ABCMdb

ABCC7 p.Arg75*

ClinVar:	c.224G>A , p.Arg75Gln ? , Conflicting interpretations of pathogenicity c.224G>T , p.Arg75Leu ? , not provided c.223C>T , p.Arg75* D , Pathogenic
CF databases:	c.224G>A , p.Arg75Gln N , Non CF-causing c.223C>T , p.Arg75* D , CF-causing c.224G>T , p.Arg75Leu (CFTR1) D , The mucleotide change G->T at position 356 (codon 75 in exon 3) has been found in an infertile man with CBAVD having no manifestation of gastrointestinal or pulmonary disease. He carries the [delta]F508 mutation on the other chromosome.

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Spectrum of CFTR mutations in Mexican cystic fibro... Hum Genet. 2000 Mar;106(3):360-5. Orozco L, Velazquez R, Zielenski J, Tsui LC, Chavez M, Lezana JL, Saldana Y, Hernandez E, Carnevale A
Spectrum of CFTR mutations in Mexican cystic fibrosis patients: identification of five novel mutations (W1098C, 846delT, P750L, 4160insGGGG and 297-1G-->A).
Hum Genet. 2000 Mar;106(3):360-5., [PMID:10798368]

Abstract [show]
We have analyzed 97 CF unrelated Mexican families for mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Our initial screening for 12 selected CFTR mutations led to mutation detection in 56.66% of the tested chromosomes. In patients with at least one unknown mutation after preliminary screening, an extensive analysis of the CFTR gene by single stranded conformation polymorphism (SSCP) or by multiplex heteroduplex (mHET) analysis was performed. A total of 34 different mutations representing 74.58% of the CF chromosomes were identified, including five novel CFTR mutations: W1098C, P750L, 846delT, 4160insGGGG and 297-1G-->A. The level of detection of the CF mutations in Mexico is still lower than that observed in other populations with a relatively low frequency of the deltaF508 mutation, mainly from southern Europe. The CFTR gene analysis described here clearly demonstrated the high heterogeneity of our CF population, which could be explained by the complex ethnic composition of the Mexican population, in particular by the strong impact of the genetic pool from southern European countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 It was found in a male patient who carries the R75X severe mutation on exon 3 of the paternal allele. Login to comment
69 First, we tested these patients for 12 mutations selected for the following reasons: five are the most common mutations worldwide (∆F508, G542X, N1303K, G551D and R553X; CFGAC 1994); 362 Table 1 Frequency of the CFTR gene mutations in 97 (194 chromosomes) Mexican patients Mutation Number of Frequency affected alleles (%) ∆F508 79 40.72 G542X 12 6.18 ∆I507 5 2.57 S549N 5 2.57 N1303K 4 2.06 R75X 3 1.54 406-1G→A 3 1.54 I148T 3 1.54 2055del9→A 2 1.03 935delA 2 1.03 I506T 2 1.03 3199del6 2 1.03 2183AA→G 2 1.03 G551D 1 0.51 R553X 1 0.51 1924del7 1 0.51 G551S 1 0.51 1078delT 1 0.51 Y1092X 1 0.51 R117H 1 0.51 G85E 1 0.51 3849+10KbC→T 1 0.51 1716G→A 1 0.51 W1204X 1 0.51 W1098Ca 1 0.51 846delTa 1 0.51 P750La 1 0.51 V754M 1 0.51 R75Q 1 0.51 W1069X 1 0.51 L558S 1 0.51 4160insGGGGa 1 0.51 297-1G→Aa 1 0.51 H199Y 1 0.51 2869insG 0 0 R1162X 0 0 3120+1G→A 0 0 Total 34 145 74.58% aNovel mutations detected in this study Fig.1 Sequencing ladders showing the CFTR novel mutations. Login to comment
88 W1098C seems to be a mild mutation because the phenotype is mild despite the presence of a severe mutation (R75X) on the other chromosome. Login to comment

[hide] Identification of novel mutations in Arabs with cy... Eur J Pediatr. 2000 May;159(5):303-9. Kambouris M, Banjar H, Moggari I, Nazer H, Al-Hamed M, Meyer BF
Identification of novel mutations in Arabs with cystic fibrosis and their impact on the cystic fibrosis transmembrane regulator mutation detection rate in Arab populations.
Eur J Pediatr. 2000 May;159(5):303-9., [PMID:10834512]

Abstract [show]
The cystic fibrosis transmembrane regulator (CFTR) gene in Arab patients with cystic fibrosis (CF) (sweat chloride > 60 mmol/l) from 61 unrelated families was screened for mutations in exons 3, 4, 5, 7, 10, 11, 16 and 19 and for mutations W1282X, N1303K and 3,849 + 10kbC --> T. Eight novel mutations were identified. These are: in exon 4: a) 425del42 (an in-frame 42 bp deletion that removes 14 amino acids and causes Gln98 --> His at the point of deletion), b) 475G --> T (Glu115 --> Stop) and c) 548A --> T (His139 --> Leu); in intron 5,711 + 1G --> A (splice site mutation); in exon 10, 1548delG (deletion of a "G" nucleotide causing a frameshift mutation that alters the amino acid sequence at residue 473 and results in translation termination at residue 526); in exon 11, a) 1729T --> C (Ph533E --> Leu) and b) 1,811 + 2 (splice site mutation) and finally in exon 19,3361A --> T (Lys1177 --> Stop). All mutations were detected by heteroduplex analysis and identified by sequencing. Of more than 850 known CFTR mutations, only 9 were encountered. The comparative frequencies of the most common mutations are: 1548delG> 1123V = deltaF508 = 3,120 + 1G --> A > H139L. Screening for these five mutations identifies 60% of the CF alleles in Arab populations. The novel mutation 1548delG is the most frequent (17%) among Arabs. CONCLUSION: Novel Arab-specific mutations were identified in the CFTR gene underlying cystic fibrosis. As a result of this study, the CFTR mutation detection rate among Arabs with cystic fibrosis is now comparable to that of other populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 Of more than 850 known CFTR mutations (http:// www.genet.sickkids.on.ca/cftr-cgi-bin/Mutation Table), only 9 were encountered in this study: R75X, A141D, 1249G ® A, DF508, S549R, R553X, 3120 + 1G ® A, I1234V and N1303K. Login to comment
108 aa amino acids CFTR position Mutation DNA Consequence Number of families Number and percentage of alleles Exon 3 355C ® T R75X ± protein truncation 1a [1548delG] 1 (private mutation) Exon 4 425del42 Q98H and deletion of the following 14 aa 1a [?] Login to comment
111 1 (private mutation) Exon 10 1548delG Frame shift 8 16 Altered residues at aa 473; stop codon at 526 1a [R75X] 1 1a [1811 + 2 T ® C] 1 1a [N1303K] 1 2a [?] Login to comment

[hide] Many deltaF508 heterozygote neonates with transien... J Med Genet. 2000 Jul;37(7):543-7. Boyne J, Evans S, Pollitt RJ, Taylor CJ, Dalton A
Many deltaF508 heterozygote neonates with transient hypertrypsinaemia have a second, mild CFTR mutation.
J Med Genet. 2000 Jul;37(7):543-7., [PMID:10970190]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
538 These have been reported in patients with presenting phenotypes ranging from "cystic fibrosis" to oligospermia, but there have been too few cases Table 2 Compound heterozygotes detected Domain and mutation type Genotype Exon 1st IRT 2nd IRT Transmembrane, missense F508/P67L 3 129 34* F508/R117H 4 110 21* F508/R117H 4 84 34 F508/R117H 4 95 39 F508/R117H 4 104 40 F508/R117H 4 146 41 F508/R117H 4 104 48* F508/R117H 4 120 53 F508/R117H 4 111 54 F508/R117H 4 175 72* F508/R117L 4 129 70 F508/L967S 15 122 15 F508/F1052V 17b 189 29 F508/R1066H 17b 94 18 Transmembrane, nonsense F508/R75X 3 86 26 F508/R75X 3 171 27 F508/R851X 14a 112 76 Regulatory, missense F508/F693L 13 109 29 Alternate splice site F508/3849+10KB C→T i19 99 26* F508/3849+10KB C→T i19 112 36* None of these samples had the IVS8-5T variant sequence. Login to comment

[hide] Type I, II, III, IV, and V cystic fibrosis transme... Curr Opin Pulm Med. 2000 Nov;6(6):521-9. Choo-Kang LR, Zeitlin PL
Type I, II, III, IV, and V cystic fibrosis transmembrane conductance regulator defects and opportunities for therapy.
Curr Opin Pulm Med. 2000 Nov;6(6):521-9., [PMID:11100963]

Abstract [show]
Recent advances in cellular and molecular biology have furthered the understanding of several genetic diseases, including cystic fibrosis. Mutations that cause cystic fibrosis are now understood in terms of the specific molecular consequences to the cystic fibrosis transmembrane conductance regulator (CFTR) protein expression and function. This knowledge has spawned interest in the development of therapies aimed directly at correcting the defective CFTR itself. In this article, we review the molecular defect underlying each recognized class of CFTR mutation and the potential therapies currently under investigation. Opportunities for protein-repair therapy appear to be vast and range from naturally occurring compounds, such as isoflavonoids, to pharmaceuticals already in clinical use, including aminoglycoside antibiotics, butyrate analogues, phosphodiesterase inhibitors, and adenosine nucleotides. Future therapies may resemble designer compounds like benzo[c]quinoliziniums or take the form of small peptide replacements. Given the heterogeneity and progressive nature of cystic fibrosis, however, optimal benefit from protein-repair therapy will most likely require the initiation of combined therapies early in the course of disease to avoid irreparable organ damage.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 The nonsense mutations G542X, W1282X, R553X, Q39X, E60X, R75X, L719X, Y1092X, and S1196X significantly reduce the levels of mutant CFTR mRNA to 5 to 30% of wild-type levels [28]. Login to comment

[hide] Genotype analysis and phenotypic manifestations of... Chest. 2000 Dec;118(6):1591-7. Desmarquest P, Feldmann D, Tamalat A, Boule M, Fauroux B, Tournier G, Clement A
Genotype analysis and phenotypic manifestations of children with intermediate sweat chloride test results.
Chest. 2000 Dec;118(6):1591-7., [PMID:11115444]

Abstract [show]
STUDY OBJECTIVES: Cystic fibrosis (CF) is one of the most common inherited diseases among whites. Since the cloning of the CF transmembrane conductance regulator (CFTR) gene, a number of studies have focused on associations between the genotype and phenotype in CF. This had led to the progressive identification of new groups of patients, including those who have mild lung disease and those who have normal sweat chloride values (< 60 mEq/L). The aim of the present work was to provide information on the genotype and the phenotypic characteristics of children with intermediate-range sweat chloride test results. PATIENTS AND RESULTS: We focused on children referred to the pulmonary department for various types of pulmonary disease and who had several sweat chloride test results with median values in the range of 40 to 60 mEq/L. Twenty-four patients over a 10-year period were enrolled (mean age, 4.8 years). Respiratory manifestations at initial evaluation included recurrent bronchitis, wheezing, chronic cough, and pneumonia. The duration of the follow-up ranged from 0.5 to 10.5 years. Sputum cultures revealed the presence of Haemophilus influenzae (10 children), Staphylococcus aureus (4 children), and Pseudomonas aeruginosa (3 children). Pancreatic insufficiency was found in two patients. Analysis of the entire coding sequence allowed identification of 16 known mutations in CFTR gene. Fifteen chromosomes (31.2%) carried a mutation in CFTR gene and one allele carried two mutations. Three patients were homozygous or double heterozygous (DeltaF508/DeltaF508, DeltaF508/3849 + 10 kb C-->T, S1235R/G551D). The 5-thymidine allele was identified in four children. CONCLUSION: These results indicate an higher frequency of CFTR gene mutations in patients with borderline sweat chloride test results, compared to data reported in the general population. They lead to the recommendations for complete pulmonary and GI investigations in this group of patients, as well as assiduous care and medical follow-up.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
82 Patient 3 was heterozygous for the mutations R75X and D1270H; however, the familial analysis revealed that the mutations R75X and D1270H were both carried by the paternal allele. Login to comment
92 Genotype Poly T 1 -/- 7T/7T 2 R117C/- 7T/7T 3 R75X-D1270H/- 7T/7T 4 -/- 7T/7T 5 G91R/- 7T/5T 6 ⌬F508/- 7T/9T 7 -/- 7T/7T 8 -/- 7T/7T 9 S1235R/G551D 5T/7T 10 ⌬F508/- 9T/9T 11 7T/7T 12 ⌬F508/⌬F508 9T/9T 13 ⌬F508/- 7T/9T 14 -/- 7T/7T 15 ⌬F508/- 7T/9T 16 -/- 7T/5T 17 -/- 7T/7T 18 -/- 7T/7T 19 -/- 7T/9T 20 ⌬F508/- 7T/9T 21 -/- 7T/7T 22 W1282X/- 7T/5T 23 -/- 7T/7T 24 ⌬F508/3849 ϩ 10 kb C 3 T 7T/7T 1594 Clinical Investigations reported in the general population (frequency of the 5T allele in the general population, 5.2%).26 Based on the results of DNA analysis and according to the consensus statement on the diagnosis of CF, three patients (patients 9, 12, and 24) met the criteria of both respiratory manifestations and identification of two CF mutations.21 For patient 6, there was a diagnostic dilemma. Login to comment
98 Results indicated that 15 (of 48) chromosomes had a known mutation in CFTR gene, with 1 chromosome bearing two mutations (R75X and D1270H). Login to comment

[hide] Comprehensive mutation screening in a cystic fibro... Pediatrics. 2001 Feb;107(2):280-6. Wine JJ, Kuo E, Hurlock G, Moss RB
Comprehensive mutation screening in a cystic fibrosis center.
Pediatrics. 2001 Feb;107(2):280-6., [PMID:11158459]

Abstract [show]
OBJECTIVES AND BACKGROUND: The identities of a cystic fibrosis (CF) patient's CFTR mutations can influence therapeutic strategies, but because >800 CFTR mutations exist, cost-effective, comprehensive screening requires a multistage approach. Single-strand conformation polymorphism and heteroduplex analysis (SSCP/HA) can be an important part of mutation detection, but must be calibrated within each laboratory. The sensitivity of a combined commercial-SSCP/HA approach to genotyping in a large, ethnically diverse US center CF population has not been established. STUDY DESIGN: We screened all 27 CFTR exons in 10 human participants who had an unequivocal CF diagnosis including a positive sweat chloride test and at least 1 unknown allele after commercial testing for the 70 most common mutations by SSCP/HA. These participants were compared with 7 participants who had negative sweat tests but at least 1 other CF-like symptom meriting complete genotyping. RESULTS: For the 10 CF participants, we detected 11 of 16 unknown alleles (69%) and all 4 of the known alleles (100%), for an overall rate of 75% inpatients not fully genotyped by conventional 70 mutation screen. For 7 participants with negative sweat tests, we confirmed 1 identified mutation in 14 alleles and detected 3 additional mutations. Mutations detected in both groups included 7 missense mutations (S13F, P67L, G98R, S492F, G970D, L1093P, N1303K) and 9 deletion, frameshift, nonsense or splicing mutations (R75X, G542X, DeltaF508, 451-458Delta8 bp, 5T, 663DeltaT, exon 13 frameshift, 1261+1G-->A and 3272-26A-->G). Three of these mutations were novel (G970D, L1093P, and 451-458Delta8 bp(1)). Thirteen other changes were detected, including the novel changes 1812-3 ins T, 4096-278 ins T, 4096-265 ins TG, and 4096-180 T-->G. CONCLUSION: When combined with the 70 mutation Genzyme test, SSCP/HA analysis allows for detection of >95% of the mutations in an ethnically heterogeneous CF center population. We discuss 5 possible explanations that could account for the few remaining undetected mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
16 Mutations detected in both groups included 7 missense mutations (S13F, P67L, G98R, S492F, G970D, L1093P, N1303K) and 9 deletion, frameshift, nonsense or splicing mutations (R75X, G542X, ⌬F508, 451-458⌬8 bp, 5T, 663⌬T, exon 13 frameshift, 1261؉1G3A and 3272-26A3G). Login to comment
115 Mutation Detection in 10 Participants With Positive Sweat Chloride Values I.D. Pancreatic Function Mutation Status Discovered Mutations (Novel) Polymorphisms SP1 PI N1303K/unk* L1093P (17b), M470V (10)* SP2 PI unk*/unk* S13F (exon1) 2184 ins A (exon 13) GATT7/7, 2694 T/G SP3 PS unk*/unk* ⌬451-458 (4); G970D (16) GATT7/6, 2694 T/G SP4 PS unk*/unk* R75X (3), G98R (4) GATT7/7, 492 G/A SP5 PS unk*/unk 3272-26A/G (17b) M470V/M470V (10) SP6 PI/PS (mild) ⌬F508/unk None found - SP7 PI ⌬F508/unk None found GATT6/7,1001ϩ11C/T (6b), M470V (10) SP8 PI unk*/unk S492F (10) GATT7/7 GT11/11 M470V/M470V SP9 PI ⌬F508/unk None found - SP10 PI unk*/unk* 663 ⌬T/663 ⌬T GATT6/6, 2694T3G Column labeled Pancreatic Function indicates the need for dietary supplementation with pancreatic enzymes. Login to comment

[hide] XV-2c/KM-19 haplotype analysis of cystic fibrosis ... Am J Med Genet. 2001 Aug 15;102(3):277-81. Orozco L, Gonzalez L, Chavez M, Velazquez R, Lezana JL, Saldana Y, Villarreal T, Carnevale A
XV-2c/KM-19 haplotype analysis of cystic fibrosis mutations in Mexican patients.
Am J Med Genet. 2001 Aug 15;102(3):277-81., 2001-08-15 [PMID:11484207]

Abstract [show]
We analyzed 97 unrelated Mexican cystic fibrosis (CF) patients and their first-degree relatives to study the association of XV2C/TaqI/KM19/PstI haplotypes with CF mutations in this population. Haplotype phases could be established in 148 CF and 110 normal chromosomes, and haplotype distributions of normal and CF chromosomes differed significantly (P < 0.001). DeltaF508 and G542X mutations accounted for 56% of CF chromosomes and were found to be associated with haplotype B in 97.2% and 72.7% of chromosomes, respectively. The haplotype distribution of CF chromosomes carrying other rare and unknown mutations was similar to that of normal chromosomes (P > 0.05), haplotypes A and C being the most frequent. This is in accordance with the extensive heterogeneity and the spectrum of mutations reported in Mexican CF patients. We also report the haplotype distribution of all informative chromosomes bearing rare mutations; some were found to be associated with previously reported haplotypes, whereas others were found on different haplotypes. Recombination or recurrence of mutations may explain these different associations, although other intragenic markers must be used to better understand the origin and dispersion of CF mutations in our country. XK haplotype analysis allowed carrier detection among sibs in 24.3% of families, showing that this method may be useful for carrier detection in populations with high allelic heterogeneity.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
65 Distribution of XK Haplotype on Chromosomes Bearing Uncommon Cystic Fibrosis (CF) Mutations A B C D S549N 4/4 DI507 3/3 N1303K 3/3 2055 del9!A 2/2 I148T 1/1 406-1G!A 1/1 R75X 1/1 I506T 1/1 935delA 1/1 2183AA!G 1/1 1924del7 1/1 G551S 1/1 1078delT 1/1 R117H 1/1 384910KbC!T 1/1 1716G!A 1/1 W1204X 1/1 W1098C 1/1 846delT 1/1 R75Q 1/1 W1069X 1/1 L558S 1/1 4160insGGGG 1/1 297-1G!A 1/1 Fig. Login to comment

[hide] Improved detection of CFTR mutations in Southern C... Hum Mutat. 2001 Oct;18(4):296-307. Wong LJ, Wang J, Zhang YH, Hsu E, Heim RA, Bowman CM, Woo MS
Improved detection of CFTR mutations in Southern California Hispanic CF patients.
Hum Mutat. 2001 Oct;18(4):296-307., [PMID:11668613]

Abstract [show]
Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene cause cystic fibrosis (CF), a common autosomal recessive disease in Caucasians. The broad mutation spectrum varies among different patient groups. Current molecular diagnoses are designed to detect 80-97% of CF chromosomes in Caucasians and Ashkenazi Jews but have a much lower detection rate in Hispanic CF patients. Grebe et al. [1994] reported a 58% detection rate in Hispanic patients. Since then, there has been no large-scale, complete mutational analysis of Hispanic CF patients. In this study, the mutations in 62 Hispanic patients from southern California were investigated. The entire coding and flanking intronic regions of the CFTR gene were analyzed by temporal temperature gradient gel electrophoresis (TTGE) followed by sequencing to identify the mutations. Eleven novel mutations were discovered in this patient group: 3876delA, 406-1G>A, 935delA, 663delT, 3271delGG, 2105-2117del13insAGAAA, 3199del6, Q179K, 2108delA, 3171delC, and 3500-2A>T. Among the mutations, seven were out-of-frame insertions and deletions that result in truncated proteins, two were splice-site mutations, one was an in-frame 6 bp deletion, and one was a missense mutation that involved the non-conservative change of glutamine-179 to lysine. All patients presented severe classical clinical course with pancreatic insufficiency and poor growth, consistent with the nature of truncation mutation. The results indicate that TTGE screening following the analysis of recurrent mutations will substantially improve the mutation detection rate for Hispanic CF patients from southern California.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
117 Summary of Mutations Found in This Group of Hispanic Patients Exon or Number of Mutation intron chromosomes Frequency % Mutations detected before full gene analysis 91 73.38% 1 F508 10 64 51.6 2 G542X 11 5 4 3 3849+10kb C>T Intron 19 5 4 4 S549N 11 3 2.4 5 I148T 4 2 1.6 6 3120+1G>A 16 2 1.6 7 R334W 7 2 1.6 8 G551D 11 1 0.8 9 N1303K 21 1 0.8 10 W1282X 20 1 0.8 11 R1162X 19 1 0.8 12 G85E 3 1 0.8 13 W1089X 17b 1 0.8 14 Y1092X 17b 1 0.8 15 P205S 6a 1 0.8 Mutations detected by full gene screening 26 20.97% 16 R1066Ca 17b 2 1.6 17 1949del84 13 1 0.8 18 2184delA 13 1 0.8 19 Q98R 4 1 0.8 20 R75X 3 1 0.8 21 G1244E 20 1 0.8 22 3876delA 20 7 5.65 23 935delA 6b 2 1.6 24 406-1G>A Intron 2 2 1.6 25 3271delGG 17a 1 0.8 26 2105-2117del13insAGAAA 13 1 0.8 27 663delT 5 1 0.8 28 3171delC 17a 1 0.8 29 2108delA 13 1 0.8 30 Q179K 5 1 0.8 31 3199del6 17a 1 0.8 32 3500-2 A->T Intron 17b 1 0.8 Total identified 117 (177)b 94.35 (97.5)b Unidentified 7 (3)b 5.65 (2.5)b Total 124 (120)b 100 (100)b a This mutation was also detected by SSCP. Login to comment
122 Clinical Presentations of Hispanic Cystic Fibrosis Patients With Novel Genotypes Patient number 1 2 3 4 5 6 7 8 9 Age/age at 7/1 (31)/0.5 23/1.2 18/9.5 (21)/15 13/0.3 18/at birth 12/7 15/0.5 diagnosisa Genotype ∆F508/3171delC W1089X/Q179K ∆F508/R75X 3271delGG/S549N I148T/3199del6 ∆F508/406-1G->A R334W/3500-2A->T 406-1G->A/unk Y1092X/R1162X Sweat Cl- 87 mEq/L (1) 79 mEq/L (0.5) 86 mEq/L (0.5) 73 mEq/L (10) 102 mEq/L (15) 100 mEq/L (0.5) 104 mEq/L (at birth) 72 mEq/L (4) 64 mEq/L (1) (age) FVC (age)b NA 59% (29) 54% (22) 75% (17) 45% (22) 81% (11); 99 (12) 60% (18) 73% (11); 71 (12) 45% (13) FEV1 (age)c NA 26% (29) 38% (22) 53% (17) 24% (22) 59% (11); 78 (12) 44% (18) 30% (11); 58 (12) 31% (13) Pancreatic Insufficient Insufficient Insufficient Insufficient Insufficient Insufficient Insufficient Insufficient Insufficient functiond Microbial Enterobacter Pseudomonas Staphylococcus Pseudomonas E. coli Staphylococcus Pseudomonas Staphylococcus Pseudomonas colonization Cloacae Aspergillus Pseudomonas Pseudomonas Staphylococcus Pseudomonas Acintobacter Aspergillus Height/weight/ 5/18/4 5/5/30 5/5/22 77/91/17 20/46/20 9/11/12 5/5/18 12/5/12 24/31/13 agee Complications Hypothyroidism RU/RML Learning Diabetes, Hypersplenism, Meconium PPD converter Chronic bronchictasis disability, depression portal ileus constipation requiring chronic hypertension, lobectomy abdominal pain liver cysts a Age and age at diagnosis are in years. Login to comment

