ABCC7 p.Asp924Val
| ClinVar: |
c.2770G>A
,
p.Asp924Asn
?
, not provided
|
| CF databases: |
c.2770G>A
,
p.Asp924Asn
(CFTR1)
?
, This substitution, located in a transmembrane domain, involves a residue conserved among species and affects the charge of the CFTR protein. It was found in the father of a fetus having hyperechogenic bowel. The man had a Polish origin. There was no family history of CF. The fetus inherited the mutation but no other anomaly was detected after scanning of almost all the CFTR coding regions and screening for 3849+10kbC->T and 1811+1.6kbA->G. The outcome of the pregnancy is still unknown.
c.2770G>T , p.Asp924Tyr (CFTR1) ? , |
| Predicted by SNAP2: | A: N (66%), C: N (53%), E: N (72%), F: D (66%), G: N (57%), H: D (71%), I: D (71%), K: D (66%), L: D (59%), M: D (66%), N: N (61%), P: D (75%), Q: D (63%), R: D (71%), S: N (66%), T: N (61%), V: D (63%), W: D (85%), Y: D (71%), |
| Predicted by PROVEAN: | A: N, C: N, E: N, F: N, G: N, H: N, I: N, K: N, L: N, M: N, N: N, P: N, Q: N, R: N, S: N, T: N, V: N, W: D, Y: N, |
[switch to compact view]
Comments [show]
None has been submitted yet.
[hide] Biogenesis of CFTR and other polytopic membrane pr... J Membr Biol. 2004 Dec;202(3):115-26. Sadlish H, Skach WR
Biogenesis of CFTR and other polytopic membrane proteins: new roles for the ribosome-translocon complex.
J Membr Biol. 2004 Dec;202(3):115-26., [PMID:15798900]
Abstract [show]
Polytopic protein biogenesis represents a critical, yet poorly understood area of modern biology with important implications for human disease. Inherited mutations in a growing array of membrane proteins frequently lead to improper folding and/or trafficking. The cystic fibrosis transmembrane conductance regulator (CFTR) is a primary example in which point mutations disrupt CFTR folding and lead to rapid degradation in the endoplasmic reticulum (ER). It has been difficult, however, to discern the mechanistic principles of such disorders, in part, because membrane protein folding takes place coincident with translation and within a highly specialized environment formed by the ribosome, Sec61 translocon, and the ER membrane. This ribosome-translocon complex (RTC) coordinates the synthesis, folding, orientation and integration of transmembrane segments across and into the ER membrane. At the same time, RTC function is controlled by specific sequence determinants within the nascent polypeptide. Recent studies of CFTR and other native membrane proteins have begun to define novel variations in translocation pathways and to elucidate the specific steps that establish complex topology. This article will attempt to reconcile advances in our understanding of protein biogenesis with emerging models of RTC function. In particular, it will emphasize how information within the nascent polypeptide is interpreted by and in turn controls RTC dynamics to generate the broad structural and functional diversity observed for naturally occurring membrane proteins.
Comments [show]
None has been submitted yet.
No. Sentence Comment
166 Interestingly, removal of a single charged residue from TM8 (D924V) prevented Asn908 from being glycosylated and at the same time conferred TM7-independent stop transfer activity onto the TM8 hydrophobic segment (Carveth et al., 2002).
X
ABCC7 p.Asp924Val 15798900:166:61
status: NEW183 Similarly, the D924V mutation converts TM8 to a strong, independent stop transfer sequence but dramatically decreases CFTR chloride conductance (D. Dawson and W. Skach, unpublished observations).
X
ABCC7 p.Asp924Val 15798900:183:15
status: NEW[hide] Sequence-specific retention and regulated integrat... Mol Biol Cell. 2009 Jan;20(2):685-98. Epub 2008 Nov 19. Pitonzo D, Yang Z, Matsumura Y, Johnson AE, Skach WR
Sequence-specific retention and regulated integration of a nascent membrane protein by the endoplasmic reticulum Sec61 translocon.
Mol Biol Cell. 2009 Jan;20(2):685-98. Epub 2008 Nov 19., [PMID:19019984]
Abstract [show]
A defining feature of eukaryotic polytopic protein biogenesis involves integration, folding, and packing of hydrophobic transmembrane (TM) segments into the apolar environment of the lipid bilayer. In the endoplasmic reticulum, this process is facilitated by the Sec61 translocon. Here, we use a photocross-linking approach to examine integration intermediates derived from the ATP-binding cassette transporter cystic fibrosis transmembrane conductance regulator (CFTR) and show that the timing of translocon-mediated integration can be regulated at specific stages of synthesis. During CFTR biogenesis, the eighth TM segment exits the ribosome and enters the translocon in proximity to Sec61alpha. This interaction is initially weak, and TM8 spontaneously dissociates from the translocon when the nascent chain is released from the ribosome. Polypeptide extension by only a few residues, however, results in stable TM8-Sec61alpha photocross-links that persist after peptidyl-tRNA bond cleavage. Retention of these untethered polypeptides within the translocon requires ribosome binding and is mediated by an acidic residue, Asp924, near the center of the putative TM8 helix. Remarkably, at this stage of synthesis, nascent chain release from the translocon is also strongly inhibited by ATP depletion. These findings contrast with passive partitioning models and indicate that Sec61alpha can retain TMs and actively inhibit membrane integration in a sequence-specific and ATP-dependent manner.
Comments [show]
None has been submitted yet.
No. Sentence Comment
43 MATERIALS AND METHODS Plasmid Construction CFTR expression plasmids encoding wild-type and D924V mutant have been described previously (Carveth et al., 2002) and encode a methionine ATG translation start codon followed by CFTR residues Glu838 to Tryp1204.
