ABCMdb

ABCA1 p.Val825Leu

Predicted by SNAP2:	A: N (78%), C: N (87%), D: D (53%), E: N (61%), F: D (71%), G: N (66%), H: N (61%), I: N (82%), K: D (85%), L: N (82%), M: N (87%), N: N (61%), P: N (57%), Q: N (72%), R: N (57%), S: N (78%), T: N (78%), W: N (78%), Y: N (82%),
Predicted by PROVEAN:	A: N, C: N, D: D, E: D, F: N, G: D, H: D, I: N, K: D, L: N, M: N, N: D, P: D, Q: N, R: D, S: N, T: N, W: D, Y: N,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Genetic determinants of HDL: monogenic disorders a... Curr Opin Cardiol. 2007 Jul;22(4):344-51. Klos KL, Kullo IJ
Genetic determinants of HDL: monogenic disorders and contributions to variation.
Curr Opin Cardiol. 2007 Jul;22(4):344-51., [PMID:17556888]

Abstract [show]
PURPOSE OF REVIEW: This review focuses on recent progress towards the characterization of genetic variations that contribute to interindividual variation in plasma high-density lipoprotein cholesterol levels in the general population. RECENT FINDINGS: Many of the genes that harbor rare mutations leading to extreme high-density lipoprotein cholesterol levels contain common variation that influences plasma high-density lipoprotein cholesterol in several study populations. Candidate gene association studies provide evidence that some of these variations have an effect on high-density lipoprotein cholesterol, dependent on epistatic interactions or environmental context. Both rare and common variations contribute to interindividual high-density lipoprotein cholesterol variation. Recent comparisons of candidate gene sequences between individuals in the tails of the high-density lipoprotein cholesterol distributions (the upper or lower 1-5%) of several study populations indicate that as many as 20% of individuals with low high-density lipoprotein cholesterol harbor a rare mutation in an investigated gene. For example, the ABCA1 gene region harbors rare mutations and common variants that contribute to interindividual high-density lipoprotein cholesterol variation in the general population. SUMMARY: The genetic control of high-density lipoprotein cholesterol level is complex. Maximizing the utility of genetic knowledge for predicting an individual's high-density lipoprotein cholesterol level or response to intervention will require a better understanding of the action of combinations of genetic variants and environmental exposures.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 Interestingly, haplotype analysis in a sample of healthy Pakistani people revealed that the effect of a V825L polymorphism in ABCA1 on HDL-C was dependent on allelic state at R219K [32 ] and, in Turkish people, an effect of R219K on HDL-C was only seen when in combination with the I883M polymorphism [33]. Login to comment
81 Sequence analyses, most notably of the ABCA1 region, suggest that both common variants and rare mutations contribute to interindividual variation in Genetic determinants of HDL Klos and Kullo 347 Table1Commonpolymorphisms(minorallelefrequency>5%)reportedtobeassociatedwithplasmaHDL-Cinmorethanonestudy;thereporteddirectionofeffectoftheless commonallele,andtheircontributionstocovariate-adjustedHDL-Cvariationaloneandincombinationwithotherpolymorphismsofthesamegene GenesymbolGenenamePolymorphismEffecta Single-sitevariationMultisitevariation ABCA1ATP-bindingcassette,sub-familyA (ABC1),member1 596G>A"HDL-C[52,53]4%[52] R219K"HDL-C[28,29 ,30 ]6%[54] V771M"HDL-C[30 ,33] V825I/V825L"HDL-C[30 ];#HDL-C[32 ] APOA5ApolipoproteinA-VÀ1131T>C#HDL-C[55-57] APOC3ApolipoproteinC-III482C>T#HDL-C[55,58 ]0.2-1.4%[58 ]1-6%[58 ,59] SstIS2allelewith#HDL-C[60,61] APOEApolipoproteinEÀ219G>T#HDL-C[27 ,62] e2/e3/e40.8-6.5%[63,64 ]8.3-15.3%[65] ARAndrogenreceptorEx1CAGrepeat"HDL-Cwithlength[66] CETPCholesterol-estertransferproteinÀ1946VNTR"HDL-Cwiththeshortallele[36,67] À629C>A"HDL-C[36,38,39,67-69]4.6-5.2%[39,64 ]5.5-9.8%[39,68] Taq1B"HDL-C[35]3.9%[39]5.5-15%[39,54] MspIin8#HDL-C[36,67] A373P/R451Q#HDL-C[67,68]8%[70] I405V"HDL-C[35] LIPCHepaticlipaseÀ514C>T"HDL-C[45]Upto31%[54] À250G>A"HDL-C[41,43]4.7%[67] LIPGEndotheliallipaseT111I"HDL-C[72,73 ];#HDL-C[74] LPLLipoproteinlipaseHindIII#HDL-CwiththeHþallele[49,75] N291S#HDL-C[50 ] S447X"HDL-C[48,75]0.8%[64 ]3%[35] PON1Paraoxonase1À107T>C"HDL-C[76-78] Q192R"HDL-C[77,79 ];#HDL-C[79 ] PPARDPeroxisomeproliferatorsactivatedreceptordelta294T>C#HDL-C[80] PPARGPeroxisomeproliferatorsactivatedreceptorgammaPro12Ala"HDL-C[81,82] SCARB1ScavengerreceptorclassB,member1A350A"HDL-C[64 ,83]1.3%[64 ] IVS5/A350A(/IVS10)haplotype#HDL-C[84 ] a Citationsrepresentaselectionofavailablestudiesprioritizedbasedonmeta-analysesofassociationresultsinnumerousstudygroups,andrecentstudiescontainingcomprehensivereviewsofpreviously reportedassociations. Login to comment