[hide] Cystic fibrosis: a worldwide analysis of CFTR muta... Hum Mutat. 2002 Jun;19(6):575-606. Bobadilla JL, Macek M Jr, Fine JP, Farrell PM
Cystic fibrosis: a worldwide analysis of CFTR mutations--correlation with incidence data and application to screening.
Hum Mutat. 2002 Jun;19(6):575-606., [PMID:12007216]

Abstract [show]
Although there have been numerous reports from around the world of mutations in the gene of chromosome 7 known as CFTR (cystic fibrosis transmembrane conductance regulator), little attention has been given to integrating these mutant alleles into a global understanding of the population molecular genetics associated with cystic fibrosis (CF). We determined the distribution of CFTR mutations in as many regions throughout the world as possible in an effort designed to: 1) increase our understanding of ancestry-genotype relationships, 2) compare mutational arrays with disease incidence, and 3) gain insight for decisions regarding screening program enhancement through CFTR multi-mutational analyses. Information on all mutations that have been published since the identification and cloning of the CFTR gene's most common allele, DeltaF508 (or F508del), was reviewed and integrated into a centralized database. The data were then sorted and regional CFTR arrays were determined using mutations that appeared in a given region with a frequency of 0.5% or greater. Final analyses were based on 72,431 CF chromosomes, using data compiled from over 100 original papers, and over 80 regions from around the world, including all nations where CF has been studied using analytical molecular genetics. Initial results confirmed wide mutational heterogeneity throughout the world; however, characterization of the most common mutations across most populations was possible. We also examined CF incidence, DeltaF508 frequency, and regional mutational heterogeneity in a subset of populations. Data for these analyses were filtered for reliability and methodological strength before being incorporated into the final analysis. Statistical assessment of these variables revealed that there is a significant positive correlation between DeltaF508 frequency and the CF incidence levels of regional populations. Regional analyses were also performed to search for trends in the distribution of CFTR mutations across migrant and related populations; this led to clarification of ancestry-genotype patterns that can be used to design CFTR multi-mutation panels for CF screening programs. From comprehensive assessment of these data, we offer recommendations that multiple CFTR alleles should eventually be included to increase the sensitivity of newborn screening programs employing two-tier testing with trypsinogen and DNA analysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
111 Slovakia ∆F508 (57.3%) CFTRdele2,3 (1.2%) 82.7 68.4 14 908/254 CFGAC [1994]; Estivill et al. G542X (6.8%) 3849+10KbC→T (1.0%) [1997]; Dörk et al. [2000]; R553X (4.0%) S42F (0.9%) Macek et al. [2002] N1303K (3.4%) R75X (0.9%) 2143delT (1.8%) G85E (0.9%) R347P (1.4%) 605insT (0.9%) W1282X (1.3%) 1898+1G→A (0.9%) Slovenia ∆F508 (57.8%) R347P (1.1%) 79.7 63.5 16 455/132 CFGAC [1994]; Dörk et al. 2789+5G→A (4.1%) S4X (0.8%) [2000]; Macek et al. [2002] R1162X (3.2%) 457TAT→G (0.8%) G542X (1.9%) D192G (0.8%) Q552X (1.5%) R553X (0.8%) Q685X (1.5%) A559T (0.8%) 3905insT (1.5%) 2907delTT (0.8%) CFTRdele2,3 (1.5%) 3667ins4 (0.8%) Spain ∆F508 (52.7%) G85E (0.8%) 80.2 64.3 21 3608/1356 Chillón et al. [1994]; Casals et G542X (8.0%) R1066C (0.8%) al. [1997]; Estivill et al. [1997] N1303K (2.5%) 2789+5G→A (0.7%) 3601-111G→C (2.0%) 2869insG (0.7%) 1811+1.6Kb A→G (1.7%) ∆I507 (0.6%) R1162X (1.6%) W1282X (0.6%) 711+1G→T (1.3%) L206W (0.5%) R334W (1.2%) R709X (0.5%) Q890X (1.0%) K710X (0.5%) 1609delCA (1.0%) 3272-26A→G (0.5%) 712-1G→T (1.0%) Sweden ∆F508 (66.6%) E60X (0.6%) 85.9 73.8 10 1357/662 Schwartz et al. [1994]; Estivill et 394delTT (7.3%) Y109C (0.6%) al. [1997]; Schaedel et al. 3659delC (5.4%) R117H (0.6%) [1999] 175insT (2.4%) R117C (0.6%) T338I (1.2%) G542X (0.6%) Switzerland ∆F508 (57.2%) K1200E (2.1%) 91.3 83.4 9 1268/1173 Estivill et al. [1997]; R553X (14.0%) N1303K (1.2%) Hergersberg et al. [1997] 3905insT (9.8%) W1282X (1.1%) 1717-1G→A (2.7%) R347P (0.6%) G542X (2.6%) Ukraine ∆F508 (65.2%) CFTRdele2,3 (1.1%) 74.6 55.7 6 1055/580 Estivill et al. [1997]; Dörk et al. R553X (3.6%) G551D (1.8%) [2000]; Macek et al. [2002] N1303K (2.4%) W1282X (0.5%) United ∆F508 (75.3%) 621+1G→T (0.93%) 81.6 66.6 5 19622/9815 Schwartz et al. [1995b]; Kingdom G551D (3.1%) 1717-1G→A (0.57%) Estivill et al. [1997] (total) G542X (1.7%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS585 United ∆F508 (56.6%) 621+1G→T (1.8%) 69.1 47.7 7 456 CFGAC [1994] Kingdom G551D (3.7%) R117H (1.5%) (N. Ireland) R560T (2.6%) ∆I507 (0.9%) G542X (2.0%) United ∆F508 (19.2%) 621+2T→C (3.8%) 84.4 71.2 11 52 Malone et al. [1998] Kingdom Y569D (15.4%) 2184insA (3.8%) (Pakistani) Q98X (11.5%) R560S (1.9%) 1525-1G→A (9.6%) 1898+1G→T (1.9%) 296+12T→C (7.7%) R709X (1.9%) 1161delC (7.7%) United ∆F508 (71.3%) 1717-1G→A (1.0%) 86.4 74.6 9 1236/730 Shrimpton et al. [1991]; Kingdom G551D (5.5%) 621+1G→T (0.6%) Gilfillan et al. [1998] (Scotland) G542X (4.0%) ∆I507 (0.6%) R117H (1.4%) R560T (0.6%) P67L (1.4%) United ∆F508 (71.6%) 1717-1G→A (1.1%) 98.7 97.4 17 183 Cheadle et al. [1993] Kingdom 621+1G→T (6.6%) 3659delC (0.5%) (Wales) 1898+1G→A (5.5%) R117H (0.5%) G542X (2.2%) N1303K (0.5%) G551D (2.2%) E60X (0.5%) 1078delT (2.2%) S549N (0.5%) R1283M (1.6%) 3849+10KbC→T (0.5%) R553X (1.1%) 4016insT (0.5%) ∆I507 (1.1%) Yugoslavia ∆F508 (68.9%) 3849G→A (1.0%) 82.2 67.6 11 709/398 Dabovic et al. [1992]; Estivill et G542X (4.0%) N1303K (0.8%) al. [1997]; Macek et al. R1162C (3.0%) 525delT (0.5%) (submitted for publication) 457TAT→G (1.0%) 621+1G→T (0.5%) I148T (1.0%) G551D (0.5%) Q552X (1.0%) Middle East/Africa Algeria 1) DF508 (20.0%) 4) 1812-1G®A (5.0%) - - 5 20 Loumi et al. [1999] 2) N1303K (20.0%) 5) V754M (5.0%) 3) 711+1G®T (10.0%) Jewish W1282X (48.0%) 3849+10KbC→T (6.0%) 95.0 90.3 6 261 Kerem et al. [1995] (Ashkenazi) ∆F508 (28.0%) N1303K (3.0%) G542X (9.0%) 1717-1G→A (1.0%) Jewish 1) N1303K - - 1 6 Kerem et al. [1995] (Egypt) Jewish 1) Q359K/T360K - - 1 8 Kerem et al. [1995] (Georgia) Jewish 1) DF508 2) 405+1G®A - - 2 11 Kerem et al. [1995] (Libya) Jewish 1) DF508 (72.0%) 3) D1152H (6.0%) - - 3 33 Kerem et al. [1995] (Morocco) 2) S549R (6.0%) Jewish ∆F508 (35.0%) W1282X (2.0%) 43.0 18.5 4 51 Shoshani et al. [1992] (Sepharadim) G542X (4.0%) S549I (2.0%) (Continued) BOBADILLAETAL. Login to comment
113 Mexico ∆F508 (41.6%) G551S (0.5%) 75.5 57.0 35 374/194 Orozco et al.[1993]; Villalobos- G542X (5.6%) 1078delT (0.5%) Torres et al. [1997]; Liang et al. ∆I507 (2.5%) Y1092X (0.5%) [1998]; Orozco et al. [2000] S549N (1.9%) R117H (0.5%) N1303K (1.7%) G85E (0.5%) R75X (1.5%) 1716G→A (0.5%) 406-1G→A (1.5%) W1204X (0.5%) I148T (1.5%) W1098C (0.5%) 3849+10KbC→T (1.5%) 846delT (0.5%) 621+1G→T (1.2%) P750L (0.5%) 2055del9→A (1.0%) V754M (0.5%) 935delA (1.0%) R75Q (0.5%) I506T (1.0) W1096X (0.5%) 3199del6 (1.0%) L558S (0.5%) 2183AA→G (1.0%) 4160insGGGG (0.5%) G551D (0.5%) 297-1G→A (0.5%) R553X (0.5%) H199Y (0.5%) 1924del7 (0.5%) United States ∆F508 (68.6%) R553X (0.9%) 79.7 63.5 10 25048 Cystic Fibrosis Foundation (total) G542X (2.4%) 621+1G→T (0.9%) [1998] G551D (2.1%) 1717-1G→A (0.7%) W1282X (1.4%) 3849+10KbC→T (0.7%) N1303K (1.3%) R117H (0.7%) United States ∆F508 (48.0%) S1255X (1.4%) 77.3 59.8 16 160/148 Carles et al. [1996]; Macek et al. (African 3120+1G→A (12.2%) 444delA (0.7%) [1997]; Dörk et al. [1998]; American) 2307insA (2.0%) R334W (0.7%) Friedman et al. [1998] A559T (2.0%) ∆I507 (0.7%) R553X (2.0%) 1717-1G→A (0.7%) ∆F311 (2.0%) G542X (0.7%) G480C (1.4%) S549N (0.7%) 405+3A→C (1.4%) G551D (0.7%) United States 1) L1093P - - 1 2 Yee et al. [2000] (Cherokee) United States Non-French: French: Non- Non- Non- Non- Bayleran et al. [1996] (Maine) ∆F508 (82.0%) ∆F508 (58%) French: French: French: French: G542X (2.6%) 711+1G→T (8.3%) 95.3 90.8 11 191 G551D (2.6%) I148T (4.2%) French: French: French: French: N1303K (2.1%) A455E (4.2%) 80.3 64.5 8 72 R560T (1.0%) 1717-1G→A (1.4%) Total: 621+1G→T (1.0%) G85E (1.4%) 263 711+1G→T (1.0%) 621+1G→T (1.4%) R117H (1.0%) Y1092X (1.4%) 1717-1G→A (1.0%) G85E (0.5%) W1282X (0.5%) TABLE 1. Continued. Estimated Projected detection of Number of Number of Country/ allele two CFTR mutations chromosomes Region Mutation array detectiona mutationsb includedc (max/min)d Reference WORLDWIDEANALYSISOFCFTRMUTATIONS589 United States ∆F508 (46.0%) R334W (1.6%) 58.5 34.2 7 129 Grebe et al. [1994] (SW Hispanic) G542X (5.4%) W1282X (0.8%) 3849+10KbC→T (2.3%) R553X (0.8%) R1162X (1.6%) United States 1) R1162X - - 3 17 Mercier et al. [1992] (SW Native 2) D648V American) 3) G542X United States 1) R1162X 3) G542X - - 4 16 Mercier et al. [1994] (Zuni Pueblo) 2) 3849+10KbC®T 4) D648V Venezuela ∆F508 (29.6%) G542X (3.7%) 33.3 11.1 2 54 Restrepo et al. [2000] Other Regions Australia ∆F508 (76.9%) 621+1G→T (1.1%) 88.7 78.7 8 761/464 CFGAC [1994] G551D (4.5%) N1303K (0.9%) G542X (2.8%) W1282X (0.6%) R553X (1.3%) R117H (0.6%) East Asia 1) 1898+1G®T 2) 1898+5G®T - - 2 28 Suwanjutha et al. [1998] Hutterite 1) M1101K (69.0%) 2) DF508 (31.0%) - - 2 32 Zielenski et al. [1993] Brethren New Zealand ∆F508 (78.0%) N1303K (1.9%) 87.4 76.4 5 636 CFGAC [1994] G551D (4.4%) 621+1G→T (1.1%) G542X (2.0%) *This table presents the mutation panels for all regions investigated in this study. Login to comment
213 Ideal Recommended CFTR Mutation Screening Panel for 2001 Neonatal Screening in the USA* Location Estimated Mutation in CFTRa percentageb Reason for inclusion DF508 Exon 10 68.6% CFF registry, >1%, Pan-European G542X Exon 11 2.4% CFF registry, >1%, Mediterranean G551D Exon 11 2.1% CFF registry, >1%, Celtic W1282X Exon 20 1.4% CFF registry, >1%, Ashkenazi Jew N1303K Exon 21 1.3% CFF registry, >1%, Mediterranean R553X Exon 11 0.9% CFF registry, >0.5%, Hispanic 621+1G®T Intron 4 0.9% CFF registry, >0.5%, multi-ethnic 1717-1G®A Intron 10 0.7% CFF registry, >0.5%, Italian 3849+10KbC®T Intron 19 0.7% CFF registry, >0.5%, Hispanic R117Hc Exon 4 0.7% CFF registry, >0.5% 1898+1G→T Intron 12 0.4% CFF registry, >0.1%, East Asian DI507 Exon 10 0.3% CFF registry, >0.1%, Hispanic 2789+5G®A Intron 14b 0.3% CFF registry, >0.1% G85E Exon 3 0.3% CFF registry, >0.1% R347P Exon 7 0.2% CFF registry, >0.1% R334W Exon 7 0.2% CFF registry, >0.1%, multi-ethnic R1162X Exon 19 0.2% CFF registry, >0.1%, multi-ethnic R560T Exon 11 0.2% CFF registry, >0.1% 3659delC Exon 19 0.2% CFF registry, >0.1% A455E Exon 9 0.2% CFF registry, >0.1% 2184delA Exon 13 0.1% CFF registry, >0.1% S549N Exon 11 0.1% CFF registry, >0.1%, multi-ethnic 711+1G®T Intron 5 0.1% CFF registry, >0.1% R75X Exon 3 0.2% Hispanic 406-1G→A Intron 3 0.2% Hispanic I148T Exon 4 0.2% Hispanic, French 2055del9→A Exon 13 0.1% Hispanic 935delA Exon 6b 0.1% Hispanic I506T Exon 10 0.1% Hispanic 3199del6 Exon 17a 0.1% Hispanic 2183AA→G Exon 13 0.1% Hispanic 3120+1G®A Intron 16 1.5% African American, Arabian 2307insA Exon 13 0.2% African American A559T Exon 11 0.2% African American ∆F311 Exon 7 0.2% African American G480C Exon 10 0.2% African American 405+3A→C Intron 3 0.2% African American S1255X Exon 20 0.2% African American L1093P Exon 17b Undetermined Native American D648V Exon 13 Undetermined Native American I1234V Exon 19 Undetermined Arabian linkage S549R Exon 11 Undetermined Arabian linkage 1898+5G→T Intron 12 Undetermined East Asian linkage CFTRdele2,3 Exons 2,3 Undetermined Eastern European linkage (Slavic) Y1092X Exon 17b Undetermined French linkage 394delTT Exon 3 Undetermined Nordic linkage Y569D Exon 12 Undetermined Pakistani linkage 3905insT Exon 20 Undetermined Swiss linkage (also: Amish, Acadian, Mennonite) 1898+1G®A Intron 12 Undetermined Welsh linkage M1101k Exon 17b Undetermined Hutterite ancestry *This table presents the top 50 mutations in the USA based on the Cystic Fibrosis Foundation CF Registry data from 1997 [Cystic Fibrosis Foundation, 1998], and data generated during our investigation. Login to comment

[hide] Analysis by mass spectrometry of 100 cystic fibros... Hum Reprod. 2002 Aug;17(8):2066-72. Wang Z, Milunsky J, Yamin M, Maher T, Oates R, Milunsky A
Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens.
Hum Reprod. 2002 Aug;17(8):2066-72., [PMID:12151438]

Abstract [show]
BACKGROUND: Limited mutation analysis for congenital bilateral absence of the vas deferens (CBAVD) has revealed only a minority of men in whom two distinct mutations were detected. We aimed to determine whether a more extensive mutation analysis would be of benefit in genetic counselling and prenatal diagnosis. METHODS: We studied a cohort of 92 men with CBAVD using mass spectrometry and primer oligonucleotide base extension to analyse an approximately hierarchical set of the most common 100 CF mutations. RESULTS: Analysis of 100 CF mutations identified 33/92 (35.9%) patients with two mutations and 29/92 (31.5%) with one mutation, compound heterozygosity accounting for 94% (31/33) of those with two mutations. This panel detected 12.0% more CBAVD men with at least one mutation and identified a second mutation in >50% of those considered to be heterozygotes under the two routine 25 mutation panel analyses. CONCLUSION: Compound heterozygosity of severe/mild mutations accounted for the vast majority of the CBAVD patients with two mutations, and underscores the value of a more extensive CF mutation panel for men with CBAVD. The CF100 panel enables higher carrier detection rates especially for men with CBAVD, their partners, partners of known CF carriers, and those with 'mild' CF with rarer mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Given the frequency of CF mutations, especially in the Caucasian population ( in 25), and the common request by CBAVD men to sire their own offspring by using surgical Table I. The 100 most common cystic fibrosis mutations listed by exon Mutationa Exonb Frequency (%)c G85E 3 0.1 394delTT 3 Swedish E60X 3 Belgium R75X 3 405ϩ1G→A Int 3 R117H 4 0.30 Y122X 4 French 457TAT→G 4 Austria I148T 4 Canada (French Canadian) 574delA 4 444delA 4 R117L 4 621ϩ1G→T Int 4 0.72 711ϩ1G→T Int 5 Ͼ0.1 712-1G→T Int 5 711ϩ5G→A Int 5 Italy (Caucasian) L206W 6a R347P 7 0.24 1078delT 7 Ͼ0.1 R334W 7 Ͼ0.1 1154InsTC 7 T338I 7 Italy R347H 7 Turkey Q359K/T360K 7 Israel (Georgian Jews) I336K 7 R352Q 7 G330X 7 S364P 7 A455E 9 0.20 I507 10 0.21 F508 10 66.02 1609delCA 10 Spain (Caucasian) V520F 10 Q493X 10 C524X 10 G480C 10 Q493R 10 1717-1G→A Int 10 0.58 R553X 11 0.73 G551D 11 1.64 G542X 11 2.42 R560T 11 Ͼ0.1 S549N 11 Q552X 11 Italy S549I 11 Israel (Arabs) A559T 11 African American R553G 11 R560K 11 1812-1G→A Int 11 A561E 12 E585X 12 Y563D 12 Y563N 12 1898ϩ1G→A Int 12 0.22 1898ϩ1G→C Int 12 2183AA→G 13 Italian 2184delA 13 Ͻ0.1 K710X 13 2143delT 13 Moscow (Russian) 2184InsA 13 1949del84 13 Spain (Spanish) 2176InsC 13 2043delG 13 2307insA 13 2789ϩ5G→A Int 14b Ͼ0.1 2869insG 15 S945L 15 Q890X 15 3120G→A 16 2067 Table I. continued Mutationa Exonb Frequency (%)c 3120ϩ1G→A Int 16 African American 3272-26A→G Int 17a R1066C 17b Portugal (Portugese) L1077P 17b R1070Q 17b Bulgarian W1089X 17b M1101K 17b Canada (Hutterite) R1070P 17b R1162X 19 0.29 3659delC 19 Ͼ0.1 3849G→A 19 3662delA 19 3791delC 19 3821delT 19 Russian Q1238X 19 S1235R 19 France, South S1196X 19 K1177R 19 3849ϩ10kbC→T Int 19 0.24 3849ϩ4A→G Int 19 W1282X 20 1.22 S1251N 20 Dutch, Belgian 3905insT 20 Swiss, Acadian, Amish G1244E 20 R1283M 20 Welsh W1282R 20 D1270N 20 S1255X 20 African American 4005ϩ1G→A Int 20 N1303K 21 1.34 W1316X 21 aMutations were chosen according to their frequencies (Cystic Fibrosis Genetic Analysis Consortium, 1994; Zielenski and Tsui, 1995; Estivill et al., 1997). Login to comment

[hide] A finger sweat chloride test for the detection of ... Pancreas. 2004 Apr;28(3):e80-5. Naruse S, Ishiguro H, Suzuki Y, Fujiki K, Ko SB, Mizuno N, Takemura T, Yamamoto A, Yoshikawa T, Jin C, Suzuki R, Kitagawa M, Tsuda T, Kondo T, Hayakawa T
A finger sweat chloride test for the detection of a high-risk group of chronic pancreatitis.
Pancreas. 2004 Apr;28(3):e80-5., [PMID:15084988]