X
ABCC7 p.Asp924Val 19019984:43:91
status: NEW46 Mutants encoding D924E, D924R, and A923D/D924V as well as glycosylation mutants were generated by standard techniques using PCR overlap extension as described previously (Carveth et al., 2002) using the following sense (and corresponding antisense) oligonucleotides: GGGGCTAGCACTCATAGTAGAAATA- ACAG(N894A), CATTCTAGAGCGAACAGCTATGCAGTGATTAT(N900A), and GACAAAGGGGCTAGCACTCATTCTAGAGCGAAC(N894A/N900A).
X
ABCC7 p.Asp924Val 19019984:46:41
status: NEW219 In both wild-type (WT) and D924V mutants, TM8 photocross-links were observed during initial stages of translocon insertion at truncations 957 and 967 (Figure 8).
X
ABCC7 p.Asp924Val 19019984:219:27
status: NEW220 However, photoadducts to D924V decreased abruptly at truncation sites beyond residue 967 (Figure 8B), and no peptidyl-tRNA-independent photocross-links to residue 913 were observed (Figure 8A).
X
ABCC7 p.Asp924Val 19019984:220:25
status: NEW221 Thus, the D924V mutant leaves the proximity of Sec61 at an earlier stage of synthesis than its wild-type counterpart and fails to exhibit peptidyl-tRNA-independent TM8-Sec61␣ interactions.
X
ABCC7 p.Asp924Val 19019984:221:10
status: NEW226 We therefore moved the aspartate group 1 residue toward the N terminus to position 923 (A923D and D924V), which would be located at approxi- Figure 8.
X
ABCC7 p.Asp924Val 19019984:226:98
status: NEW228 (A) Photocross-linking to integration intermediates (residues 837-977) containing WT and mutant (D924V) TM8 revealed similar UV-dependent photoadducts (upward arrowheads) for truncations 957 and 967 that disappeared after puromycin treatment.
X
ABCC7 p.Asp924Val 19019984:228:97
status: NEW230 At truncations 977 and 987, photoadducts to WT TM8 increased in intensity and were peptidyl-tRNA independent (lanes 14 and 15 and 20 and 21), whereas photoadducts were absent for the D924V mutant (lanes 17, 18, 23, and 24).
X
ABCC7 p.Asp924Val 19019984:230:183
status: NEW231 (B) Immunoprecipitation of photoadducts with Sec 61␣ antisera confirmed that the D924V mutation decreases Sec61␣ cross-linking at the same stage of synthesis when photocross-linking to WT TM8 becomes independent of the peptidyl-tRNA bond.
X
ABCC7 p.Asp924Val 19019984:231:88
status: NEW255 A923D, D924V mutations decreased Sec61␣ photocross-linking (to residue 913) after puromycin treatment (compare lane 4 with lane 10) but significantly increased the peptidyl-tRNA-independent photocross-linking to residue 912 (lanes 2 and 8).
X
ABCC7 p.Asp924Val 19019984:255:7
status: NEW283 Moreover, translocation termination is accomplished by both WT TM8 and the D924V mutant (Carveth et al., 2002), but integration is delayed only when an acidic residue is present.
X
ABCC7 p.Asp924Val 19019984:283:75
status: NEW[hide] Mechanisms of CFTR Folding at the Endoplasmic Reti... Front Pharmacol. 2012 Dec 13;3:201. doi: 10.3389/fphar.2012.00201. eCollection 2012. Kim SJ, Skach WR
Mechanisms of CFTR Folding at the Endoplasmic Reticulum.
Front Pharmacol. 2012 Dec 13;3:201. doi: 10.3389/fphar.2012.00201. eCollection 2012., [PMID:23248597]
Abstract [show]
In the past decade much has been learned about how Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) folds and misfolds as the etiologic cause of cystic fibrosis (CF). CFTR folding is complex and hierarchical, takes place in multiple cellular compartments and physical environments, and involves several large networks of folding machineries. Insertion of transmembrane (TM) segments into the endoplasmic reticulum (ER) membrane and tertiary folding of cytosolic domains begin cotranslationally as the nascent polypeptide emerges from the ribosome, whereas posttranslational folding establishes critical domain-domain contacts needed to form a physiologically stable structure. Within the membrane, N- and C-terminal TM helices are sorted into bundles that project from the cytosol to form docking sites for nucleotide binding domains, NBD1 and NBD2, which in turn form a sandwich dimer for ATP binding. While tertiary folding is required for domain assembly, proper domain assembly also reciprocally affects folding of individual domains analogous to a jig-saw puzzle wherein the structure of each interlocking piece influences its neighbors. Superimposed on this process is an elaborate proteostatic network of cellular chaperones and folding machineries that facilitate the timing and coordination of specific folding steps in and across the ER membrane. While the details of this process require further refinement, we finally have a useful framework to understand key folding defect(s) caused by DeltaF508 that provides a molecular target(s) for the next generation of CFTR small molecule correctors aimed at the specific defect present in the majority of CF patients.
Comments [show]
None has been submitted yet.
No. Sentence Comment
100 Interestingly, removal of an aspartate residue from TM8 (D924V) prevents transient lumenal exposure and at the same time confers independent stop transfer activity.
X
ABCC7 p.Asp924Val 23248597:100:57
status: NEW111 Similarly, the D924V mutation converts TM8 to a strong strop transfer sequence and facilitates cotranslational membrane integration, but decreases CFTR chloride conductance (our observations).
X
ABCC7 p.Asp924Val 23248597:111:15
status: NEW