[hide] A novel haplotype in ABCA1 gene effects plasma HDL... Int J Cardiol. 2007 Jan 31;115(1):7-13. Epub 2006 Jun 23. Saleheen D, Khanum S, Haider SR, Nazir A, Ahmad U, Khalid H, Hussain I, Shuja F, Shahid K, Habib A, Frossard PM
A novel haplotype in ABCA1 gene effects plasma HDL-C concentration.
Int J Cardiol. 2007 Jan 31;115(1):7-13. Epub 2006 Jun 23., [PMID:16806540]

Abstract [show]
BACKGROUND AND OBJECTIVES: ATP-binding cassette transporter 1 (ABCA1) is a trans-membrane protein responsible for the efflux of cholesterol and phospholipids across the cell membrane, an essential step in the reverse cholesterol transport system. This study investigates the effect of five non-synonymous SNPs of ABCA1 gene on plasma HDL-C levels in Pakistani individuals free of ischemic heart disease and stroke. METHODS: Five non-synonymous SNPs were selected after sequencing ABCA1 gene in patients of Hypoalphalipoproteinemia. The presence of these SNPs was then checked in 200 individuals by using PCR-RFLP. Plasma glucose and lipid fractions were measured in fasting state. Ethical approval was obtained from the Ethical Review Committee, Aga Khan University and informed consent was obtained from all subjects. RESULTS: LL genotype of V825L polymorphism was associated with decreased levels of HDL-C [-0.17 (-0.32 to -0.19); P=0.02] and P774 allele showed a significant increase in HDL-C levels as compared to T774 allele [-0.15 (-0.18 to -0.02); P=0.01]. R219K, A399V and V771M polymorphisms did not show any association with levels of HDL-C, LDL-C, cholesterol and triglycerides. Haplotype analysis between R219K and V825L polymorphisms showed a unique interaction between R219 allele and L825 allele. The RL haplotype was found to be associated with decreased levels of HDL-C [-0.12 (-0.22 to -0.03); P=0.001]. CONCLUSIONS: ABCA1 polymorphisms are associated with varying levels of HDL-C in Pakistani individuals. These results warrant further investigations as ABCA1 polymorphisms may have a major role in the high incidence of cardiovascular disorders in South Asians.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
6 Results: LL genotype of V825L polymorphism was associated with decreased levels of HDL-C [À0.17 (À0.32 to À0.19); P=0.02] and P774 allele showed a significant increase in HDL-C levels as compared to T774 allele [À0.15 (À0.18 to À0.02); P=0.01]. Login to comment
8 Haplotype analysis between R219K and V825L polymorphisms showed a unique interaction between R219 allele and L825 allele. Login to comment
50 Subjects were classified as having diabetes mellitus if he or she already Table 1 Methods for restriction fragment length polymorphism for screening of ABCA1 SNPs Variant Forward oligo (5VY3V), reverse oligo (5VY3V) Annealing temperature Enzyme Product (bp), wild-type allele, variant allele R219K (G1051A) ''aaagacttcaaggacccagctt``, ''cctcacattccgaaagcatta`` 62.5 -C EcoNI 309, 184, 125 V399A (T1591C) ''ctcattgtctgtgcttctcctc``, ''gtgaccagaaactcacctctcc`` 64.0 -C HphI 117, 71, 48, 188, 48 V771M (G2706A) ''tacaagtgagtgcttgggattg``, ''cccattggaaaagacaatcatc`` 60.0 -C BsaAI 254, 137, 391 V825L (G2868A) ''ttctgcaccttatgattgatcc``, ''agcacaaagaaaggacatcagc`` 62.5 -C BsaI 265, 127, 392 Polymerase chain reaction (PCR) was carried out using a Perkin Elmer GeneAmp PCR system 2400 (Perkin Elmer Corp., Applied Biosystems Division, USA). Login to comment