Abstract [show]
OBJECTIVES: Mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene are associated with chronic pancreatitis in Caucasians. We developed a simple method for measuring finger sweat chloride concentration to test whether CFTR dysfunction underlies chronic pancreatitis in Japan where cystic fibrosis (CF) is rare. METHODS: We studied 25 patients with chronic (21 alcoholic and 4 idiopathic) pancreatitis and 25 healthy volunteers. Sweat chloride concentrations were measured by a finger sweat chloride test. We analyzed DNA for 20 common CFTR mutations in Europeans, 9 CF-causing mutations in Japanese, and 2 polymorphic loci, a poly-T tract and (TG) repeats, at intron 8. RESULTS: Thirteen patients (52%) had sweat chloride levels >60 mmol/L, a level consistent with CF, while only 4 (16%) healthy subjects exceeded this level. The 29 CF mutations and the 5T allele were detected in neither the patients nor controls. The (TG) 12 allele was common in both the patients (58%) and controls (48%). The (TG) 12/12 genotype was common in alcoholic pancreatitis (29%) compared with the (TG) 11/11 (10%). Patients with the (TG) 12/12 genotype had significantly higher sweat chloride concentrations than the controls. CONCLUSION: CFTR dysfunction as evidenced by a finger sweat chloride test is present in about half of Japanese patients with chronic pancreatitis, suggesting that this test may be useful for detecting the high-risk group. A higher proportion of the (TG) 12 allele may be a genetic background for elevated sweat chloride concentrations in Japanese patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 The 9 CF-causing mutations (R75X, Q98R, M152R, R347H, L441P, L571S, D979A, H1085R, and T1086I) in Japa- nese20,25-28 were screened by SNP typing with Masscode System (Shimadzu, Kyoto, Japan). Login to comment

[hide] Genetic evidence for CFTR dysfunction in Japanese:... J Med Genet. 2004 May;41(5):e55. Fujiki K, Ishiguro H, Ko SB, Mizuno N, Suzuki Y, Takemura T, Yamamoto A, Yoshikawa T, Kitagawa M, Hayakawa T, Sakai Y, Takayama T, Saito M, Kondo T, Naruse S
Genetic evidence for CFTR dysfunction in Japanese: background for chronic pancreatitis.
J Med Genet. 2004 May;41(5):e55., [PMID:15121783]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
219 The nine CF causing (R75X, Q98R, M152R, R347H, L441P, L571S, D979A, H1085R, and T1086I) and two non-CF causing (Q1352H and R1453W) mutations in Japanese6 22-24 were screened by SNP typing with a Masscode system (Shimadzu, Kyoto, Japan) and confirmed by sequence analysis in positive and equivocal cases. Login to comment

[hide] Spectrum of cystic fibrosis mutations in Serbia an... Genet Test. 2004 Fall;8(3):276-80. Radivojevic D, Djurisic M, Lalic T, Guc-Scekic M, Savic J, Minic P, Antoniadi T, Tzetis M, Kanavakis E
Spectrum of cystic fibrosis mutations in Serbia and Montenegro and strategy for prenatal diagnosis.
Genet Test. 2004 Fall;8(3):276-80., [PMID:15727251]

Abstract [show]
We have screened 175 patients for molecular defects in the cystic fibrosis transmembrane conductance regulator (CFTR) gene using nondenaturing polyacrylamide gel electrophoresis (PAGE), denaturing gradient gel electrophoresis (DGGE), and sequencing. Six different mutations (F508del, G542X, 621+1G --> T, 2789+5G --> A, R1070Q, and S466X) accounted for 79.71% of CF alleles, with the F508del mutation showing a frequency of 72.28%. Another 12 mutations (R334W, 2184insA, I507del, 1525-1G --> A, E585X, R75X, M1I, 457TAT --> G, 574delA, 2723delTT, A120T, and 2907delTT) covered an additional 3.36%. A novel mutation (2723delTT) was found in one CF patient (F508del/2723delTT). Thus, a total of 18 mutations cover 82.57% of CF alleles. During our study, 72% of families at risk for having a CF child were found to be fully informative for prenatal diagnosis. Prenatal diagnosis was performed on 56 families; 76 analyses resulting in 16 affected, 38 carriers, and 22 healthy fetuses. These results imply that the molecular basis of CF in Serbia and Montenegro is highly heterogeneous, as is observed in other eastern and southern European populations. Because we detected more then 80% of CFTR alleles, results could be used for planning future screening and appropriate genetic counseling programs in our country.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Another 12 mutations (R334W, 2184insA, I507del, 1525-1G Ǟ A, E585X, R75X, M1I, 457TAT Ǟ G, 574delA, 2723delTT, A120T, and 2907delTT) covered an additional 3.36%. Login to comment
44 CFTR MUTATIONS IDENTIFIED IN 175 YUGOSLAVIAN CF PATIENTS Location Number of positive Frequency Mutation (exon/intron) CF alleles (percentage) F508del Exon 10 253 72.28 621 ϩ 1G → T Intron 4 10 2.86 G542X Exon 11 9 2.57 S466X Exon 10 3 0.86 2789 ϩ 5 G → A Intron 14b 2 0.57 R1070Q Exon 17b 2 0.57 MI1 Exon 1 1 0.28 R75X Exon 3 1 0.28 457TAT → G Exon 4 1 0.28 574delA Exon 4 1 0.28 A120T Exon 4 1 0.28 R334W Exon 7 1 0.28 1525-1 G → A Intron 9 1 0.28 I507del Exon 10 1 0.28 E585X Exon 12 1 0.28 2184insA Exon 13 1 0.28 2723delTTa Exon 14a 1 0.28 2907delTT Exon 15 1 0.28 Unknown - 61 17.43 aNew frameshift mutation. Login to comment
55 Nine different mutations were detected: F508del, 2907delTT, S466X, 457TAT Ǟ G, R75X, 2184insA, G542X, 621ϩ1G Ǟ T, and R1070Q in a total of 76 prenatal analyses (Table 2). Login to comment
74 Eleven mutations detected in Yugoslavian (YU) CF alleles were also found in the neighboring region: R1070Q (Albania, Bulgaria, Greece), 2789ϩ5G Ǟ A (Bulgaria, Greece, FYROM, Slovenia), R334W (Greece), 2184insA (Bulgaria, FYROM), I507del (Greece, Italy), 1525-1G Ǟ A (Greece), R75X (Greece), 457TAT Ǟ G (Greece, FYROM, Slovenia), 574delA (Bulgaria), A120T (Greece), and 2907delTT (Slovenia) (Audrezet et al., 1994; CFGAC, 1994; Estivill et al., 1997; Kremensky et al., 2000; Vouk et al., 2000; Koceva et al., 2001; Bobadilla et al., 2002; Kanavakis et al., 2003). Login to comment

[hide] Extensive sequencing of the CFTR gene: lessons lea... Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28. McGinniss MJ, Chen C, Redman JB, Buller A, Quan F, Peng M, Giusti R, Hantash FM, Huang D, Sun W, Strom CM
Extensive sequencing of the CFTR gene: lessons learned from the first 157 patient samples.
Hum Genet. 2005 Dec;118(3-4):331-8. Epub 2005 Sep 28., [PMID:16189704]

Abstract [show]
Cystic fibrosis (CF) is one of the most common monogenic diseases affecting Caucasians and has an incidence of approximately 1:3,300 births. Currently recommended screening panels for mutations in the responsible gene (CF transmembrane regulator gene, CFTR) do not detect all disease-associated mutations. Our laboratory offers extensive sequencing of the CFTR (ABCC7) gene (including the promoter, all exons and splice junction sites, and regions of selected introns) as a clinical test to detect mutations which are not found with conventional screening. The objective of this report is to summarize the findings of extensive CFTR sequencing from our first 157 consecutive patient samples. In most patients with classic CF symptoms (18/24, 75%), extensive CFTR sequencing confirmed the diagnosis by finding two disease-associated mutations. In contrast, only 5 of 75 (7%) patients with atypical CF had been identified with two CFTR mutations. A diagnosis of CF was confirmed in 10 of 17 (58%) newborns with either positive sweat chloride readings or positive immunoreactive trypsinogen (IRT) screen results. We ascertained ten novel sequence variants that are potentially disease-associated: two deletions (c.1641AG>T, c.2949_2853delTACTC), seven missense mutations (p.S158T, p.G451V, p.K481E, p.C491S, p.H949L, p.T1036N, p.F1099L), and one complex allele ([p.356_A357del; p.358I]). We ascertained three other apparently novel complex alleles. Finally, several patients were found to carry partial CFTR gene deletions. In summary, extensive CFTR gene sequencing can detect rare mutations which are not found with other screening and diagnostic tests, and can thus establish a definitive diagnosis in symptomatic patients with previously negative results. This enables carrier detection and prenatal diagnosis in additional family members.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 DF508/c.546insCTA CF; lung symptoms; PS; 2 sibs with CF NG Pos p.R1066C/c.3272-26 A>G Mild CF 40 115 [p.V562I;p.A1006E]b /p.R1158X CF, FTT 6 Not done DF508/c.1716G>A Classic CF 21 Not done p.R785X/c.2732insA Classic CF, PI 4 Not done DF508/p.R117C Classic CF 2 Not done DF508/p.R75X CF 19 Pos DF508/p.G451Va Mild CF 23 Pos DF508/p.L206W Classic CF 9 150s DF508/p.G542Xc Classic CF 15 Pos p.T1036N/p.T1036Na CF, PS 9 Pos DF508/c.3272-26 A>G Classic CF 33 Not done DF508/p.R117Hc Classic CF 35 Not done DF508/p.A455Ec CF 3 Pos p.G551D/p.Y275X a Novel CFTR variant b Complex CFTR allele c Both mutations are on the ACMG/ACOG panel Table 5 Diagnosis of CF in infants/newborns with abnormal newborn screening results Patient number Genotype Age at sequencing Sex Newborn screen result Sweat chloride concentration (mmol/l)a Phenotype 1 DF508/c.2789+2insA 3 months F Positive sweat test 88,96,89,84 Dx of CF, being treated prophylactically 2 DF508/c.2949del5b 3 months F IRT positive 105 Dx of CF 3 p.G551D/c.1259insA 14 months M Positive sweat test ?

In reference to DF508 and 1716G>A. Does this mean these two mutation have resulted in "classic CF"? Does this mean 1716G>A is disease causing?
Gibson75 on 2013-08-12 07:00:25

Login to comment

[hide] Comprehensive genetic analysis of the cystic fibro... Genet Med. 2006 Sep;8(9):557-62. Kammesheidt A, Kharrazi M, Graham S, Young S, Pearl M, Dunlop C, Keiles S
Comprehensive genetic analysis of the cystic fibrosis transmembrane conductance regulator from dried blood specimens--implications for newborn screening.
Genet Med. 2006 Sep;8(9):557-62., [PMID:16980811]

Abstract [show]
PURPOSE: In the United States, approximately 1/3,700 babies is born with cystic fibrosis each year. The >1,300 documented sequence variants pose a challenge for detection of cystic fibrosis through genetic screening. To investigate whether comprehensive characterization of the cystic fibrosis gene is feasible using dried newborn blood specimens, we modified the whole blood Ambry Test: CF and determined its sensitivity by testing DNA from individuals with cystic fibrosis who still had unknown mutations after commercial mutation panel testing. METHODS: DNA from 42 archived newborn dried blood specimens of affected Hispanic, African-American and Caucasian individuals in California was analyzed by temporal temperature gradient electrophoresis screening and targeted sequencing, and by gross deletion analysis. RESULTS: Excluding two specimens that could not be analyzed due to poor DNA quality, we report a 100% sensitivity and clinical detection rate in the remaining 40 patients. Eighty-three mutations representing 40 different variants were detected, including 8 novel mutations. CONCLUSIONS: This study demonstrates the feasibility of temporal temperature gradient electrophoresis-based full sequence analysis and targeted sequencing from DNA in newborn blood specimens. The Ambry Test: CF, as an additional step in cystic fibrosis newborn screening models, can be used to dramatically reduce the number of cystic fibrosis carrier sweat test referrals.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
98 In states with single specimenmodels,originalspecimensaretestedforthepresenceof themostcommonmutation,deltaF508,and/orotherdeleterious Table 1 Genotype data from panel testing and comprehensive Ambry TestTM : CF analysis Case Ethnicity ABI-31 Mutation 1 ABI-31 Mutation 2 Genzyme-87 Mutation 1 Genzyme-87 Mutation 2 Ambry Mutation 1 Ambry Mutation 2 Ambry Mutation 3 1 Hispanic delF508a 4382delAa 2 Hispanic delF508 N/I delF508 N/I delF508a 1248ϩ1GϾAa 3 African-American N/I N/I N/I N/I M150K CFTRdele17A,17Bb 4 Hispanic G542X N/I G542X N/I G542Xa 1288insTAa 5 African-American N/I N/I 3120ϩ1GϾA N/I 3120ϩ1GϾAa Q98Xa 3849؉72G>A 6 Hispanic delF508 N/I delF508 N/I delF508a 2289del10ins5a 7c Hispanic N/I N/I N/I N/I H199Ya 406-1GϾAa 8 Hispanic delF508 N/I delF508 N/I delF508a CFTRdele2,3(21kbb 9 Hispanic delF508 N/I delF508 N/I delF508a 2105-2117del13insAGAAAa 10 Hispanic G542X N/I G542X N/I G542X M952I Y914X 11 Hispanic N/I N/I N/I N/I 663delT L558S 12 Hispanic N/I N/I delF311 N/I delF311a 406-1GϾAa 13 Hispanic N/I N/I 2055del9insAa 2055del9insAa 14 Hispanic delF508 N/I delF508 N/I delF508 2055del9insA 15 Hispanic delF508 N/I delF508 N/I delF508 E257X 16 Hispanic N/I N/I N/I N/I V232D V232D 17 Hispanic delF508 N/I delF508 N/I delF508 H199Y 18 Hispanic delF508 N/I delF508 4160insGGGG 19 Caucasian delF508 N/I delF508 297-1GϾA 20 Hispanic 2183delAAϾG N/I 2183delAAϾG N/I 2183de1AAϾG 3500-2AϾG 21 Hispanic delF508 N/I delF508 S492F 22 Hispanic delF508 N/I delF508 N/I delF508 935delA 23 Caucasian R1162X N/I R1162X N/I R1162X 3940delG 24 Hispanic 711ϩ1GϾT N/I 711ϩ1GϾT T465N 25 Hispanic delF508 N/I delF508 N/I delF508 406-1GϾA 26 Hispanic delF508 N/I delF508 2055del9insA 27 Hispanic delF508 N/I delF508 N/I delF508 V232D 28 Hispanic delF508 N/I delF508 N/I delF508 S1235R 29 Hispanic G542X N/I G542X N/I G542X 297-1GϾA 30 Hispanic delF508 N/I delF508 N/I delF508 Q1100P 31 Hispanic delF508 N/I delF508 W216X 32 Hispanic N/I N/I N/I N/I 406-1GϾA H199Y 33 Hispanic N/I N/I N/I N/I 3272-26AϾG R75X 34 Hispanic N/I N/I Q890X N/I Q890X 2055del9insA 35 Hispanic delF508 N/I delF508 N/I delF508 W216X 36 Hispanic delF508 N/I delF508 N/I delF508 H199Y 37 Hispanic delF508 N/I delF508 N/I delF508 1288insTA I1027T 38 Hispanic G542X N/I G542X N/I G542X 663delT 39 Hispanic delF508 N/I delF508 N/I delF508 1288insTA 40 Hispanic delF508 N/I delF508 1288insTA mutations using mutation panels. Login to comment

[hide] Identification of CFTR, PRSS1, and SPINK1 mutation... Pancreas. 2006 Oct;33(3):221-7. Keiles S, Kammesheidt A
Identification of CFTR, PRSS1, and SPINK1 mutations in 381 patients with pancreatitis.
Pancreas. 2006 Oct;33(3):221-7., [PMID:17003641]

Abstract [show]
OBJECTIVES: Chronic pancreatitis is a progressive inflammatory disorder leading to irreversible exocrine and/or endocrine impairment. It is well documented that mutations in the cationic trypsinogen (PRSS1) gene can cause hereditary pancreatitis. Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) and the serine protease inhibitor Kazal type 1 (SPINK1) genes are also associated with pancreatitis. METHODS: We analyzed 381 patients with a primary diagnosis of chronic or recurrent pancreatitis using the Ambry Test: Pancreatitis to obtain comprehensive genetic information for the CFTR, SPINK1, and PRSS1 genes. RESULTS: The results identified 32% (122/381) of patients with 166 mutant CFTR alleles, including 12 novel CFTR variants: 4375-20 A>G, F575Y, K598E, L1260P, G194R, F834L, S573C, 2789 + 17 C>T, 621+83 A>G, T164S, 621+25 A>G, and 3500-19 G>A. Of 122 patients with CFTR mutations, 5.5% (21/381) also carried a SPINK1 mutation, and 1.8% (7/381) carried a PRSS1 mutation. In addition, 8.9% (34/381) of all patients had 1 of 11 different SPINK1 mutations. Another 6.3% (24/381) of the patients had 1 of 8 different PRSS1 mutations. Moreover, 1.3% of the patients (5/381) had 1 PRSS1 and 1 SPINK1 mutation. A total 49% (185/381) of the patients carried one or more mutations. CONCLUSIONS: Comprehensive testing of the CFTR, PRSS1, and SPINK1 genes identified genetic variants in nearly half of all subjects considered by their physicians as candidates for genetic testing. Comprehensive test identified numerous novel variants that would not be identified by standard clinical screening panels.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 Patients With SPINK1 and CFTR Mutations SPINK Mutation 1 SPINK Mutation 2 SPINK1 Mutation 3 CFTR Mutation 1 CFTR Mutation 2 No. of Patients 5¶UTR-147 A9G W1282X 1 5¶UTR-41 G9A 5¶UTR-41 G9A D1445N 1 5¶-41 G9A D1270N R74W 1 5¶UTR-81 C9T deltaF508 5T 1 IVS3+184 T9A S1235R 1 IVS3+184 T9A 5T 1 IVS3+184 T9A deltaF508 5T 1 IVS-72delCT R75X 1 L12F IVS3+90 A9T 296+28 A9G 1 L12F IVS3+90 A9T 4375-20 A9G 1 M1R 5¶UTR-147 A9G 5T 1 N34S IVS3-66-65insTTTT N37S Q1352H 1 N34S IVS3-66-65insTTTT L997F 1 N34S 5T 1 N34S IVS3-66-65insTTTT 5T 3 N34S IVS3-66-65insTTTT IVS1-37T 9C deltaF508 R117H 1 N34S IVS3-66-65insTTTT IVS1-37T9C R117H 5T 1 N34S IVS3-66-65insTTTT 621+83 A9G 1 N34S IVS3-66-65insTTTT IVS1-37T9C deltaF508 S1235R 1 Total patients 21 CFTR mutations in boldface would not have been detected by the ACOG/ACMG mutation panel. Login to comment

[hide] Scanning the cystic fibrosis transmembrane conduct... Clin Chem. 2007 Nov;53(11):1891-8. Epub 2007 Sep 21. Montgomery J, Wittwer CT, Kent JO, Zhou L
Scanning the cystic fibrosis transmembrane conductance regulator gene using high-resolution DNA melting analysis.
Clin Chem. 2007 Nov;53(11):1891-8. Epub 2007 Sep 21., [PMID:17890437]

Abstract [show]
BACKGROUND: Complete gene analysis of the cystic fibrosis transmembrane conductance regulator gene (CFTR) by scanning and/or sequencing is seldom performed because of the cost, time, and labor involved. High-resolution DNA melting analysis is a rapid, closed-tube alternative for gene scanning and genotyping. METHODS: The 27 exons of CFTR were amplified in 37 PCR products under identical conditions. Common variants in 96 blood donors were identified in each exon by high-resolution melting on a LightScanner(R). We then performed a subsequent blinded study on 30 samples enriched for disease-causing variants, including all 23 variants recommended by the American College of Medical Genetics and 8 additional, well-characterized variants. RESULTS: We identified 22 different sequence variants in 96 blood donors, including 4 novel variants and the disease-causing p.F508del. In the blinded study, all 40 disease-causing heterozygotes (29 unique) were detected, including 1 new probable disease-causing variant (c.3500-2A>T). The number of false-positive amplicons was decreased 96% by considering the 6 most common heterozygotes. The melting patterns of most heterozygotes were unique (37 of 40 pairs within the same amplicon), the exceptions being p.F508del vs p.I507del, p.G551D vs p.R553X, and p.W1282X vs c.4002A>G. The homozygotes p.G542X, c.2789 + 5G>A, and c.3849 + 10kbC>T were directly identified, but homozygous p.F508del was not. Specific genotyping of these exceptions, as well as genotyping of the 5T allele of intron 8, was achieved by unlabeled-probe and small-amplicon melting assays. CONCLUSIONS: High-resolution DNA melting methods provide a rapid and accurate alternative for complete CFTR analysis. False positives can be decreased by considering the melting profiles of common variants.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 G85E is in a low-temperature domain compared with R75X, resulting in deviation of the melting curves at different temperatures. The PCR product was 169 bp in length. Login to comment
145 2 223CϾT R31C 3 355CϾT R75X 386GϾA G85E 4 482GϾA R117H 575TϾC I148T 621 ؉ 1GϾTb 5 711 ؉ 1GϾT 7 1078delT 1132CϾT R334W 1150delA 1172GϾC R347P 8 1341 ϩ 18AϾCc 9 1496CϾA A455E 10 1651-1653del I507del 1653-1655del F508deld 11 1717 - 1GϾA 1756GϾT G542Xe 1784GϾA G551Db 1789CϾT R553Xf 1811GϾC R560T 12 1898 ؉ 1GϾA 13 2184delA 14b 2789 ؉ 5GϾAe 16 3120 ؉ 1GϾA 18 3500 - 2AϾTg 19 3616CϾT R1162X 3659delC Intron 19 3849 ؉ 10kbCϾTe 20 3978GϾA W1282X 21 4041CϾG N1303K 22 4178GϾA G1349Dc a Disease-causing variants recommended for genotyping by the ACMG (4) are in bold. Login to comment
108 In contrast, the p.R75X variant occupies a region of greater thermal stability and exhibits a shape change at higher temperatures. The disease-associated variants tested in the blinded study are shown in Table 2. Login to comment

[hide] CFTR mutations in Turkish and North African cystic... Genet Test. 2008 Mar;12(1):25-35. Lakeman P, Gille JJ, Dankert-Roelse JE, Heijerman HG, Munck A, Iron A, Grasemann H, Schuster A, Cornel MC, Ten Kate LP
CFTR mutations in Turkish and North African cystic fibrosis patients in Europe: implications for screening.
Genet Test. 2008 Mar;12(1):25-35., [PMID:18373402]

