAATA- ACAG(N894A), CATTCTAGAGCGAACAGCTATGCAGTGATTAT(N900A), and GACAAAGGGGCTAGCACTCATTCTAGAGCGAAC(N894A/N900A).
X
ABCC7 p.Ala923Asp 19019984:46:35
status: NEW226 We therefore moved the aspartate group 1 residue toward the N terminus to position 923 (A923D and D924V), which would be located at approxi- Figure 8.
X
ABCC7 p.Ala923Asp 19019984:226:88
status: NEW255 A923D, D924V mutations decreased Sec61␣ photocross-linking (to residue 913) after puromycin treatment (compare lane 4 with lane 10) but significantly increased the peptidyl-tRNA-independent photocross-linking to residue 912 (lanes 2 and 8).
X
ABCC7 p.Ala923Asp 19019984:255:0
status: NEW