70 L825 allele is associated with decreased HDL-C levels LL genotype of V825L polymorphism was associated with decreased levels of HDL-C as compared to VV-the wild type genotype. This association remained significant when LL genotype was compared with LV+VV genotypes [À0.164 (À0.313 to À0.016); P-value<0.05, adjusted for age and gender. Login to comment
80 R219K, V399A and T774P polymorphisms followed the HWE however V825L and V771M showed a departure from HWE. Login to comment
82 Linkage disequilibrium and haplotype analysis R219K polymorphism was in significant linkage disequilibrium (LD) with V825L and V771M (DV=0.50; P-value<10À3 ). Login to comment
83 Similarly, T774P showed high LD with V825L (DV=0.70; P-value<10À3 ). Login to comment
87 D. Saleheen et al. / International Journal of Cardiology 115 (2007) 7-13 9 polymorphism was in complete linkage equilibrium with T774P, V825L and V771M polymorphisms. Login to comment
92 On two-point haplotype analysis, the haplotype model between R219K and V825L polymorphisms showed RL haplotype to be associated with decreased levels of HDL-C. Importantly, this association remained significant when age, gender, hypertension and diabetes mellitus were introduced in to the haplotype model. Login to comment
97 South Asian populations (from Pakistan, India, Bangladesh and Sri Lanka) represent a quarter of the developing world and harbor thirty percent of the global Table 4 Haplotype association analysis of the ABCA1 gene polymorphisms in relation with the HDL-C levels Haplotype Haplotype frequencies Haplotypic additive effects [95% CI] P-value R219K RV 0.47 + V825L RL 0.18 À0.12 [À0.22 to À0.03] 0.001 KV 0.28 À0.04 [À0.10 to 0.01] 0.15 KL 0.06 0.08 [À0.06 to 0.22] 0.25 T774P TV 0.21 0.03 [À0.05 to 0.12] 0.41 V825L TL 0.09 0.10 [À0.06 to 0.27] 0.22 PV 0.47 + PL 0.21 À0.06 [À0.14 to 0.02] 0.15 R219K RM 0.55 + V771M RV 0.07 À0.13 [À0.45 to 0.19] 0.41 KM 0.34 À0.02 [À0.09 to 0.05] 0.54 KV 0.04 0.07 [À0.12 to 0.27] 0.46 Table 3 Mean HDL-C levels (S.D.) for the genotypes and alleles of the studied polymorphisms Frequencies HDL-C (S.D.) b (95% CI) P-value R219K RR 39.8 1.06 (0.30) À0.02 (À0.16 to 0.13) 0.85 RK 46.0 1.10 (0.28) 0.00 (À0.14 to 0.14) 0.99 KK 14.3 1.10 (0.31) + R 62.7 1.08 (0.26) 0.01 (À0.05 to 0.07) 0.79 K 37.3 1.09 (0.31) V399A AA 6.0 1.01 (0.23) À0.03 (À0.24 to 0.16) 0.70 AV 34.7 1.11 (0.28) 0.10 (À0.04 to 0.16) 0.22 VV 59.3 1.04 (0.31) + A 23.3 1.09 (0.28) À0.03 (À0.10 to 0.05) 0.58 V 76.7 1.04 (0.31) T774P PP 9.6 1.10 (0.31) 0.20 (0.01 to 0.40) 0.03 PT 37.5 1.03 (0.32) 0.13 (À0.03 to 0.20) 0.14 TT 52.9 0.97 (0.28) + P 28.4 1.05 (0.32) À0.15 (À0.18 to À0.02) 0.01 T 71.6 0.99 (0.29) V771M MM 6.1 1.09 (0.30) 0.01 (À0.24 to 0.25) VM 10.1 0.98 (0.24) À0.07 (À0.27 to 0.12) 0.46 VV 83.8 1.07 (0.29) + 0.94 M 11.1 1.04 (0.27) 0.03 (À0.10 to 0.15) 0.71 V 88.9 1.07 (0.29) V825L LL 9.8 0.89 (0.299) À0.17 (À0.32 to À0.19) 0.02 LV 32.8 1.06 (0.265) À0.03 (À0.11 to 0.076) 0.70 VV 57.5 1.07 (0.30) + L 26.1 1.07 (0.29) 0.10 (À0.00 to .13) 0.05 V 73.9 1.00 (0.28) P-values are adjusted for age and gender. Login to comment
105 We found LL genotype of V825L polymorphism to be associated with decreased levels of HDL-C on both univariate and multivariate analyses. Login to comment
107 On haplotype analysis, the RL haplotype generated from the R219K and V825L polymorphisms was strongly associated with decreased levels of HDL-C. Importantly, association of this haplotype was stronger than the association observed for V825L polymorphism. Login to comment
116 Importantly, we have shown that carriers of LL genotype of V825L polymorphism are associated with decreased levels of HDL-C. Login to comment