Abstract [show]
AIMS: To obtain more insight into the variability of the CFTR mutations found in immigrant cystic fibrosis (CF) patients who are living in Europe now, and to estimate the test sensitivity of different frequently used methods of DNA analysis to detect CF carriers or patients among these Turkish or North African immigrants. METHODS: A survey among 373 European CF centers asking which CFTR mutations had been found in Turkish and North African CF patients. RESULTS: 31 and 26 different mutations were reported in Turkish and North African patients, identifying 64.2% (113/176) and 87.4% (118/135) alleles, respectively (p < 0.001). The mean sensitivity (detection rate) of three most common CFTR mutation panels to detect these mutations differed between Turkish and North African people, 44.9% (79/176) versus 69.6% (94/135) (p < 0.001), and can be increased to 57.4% (101/176) and 79.3% (107/135) (p < 0.001), respectively, by expanding these panels with 13 mutations which have been found on two or more alleles. CONCLUSION: 35.8% and 12.6%, respectively, of CF alleles in Turkish and North African patients living in Europe now had not been identified. Among these populations, the test sensitivity of common CFTR mutation panels is insufficient for use in screening programs in Europe, even after expansion with frequent Turkish and North African mutations. This raises questions about whether and how to implement CF carrier and neonatal screening in a multiethnic society.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
113 Identity and Frequency of CFTR Mutations on Unrelated Turkish (Tr) and North African (NA) CF alleles Total number of allelesa Number of CF patients with this mutationb Mutation Exon All Tr NA Homozygote Compound heterozygote: two mutations found Compound heterozygote: one mutation found F508delc 10 73 33 40 27 11 6 N1303K 21 22 12 10 10 5 2 711 þ 1G > T Intron 5 14 - 14 7 2 0 G542X 11 14 6 8 7 1 0 R1162X 19 11 - 11 1 5 2 2183AA > G 13 9 9 - 3 3 1 W1282X 20 7 3 4 2 3 1 2789 þ 5G > A Intron 14b 6 3 3 1 4 1 L227R 6a 4 - 4 3 1 0 1677delTA 10 4 4 - 2 1 1 2184insA 13 4 4 - 1 2 0 R334W 7 4 4 - 1 1 1 G85E 3 4 3 1 1 2 0 R709X 13 3 - 3 2 0 0 L732X 13 3 3 - 2 0 0 2184delA 13 3 3 - 0 3 0 del exon 1-4d 1-4 3 3 - 1 1 0 del exon 19 19 2 2 - 2 0 0 3849 þ 10kbC > T Intron 19 2 - 2 1 0 0 S549N 11 2 1 1 0 1 1 3120 þ G > A Intron 16 2 2 - 1 0 0 3601-2A > G Intron 18 2 2 - 1 0 0 D1152H 18 2 2 - 1 0 0 E1104X 17b 2 - 2 1 0 0 S1159F 19 2 2 - 1 0 0 S977F 16 2 - 2 0 1 0 2347delG 13 2 - 2 1 0 0 4096-3C > G Intron 21 1 1 - 1 0 0 E831X 14a 1 1 - 1 0 0 L619S 13 1 1 - 1 0 0 1525-1G > Ac Intron 9 1 1 - 1 0 0 F1052V 17b 1 1 - 1 0 0 3130delA 17a 1 1 - 1 0 0 R352Q 7 1 - 1 0 1 0 1812-1G > A Intron 11 1 - 1 0 1 0 R553X 11 1 - 1 0 0 1 IVS8-5T Intron 8 1 1 - 0 1 0 R1066C 17b 1 - 1 0 1 0 3129del4 17a 1 - 1 0 1 0 D110H 4 1 1 - 0 1 0 R117H 4 1 - 1 0 1 0 S945L 15 1 - 1 0 1 0 1716G=A 10 1 - 1 0 0 1 711 þ 3A > G Intron 5 1 1 - 0 1 0 R75X 3 1 1 - 0 1 0 R764X 13 1 - 1 0 1 0 S1196X 19 1 1 - 0 1 0 S492F 10 1 - 1 0 1 0 G551D 11 1 - 1 1 0 0 del exon 2 2 1 1 - 1 0 0 Subtotal 231 113 118 - No mutation 80 63 17 - Total 311 176 135 88 60 18 a n ¼ 311 alleles, based on 166 CF patients (332 alleles) with both parents and 22 CF patients (22 alleles) with one parent from Turkey or North Africa, minus 43 alleles of homozygous CF patients with consanguineous parents of whom only one allele was taken into account. Login to comment

[hide] Cystic fibrosis carrier testing in an ethnically d... Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7. Rohlfs EM, Zhou Z, Heim RA, Nagan N, Rosenblum LS, Flynn K, Scholl T, Akmaev VR, Sirko-Osadsa DA, Allitto BA, Sugarman EA
Cystic fibrosis carrier testing in an ethnically diverse US population.
Clin Chem. 2011 Jun;57(6):841-8. Epub 2011 Apr 7., [PMID:21474639]

Abstract [show]
BACKGROUND: The incidence of cystic fibrosis (CF) and the frequency of specific disease-causing mutations vary among populations. Affected individuals experience a range of serious clinical consequences, notably lung and pancreatic disease, which are only partially dependent on genotype. METHODS: An allele-specific primer-extension reaction, liquid-phase hybridization to a bead array, and subsequent fluorescence detection were used in testing for carriers of 98 CFTR [cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)] mutations among 364 890 referred individuals with no family history of CF. RESULTS: One in 38 individuals carried one of the 98 CFTR mutations included in this panel. Of the 87 different mutations detected, 18 were limited to a single ethnic group. African American, Hispanic, and Asian individuals accounted for 33% of the individuals tested. The mutation frequency distribution of Caucasians was significantly different from that of each of these ethnic groups (P < 1 x 10(1)). CONCLUSIONS: Carrier testing using a broad mutation panel detects differences in the distribution of mutations among ethnic groups in the US.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
140 Three mutations (c.54-5940_273ϩ10250del21kb, c.2052dupA, and p.R75X) Table 2. Login to comment
148 An additional 3 mutations (c.803delA, p.R75X, and p.R709X) identified in Asians accounted for 8.6% of all alleles detected in this population. Login to comment

[hide] Detection of CFTR mutations using temporal tempera... Electrophoresis. 2004 Aug;25(15):2593-601. Wong LJ, Alper OM
Detection of CFTR mutations using temporal temperature gradient gel electrophoresis.
Electrophoresis. 2004 Aug;25(15):2593-601., [PMID:15300780]

Abstract [show]
Cystic fibrosis (CF), caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, is one of the most common autosomal recessive diseases with variable incidences and mutation spectra among different ethnic groups. Current commercially available mutation panels designed for the analysis of known recurrent mutations have a detection rate between 38 to 95%, depending upon the ethnic background of the patient. We describe the application of a novel mutation detection method, temporal temperature gradient gel electrophoresis (TTGE), to the study of the molecular genetics of Hispanic CF patients. TTGE effectively identified numerous rare and novel mutations and polymorphisms. One interesting observation is that the majority of the novel mutations are splice site, frame shift, or nonsense mutations that cause severe clinical phenotypes. Our data demonstrate that screening of the 27 exons and intron/exon junctions of the CFTR gene by TTGE greatly improves the molecular diagnosis of Hispanic CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
133 Identification of rare and novel mutations and polymorphisms Base substitution Mutation Exon or intron Homozygote or heterozygote Polymorphism or mutation # Alleles identified 1 c.124_146del23bp Frameshift 1 Heterozygote Mutation 1 2 c.296+2T>A Splice Int 2 Heterozygote Mutation 1 3 c.296+28A/G Int 2 Homozygote Polymorphism 2 4 c.355CT p.R75X 3 Heterozygote Mutation 2 5 c.360_365insT Frameshift 3 Heterozygote Mutation 1 6 c.379_381insT Frameshift 3 Heterozygote Mutation 1 7 c.406-1G>A Splice Int 4 Heterozygote Mutation 2 8 c.424C.T p.Q98X 4 Heterozygote Mutation 1 9 c.425A.G p.Q98R 4 Heterozygote Mutation 3 10 c.586A.G p.M152V 4 Homozygote Mutation 2 11 c.663delT Frameshift 5 Heterozygote Mutation 3 12 c.667C>A p.Q179K 5 Heterozygote Mutation, 1 13 c.745C.T p.P205S 6a Heterozygote Mutation 5 14 c.875140A/G 6a Heterozygote Polymorphism 11 15 c.935delA Frameshift 6b Heterozygote Mutation 2 16 c.124811G.A Splice Int 7 Heterozygote Mutation 2 17 c.1285ins TA Frameshift 8 Heterozygote Mutation 4 Homozygote Mutation 2 18 c.1342+196C/T Int 8 Heterozygote Polymorphism 4 Homozygote 2 19 c.1461insAGAT Frameshift 9 Heterozygote Mutation 1 20 c.1525-61A/G 10 Heterozygote Polymorphism 22 21 c.1529C.A/G p.S466X 10 Heterozygote Mutation 1 22 c.1607C.T p.S492F 10 Heterozygote Mutation 3 23 c.1814C.T p.A561E 12 Heterozygote Mutation 1 24 c.189813A.G Splice Int 12 Heterozygote Mutation 1 25 c.18981152T/A Int 12 Heterozygote Polymorphism 5 26 c.1924del 7bp Frameshift 13 Heterozygote Mutation 1 27 c.1949del84 Frameshift 13 Heterozygote Mutation 1 28 c.2055del9toA Frameshift 13 Homozygote Mutation 2 29 c.2105_2117 Frameshift 13 Heterozygote Mutation 4 del13insAGAAA 30 c.2108delA Frameshift 13 Heterozygote Mutation 1 31 c.2184insA Frameshift 13 Heterozygote Mutation 2 32 c.2184delA Frameshift 13 Heterozygote Mutation 1 33 c.2289_2295 Frameshift 13 Heterozygote Mutation 1 del7insGT 34 c.2694T.G p.T854T 14a Heterozygote Polymorphism 10 35 c.2752+12G/C Int 14a Heterozygote Polymorphism 2 36 c.2800C.T p.Q890X 15 Homozygote Mutation 2 37 c.3171delC Frameshift 17a Heterozygote Mutation 1 38 c.3179T>C p.F1016S 17a Heterozygote Mutation 1 39 c.3199del 6bp Frameshift 17a Heterozygote Mutation 1 40 c.3212T.C p.I1027T 17a Heterozygote Mutation 1 41 c.3272-26A.G Splice Int17a Heterozygote Mutation 4 42 c.3271delGG Frameshift 17a Heterozygote Mutation 1 43 c.3313G.C p.G1061R 17b Heterozygote Mutation 1 44 c.3328C.T p.R1066C 17b Heterozygote Mutation 2 45 c.3362T.C p.L1077P 17b Heterozygote Mutation 1 46 c.3431A.C p.Q1100P 17b Heterozygote Mutation 1 47 c.3500-2A>T Splice Int 17b Heterozygote Mutation 1 48 c.3743G.A p.W1204X 19 Heterozygote Mutation 1 Homozygote Mutation 2 49 c.3601-65C/A Int 19 Heterozygote Polymorphism 14 50 c.3863G.A p.G1244E 20 Heterozygote Mutation 3 Table 3. Login to comment

[hide] Spectrum of mutations in the CFTR gene in cystic f... Ann Hum Genet. 2007 Mar;71(Pt 2):194-201. Alonso MJ, Heine-Suner D, Calvo M, Rosell J, Gimenez J, Ramos MD, Telleria JJ, Palacio A, Estivill X, Casals T
Spectrum of mutations in the CFTR gene in cystic fibrosis patients of Spanish ancestry.
Ann Hum Genet. 2007 Mar;71(Pt 2):194-201., [PMID:17331079]

Abstract [show]
We analyzed 1,954 Spanish cystic fibrosis (CF) alleles in order to define the molecular spectrum of mutations in the CFTR gene in Spanish CF patients. Commercial panels showed a limited detection power, leading to the identification of only 76% of alleles. Two scanning techniques, denaturing gradient gel electrophoresis (DGGE) and single strand conformation polymorphism/hetroduplex (SSCP/HD), were carried out to detect CFTR sequence changes. In addition, intragenic markers IVS8CA, IVS8-6(T)n and IVS17bTA were also analyzed. Twelve mutations showed frequencies above 1%, p.F508del being the most frequent mutation (51%). We found that eighteen mutations need to be studied to achieve a detection level of 80%. Fifty-one mutations (42%) were observed once. In total, 121 disease-causing mutations were identified, accounting for 96% (1,877 out of 1,954) of CF alleles. Specific geographic distributions for the most common mutations, p.F508del, p.G542X, c.1811 + 1.6kbA > G and c.1609delCA, were confirmed. Furthermore, two other relatively common mutations (p.V232D and c.2789 + 5G > A) showed uneven geographic distributions. This updated information on the spectrum of CF mutations in Spain will be useful for improving genetic testing, as well as to facilitate counselling in people of Spanish ancestry. In addition, this study contributes to defining the molecular spectrum of CF in Europe, and corroborates the high molecular mutation heterogeneity of Mediterranean populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
105 Our impression is that Table 3 Common CF mutations identified in this study and in several Latin American populations Mutation This study Hispanic1 Mexico2 Colombia3 Brazil4 Argentina5 Chile6 p.F508del 51.7 51.6 40.7 41.8 48.4 58.6 45.0 p.G542X 7.7 4.0 6.2 3.8 8.8 4.1 7.0 p.N1303K 2.9 0.8 2.0 0.5 2.5 2.7 - c.1811 + 1,6kbA > G 1.8 - - 6.5 - 0.9 - p.R334W 1.8 1.6 - 0.5 2.5 1.1 2.0 p.L206W 1.6 - - - 0.6 - - c.711 + 1G > T 1.6 - - - - - - p.Q890X 1.4 - - - - - - p.R1162X 1.3 0.8 - 1.1 2.5 0.4 2.0 c.2789 + 5G > A 1.2 - - 0.5 0.3 0.7 - p.R1066C 1.2 1.6 - 0.5 - 0.2 - p.I507del 1.0 - 2.6 - - 0.7 - c.2183AA > G 0.8 - 1.0 - 0.2 - p.G85E 0.7 0.8 0.5 - 1.3 0.7 - p.W1282X 0.7 0.8 - 1.1 1.3 2.7 5.0 c.3849 + 10kbC > T 0.4 4.0 0.5 - - 0.9 3.0 p.S549N - 2.4 2.6 - - - - c.3120 + 1G > A - 1.6 - 0.5 - - - c.3876delA - 5.6 - - - - - c.406-1G > A - 1.6 1.5 - - - - c.935delA - 1.6 1.0 - - - - p.R75X - 0.8 1.5 - - - - c.2055del9 - - 1.0 - - - - p.I506T - - 1.0 - - - - c.3199del6 - - 1.0 - - - - p.S549R 0.4 - - 2.2 - 0.2 - c.1717-1G > A 0.2 - - - 0.3 1.1 - p.G551D 0.2 0.8 0.5 - - - 1.0 p.R553X 0.4 - 0.5 - 0.6 0.2 1.0 No. Login to comment

[hide] Cystic fibrosis transmembrane conductance regulato... J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2. Ooi CY, Durie PR
Cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations in pancreatitis.
J Cyst Fibros. 2012 Sep;11(5):355-62. doi: 10.1016/j.jcf.2012.05.001. Epub 2012 Jun 2., [PMID:22658665]

Abstract [show]
BACKGROUND: The pancreas is one of the primary organs affected by dysfunction of the cystic fibrosis transmembrane conductance regulator (CFTR) protein. While exocrine pancreatic insufficiency is a well-recognized complication of cystic fibrosis (CF), symptomatic pancreatitis is often under-recognized. RESULTS: The aim of this review is to provide a general overview of CFTR mutation-associated pancreatitis, which affects patients with pancreatic sufficient CF, CFTR-related pancreatitis, and idiopathic pancreatitis. The current hypothesis regarding the role of CFTR dysfunction in the pathogenesis of pancreatitis, and concepts on genotype-phenotype correlations between CFTR and symptomatic pancreatitis will be reviewed. Symptomatic pancreatitis occurs in 20% of pancreatic sufficient CF patients. In order to evaluate genotype-phenotype correlations, the Pancreatic Insufficiency Prevalence (PIP) score was developed and validated to determine severity in a large number of CFTR mutations. Specific CFTR genotypes are significantly associated with pancreatitis. Patients who carry genotypes with mild phenotypic effects have a greater risk of developing pancreatitis than patients carrying genotypes with moderate-severe phenotypic consequences at any given time. CONCLUSIONS: The genotype-phenotype correlation in pancreatitis is unique compared to other organ manifestations but still consistent with the complex monogenic nature of CF. Paradoxically, genotypes associated with otherwise mild phenotypic effects have a greater risk for causing pancreatitis; compared with genotypes associated with moderate to severe disease phenotypes. Greater understanding into the underlying mechanisms of disease is much needed. The emergence of CFTR-assist therapies may potentially play a future role in the treatment of CFTR-mutation associated pancreatitis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
855 CFTR mutation Total PI Total PI + PS PIP score CFTR mutation Total PI Total PI + PS PIP score 621+1G>T 96 96 1.00 G542X 74 75 0.99 711+1G>T 36 36 1.00 F508del 1276 1324 0.96 I507del 34 34 1.00 1717-1G>A 20 21 0.95 R553X 24 24 1.00 W1282X 19 20 0.95 Q493X 11 11 1.00 N1303K 45 48 0.94 S489X 11 11 1.00 R1162X 12 13 0.92 1154insTC 10 10 1.00 Y1092X 12 13 0.92 3659delC 9 9 1.00 I148T 10 11 0.91 CFTRdele2 7 7 1.00 V520F 9 10 0.90 4016insT 7 7 1.00 G551D 59 67 0.88 E60X 7 7 1.00 L1077P 5 6 0.83 R560T 7 7 1.00 R1066C 5 6 0.83 R1158X 7 7 1.00 2184insA 9 12 0.75 3905insT 6 6 1.00 2143delT 3 4 0.75 I148T;3199del6 5 5 1.00 1161delC 3 4 0.75 2183AA>G 5 5 1.00 3120+1G>A 3 4 0.75 1898+1G>A 5 5 1.00 S549N 3 4 0.75 2347delG 4 4 1.00 G85E 16 22 0.73 Q1313X 3 3 1.00 R117C 2 3 0.67 Q220X 3 3 1.00 M1101K 19 30 0.63 2184delA 3 3 1.00 P574H 3 5 0.60 1078delT 3 3 1.00 474del13BP 1 2 0.50 L1254X 3 3 1.00 R352Q 1 2 0.50 E585X 3 3 1.00 Q1291H 1 2 0.50 3876delA 2 2 1.00 A455E 18 37 0.49 S4X 2 2 1.00 R347P 6 15 0.40 R1070Q 2 2 1.00 2789+5G>A 6 16 0.38 F508C 2 2 1.00 L206W 6 18 0.33 DELI507 2 2 1.00 IVS8-5T 4 16 0.25 Q1411X 2 2 1.00 3272-26A>G 1 4 0.25 365-366insT 2 2 1.00 R334W 1 10 0.10 R709X 2 2 1.00 3849+10kbC>T 2 22 0.09 1138insG 2 2 1.00 P67L 1 14 0.07 CFTRdele2-4 2 2 1.00 R117H 1 25 0.04 3007delG 2 2 1.00 R347H 0 5 0.00 Q814X 2 2 1.00 G178R 0 3 0.00 394delTT 2 2 1.00 E116K 0 2 0.00 406-1G>A 2 2 1.00 875+1G>C 0 2 0.00 R75X 2 2 1.00 V232D 0 2 0.00 CFTRdel2-3 2 2 1.00 D579G 0 2 0.00 E193X 2 2 1.00 L1335P 0 2 0.00 185+1G>T 2 2 1.00 Mild mutations (based on PIP scores) are shaded in gray. Login to comment

[hide] Role of Cystic Fibrosis Transmembrane Conductance ... Chest. 2012 Mar 15. Gonska T, Choi P, Stephenson A, Ellis L, Martin S, Solomon M, Dupuis A, Dorfman R, Zielenski J, Ooi CY, Weiser W, Durie PR, Tullis E
Role of Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) in patients with chronic sinopulmonary disease.
Chest. 2012 Mar 15., [PMID:22423042]

Abstract [show]
ABSTRACT INTRODUCTION:Previous studies report a high frequency of mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene in patients with idiopathic bronchiectasis. However, most studies have based their findings on pre-selected patient groups or have performed limited testing for CFTR dysfunction. The objective of our study was to evaluate the prevalence of CFTR gene mutations and/or CFTR-related ion channel abnormalities among subjects with idiopathic chronic sinopulmonary disease and the prevalence of CF or a CFTR-related disorder in this population. METHODS:We evaluated 72 prospectively enrolled patients from 1995-2005 at the Hospital for Sick Children and St. Michael's Hospital with idiopathic chronic sinopulmonary disease for evidence of CFTR-mediated abnormalities. We performed CFTR genotyping and assessed CFTR function using sweat testing and nasal potential difference testing. The results were compared with data from healthy controls, CF heterozygotes and CF patients. RESULTS:The CFTR functional tests in idiopathic sinopulmonary patients showed a continuous spectrum, ranging from normal to values typically seen in individuals with CF. Forty eight patients (66%) demonstrated CFTR mutations and/or abnormalities of CFTR function. Twenty two (31%) fulfilled criteria for a CF diagnosis and 26 (36%) for a CFTR-related disorder with a strong female preponderance. Functional tests, more than genotyping, were instrumental in establishing a CF diagnosis. Clinical features failed to distinguish CF subjects from those with CFTR-related or idiopathic disease. CONCLUSION:The high prevalence of CF and CFTR dysfunction among patients with idiopathic chronic sinopulmonary disease underscores the need for extensive diagnostic evaluation for CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 All P values are two-sided with a Table 2-CFTR Genotypes Identified in Subjects With Idiopathic Sinopulmonary Disease CF Causing/CF Causing CF Causing/CFTR Mutation CFTR Mutation/CFTR Mutation CF Causing/Unknown CFTR Mutation/Unknown F508del/A455E 3x F508del /D1152H 2x D579G/D579G 2x F508del /26x R764X/2 F508del/S1251N R75X/V456A 758delC/2 F508del/L967S 1716G.A/5T 1716G.A/2 F508del/5T R75Q/5T R117H (7T)/23x F508del/3212T.C 5T/23x G542X/D1152H 1717-1G.A/Q1291H Patients are grouped according to the identified CFTR alterations on allele 1/allele 2. Login to comment

[hide] The D1152H cystic fibrosis mutation in prenatal ca... J Med Screen. 2011;18(4):169-72. Epub 2011 Dec 7. Peleg L, Karpati M, Bronstein S, Berkenstadt M, Frydman M, Yonath H, Pras E
The D1152H cystic fibrosis mutation in prenatal carrier screening, patients and prenatal diagnosis.
J Med Screen. 2011;18(4):169-72. Epub 2011 Dec 7., [PMID:22156145]

Abstract [show]
OBJECTIVE: To assess the frequency of the D1152H mutation in the CFTR gene in normal individuals, in cystic fibrosis (CF) patients and in the setting of prenatal diagnosis. SETTING: A database analysis of sequential screening results seen at the Sheba Medical Center, Israel, between 2001 and 2010. METHODS: We retrospectively analyzed the frequency of D1152H in a large cohort of healthy individuals who were screened as part of a routine prenatal care programme, in individuals referred due to CF-related symptoms and in the setting of prenatal diagnosis. RESULTS: We found one asymptomatic homozygous female and 195 D1152H carriers among 49,940 healthy individuals screened, establishing a carrier rate of 1:255 for this mutation. We detected D1152H in nine of 103 individuals referred due to CF-related symptoms. Four suffered from respiratory symptoms and five from congenital bilateral absence of the vas deferens (CBAVD). During this period D1152H was detected in three pregnancies, two of which were aborted. CONCLUSION: The increased frequency of D1152H in individuals referred due to CF-related symptoms compared with healthy individuals included in the CF carrier screening programme (P < 0.001) clearly indicates that it is a disease-causing mutation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
180 of mutations Group of mutations 2001 Ashkenazi Jews 7 Group A Non-Ashkenazi Jews 11 Group A þ B Georgian Jews 12 Group A þ B þ T360K/Q359K 9.2004-7.2005 Yemenite Jews 12 Groups A þ B þ I1234V Iraqi Jews 12 Groups A þ B þY1092X 8.2005-12.2007 Iraqi Jews 14 Groups A þ B þY1092X þ 3121-1G-A 1.2008-2010 14 mutations for all 14 Groups A þ B þ C Georgian Jews 15 Groups A þ B þ C þ T360K/Q359K Arabic population 19 Groups A þ B þ C þ D Group A: G542X, W1282X, N1303K, F508del, 3849 þ 10KbC-T, 1717-1G-A, D1152H Group B: W1089X, G85E, 405 þ 1G-A, S549R(T-G) Group C: Y1092X, 3121-1G-A, I1234V Group D: 4010delTATT, S549I, 3120 þ 1Kbdel18.6Kb, 2183AA-G, R75X Between 2005-2008 the Iraqi population was screened for an additional mutation 2751 þ 1insT. Login to comment

[hide] Consensus on the use and interpretation of cystic ... J Cyst Fibros. 2008 May;7(3):179-96. Castellani C, Cuppens H, Macek M Jr, Cassiman JJ, Kerem E, Durie P, Tullis E, Assael BM, Bombieri C, Brown A, Casals T, Claustres M, Cutting GR, Dequeker E, Dodge J, Doull I, Farrell P, Ferec C, Girodon E, Johannesson M, Kerem B, Knowles M, Munck A, Pignatti PF, Radojkovic D, Rizzotti P, Schwarz M, Stuhrmann M, Tzetis M, Zielenski J, Elborn JS
Consensus on the use and interpretation of cystic fibrosis mutation analysis in clinical practice.
J Cyst Fibros. 2008 May;7(3):179-96., [PMID:18456578]

Abstract [show]
It is often challenging for the clinician interested in cystic fibrosis (CF) to interpret molecular genetic results, and to integrate them in the diagnostic process. The limitations of genotyping technology, the choice of mutations to be tested, and the clinical context in which the test is administered can all influence how genetic information is interpreted. This paper describes the conclusions of a consensus conference to address the use and interpretation of CF mutation analysis in clinical settings. Although the diagnosis of CF is usually straightforward, care needs to be exercised in the use and interpretation of genetic tests: genotype information is not the final arbiter of a clinical diagnosis of CF or CF transmembrane conductance regulator (CFTR) protein related disorders. The diagnosis of these conditions is primarily based on the clinical presentation, and is supported by evaluation of CFTR function (sweat testing, nasal potential difference) and genetic analysis. None of these features are sufficient on their own to make a diagnosis of CF or CFTR-related disorders. Broad genotype/phenotype associations are useful in epidemiological studies, but CFTR genotype does not accurately predict individual outcome. The use of CFTR genotype for prediction of prognosis in people with CF at the time of their diagnosis is not recommended. The importance of communication between clinicians and medical genetic laboratories is emphasized. The results of testing and their implications should be reported in a manner understandable to the clinicians caring for CF patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1236 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment
1239 Table 1 Geographical distribution of the most common mutations E60X Southern European S549N Indian CFTR Slavic - Eastern European G551D United Kingdom, Central Europe R75X Southern European, US-Hispanic Q552X Southern European, Italian 394delTT Nordic - Baltic sea region R553X Central European G85E Southern Europe A559T African-American 406-1GNA US-Hispanic R560T Northern Irish R117H European-derived populations 1811+1.6kbANG Spanish, US-Hispanic R117C Northern European 1898+1GNA United Kingdom, Central Europe 621+1GNT Southern European 1898+5GNT East Asian populations 711+1GNT French, French Canadian 2143delT Slavic - Eastern European 711+5GNA US-Hispanic 2183delAANG Southern Europe, Middle Eastern, Iranian, Latin American L206W Spanish and US-Hispanic 2184delA European-derived populations V232D Spanish and US-Hispanic 2789+5GNA European-derived populations 1078delT French Brittany Q890X Southern European R334W Southern European, Latin American 3120+1GNA African, Arabian, African-American, Southern Europe 1161delC Indian 3272-26ANG European-derived populations R347P European-derived, Latin America 3659delC Scandinavian R347H Turkish 3849+10kbCNT Ashkenazi-Jewish, Southern European, Middle Eastern, Iranian, Indian A455E Dutch R1066C Southern European 1609delCA Spanish, US-Hispanic Y1092X (CNA) Southern European I506T Southern European, Spanish M1101K US-Hutterite I507del European-derived populations 3905insT Swiss F508del European-derived populations D1152H European-derived populations 1677delTA Southern European, Middle Eastern R1158X Southern European 1717-GNA European-derived populations R1162X Italian, Amerindian, Latin America V520F Irish S1251N European-derived populations G542X Southern European, Mediterranean W1282X Ashkenazi-Jewish, Middle Eastern S549R(TNG) Middle Eastern N1303K Southern European, Middle Eastern Legend: these alleles occur with a frequency superior to 0.1% in selected populations. Login to comment

[hide] A haplotype framework for cystic fibrosis mutation... J Mol Diagn. 2006 Feb;8(1):119-27. Elahi E, Khodadad A, Kupershmidt I, Ghasemi F, Alinasab B, Naghizadeh R, Eason RG, Amini M, Esmaili M, Esmaeili Dooki MR, Sanati MH, Davis RW, Ronaghi M, Thorstenson YR
A haplotype framework for cystic fibrosis mutations in Iran.
J Mol Diagn. 2006 Feb;8(1):119-27., [PMID:16436643]

Abstract [show]
This is the first comprehensive profile of cystic fibrosis transmembrane conductance regulator (CFTR) mutations and their corresponding haplotypes in the Iranian population. All of the 27 CFTR exons of 60 unrelated Iranian CF patients were sequenced to identify disease-causing mutations. Eleven core haplotypes of CFTR were identified by genotyping six high-frequency simple nucleotide polymorphisms. The carrier frequency of 2.5 in 100 (1 in 40) was estimated from the frequency of heterozygous patients and suggests that contrary to popular belief, cystic fibrosis may be a common, under-diagnosed disease in Iran. A heterogeneous mutation spectrum was observed at the CFTR locus in 60 cystic fibrosis (CF) patients from Iran. Twenty putative disease-causing mutations were identified on 64 (53%) of the 120 chromosomes. The five most common Iranian mutations together represented 37% of the expected mutated alleles. The most frequent mutation, DeltaF508 (p.F508del), represented only 16% of the expected mutated alleles. The next most frequent mutations were c.1677del2 (p.515fs) at 7.5%, c.4041C>G (p.N1303K) at 5.6%, c.2183AA>G (p.684fs) at 5%, and c.3661A>T (p.K1177X) at 2.5%. Three of the five most frequent Iranian mutations are not included in a commonly used panel of CF mutations, underscoring the importance of identifying geographic-specific mutations in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
177 Six additional mutations reported in at least two other Arab populations, including c.711ϩ1GϾA, p.R75X, c.1548delG, c.3120ϩ1GϾA, c.3199del6, and p.S549R,30,42,53-56 could have been detected in our assay but were not found in Iran. Login to comment

[hide] Genotyping microarray for the detection of more th... J Mol Diagn. 2005 Aug;7(3):375-87. Schrijver I, Oitmaa E, Metspalu A, Gardner P
Genotyping microarray for the detection of more than 200 CFTR mutations in ethnically diverse populations.
J Mol Diagn. 2005 Aug;7(3):375-87., [PMID:16049310]

Abstract [show]
Cystic fibrosis (CF), which is due to mutations in the cystic fibrosis transmembrane conductance regulator gene, is a common life-shortening disease. Although CF occurs with the highest incidence in Caucasians, it also occurs in other ethnicities with variable frequency. Recent national guidelines suggest that all couples contemplating pregnancy should be informed of molecular screening for CF carrier status for purposes of genetic counseling. Commercially available CF carrier screening panels offer a limited panel of mutations, however, making them insufficiently sensitive for certain groups within an ethnically diverse population. This discrepancy is even more pronounced when such carrier screening panels are used for diagnostic purposes. By means of arrayed primer extension technology, we have designed a genotyping microarray with 204 probe sites for CF transmembrane conductance regulator gene mutation detection. The arrayed primer extension array, based on a platform technology for disease detection with multiple applications, is a robust, cost-effective, and easily modifiable assay suitable for CF carrier screening and disease detection.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
51 Complete List of Mutations Detectable with the CF APEX Assay CFTR location Amino acid change Nucleotide change 1 E 1 Frameshift 175delC 2 E 2,3 Frameshift del E2, E3 3 E 2 W19C 189 GϾT 4 E 2 Q39X 247 CϾT 5 IVS 2 Possible splicing defect 296 ϩ 12 TϾC 6 E 3 Frameshift 359insT 7 E 3 Frameshift 394delTT 8 E 3 W57X (TAG) 302GϾA 9 E 3 W57X (TGA) 303GϾA 10 E 3 E60X 310GϾT 11 E 3 P67L 332CϾT 12 E 3 R74Q 353GϾA 13 E 3 R75X 355CϾT 14 E 3 G85E 386GϾA 15 E 3 G91R 403GϾA 16 IVS 3 Splicing defect 405 ϩ 1GϾA 17 IVS 3 Possible splicing defect 405 ϩ 3AϾC 18 IVS 3 Splicing defect 406 - 1GϾA 19 E 4 E92X 406GϾT 20 E 4 E92K 406GϾA 21 E 4 Q98R 425AϾG 22 E 4 Q98P 425AϾC 23 E 4 Frameshift 444delA 24 E 4 Frameshift 457TATϾG 25 E 4 R117C 481CϾT 26 E 4 R117H 482GϾA 27 E 4 R117P 482GϾC 28 E 4 R117L 482GϾT 29 E 4 Y122X 498TϾA 30 E 4 Frameshift 574delA 31 E 4 I148T 575TϾC 32 E 4 Splicing defect 621GϾA 33 IVS 4 Splicing defect 621 ϩ 1GϾT 34 IVS 4 Splicing defect 621 ϩ 3AϾG 35 E 5 Frameshift 624delT 36 E 5 Frameshift 663delT 37 E 5 G178R 664GϾA 38 E 5 Q179K 667CϾA 39 IVS 5 Splicing defect 711 ϩ 1GϾT 40 IVS 5 Splicing defect 711 ϩ 1GϾA 41 IVS 5 Splicing defect 712 - 1GϾT 42 E 6a H199Y 727CϾT 43 E 6a P205S 745CϾT 44 E 6a L206W 749TϾG 45 E 6a Q220X 790CϾT 46 E 6b Frameshift 935delA 47 E 6b Frameshift 936delTA 48 E 6b N287Y 991AϾT 49 IVS 6b Splicing defect 1002 - 3TϾG 50 E 7 ⌬F311 3-bp del between nucleotides 1059 and 1069 51 E 7 Frameshift 1078delT 52 E 7 Frameshift 1119delA 53 E 7 G330X 1120GϾT 54 E 7 R334W 1132CϾT 55 E 7 I336K 1139TϾA 56 E 7 T338I 1145CϾT 57 E 7 Frameshift 1154insTC 58 E 7 Frameshift 1161delC 59 E 7 L346P 1169TϾC 60 E 7 R347H 1172GϾA 61 E 7 R347P 1172GϾC 62 E 7 R347L 1172GϾT 63 E 7 R352Q 1187GϾA 64 E 7 Q359K/T360K 1207CϾA and 1211CϾA 65 E 7 S364P 1222TϾC 66 E 8 Frameshift 1259insA 67 E 8 W401X (TAG) 1334GϾA 68 E 8 W401X (TGA) 1335GϾA 69 IVS 8 Splicing changes 1342 - 6 poly(T) variants 5T/7T/9T 70 IVS 8 Splicing defect 1342 - 2AϾC Table 1. Continued CFTR location Amino acid change Nucleotide change 71 E 9 A455E 1496CϾA 72 E 9 Frameshift 1504delG 73 E 10 G480C 1570GϾT 74 E 10 Q493X 1609CϾT 75 E 10 Frameshift 1609delCA 76 E 10 ⌬I507 3-bp del between nucleotides 1648 and 1653 77 E 10 ⌬F508 3-bp del between nucleotides 1652 and 1655 78 E 10 Frameshift 1677delTA 79 E 10 V520F 1690GϾT 80 E 10 C524X 1704CϾA 81 IVS 10 Possible splicing defect 1717 - 8GϾA 82 IVS 10 Splicing defect 1717 - 1GϾA 83 E 11 G542X 1756GϾT 84 E 11 G551D 1784GϾA 85 E 11 Frameshift 1784delG 86 E 11 S549R (AϾC) 1777AϾC 87 E 11 S549I 1778GϾT 88 E 11 S549N 1778GϾA 89 E 11 S549R (TϾG) 1779TϾG 90 E 11 Q552X 1786CϾT 91 E 11 R553X 1789CϾT 92 E 11 R553G 1789CϾG 93 E 11 R553Q 1790GϾA 94 E 11 L558S 1805TϾC 95 E 11 A559T 1807GϾA 96 E 11 R560T 1811GϾC 97 E 11 R560K 1811GϾA 98 IVS 11 Splicing defect 1811 ϩ 1.6 kb AϾG 99 IVS 11 Splicing defect 1812 - 1GϾA 100 E 12 Y563D 1819TϾG 101 E 12 Y563N 1819TϾA 102 E 12 Frameshift 1833delT 103 E 12 D572N 1846GϾA 104 E 12 P574H 1853CϾA 105 E 12 T582R 1877CϾG 106 E 12 E585X 1885GϾT 107 IVS 12 Splicing defect 1898 ϩ 5GϾT 108 IVS 12 Splicing defect 1898 ϩ 1GϾA 109 IVS 12 Splicing defect 1898 ϩ 1GϾC 110 IVS 12 Splicing defect 1898 ϩ 1GϾT 111 E 13 Frameshift 1924del7 112 E 13 del of 28 amino acids 1949del84 113 E 13 I618T 1985TϾC 114 E 13 Frameshift 2183AAϾG 115 E 13 Frameshift 2043delG 116 E 13 Frameshift 2055del9ϾA 117 E 13 D648V 2075TϾA 118 E 13 Frameshift 2105-2117 del13insAGAA 119 E 13 Frameshift 2108delA 120 E 13 R668C 2134CϾT 121 E 13 Frameshift 2143delT 122 E 13 Frameshift 2176insC 123 E 13 Frameshift 2184delA 124 E 13 Frameshift 2184insA 125 E 13 Q685X 2185CϾT 126 E 13 R709X 2257CϾT 127 E 13 K710X 2260AϾT 128 E 13 Frameshift 2307insA 129 E 13 V754M 2392GϾA 130 E 13 R764X 2422CϾT 131 E 14a W846X 2670GϾA 132 E 14a Frameshift 2734delGinsAT 133 E 14b Frameshift 2766del8 134 IVS 14b Splicing defect 2789 ϩ 5GϾA 135 IVS 14b Splicing defect 2790 - 2AϾG 136 E 15 Q890X 2800CϾT 137 E 15 Frameshift 2869insG 138 E 15 S945L 2966CϾT 139 E 15 Frameshift 2991del32 140 E 16 Splicing defect 3120GϾA interrogation: ACCAACATGTTTTCTTTGATCTTAC 3121-2A3G,T S; 5Ј-ACCAACATGTTTTCTTTGATCTTAC A GTTGTTATTAATTGTGATTGGAGCTATAG-3Ј; CAACAA- TAATTAACACTAACCTCGA 3121-2A3G,T AS. Login to comment
73 Genomic DNA Samples Used for Mutation Evaluation on the APEX Array Mutations validated with native DNA CFTRdel 2,3 (21 kb) 394delTT G85E R75X 574delA Y122X R117C R117H 621 ϩ 1GϾT 621 ϩ 3AϾG 711 ϩ 1GϾT I336K R334W R347P IVS8-5T IVS8-7T IVS8-9T A455E ⌬F508 ⌬I507 1677delTA 1717 - 1GϾA G542X G551D R553X R560T S549N 1898 ϩ 1GϾA 1898 ϩ 1GϾC 2183AAϾG 2043delG R668C 2143delT 2184delA 2184insA 2789 ϩ 5GϾA S945L 3120 ϩ 1GϾA I1005R 3272 - 26AϾG R1066C G1069R Y1092X (CϾA) 3500 - 2AϾT R1158X R1162X 3659delC S1235R 3849 ϩ 10 kb CϾT W1282X primer. Login to comment
85 Mutations include several prominent in non-Caucasian backgrounds, including N1303K, 3849 ϩ 10 kb, 2789 ϩ 5GϾA, 3876delA, 406-1GϾA, R75X, 2055delGϾA, and S549N, which are each prevalent in the Hispanic popu- Figure 1. Login to comment
150 Primers Generated to Create Synthetic Templates That Serve As Positive Mutation Controls Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј 175delC synt F T(15)ATTTTTTTCAGGTGAGAAGGTGGCCA 175delC synt R T(15)ATTTGGAGACAACGCTGGCCTTTTCC W19C synt F T(15)TACCAGACCAATTTTGAGGAAAGGAT W19C synt R T(15)ACAGCTAAAATAAAGAGAGGAGGAAC Q39X synt F T(15)TAAATCCCTTCTGTTGATTCTGCTGA Q39X synt R T(15)AGTATATGTCTGACAATTCCAGGCGC 296 ϩ 12TϾC synt F T(15)CACATTGTTTAGTTGAAGAGAGAAAT 296 ϩ 12TϾC synt R T(15)GCATGAACATACCTTTCCAATTTTTC 359insT synt F T(15)TTTTTTTCTGGAGATTTATGTTCTAT 359insT synt R T(15)AAAAAAACATCGCCGAAGGGCATTAA E60X synt F T(15)TAGCTGGCTTCAAAGAAAAATCCTAA E60X synt R T(15)ATCTATCCCATTCTCTGCAAAAGAAT P67L synt F T(15)TTAAACTCATTAATGCCCTTCGGCGA P67L synt R T(15)AGATTTTTCTTTGAAGCCAGCTCTCT R74Q synt F T(15)AGCGATGTTTTTTCTGGAGATTTATG R74Q synt R T(15)TGAAGGGCATTAATGAGTTTAGGATT R75X synt F T(15)TGATGTTTTTTCTGGAGATTTATGTT R75X synt R T(15)ACCGAAGGGCATTAATGAGTTTAGGA W57X(TAG) synt F T(15)AGGATAGAGAGCTGGCTTCAAAGAAA W57X(TAG) synt R T(15)TATTCTCTGCAAAAGAATAAAAAGTG W57X(TGA) synt F T(15)AGATAGAGAGCTGGCTTCAAAGAAAA W57X(TGA) synt R T(15)TCATTCTCTGCAAAAGAATAAAAAGT G91R synt F T(15)AGGGTAAGGATCTCATTTGTACATTC G91R synt R T(15)TTAAATATAAAAAGATTCCATAGAAC 405 ϩ 1GϾA synt F T(15)ATAAGGATCTCATTTGTACATTCATT 405 ϩ 1GϾA synt R T(15)TCCCTAAATATAAAAAGATTCCATAG 405 ϩ 3AϾC synt F T(15)CAGGATCTCATTTGTACATTCATTAT 405 ϩ 3AϾC synt R T(15)GACCCCTAAATATAAAAAGATTCCAT 406 - 1GϾA synt F T(15)AGAAGTCACCAAAGCAGTACAGCCTC 406 - 1GϾA synt R T(15)TTACAAAAGGGGAAAAACAGAGAAAT E92X synt F T(15)TAAGTCACCAAAGCAGTACAGCCTCT E92X synt R T(15)ACTACAAAAGGGGAAAAACAGAGAAA E92K synt F T(15)AAAGTCACCAAAGCAGTACAGCCTCT E92K synt R T(15)TCTACAAAAGGGGAAAAACAGAGAAA 444delA synt F T(15)GATCATAGCTTCCTATGACCCGGATA 444delA synt R T(15)ATCTTCCCAGTAAGAGAGGCTGTACT 574delA synt F T(15)CTTGGAATGCAGATGAGAATAGCTAT 574delA synt R T(15)AGTGATGAAGGCCAAAAATGGCTGGG 621GϾA synt F T(15)AGTAATACTTCCTTGCACAGGCCCCA 621GϾA synt R T(15)TTTCTTATAAATCAAACTAAACATAG Q98P synt F T(15)CGCCTCTCTTACTGGGAAGAATCATA Q98P synt R T(15)GGTACTGCTTTGGTGACTTCCTACAA 457TATϾG synt F T(15)GGACCCGGATAACAAGGAGGAACGCT 457TATϾG synt R T(15)CGGAAGCTATGATTCTTCCCAGTAAG I148T synt F T(15)CTGGAATGCAGATGAGAATAGCTATG I148T synt R T(15)GTGTGATGAAGGCCAAAAATGGCTGG 624delT synt F T(15)CTTAAAGCTGTCAAGCCGTGTTCTAG 624delT synt R T(15)TAAGTCTAAAAGAAAAATGGAAAGTT 663delT synt F T(15)ATGGACAACTTGTTAGTCTCCTTTCC 663delT synt R T(15)CATACTTATTTTATCTAGAACACGGC G178R synt F T(15)AGACAACTTGTTAGTCTCCTTTCCAA G178R synt R T(15)TAATACTTATTTTATCTAGAACACGG Q179K synt F T(15)AAACTTGTTAGTCTCCTTTCCAACAA Q179K synt R T(15)TTCCAATACTTATTTTATCTAGAACA 711 ϩ 5GϾA synt F T(15)ATACCTATTGATTTAATCTTTTAGGC 711 ϩ 5GϾA synt R T(15)TTATACTTCATCAAATTTGTTCAGGT 712 - 1GϾT synt F T(15)TGGACTTGCATTGGCACATTTCGTGT 712 - 1GϾT synt R T(15)TATGGAAAATAAAAGCACAGCAAAAAC H199Y synt F T(15)TATTTCGTGTGGATCGCTCCTTTGCA H199Y synt R T(15)TATGCCAATGCTAGTCCCTGGAAAATA P205S synt F T(15)TCTTTGCAAGTGGCACTCCTCATGGG P205S synt R T(15)TAAGCGATCCACACGAAATGTGCCAAT L206W synt F T(15)GGCAAGTGGCACTCCTCATGGGGCTA L206W synt R T(15)TCAAGGAGCGATCCACACGAAATGTGC Q220X synt F T(15)TAGGCGTCTGCTTTCTGTGGACTTGG Q220X synt R T(15)TATAACAACTCCCAGATTAGCCCCATG 936delTA synt F T(15)AATCCAATCTGTTAAGGCATACTGCT 936delTA synt R T(15)TGATTTTCAATCATTTCTGAGGTAATC 935delA synt F T(15)GAAATATCCAATCTGTTAAGGCATAC 935delA synt R T(15)TATTTCAATCATTTCTGAGGTAATCAC N287Y synt F T(15)TACTTAAGACAGTAAGTTGTTCCAAT N287Y synt R T(15)TATTCAATCATTTTTTCCATTGCTTCT 1002 - 3TϾG synt F T(15)GAGAACAGAACTGAAACTGACTCGGA 1002 - 3TϾG synt R T(15)TCTAAAAAACAATAACAATAAAATTCA 1154insTC syntwt F T(15)ATCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntwt R T(15)TTGAGATGGTGGTGAATATTTTCCGGA 1154insTC syntmt F T(15)TCTCTCATTCTGCATTGTTCTGCGCAT 1154insTC syntmt R T(15)TAGAGATGGTGGTGAATATTTTCCGGA DF311 mt syntV1 F T(15)CCTTCTTCTCAGGGTTCTTTGTGGTG dF311 mt syntV1 R T(15)GAGAAGAAGGCTGAGCTATTGAAGTATC G330X synt F T(15)TGAATCATCCTCCGGAAAATATTCAC G330X synt R T(15)ATTTGATTAGTGCATAGGGAAGCACA S364P synt F T(15)CCTCTTGGAGCAATAAACAAAATACA S364P synt R T(15)GGTCATACCATGTTTGTACAGCCCAG Q359K/T360K mt synt F T(15)AAAAAATGGTATGACTCTCTTGGAGC Q359K/T360K mt synt R T(15)TTTTTTACAGCCCAGGGAAATTGCCG 1078delT synt F T(15)CTTGTGGTGTTTTTATCTGTGCTTCC 1078delT synt R T(15)CAAGAACCCTGAGAAGAAGAAGGCTG 1119delA synt F T(15)CAAGGAATCATCCTCCGGAAAATATT 1119delA synt R T(15)CTTGATTAGTGCATAGGGAAGCACAG 1161delC synt F T(15)GATTGTTCTGCGCATGGCGGTCACTC 1161delC synt R T(15)TCAGAATGAGATGGTGGTGAATATTT T338I synt F T(15)TCACCATCTCATTCTGCATTGTTCTG T338I synt R T(15)ATGAATATTTTCCGGAGGATGATTCC R352Q synt F T(15)AGCAATTTCCCTGGGCTGTACAAACA R352Q synt R T(15)TGAGTGACCGCCATGCGCAGAACAAT L346P synt F T(15)CGCGCATGGCGGTCACTCGGCAATTT L346P synt R T(15)GGAACAATGCAGAATGAGATGGTGGT 1259insA synt F T(15)AAAAAGCAAGAATATAAGACATTGGA 1259insA synt R T(15)TTTTTGTAAGAAATCCTATTTATAAA W401X(TAG)mtsynt F T(15)AGGAGGAGGTCAGAATTTTTAAAAAA W401X(TAG)mtsynt R T(15)TAGAAGGCTGTTACATTCTCCATCAC W401X(TGA) synt F T(15)AGAGGAGGTCAGAATTTTTAAAAAAT W401X(TGA) synt R T(15)TCAGAAGGCTGTTACATTCTCCATCA 1342 - 2AϾC synt F T(15)CGGGATTTGGGGAATTATTTGAGAAA 1342 - 2AϾC synt R T(15)GGTTAAAAAAACACACACACACACAC 1504delG synt F T(15)TGATCCACTGTAGCAGGCAAGGTAGT 1504delG synt R T(15)TCAGCAACCGCCAACAACTGTCCTCT G480C synt F T(15)TGTAAAATTAAGCACAGTGGAAGAAT G480C synt R T(15)ACTCTGAAGGCTCCAGTTCTCCCATA C524X synt F T(15)ACAACTAGAAGAGGTAAGAAACTATG C524X synt R T(15)TCATGCTTTGATGACGCTTCTGTATC V520F synt F T(15)TTCATCAAAGCAAGCCAACTAGAAGA V520F synt R T(15)AGCTTCTGTATCTATATTCATCATAG 1609delCA synt F T(15)TGTTTTCCTGGATTATGCCTGGCACC 1609delCA synt R T(15)CAGAACAGAATGAAATTCTTCCACTG 1717 - 8GϾA synt F T(15)AGTAATAGGACATCTCCAAGTTTGCA 1717 - 8GϾA synt R T(15)TAAAAATAGAAAATTAGAGAGTCACT 1784delG synt F T(15)AGTCAACGAGCAAGAATTTCTTTAGC 1784delG synt R T(15)ACTCCACTCAGTGTGATTCCACCTTC A559T synt F T(15)ACAAGGTGAATAACTAATTATTGGTC A559T synt R T(15)TTAAAGAAATTCTTGCTCGTTGACCT Q552X synt F T(15)TAACGAGCAAGAATTTCTTTAGCAAG Q552X synt R T(15)AACCTCCACTCAGTGTGATTCCACCT S549R(AϾC) synt F T(15)CGTGGAGGTCAACGAGCAAGAATTTC S549R(AϾC) synt R T(15)GCAGTGTGATTCTACCTTCTCCAAGA S549R(TϾG) synt F T(15)GGGAGGTCAACGAGCAAGTATTTC S549R(TϾG) synt R T(15)CCTCAGTGTGATTCCACCTTCTCCAA L558S synt F T(15)CAGCAAGGTGAATAACTAATTATTGG L558S synt R T(15)GAAGAAATTCTCGCTCGTTGACCTCC 1811 ϩ 1.6 kb AϾG synt F T(15)GTAAGTAAGGTTACTATCAATCACAC 1811 ϩ 1.6 kb AϾG synt R T(15)CATCTCAAGTACATAGGATTCTCTGT 1812 - 1GϾA synt F T(15)AAGCAGTATACAAAGATGCTGATTTG 1812 - 1GϾA synt R T(15)TTAAAAAGAAAATGGAAATTAAATTA D572N synt F T(15)AACTCTCCTTTTGGATACCTAGATGT D572N synt R T(15)TTAATAAATACAAATCAGCATCTTTG P574H synt F T(15)ATTTTGGATACCTAGATGTTTTAACA P574H synt R T(15)TGAGAGTCTAATAAATACAAATCAGC 1833delT synt F T(15)ATTGTATTTATTAGACTCTCCTTTTG 1833delT synt R T(15)CAATCAGCATCTTTGTATACTGCTCT Table 4. Continued Primer name Sense strand 5Ј 3 3Ј Name Antisense strand 5Ј 3 3Ј Y563D synt F T(15)GACAAAGATGCTGATTTGTATTTATT Y563D synt R T(15)CTACTGCTCTAAAAAGAAAATGGAAA T582R synt F T(15)GAGAAAAAGAAATATTTGAAAGGTAT T582R synt R T(15)CTTAAAACATCTAGGTATCCAAAAGG E585X synt F T(15)TAAATATTTGAAAGGTATGTTCTTTG E585X synt R T(15)ATTTTTCTGTTAAAACATCTAGGTAT 1898 ϩ 5GϾT synt F T(15)TTTCTTTGAATACCTTACTTATATTG 1898 ϩ 5GϾT synt R T(15)AATACCTTTCAAATATTTCTTTTTCT 1924del7 synt F T(15)CAGGATTTTGGTCACTTCTAAAATGG 1924del7 synt R T(15)CTGTTAGCCATCAGTTTACAGACACA 2055del9ϾA synt F T(15)ACATGGGATGTGATTCTTTCGACCAA 2055del9ϾA synt R T(15)TCTAAAGTCTGGCTGTAGATTTTGGA D648V synt F T(15)TTTCTTTCGACCAATTTAGTGCAGAA D648V synt R T(15)ACACATCCCATGAGTTTTGAGCTAAA K710X synt F T(15)TAATTTTCCATTGTGCAAAAGACTCC K710X synt R T(15)ATCGTATAGAGTTGATTGGATTGAGA I618T synt F T(15)CTTTGCATGAAGGTAGCAGCTATTTT I618T synt R T(15)GTTAATATTTTGTCAGCTTTCTTTAA R764X synt F T(15)TGAAGGAGGCAGTCTGTCCTGAACCT R764X synt R T(15)ATGCCTGAAGCGTGGGGCCAGTGCTG Q685X synt F T(15)TAATCTTTTAAACAGACTGGAGAGTT Q685X synt R T(15)ATTTTTTTGTTTCTGTCCAGGAGACA R709X synt F T(15)TGAAAATTTTCCATTGTGCAAAAGAC R709X synt R T(15)ATATAGAGTTGATTGGATTGAGAATA V754M synt F T(15)ATGATCAGCACTGGCCCCACGCTTCA V754M synt R T(15)TGCTGATGCGAGGCAGTATCGCCTCT 1949del84 synt F T(15)AAAAATCTACAGCCAGACTTTATCTC 1949del84 synt R T(15)TTTTTAGAAGTGACCAAAATCCTAGT 2108delA synt F T(15)GAATTCAATCCTAACTGAGACCTTAC 2108delA synt R T(15)ATTCTTCTTTCTGCACTAAATTGGTC 2176insC synt F T(15)CCAAAAAAACAATCTTTTAAACAGACTGGAGAG 2176insC synt R T(15)GGTTTCTGTCCAGGAGACAGGAGCAT 2184delA synt F T(15)CAAAAAACAATCTTTTAAACAGACTGG 2184delA synt R T(15)GTTTTTTGTTTCTGTCCAGGAGACAG 2105-2117 del13 synt F T(15)AAACTGAGACCTTACACCGTTTCTCA 2105-2117 del13 synt R T(15)TTTCTTTCTGCACTAAATTGGTCGAA 2307insA synt F T(15)AAAGAGGATTCTGATGAGCCTTTAGA 2307insA synt R T(15)TTTCGATGCCATTCATTTGTAAGGGA W846X synt F T(15)AAACACATACCTTCGATATATTACTGTCCAC W846X synt R T(15)TCATGTAGTCACTGCTGGTATGCTCT 2734G/AT synt F T(15)TTAATTTTTCTGGCAGAGGTAAGAAT 2734G/AT synt R T(15)TTAAGCACCAAATTAGCACAAAAATT 2766del8 synt F T(15)GGTGGCTCCTTGGAAAGTGAGTATTC 2766del8 synt R T(15)CACCAAAGAAGCAGCCACCTGGAATGG 2790 - 2AϾG synt F T(15)GGCACTCCTCTTCAAGACAAAGGGAA 2790 - 2AϾG synt R T(15)CGTAAAGCAAATAGGAAATCGTTAAT 2991del32 synt F T(15)TTCAACACGTCGAAAGCAGGTACTTT 2991del32 synt R T(15)AAACATTTTGTGGTGTAAAATTTTCG Q890X synt F T(15)TAAGACAAAGGGAATAGTACTCATAG Q890X synt R T(15)AAAGAGGAGTGCTGTAAAGCAAATAG 2869insG synt F T(15)GATTATGTGTTTTACATTTACGTGGG 2869insG synt R T(15)CACGAACTGGTGCTGGTGATAATCAC 3120GϾA synt F T(15)AGTATGTAAAAATAAGTACCGTTAAG 3120GϾA synt R T(15)TTGGATGAAGTCAAATATGGTAAGAG 3121 - 2AϾT synt F T(15)TGTTGTTATTAATTGTGATTGGAGCT 3121 - 2AϾT synt R T(15)AGTAAGATCAAAGAAAACATGTTGGT 3132delTG synt F T(15)TTGATTGGAGCCATAGCAGTTGTCGC 3132delTG synt R T(15)AATTAATAACAACTGTAAGATCAAAG 3271delGG synt F T(15)ATATGACAGTGAATGTGCGATACTCA 3271delGG synt R T(15)ATTCAGATTCCAGTTGTTTGAGTTGC 3171delC synt F T(15)ACCTACATCTTTGTTGCAACAGTGCC 3171delC synt R T(15)AGGTTGTAAAACTGCGACAACTGCTA 3171insC synt F T(15)CCCCTACATCTTTGTTGCTACAGTGC 3171insC synt R T(15)GGGGTTGTAAAACTGCGACAACTGCT 3199del6 synt F T(15)GAGTGGCTTTTATTATGTTGAGAGCATAT 3199del6 synt R T(15)CCACTGGCACTGTTGCAACAAAGATG M1101K synt F T(15)AGAGAATAGAAATGATTTTTGTCATC M1101K synt R T(15)TTTTGGAACCAGCGCAGTGTTGACAG G1061R synt F T(15)CGACTATGGACACTTCGTGCCTTCGG G1061R synt R T(15)GTTTTAAGCTTGTAACAAGATGAGTG R1066L synt F T(15)TTGCCTTCGGACGGCAGCCTTACTTT R1066L synt R T(15)AGAAGTGTCCATAGTCCTTTTAAGCT R1070P synt F T(15)CGCAGCCTTACTTTGAAACTCTGTTC R1070P synt R T(15)GGTCCGAAGGCACGAAGTGTCCATAG L1077P synt F T(15)CGTTCCACAAAGCTCTGAATTTACAT L1077P synt R T(15)GGAGTTTCAAAGTAAGGCTGCCGTCC W1089X synt F T(15)AGTTCTTGTACCTGTCAACACTGCGC W1089X synt R T(15)TAGTTGGCAGTATGTAAATTCAGAGC L1093P synt F T(15)CGTCAACACTGCGCTGGTTCCAAATG L1093P synt R T(15)GGGTACAAGAACCAGTTGGCAGTATG W1098R synt F T(15)CGGTTCCAAATGAGAATAGAAATGAT W1098R synt R T(15)GGCGCAGTGTTGACAGGTACAAGAAC Q1100P synt F T(15)CAATGAGAATAGAAATGATTTTTGTC Q1100P synt R T(15)GGGAACCAGCGCAGTGTTGACAGGTA D1152H synt F T(15)CATGTGGATAGCTTGGTAAGTCTTAT D1152H synt R T(15)GTATGCTGGAGTTTACAGCCCACTGC R1158X synt F T(15)TGATCTGTGAGCCGAGTCTTTAAGTT R1158X synt R T(15)ACATCTGAAATAAAAATAACAACATT S1196X synt F T(15)GACACGTGAAGAAAGATGACATCTGG S1196X synt R T(15)CAATTCTCAATAATCATAACTTTCGA 3732delA synt F T(15)GGAGATGACATCTGGCCCTCAGGGGG 3732delA synt R T(15)CTCCTTCACGTGTGAATTCTCAATAA 3791delC synt F T(15)AAGAAGGTGGAAATGCCATATTAGAG 3791delC synt R T(15)TTGTATTTTGCTGTGAGATCTTTGAC 3821delT synt F T(15)ATTCCTTCTCAATAAGTCCTGGCCAG 3821delT synt R T(15)GAATGTTCTCTAATATGGCATTTCCA Q1238X synt F T(15)TAGAGGGTGAGATTTGAACACTGCTT Q1238X synt R T(15)AGCCAGGACTTATTGAGAAGGAAATG S1255X (ex19)synt F T(15)GTCTGGCCCTCAGGGGGCCAAATGAC S1255X (ex19) synt R T(15)CGTCATCTTTCTTCACGTGTGAATTC S1255X;L synt F T(15)AAGCTTTTTTGAGACTACTGAACACT S1255X;L synt R T(15)TATAACAAAGTAATCTTCCCTGATCC 3849 ϩ 4AϾG synt F T(15)GGATTTGAACACTGCTTGCTTTGTTA 3849 ϩ 4AϾG synt R T(15)CCACCCTCTGGCCAGGACTTATTGAG 3850 - 1GϾA synt F T(15)AGTGGGCCTCTTGGGAAGAACTGGAT 3850 - 1GϾA synt R T(15)TTATAAGGTAAAAGTGATGGGATCAC 3905insT synt F T(15)TTTTTTTGAGACTACTGAACACTGAA 3905insT synt R T(15)AAAAAAAGCTGATAACAAAGTACTCT 3876delA synt F T(15)CGGGAAGAGTACTTTGTTATCAGCTT 3876delA synt R T(15)CGATCCAGTTCTTCCCAAGAGGCCCA G1244V synt F T(15)TAAGAACTGGATCAGGGAAGAGTACT G1244V synt R T(15)ACCAAGAGGCCCACCTATAAGGTAAA G1249E synt F T(15)AGAAGAGTACTTTGTTATCAGCTTTT G1249E synt R T(15)TCTGATCCAGTTCTTCCCAAGAGGCC S1251N synt F T(15)ATACTTTGTTATCAGCTTTTTTGAGACTACTG S1251N synt R T(15)TTCTTCCCTGATCCAGTTCTTCCCAA S1252P synt F T(15)CCTTTGTTATCAGCTTTTTTGAGACT S1252P synt R T(15)GACTCTTCCCTGATCCAGTTCTTCCC D1270N synt F T(15)AATGGTGTGTCTTGGGATTCAATAAC D1270N synt R T(15)TGATCTGGATTTCTCCTTCAGTGTTC W1282R synt F T(15)CGGAGGAAAGCCTTTGGAGTGATACC W1282R synt R T(15)GCTGTTGCAAAGTTATTGAATCCCAA R1283K synt F T(15)AGAAAGCCTTTGGAGTGATACCACAG R1283K synt R T(15)TTCCACTGTTGCAAAGTTATTGAATC 4005 ϩ 1GϾA synt F T(15)ATGAGCAAAAGGACTTAGCCAGAAAA 4005 ϩ 1GϾA synt R T(15)TCTGTGGTATCACTCCAAAGGCTTTC 4010del4 synt F T(15)GTATTTTTTCTGGAACATTTAGAAAAAACTTGG 4010del4 synt R T(15)AAAATACTTTCTATAGCAAAAAAGAAAAGAAGAA 4016insT synt F T(15)TTTTTTTCTGGAACATTTAGAAAAAACTTGG 4016insT synt R T(15)AAAAAAATAAATACTTTCTATAGCAAAAAAGAAAAGAAGA CFTRdele21 synt F T(15)TAGGTAAGGCTGCTAACTGAAATGAT CFTRdele21 synt R T(15)CCTATAGCAAAAAAGAAAAGAAGAAGAAAGTATG 4382delA synt F T(15)GAGAGAACAAAGTGCGGCAGTACGAT 4382delA synt R T(15)CTCTATGACCTATGGAAATGGCTGTT Bold, mutation allele of interest; bold and italicized, modified nucleotide. Login to comment

[hide] Diagnostic testing by CFTR gene mutation analysis ... J Mol Diagn. 2005 May;7(2):289-99. Schrijver I, Ramalingam S, Sankaran R, Swanson S, Dunlop CL, Keiles S, Moss RB, Oehlert J, Gardner P, Wassman ER, Kammesheidt A
Diagnostic testing by CFTR gene mutation analysis in a large group of Hispanics: novel mutations and assessment of a population-specific mutation spectrum.
J Mol Diagn. 2005 May;7(2):289-99., [PMID:15858154]

Abstract [show]
Characterization of CFTR mutations in the U.S. Hispanic population is vital to early diagnosis, genetic counseling, patient-specific treatment, and the understanding of cystic fibrosis (CF) pathogenesis. The mutation spectrum in Hispanics, however, remains poorly defined. A group of 257 self-identified Hispanics with clinical manifestations consistent with CF were studied by temporal temperature gradient electrophoresis and/or DNA sequencing. A total of 183 mutations were identified, including 14 different amino acid-changing novel variants. A significant proportion (78/85) of the different mutations identified would not have been detected by the ACMG/ACOG-recommended 25-mutation screening panel. Over one third of the mutations (27/85) occurred with a relative frequency >1%, which illustrates that the identified mutations are not all rare. This is supported by a comparison with other large CFTR studies. These results underscore the disparity in mutation identification between Caucasians and Hispanics and show utility for comprehensive diagnostic CFTR mutation analysis in this population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
83 While ⌬F508 was homozygous in six subjects, seven other less common alleles (G542X, W1204X, R75X, V232D, E116K, T501A, 3272-26 AϾG) were also seen in the homozygous state. Login to comment
103 Table 1. Continued Mutations in 257 patients Allele counts of each mutation % of variant alleles (183) % of all alleles tested (514) R1070W 1 0.55 0.19 R1158X 1 0.55 0.19 R1438W 1 0.55 0.19 R334W 2 1.09 0.39 R352W 1 0.55 0.19 R553X 2 1.09 0.39 R668C 2 1.09 0.39 R74W 3 1.64 0.58 R75X 3 1.64 0.58 S1235R 2 1.09 0.39 S492F 2 1.09 0.39 S549N 1 0.55 0.19 S573CS573C 1 0.55 0.19 S945L 1 0.55 0.19 T351S 1 0.55 0.19 T501A 2 1.09 0.39 T604ST604S 1 0.55 0.19 V11I 1 0.55 0.19 V201 mol/L 1 0.55 0.19 V232D 2 1.09 0.39 V754 mol/L 1 0.55 0.19 W1089X 2 1.09 0.39 W1098C 1 0.55 0.19 W1204X 4 2.19 0.78 Y563N 1 0.55 0.19 Y913XY913X 1 0.55 0.19 85 different mutations 183 100.00 35.60 Novel variants are in boldface, mutations on the ACMG/ACOG panel are italicized. Login to comment
171 Mutations R75X, 935delA, S549N, W1204X, and R334W were present at a relative frequency of 1.3%, and 12 additional mutations were each represented at a frequency of 1% of detected mutations (Table 3). Login to comment
187 CFTR Sequence Variants Identified in Five Comprehensive CFTR Studies in US Hispanics CFTR mutations Alleles Relative mutation frequency (%) (of 317) deltaF508 123 38.80 3876delA 15 4.70 G542X 12 3.80 406 - 1GϾA 8 2.50 3849 ϩ 10kbCϾT 5 1.60 R75X 4 1.30 935delA 4 1.30 S549N 4 1.30 W1204X 4 1.30 R334W 4 1.30 2055del9ϾA 3 1 R74W 3 1 H199Y 3 1 L206W 3 1 663delT 3 1 3120 ϩ 1GϾA 3 1 L997F 3 1 I1027T 3 1 R1066C 3 1 W1089X 3 1 D1270N 3 1 2105del13insAGAAA 3 1 Q98R 2 Ͻ1 E116K 2 Ͻ1 I148T 2 Ͻ1 R668C 2 Ͻ1 P205S 2 Ͻ1 V232D 2 Ͻ1 S492F 2 Ͻ1 T501A 2 Ͻ1 1949del84 2 Ͻ1 Q890X 2 Ͻ1 3271delGG 2 Ͻ1 3272 - 26AϾG 2 Ͻ1 G1244E 2 Ͻ1 D1445N 2 Ͻ1 R553X 2 Ͻ1 E588V 2 Ͻ1 1717 - 8GϾA 2 Ͻ1 A1009T 2 Ͻ1 S1235R 2 Ͻ1 G85E 1 Ͻ1 296 ϩ 28AϾG 1 Ͻ1 406 - 6TϾC 1 Ͻ1 V11I 1 Ͻ1 Q179K 1 Ͻ1 V201 mol/L 1 Ͻ1 874insTACA 1 Ͻ1 I285F 1 Ͻ1 deltaF311 1 Ͻ1 F311L 1 Ͻ1 L320V 1 Ͻ1 T351S 1 Ͻ1 R352W 1 Ͻ1 1248 ϩ 1GϾA 1 Ͻ1 1249 - 29delAT 1 Ͻ1 1288insTA 1 Ͻ1 1341 ϩ 80GϾA 1 Ͻ1 1429del7 1 Ͻ1 1525 - 42GϾA 1 Ͻ1 P439S 1 Ͻ1 1717 - 1GϾA 1 Ͻ1 1811 ϩ 1GϾA 1 Ͻ1 deltaI507 1 Ͻ1 G551D 1 Ͻ1 A559T 1 Ͻ1 Y563N 1 Ͻ1 (Table continues) In this study, we used temporal temperature gradient gel electrophoresis (TTGE) and direct DNA sequencing to increase the sensitivity of mutation detection in U.S. Hispanics, and to determine whether additional mutations are recurrent. Login to comment
199 The pooled data set demonstrates that the most frequently seen mutations are: ⌬F508, G542X, 406-1GϾA, W1204X, R75X, 2055del9ϾA, 3876delA, ⌬I507, S549N, I148T, N1303K, 935delA, and 3849 ϩ 10kbCϾT. Login to comment
201 Comparison of Relative Frequencies of CFTR Sequence Variants in Comprehensive CFTR Studies in US and Mexican Hispanics This study % Orozco 2000 % US/ Mexican % deltaF508 28.96 54.48 43.72 G542X 3.83 8.28 5.19 406 - 1GϾA 3.28 2.07 2.38 W1204X 2.19 Ͻ1 1.08 R74W 1.64 Ͻ1 R75X 1.64 2.07 1.51 H199Y 1.64 Ͻ1 Ͻ1 L206W 1.64 Ͻ1 L997F 1.64 Ͻ1 I1027T 1.64 Ͻ1 2055del9ϾA 1.64 1.38 1.27 D1270N 1.64 Ͻ1 E116K 1.09 Ͻ1 V232D 1.09 Ͻ1 R334W 1.09 Ͻ1 S492F 1.09 Ͻ1 T501A 1.09 Ͻ1 R553X 1.09 Ͻ1 Ͻ1 E588V 1.09 Ͻ1 R668C 1.09 Ͻ1 Q890X 1.09 Ͻ1 W1089X 1.09 Ͻ1 S1235R 1.09 Ͻ1 D1445N 1.09 Ͻ1 3876delA 1.09 3.24 1717 - 8GϾA 1.09 Ͻ1 3272 - 26AϾG 1.09 Ͻ1 A1009T 1.09 Ͻ1 deltaI507 Ͻ1 3.45 1.30 S549N Ͻ1 3.45 1.95 G567A Ͻ1 Ͻ1 I148T 2.07 1.08 I506T 1.38 Ͻ1 N1303K 2.76 1.08 935delA 1.38 1.30 2183AAϾG 1.38 Ͻ1 3199del6 1.38 Ͻ1 3849 ϩ 10kbCϾT Ͻ1 1.30 ACMG/ACOG italicized. Login to comment
204 Some of the disparity in mutation detection between Caucasians and Hispanics could be alleviated by adding at least seven additional mutations to the currently recommended ACOG/ACMG panel of 25 mutations: 406-1GϾA, W1204X, R75X, 2055del9ϾA, 3876delA, S549N, and 935delA (Table 4). Login to comment
221 For carrier screening of Hispanic patients, inclusion of additional mutations with significant frequency in the Hispanic CF population (especially 406-1GϾA, W1204X, R75X, 2055del9ϾA, 3876delA, S549N, and 935delA) may be helpful to supplement the ACMG/ACOG panel. Login to comment

[hide] Prenatal screening for cystic fibrosis: where are ... J Pediatr. 2002 Dec;141(6):758-63. Farrell PM, Fost N
Prenatal screening for cystic fibrosis: where are we now?
J Pediatr. 2002 Dec;141(6):758-63., [PMID:12461490]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 For instance, 3120 + 1G → A is associated with African American CF patients, and R75X with Hispanics.9 Because new methods of analytic molecular genetics allow commercial laboratories to detect CFTR alleles that occur in minority populations, it is somewhat surprising that ACMG/ ACOG limited its recommendation to a 25 CF mutation panel that deliberately excludes CFTR alleles in "minority" ethnic groups of the United States. Login to comment

[hide] Spectrum of CFTR mutations in cystic fibrosis and ... Hum Mutat. 2000;16(2):143-56. Claustres M, Guittard C, Bozon D, Chevalier F, Verlingue C, Ferec C, Girodon E, Cazeneuve C, Bienvenu T, Lalau G, Dumur V, Feldmann D, Bieth E, Blayau M, Clavel C, Creveaux I, Malinge MC, Monnier N, Malzac P, Mittre H, Chomel JC, Bonnefont JP, Iron A, Chery M, Georges MD
Spectrum of CFTR mutations in cystic fibrosis and in congenital absence of the vas deferens in France.
Hum Mutat. 2000;16(2):143-56., [PMID:10923036]

Abstract [show]
We have collated the results of cystic fibrosis (CF) mutation analysis conducted in 19 laboratories in France. We have analyzed 7, 420 CF alleles, demonstrating a total of 310 different mutations including 24 not reported previously, accounting for 93.56% of CF genes. The most common were F508del (67.18%; range 61-80), G542X (2.86%; range 1-6.7%), N1303K (2.10%; range 0.75-4.6%), and 1717-1G>A (1.31%; range 0-2.8%). Only 11 mutations had relative frequencies >0. 4%, 140 mutations were found on a small number of CF alleles (from 29 to two), and 154 were unique. These data show a clear geographical and/or ethnic variation in the distribution of the most common CF mutations. This spectrum of CF mutations, the largest ever reported in one country, has generated 481 different genotypes. We also investigated a cohort of 800 French men with congenital bilateral absence of the vas deferens (CBAVD) and identified a total of 137 different CFTR mutations. Screening for the most common CF defects in addition to assessment for IVS8-5T allowed us to detect two mutations in 47.63% and one in 24.63% of CBAVD patients. In a subset of 327 CBAVD men who were more extensively investigated through the scanning of coding/flanking sequences, 516 of 654 (78. 90%) alleles were identified, with 15.90% and 70.95% of patients carrying one or two mutations, respectively, and only 13.15% without any detectable CFTR abnormality. The distribution of genotypes, classified according to the expected effect of their mutations on CFTR protein, clearly differed between both populations. CF patients had two severe mutations (87.77%) or one severe and one mild/variable mutation (11.33%), whereas CBAVD men had either a severe and a mild/variable (87.89%) or two mild/variable (11.57%) mutations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 e M1V, R75X, L165S, F311L, R560K, 1898+1G>C, 1949del84, 2113delA, 2184delA, R792X, W846X2, 3121-1G>A, H1054D, 3737delA, D1270N+R74W. Login to comment

[hide] A comparison of fluorescent SSCP and denaturing HP... Hum Mutat. 2000;15(6):556-64. Ellis LA, Taylor CF, Taylor GR
A comparison of fluorescent SSCP and denaturing HPLC for high throughput mutation scanning.
Hum Mutat. 2000;15(6):556-64., [PMID:10862085]

Abstract [show]
We examined 67 different mutations in 16 different amplicons in a comparison of mutation detection by fluorescent single strand conformation polymorphism (F-SSCP) and by denaturing HPLC (DHPLC). F-SSCP was used to analyze fluorescent amplicons with internal size standards and automated fragment analysis (GeneScan, PE Applied Biosystems, Foster City, CA). In DHPLC, unlabelled amplicons were analyzed by reverse phase HPLC with fragment detection by absorbance at 260nm. Both methods had high sensitivity (95-100%) and specificity (100%). Overall, F-SSCP with external temperature control was the more sensitive method, but DHPLC was particularly useful for the rapid analysis of novel fragments.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
97 Comparison of F-SSCP and DHPLC Using a Panel of ABCC7 Mutations Gel condition Location Location 49:1 49:1 49:1 49:1 MDE MDE MDE Capillary DHPLC °C from 5' (bp) from 3' (bp) 15 20 25 35 20 25 35 35 N/A Exon 3 (320bp) E60X 128 192 + + + + + + + + - P67L 150 170 + + + - + + + - + R75X 173 147 + + + + + + + + + R75Q 174 146 + + + - + + + + + G85E 204 116 + + + - + + + + + L88S 213 107 + + + + + + + + + Exon 4 (400bp) 441delA 135 265 + + + + + + + + + D110H 154 246 + + + + + + - + + R117H/H 176 224 + + + + + + + + N/A R117R/H 176 224 + + + + + + + + + L137H 236 164 + + + + + + + + + I148T 261 139 + + + + + + + + + 621+1 (G>T) 309 91 + + + + + + + + + Exon 7 (360bp) R334W 180 180 + + + + + + + - + 1058delC 105 255 + + + + + + + + + 1078delT 125 235 + + + - + + + + + 1138insG 226 134 - + + - + + + + + 1154insTC 202 158 + + + + + + + + + 1161delC 209 151 + + + + + + + + + R347H 220 140 + + + + + + - + + R347P 220 140 + + + - + + + - + A349V 226 134 + + + + + + + + + W356X 248 112 + + + + + + + + + Exon 10 (365bp) M470V 143 222 + + + + + + + + + Q493X 212 153 + + + + + + - + - DelF508 255 110 + + + + + + + + - Del I507 253 112 + + + + + + + + + V520F 293 72 + + - + + - + - + Exon 11 (190bp) 1717-1 (G>A) 54 136 + + + - + + - + + G542X 94 96 + + + - + + - + + S549N 116 74 + + + + + + + + - S549R 117 73 + + + + - - - + + G551D 122 68 + - - - + + + - + R553X 127 63 + + + + + + + + + G551D/R553X + + + + + + + + + R560T 149 41 + + + - - - - - + R560K 149 41 + + + - + + + - + 1811+1 (G>C) 150 40 + + + + + + + + + Exon 12 (250bp) 1898+1(G>A) 167 83 + + + + + + - + + Exon 13a (290bp) C590W 87 203 + + - - + - - + + Exon 13b (405bp) 2184insA 148 257 + + + + + + + - + R709X 220 185 - + - - - - - - + V754M 453 52 + + + + + + + - - Exon 13c (345bp) V754M 65 280 + + + + + + - - + R785X 158 187 + + - - + + - - + Exon 19 (370bp) 3601-17 (T>C) 29 341 - + + - + + + - + R1162X 61 309 + + - - + - - + + 3659delC 105 265 - - - + + + + + + Y1182X 123 247 - + + - + + + - + Exon 20 (370bp) W1282X 186 184 + + + + + + + + + % detected 90 96 86 66 94 88 74 72 90 remainder were detected using DGGE. Login to comment

[hide] Missense mutations in the cystic fibrosis gene in ... Hum Mutat. 1999;14(6):510-9. Lazaro C, de Cid R, Sunyer J, Soriano J, Gimenez J, Alvarez M, Casals T, Anto JM, Estivill X
Missense mutations in the cystic fibrosis gene in adult patients with asthma.
Hum Mutat. 1999;14(6):510-9., [PMID:10571949]

Abstract [show]
Asthma is a complex genetic disorder that affects 5% of adults and 10% of children worldwide. The complete characterization of the cystic fibrosis transmembrane conductance regulator (CFTR) gene identified missense mutations in 15% of 144 unrelated adult patients with asthma, but in none of 41 subjects from the general population. The four more common mutations were analyzed in an extended sample consisting of 184 individuals from the general population and did not show a significant difference in frequency. The hyperfunctional CFTR M470 allele was detected in 90% of patients with CFTR missense mutations, but in 63% of subjects from the general population and 63% of asthma patients without CFTR mutations. None of the patients with missense mutations had the 5T allele of intron 8 of CFTR, responsible for low CFTR levels, while it was detected in 8% of asthma patients without CFTR mutations and in 9% of subjects from the general population. These findings suggest a putative role for a combination of CFTR missense mutations, including the M470 allele, in the genetic variability of asthma.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 Characteristics of 15 Amino Acid Variants/Mutants in the CFTR Gene Detected in 21 Patients With Asthma Other Evolutive Conservative Other mutations Mutation1 Reference2 Exon Domain3 Patients4 phenotypes5 conservation6 change7 at same position R74W Claustres et al., 1993 3 IC1 1 CF-PS/CBAVD b, m, r, s NC - R75Q Zielenski et al., 1991 3 IC2 4 CF-PS/DB/CBAVD/ b, d, m, r, s, x NC R75X (CF) CF Parents R75L (CBAVD) I148T Bozon et al., 1994 4 IC2 1 CF-PS b, d, m, r, s, x NC I148N (CF) A534Q This report 11 NBF1 1 - b, m NC A534E (CF) G576A Fanen et al., 1992 12 NBF1 3 CF-PS/CBAVD b, m, r, s NC G576X (CF) T582R Casals et al., 1997 12 NBF1 1 CF-PS b, d, m, r, s, x NC T582I (CF) R668C Fanen et al., 1992 13 R 5 DB/CF-PS/CBAVD/ b, d, m, r, s, x NC - CF Parents V855I This report 14a IC6 1 - b, r, s C - T896I This report 15 EC4 1 - b, d, m, r, s NC - L997F Fanen et al., 1992 17a TM9 3 DB/CF-PS/CBAVD/ b, d, m, r, s, x C - non-CF M1028R This report 17a TM10 1 - d NC M1028I (CF) T2066C Fanen et al., 1992 17b IC8 1 DB/CF-PI b, d, m, r, s, x NC R1066S (CF) R1066L (CF) R1066H (CF/CBAVD) T1142I This report 18 TM12 1 - b, d, m, r, s, x NC - R1162L Fanen et al., 1992 19 IC9 1 non-CF b, d, m, r, s, x NC R1162X (CF) T1220I Ghanem et al., 1994 19 NBF2 1 DB/non-CF b, d NC - 1 Mutation name according to the Cystic Fibrosis Genetic Analysis Consortium. Login to comment

[hide] Distinct spectrum of CFTR gene mutations in congen... Hum Genet. 1997 Sep;100(3-4):365-77. Dork T, Dworniczak B, Aulehla-Scholz C, Wieczorek D, Bohm I, Mayerova A, Seydewitz HH, Nieschlag E, Meschede D, Horst J, Pander HJ, Sperling H, Ratjen F, Passarge E, Schmidtke J, Stuhrmann M
Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens.
Hum Genet. 1997 Sep;100(3-4):365-77., [PMID:9272157]

Abstract [show]
Congenital absence of the vas deferens (CAVD) is a frequent cause for obstructive azoospermia and accounts for 1%-2% of male infertility. A high incidence of mutations of the cystic fibrosis transmembrane conductance regulator (CFTR) gene has recently been reported in males with CAVD. We have investigated a cohort of 106 German patients with congenital bilateral or unilateral absence of the vas deferens for mutations in the coding region, flanking intron regions and promotor sequences of the CFTR gene. Of the CAVD patients, 75% carried CFTR mutations or disease-associated CFTR variants, such as the "5T" allele, on both chromosomes. The distribution of mutation genotypes clearly differed from that observed in cystic fibrosis. None of the CAVD patients was homozygous for delta F508 and none was compound heterozygous for delta F508 and a nonsense or frameshift mutation. Instead, homozygosity was found for a few mild missense or splicing mutations, and the majority of CAVD mutations were missense substitutions. Twenty-one German CAVD patients were compound heterozygous for delta F508 and R117H, which was the most frequent CAVD genotype in our study group. Haplotype analysis indicated a common origin for R117H in our population, whereas another frequent CAVD mutation, viz. the "5T allele" was a recurrent mutation on different intragenic haplotypes and multiple ethnic backgrounds. We identified a total of 46 different mutations and variants, of which 15 mutations have not previously been reported. Thirteen novel missense mutations and one unique amino-acid insertion may be confined to the CAVD phenotype. A few splice or missense variants, such as F508C or 1716 G-->A, are proposed here as possible candidate CAVD mutations with an apparently reduced penetrance. Clinical examination of patients with CFTR mutations on both chromosomes revealed elevated sweat chloride concentrations and discrete symptoms of respiratory disease in a subset of patients. Thus, our collaborative study shows that CAVD without renal malformation is a primary genital form of cystic fibrosis in the vast majority of German patients and links the particular expression of clinical symptoms in CAVD with a distinct subset of CFTR mutation genotypes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level. Login to comment

[hide] SSCP analysis: a blind sensitivity trial. Hum Mutat. 1997;10(1):65-70. Jordanova A, Kalaydjieva L, Savov A, Claustres M, Schwarz M, Estivill X, Angelicheva D, Haworth A, Casals T, Kremensky I
SSCP analysis: a blind sensitivity trial.
Hum Mutat. 1997;10(1):65-70., [PMID:9222762]

Abstract [show]
Studies of the sensitivity of SSCP analysis usually have been performed under conditions contrary to the rules of quality control trials and have produced widely different results. We have performed a blind trial of the sensitivity of SSCP analysis for the detection of mutations in fragments up to 500 bp in length under a fixed single set of electrophoretic conditions. The mutation detection rate was 84%. In addition, we have identified a second mutation in nine samples. All these mutations are polymorphisms, including a novel polymorphism 1248 + 52T/C first reported in the present work.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
22 List of Mutations Included in the Experiment and Original Method of Detection Used by the Referring Laboratory Referring Probe Original method laboratory no.a Mutation Exon of detection Original SSCP conditions Institut de 1 1677delTA 10 Heteroduplexes Recerca 1 1859G/C 12 DDGE Oncologica, 3 W1282X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Department 4 delF508 10 Heteroduplexes de Genetica 4 Q1313X 20 SSCPb 6% 19:1 (AA:bisAA) 4°C 5h 30W Molecular, 5 1609delCA 10 SSCPb 6% 19:1 (AA:bisAA) RT 28h 10W10% glycerol Barcelona, 7 T582R 12 DGGE Spain 8 1898+3G→A ivs 12 DGGE Molecular 910085 1161delC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Genetics 860176 1138insG 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Laboratory, 930215 1154insTC 7 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Royal 930838 delF508 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Manchester 930127 delI507 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Children`s 931205 Q493X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm Hospital, 900592 V520F 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm UK G12984 S489X 10 SSCP/Heteroduplexes 9% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 910143 G551D 11 ARMS 930274 S549N 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 920132 1811+1G→C ivs 11 SSCP/Heteroduplexes 10% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 930140 1898+1G→A ivs 12 SSCP/Heteroduplexes 930334 W1282X 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10V/cm 140735 3850-1G→A 20 SSCP/Heteroduplexes 7.25% 49:1 (AA:bisAA) 4°C 20 h 10 V/cm Laboratoire 293 G551D 11 SSCPb 5% 19:1 (AA:bisAA) 4°C 5 h 50W and de Biochimie 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol Genetique, 324 S549R 11 ASO Hybridization Centre 649 1898+1G→A ivs 12 DGGE Hospitalier 583 E585X 12 DGGE Universitaire 710 L967S 15 DGGE Montpellier, 325 S945L 15 SSCPb 5% 19:1 (AA:bisAA) 4° 5h 50W and France 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 473 N1303H 21 SSCPb 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 216 300delA 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 287 394delTT 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 559 R74W 3 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 237 P67L 3 DGGE 1023 R75X 3 DGGE 885 1215delG 7 DGGE 113 Y122X 4 DGGE, SSCP 356 621+1G→T ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 709 621+2T→G ivs 4 SSCP 5% 19:1 (AA:bisAA)4°C 5h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol 802 I148T 4 DGGE 1016 Q98R 4 DGGE V75 R117H 4 SSCP 5% 19:1 (AA:bisAA) 4°C 5 h 50W and 5% 19:1 (AA:bisAA) RT 18h 8W 10%glycerol a Identification numbers given by referring laboratories. Login to comment
57 Type of Mutations Detected by SSCP Analysis in This Study Type of mutation Mutation Mutation characteristics Detected by SSCP analysis Deletions 1677delTA deletion of TA from 1677 Yes delF508 deletion of 3 bp from 1655 Yes delI507 deletion of 3 bp from 1648 Yes 1609delCA deletion of CA from 1609 Yes 1161delC deletion of C at 1161 Yes 300delA deletion of A at 300 Yes 394delTT deletion of TT from 394 Yes 1215delG deletion of G at 1215 No Insertions 1138insG insertion of G after 1138 Yes 1154insTC insertion of TC after 1154 Yes Base 1859G/C Yes substitutions W1282X G→A at 3978 Yes Q1313X C→T at 4069 Yes T582R C→G at 1877 Yes 1898+3G→A A→G at 1898+3 Yes Q493X C→T at 1609 Yes V520F G→T at 1690 Yes S489X C→A at 1598 Yes G551D G→A at 1784 No S549N G→A at 1778 Yes 1811+1G→C G→C at 1811+1 Yese 1898+1G→A G→A at 1898 Yes 3850-1G→A G→A at 3850-1 Yes S549R T→G at 1779 Yes E585X G→T at 1885 Yes L967S C→T at 2966 Yes S945L C→T at 2966 No N1303H A→C at 4039 Yes R74W C→T at 352 Yes P67L C→T at 332 Yes R75X C→T at 355 Yes Y122X T→A at 498 No 621+1G→T G→T at 621+1 No 621+2T→G T→G at 621+2 No I148T T→C at 575 Yes Q98R A→G at 425 Yes R117H G→A at 482 Yes FIGURE 1. Login to comment

[hide] Mutation characterization of CFTR gene in 206 Nort... Hum Mutat. 1996;8(4):340-7. Hughes DJ, Hill AJ, Macek M Jr, Redmond AO, Nevin NC, Graham CA
Mutation characterization of CFTR gene in 206 Northern Irish CF families: thirty mutations, including two novel, account for approximately 94% of CF chromosomes.
Hum Mutat. 1996;8(4):340-7., [PMID:8956039]

Abstract [show]
A variety of mutation detection techniques, including restriction endonuclease digestion, allele specific oligonucleotides, and automated fluorescent sequencing, were used in the identification of 15 CFTR mutations representing 86.7% of CF chromosomes in 206 Northern Irish cystic fibrosis (CF) families. A systematic analysis of the 27 exons and intron/exon boundaries of the CFTR gene was performed using denaturing gradient gel electrophoresis (DGGE) in an attempt to characterise the 55 unknown CF mutations in 51 patients. Twenty different mutations were detected by DGGE on 30 chromosomes accounting for a further 7.3% of CF alleles. Fifteen of these mutations had not previously been found in Northern Ireland, and two are novel, M1I(G > T) and V562L. In total, 30 CFTR mutations account for 93.9% of the 412 Northern Irish CF chromosomes tested. The three major CF mutations in Northern Ireland are delta F508, G551D, and R117H with respective frequencies of 68.0%, 5.1%, and 4.1%. The efficacy of the DGGE technique was proven by the detection of 77 out of 77 control variants from all the CFTR exons. DGGE is a highly efficient and sensitive method for mutation screening especially in large genes where the mutation spectrum is known to be heterogeneous.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 241delAT 40-70 40 16 E60X 394delTT, R75X R75Q (p),P67L. Login to comment

[hide] Fluorescent multiplex microsatellites used to defi... Hum Mutat. 1996;8(3):229-35. Hughes D, Wallace A, Taylor J, Tassabehji M, McMahon R, Hill A, Nevin N, Graham C
Fluorescent multiplex microsatellites used to define haplotypes associated with 75 CFTR mutations from the UK on 437 CF chromosomes.
Hum Mutat. 1996;8(3):229-35., [PMID:8889582]

Abstract [show]
The cystic fibrosis (CF) transmembrane conductance regulator (CFTR) gene contains three highly informative microsatellites: IVS8CA, IVS17bTA, and IVS17bCA. Their analysis improves prenatal/ carrier diagnosis and generates haplotypes from CF chromosomes that are strongly associated with specific mutations. Microsatellite haplotypes were defined for 75 CFTR mutations carried on 437 CF chromosomes (220 for delta F508, 217 for other mutations) from Northern Ireland and three English regions: the North-West, East Anglia, and the South. Fluorescently labelled microsatellites were amplified in a triplex PCR reaction and typed using an ABI 373A fluorescent fragment analyser. These mutations cover all the common and most of the rare CF defects found in the UK, and their corresponding haplotypes and geographic region are tabulated here. Ancient mutations, delta F508, G542X, N1303K, were associated with several related haplotypes due to slippage during replication, whereas other common mutations were associated with the one respective haplotype (e.g., G551D and R560T with 16-7-17, R117H with 16-30-13, 621 + 1G > T with 21-31-13, 3659delC with 16-35-13). This simple, fast, and automated method for fluorescent typing of these haplotypes will help to direct mutation screening for uncharacterised CF chromosomes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
74 CF 8CA-17bTA-17bCA Mutation chromosomes % Normal Laboratoryb Reference' HaplotVpe 1)15-29-13 557delT Nl Graham et al.. 1992 21 16-07-17 MU (G>T) 3) 16-24-13 4) 16-25-13 5) 16-29-13 6) 16-30-13 7) 16-30-14 8) 16-31-13 9) 16-31-14 10) 16-32-13 12) 16-33-13 13) 16-34-13 14) 16-35-13 11)16-32-17 15)1645-13 16) 1646-13 17) 1646-14 19) 17-07-17 18)16-53-13 20)17-29-14 21) 17-31-13 22) 17-32-13 23) 17-35-13 24) 17-51-11 25) 17-55-13 27) 17-58-13 28) 21-31-13 29) 22-31-13 31)23-22-17 26) 17-56-13 30) 22-33-13 32) 23-29-13 33)23-31-13 34)23-32-13 35)23-33-13 36)23-34-13 37) 23-36-13 38)24-22-17 39) 24-31-13 182delT P67L R75X L206W 1154insTC 146linsAGAT Q493x V520F 1717-1G>A G551D R560T V562L R709X S1196X L1254X R1283M G85E 2184insA 711+lG>T 3495delA 4279insA SlOR L88S R117C R117H G178R 1717-1G>A Y563N W1098R G1123R 3850- 1G>A E6OX %%deIT 1138insG R34P 2183AA>G 2184delA R1158X 1078delT R1162X 3849G>A Q141W R347P Y917C G2iX 711+3A>G 441delA 3130de115 3659delC 1898+1G>A R709X 2711delT R1158X E92K 3849+lOkbC>T 2118delAACT 4048insCC 296+1 2 T S Q22OX R297Q A1507 2789+5G>A 3120+1G>A W128W 1811+lG>C AF508 E831X R116W AF508 W846X1 3120G>A R785X R553X R553X R553X 621+1G>T G542X G542X Y1182X N1303K AF508 G54W 3041delG 1525-1G>A N1303K G542X G542X G542X 394delTT R709X N1303K 1 1 1 2 1 1 4 2 3 4 2 26 8 1 1 1 1 1 8 1 1 1 1 1 1 1 19 1 2 1 1 1 1 7 1 1 2 1 1 2 1 1 1 1 1 1 1 1 2 1 1 7 4 1 2 1 1 2 1 1 4 Asian 1 2 1Asian 5 4 i Afro-Caribbean 5 1 42 (19%) 1 1 57 (26%) 1 2 1 1 1 2 12 2 11.4 0.4 4.9 16.3 1.1 3.8 1.9 10.6 2.3 1.5 2.3 1.5 2.7 4.5 0.4 0.8 0.8 0.4 0.8 0.4 1 2 1 7 1 1 1Asian 1 1.5 0.8 0.8 NI G NI, M M NI NI. Login to comment

[hide] Cystic fibrosis: genotypic and phenotypic variatio... Annu Rev Genet. 1995;29:777-807. Zielenski J, Tsui LC
Cystic fibrosis: genotypic and phenotypic variations.
Annu Rev Genet. 1995;29:777-807., [PMID:8825494]

Abstract [show]
Cystic fibrosis (CF) is a common genetic disorder in the Caucasian population. The gene was identified in 1989 on the basis of its map location on chromosome 7. The encoded gene product, named cystic fibrosis transmembrane conductance regulator (CFTR), corresponds to a cAMP-regulated chloride channel found almost exclusively in the secretory epithelial cells. Although the major mutation that results in a single amino acid deletion (F508) accounts for 70% of the disease alleles, more than 550 additional mutant alleles of different forms have been detected. Many of these mutations can be divided into five general classes in terms of their demonstrated or presumed molecular consequences. In addition, a good correlation has been found between CFTR genotype and one of the clinical variables--pancreatic function status. An unexpected finding, however, is the documentation of CFTR mutations in patients with atypical CF disease presentations, including congenital absence of vas deferens and several pulmonary diseases. Thus, the implication of CFTR mutation is more profound than CF alone.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
593 Not surprisingly, Rl17H is associated with CF only when the allele also contains Table 2 Examples of complex alleles in the CfTR gene Principal Second site mutationa Location alteration Location Reference R75X exon 3 125G --.. C promoter 57 405 + IG --.. A intron 3 3030G --.. A exon 15 57 R1l7H exon 4 129G --.. C promoter 203 RI17H exon 4 IVS8 : 5T or 7T intron 8 101 R297Q exon 7 IVS8 : 5T or 7T intron 8 60 aF508 exon 10 R553Q exon II 59 aF508 exon 10 1I027T exon I7a 57 8F508 exon 10 deletion of D7S8 500 kb 3' of 186 CfTR S549N exon II R75Q exon 3 205a L619S exon 13 1716G � A exon 10 57 G628R (G � C) exon 13 SI235R exon 19 47 2184insA exon 13 IVS:5T exon 9 J Zielenski, J Bal, 0 Markiewicz, L-C Tsui, unpublished data A800G exon 13 IVS8 : 5T or 7T intran 8 31 S912L exon 15 GI244V exon 20 149 GlO69R exon 17b L88X exon 3 149 3732deiA exon 19 Kl200E exon 19 70 3849 + IOkbC � intron 19 R668C exon 13 57 T SI251N exon 20 F508C exon 10 94 The status of principal mutation may not be clear in every case; e.g. G628R(G --> C) vs S1235R. Login to comment

[hide] Independent origins of cystic fibrosis mutations R... Am J Hum Genet. 1994 Nov;55(5):890-8. Morral N, Llevadot R, Casals T, Gasparini P, Macek M Jr, Dork T, Estivill X
Independent origins of cystic fibrosis mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T provide evidence of mutation recurrence in the CFTR gene.
Am J Hum Genet. 1994 Nov;55(5):890-8., [PMID:7526685]

Abstract [show]
Microsatellite analysis of chromosomes carrying particular cystic fibrosis mutations has shown different haplotypes in four cases: R334W, R347P, R1162X, and 3849 + 10kbC-->T. To investigate the possibility of recurrence of these mutations, analysis of intra- and extragenic markers flanking these mutations has been performed. Recurrence is the most plausible explanation, as it becomes necessary to postulate either double recombinations or single recombinations in conjunction with slippage at one or more microsatellite loci, to explain the combination of mutations and microsatellites if the mutations arose only once. Also in support of recurrence, mutations R334W, R347P, R1162X, and 3849 + 10kbC-->T involve CpG dinucleotides, which are known to have an increased mutation rate. Although only 15.7% of point mutations in the coding sequence of CFTR have occurred at CpG dinucleotides, approximately half of these CpG sites have mutated at least once. Specific nucleotide positions of the coding region of CFTR, distinct from CpG sequences, also seem to have a higher mutation rate, and so it is possible that the mutations observed are recurrent. G-->A transitions are the most common change found in those positions involved in more than one mutational event in CFTR.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 Slippage usually results in the addition or subtraction of one repeat unit either side Table 5 CpG Dinucleotides in CFTR Gene That Have More than One Mutational Event Position Change Mutation Reference 223 ......... CT R31C Ghanem et al. 1994 224 ......... GT R31L Zielenski et al., in press 355 ........ C- >T R75X Dork et al., in press 356 ......... G--*T R75L B. Costes, personal communication 356 ......... G-aA R75Q' Zielenski et al. 1991b 481 ......... CT R117C D6rk et al., in press 482 ......... G-oA R117H Dean etal. Login to comment

[hide] Detection of more than 50 different CFTR mutations... Hum Genet. 1994 Nov;94(5):533-42. Dork T, Mekus F, Schmidt K, Bosshammer J, Fislage R, Heuer T, Dziadek V, Neumann T, Kalin N, Wulbrand U, et al.
Detection of more than 50 different CFTR mutations in a large group of German cystic fibrosis patients.
Hum Genet. 1994 Nov;94(5):533-42., [PMID:7525450]

Abstract [show]
We have conducted a comprehensive study of the molecular basis of cystic fibrosis (CF) in 350 German CF patients. A screening approach based on single-strand conformation analysis and direct sequencing of genomic polymerase chain reaction products has allowed us to detect the molecular defects on 95.4% of the CF chromosomes within the coding region and splice sites of the cystic fibrosis transmembrane conductance regulator (CFTR) gene. The spectrum of sequence changes comprises 54 different mutations, including 17 missense mutations, 14 nonsense mutations, 11 frameshift mutations, 10 splice site variants and two amino acid deletions. Eleven of these mutations have not previously been described. Our results reflect the marked mutational heterogeneity of CF in a large sample of patients from a non-isolated population.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 In the case of novel missense or splice site mutations, a panel of 100 normal chromosomes from unaffected members of CF families was screened for the G C G A G C T A G C T Control R 75 X Figo2 Direct sequencing showing heterozygosity for the R75X nonsense mutation (arrow, right) in exon 3 T C G A T C G A Fig. 1a--d SSCP analysis of genomic PCR products from different regions of the CFTR gene. Login to comment
66 (1) R75X is a C-+T transition at nucleotide 355 leading to the termination mutation R75X (Fig. 2). Login to comment
68 The pancreas-insufficient patient inherited R75X from his father and the mutation N1303K (Osborne et al. 1991) from his mother. Login to comment
69 The R75X nonsense mutation is associated with a rare sequence variant 125 G---~C (Cutting et al. 1992) in the promoter region of the CFTR gene. Login to comment
77 Table 1 Frequency distribution and haplotypes of CFTR mutations in 700 German CF chromosomes Mutation~ Nucleotide changesb Locationc Frequencyd Haplotype~ Referencef Q39x C--~T at 247 Exon 2 1 (0.1%) D3 Cutting et al. (1992) E60X G-+T at 310 Exon 3 1 (0.1%) A2 Malone et al. (*) R75X C--+T at 355 Exon 3 1 (0.1%) C2 This study 405+1 G---~A G-+A at 405+1 Intron 3 1 (0.1%) C2 D6rk et al. (1993c) E92X G--~T at 406 Exon 4 2 (0.3%) B2 Will et al. (1994) R117C C---~Tat 481 Exon 4 1 (0.1%) C2 This study R117H G--+A at 482 Exon 4 2 (0.3%) B6 Dean et al. (1990) 621+1 G--+T G--+T at 621+1 Intron 4 1 (0.1%) B1 Zielenski et al. (1991b) H199Y C--+T at 727 Exon 6a 1 (0.1%) A2 This study (*) 1078delT Deletion of T at 1078 Exon 7 4 (0.6%) C2 Claustres et al. (1992) R334W C-~T at 1132 Exon 7 2 (0.3%) BI Gasparini et al. (1991) 1336K T-->A at 1139 Exon 7 3 (0.4%) A2 Cuppens et al. (1993) R347P G--+C at 1172 Exon 7 11 (1.6%) A2, C2 Dean et al. (1990) 1342-2 A--+C A--+C at 1342-2 Intron 8 3 (0.4%) A4 D/3rk et al. (1993b) Q414X C--+T at 1372 Exon 9 1 (0.1%) D3 D6rk et al. (1994a) A455E C-+A at 1496 Exon 9 1 (0.1%) BI Kerem et al. (1990) V456F G--~T at 1498 Exon 9 1 (0.1%) B3 D6rk et al. (1994a) A1507 Deletion of 3 bp between 1648-1653 Exon 10 1 (0.1%) D5 Kerem et al. (1990) AF508 Deletion of 3 bp between 1652-1655 Exon 10 504 (72.0%) B1, DI, B7 Kerem et al. (1989) 1717-1 G--+A G--+A at 1717-1 lntron 10 6 (0.9%) B3 Kerem et al. (1990) G542X G--+T at 1756 Exon 11 10 (1.4%) B1 Kerem et al. (1990) G551D G--+A at 1784 Exon 11 7 (l.0%) B3 Cutting et al. (1990) Q552X C-+T at 1786 Exon 11 1 (0.1%) A4 Devoto et al. (1991) R553X C--+T at 1789 Exon 11 16 (2.3%) A4, B4, D3 Cutting et al. (1990) L558S T--+C at 1805 Exon 11 1 (0.1%) C2 Maggio et al. (*) 1811+I.6kBA-+G A--+Gat 1811+l.6kB lntron 11 1 (0.1%) A2 Chillonetal. Login to comment
120 There are, however, only six additional CFTR mutations with a frequency of approximately 1% or more of the CF chromosomes; two nonsense mutations, G542X and R553X, and the missense mutations G551D and NI303K were predominantly seen in severely affected patients, whereas the transmembrane missense mutation R347P and the splice mutation 3849 + 10 kB C---~T Table 2 Rare sequence variants in the CFTR promoter and coding region Sequence variant Nucleotide change Location Frequency Associated mutatiow' Reference 125 G--+C G--~C at 125 Promoter 1 (0.1%) R75X F508C T--~G at 1655 Exon 10 2 (0.3%) S1251N 1716 G---)A G---~Aat 1716 Exon 10 1 (0.1%) L619S R553Q G-~A at 1790 Exon I 1 I (0.1%) * R668C C--~T at 2134 Exon 13 1 (0.1%) 3849+10 kB C--eT 3030 G---~A G--+A at 3030 Exon 15 1 (0.1%) 405+1 G--~A I1027 T T--~C at 3212 Exon 17a 2 (0.3%) * 3417 A-+T A--->Tat 3417 Exon 17b 1 (0.1%) Unknown 4002 A--eG A--~G at 4002 Exon 20 2 (0.3%) Unknown Cutting et al. (1992) Kobayashi et al. (1990) Kerem et al. (1990) D6rk et al. ( 1991) Fanen et al. (1992) Chillon et al. (1992) Fanen et al. (1992) This study Ferec et al. (1992) ~'Marked (*) sequence variations were present on AF508 chromosomes were the most frequent in pancreas-sufficient patients. Login to comment

[hide] CFTR gene mutations and asthma in the Norwegian En... Respir Med. 2006 Dec;100(12):2121-8. Epub 2006 May 5. Munthe-Kaas MC, Lodrup Carlsen KC, Carlsen KH, Skinningsrud B, Haland G, Devulapalli CS, Pettersen M, Eiklid K
CFTR gene mutations and asthma in the Norwegian Environment and Childhood Asthma study.
Respir Med. 2006 Dec;100(12):2121-8. Epub 2006 May 5., [PMID:16678395]

Abstract [show]
BACKGROUND: Several candidate genes have been implicated in the etiology of asthma, including the gene coding for the cystic fibrosis transmembrane conductance regulator (CFTR). Mutations in the CFTR gene result in derangements of mucociliary clearance. Homozygotes for CFTR mutations develop cystic fibrosis (CF), a disorder characterized mainly by lung and pancreas disease. OBJECTIVE: To investigate whether there was an increased frequency of CFTR mutations in asthma patients. METHODS: Seven hundred and three subjects aged 10-11 years from the environment and childhood asthma (ECA) study were included in the present study. Possible associations between asthma, reduced lung function, bronchial hyperresponsiveness (BHR), and increased or decreased nitrogen oxide (NO) levels (based on structural parental interview, spirometry, PD20 methacholine challenge test and exhaled NO measurements), and the five most common CFTR mutations in Norway (DeltaF508, R117H, R117C, 4005+2T-->C, 394delTT), the modulating polymorphisms IVS8(TG)mTn and the IVS8-5T were investigated. RESULTS: No association were found between asthma, reduced lung function, BHR or exhaled NO levels and CF heterozygosity. However, the IVS8(TG)11T7 haplotype was associated with normal lung function. CONCLUSIONS: Our results do not support the hypothesis that CFTR mutations or polymorphisms play a role in the pathogenesis of asthma in children. However, the distribution of Tn(TG)m haplotypes differed between individuals with reduced lung function and individuals with normal lung function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 CFTR mutation Alleles (%) F508del 184 (62.2) R117C 12 (4.1) R117H 12 394delTT 11 (3.8) 4005+2T-C 11 G551D 6 (2.0) 3659delC 5 (1.7) E60X 4 (1.4) V232D 4 1525-2A-G 3 (1.0) N1303K 3 G542X 2 (0.7) E279X 2 R75X 2 S912X 2 E116X 1 (0.3) L295Q 1 R347L 1 Q493X 1 I506L 1 I507del 1 R553X 1 G576A 1 621-1G-T 1 2183AA-G 1 S945L 1 R1162X 1 I1234V 1 3849+10 kbC-T 1 W1282X 1 Unknown 18 (6.5) Total alleles 296 (100%) Mutations detected with OLA31 m kit-74%. Login to comment

[hide] CFTR gene analysis in Latin American CF patients: ... J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11. Perez MM, Luna MC, Pivetta OH, Keyeux G
CFTR gene analysis in Latin American CF patients: heterogeneous origin and distribution of mutations across the continent.
J Cyst Fibros. 2007 May;6(3):194-208. Epub 2006 Sep 11., [PMID:16963320]

Abstract [show]
BACKGROUND: Cystic Fibrosis (CF) is the most prevalent Mendelian disorder in European populations. Despite the fact that many Latin American countries have a predominant population of European-descent, CF has remained an unknown entity until recently. Argentina and Brazil have detected the first patients around three decades ago, but in most countries this disease has remained poorly documented. Recently, other countries started publishing their results. METHODS: We present a compilation and statistical analysis of the data obtained in 10 countries (Argentina, Brazil, Chile, Colombia, Costa Rica, Cuba, Ecuador, Mexico, Uruguay and Venezuela), with a total of 4354 unrelated CF chromosomes studied. RESULTS: The results show a wide distribution of 89 different mutations, with a maximum coverage of 62.8% of CF chromosomes/alleles in the patient's sample. Most of these mutations are frequent in Spain, Italy, and Portugal, consistent with the origin of the European settlers. A few African mutations are also present in those countries which were part of the slave trade. New mutations were also found, possibly originating in America. CONCLUSION: The profile of mutations in the CFTR gene, which reflects the heterogeneity of its inhabitants, shows the complexity of the molecular diagnosis of CF mutations in most of the Latin American countries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
42 Some have concentrated in the search of specific mutations that are Table 1 Mutations found in the Latin American CF patients Exon 1 p.L6VÌe; Exon 3 p.W57X, p.R75X, p.G85E Exon 4 p.R117H Exon 6a p.H199Y, p.V201M, p.L206W, p.Q220X, p.V232D, c.846delTÌe; Exon 6b p.Y275XÌe;, c.935delA Exon 7 p.R334W, p.R347P, p.Y362XÌe;, c.1078delT, c.1215delG Exon 8 c.1323_1324insAÌe; Exon 9 c.1460_1461delATÌe;, c.1353_1354insTÌe;,# Exon 10 p.I506T, p.I507del, p.F508del Exon 11 p.G542X, p.S549N, p.S549R, p.G551D, p.G551S, p.R553X, p.L558S, p.A559T, c.1782delA Exon 12 p.S589I Exon 13 p.H609RÌe;, p.P750L, p.V754M, c.1924_1930del, c.2055_2063del, c.2183AA NG;c.2184delA, c.2184delA, c.2185_2186insC, c.2347delG, c.2566_2567insTÌe;, c.2594_2595delGTÌe; Exon 14a p.R851L, c.2686_2687insTÌe; Exon 15 c.2869_2870insG Exon 16 c.3120+1GNA Exon 17a p.I1027T, c.3171delC, c.3199_3204del Exon 17b p.G1061R, p.R1066C, p.W1069X#, p.W1089X, p.Y1092X, p.W1098CÌe; Exon 19 p.R1162X, p.W1204X, p.Q1238X, c.3617_3618delGAÌe;#, c.3659delC Exon 20 p.W1282X, p.R1283M Exon 21 p.N1303K, c.4016_4017insT Exon 22 c.4160_4161insGGGGÌe; 5' flanking c.-834GNT Intron 2 c.297-1GNAÌe;, c.297-2ANG Intron 3 c.406-1GNA Intron 4 c.621+1GNT Intron 5 c.711+1GNT Intron 8 c.IVS8-5T Intron 10 c.1716GNA, c.1717-1GNA Intron 11 c.1811+1.6KbANG, c.1812-1GNA Intron 12 c.1898+1GNA, c.1898+3ANG Intron 14 c.2789+2_2789+3insA, c.2789+5GNA Intron 17a c.3272-26ANG Intron 17b c.3500-2ANGÌe; Intron 19 c.3849+1GNA, c.3849+10KbCNT Intron 20 c.4005+1GNA, c.4005-1GNA# Mutations are listed according to their position in the gene. Login to comment
46 of chromosomes analysed p.F508del p.G542X p.W1282X p.N1303K p.R1162X p.L6VÌe; p.W57X p.R75X p.G85E p.R117H p.H199Y p.V201M p.L206W p.Q220X p.V232D p.Y275XÌe; p.R334W p.R347P p.Y362XÌe; p.I506T Argentina 98 61 440 258 18 12 12 2 1 1 3 1 5 1 310 181 20 7 5 5 7 0 5 0 222 135 15 7 5 1 26 14 2 1 1 150 88 6 6 1 2 3 Subtotal and frequency (%) 1246 100 737 59.15 61 4.90 27 2.17 28 2.25 9 0.72 1 0.08 1 0.08 13 1.04 1 0.08 13 1.04 1 0.08 Brazil 468 221 26 11 74 38 2 1 320 155 28 3 8 8 4 1 2 1 1 8 122 62 120 38 10 3 148 38 4 0 0 48 15 154 75 5 1 0 2 0 386 154 24 6 10 17 9 0 10 1 18 4 0 0 2 0 0 0 0 Subtotal and frequency (%) 1858 100 800 43.06 99 5.33 11 0.59 34 1.83 25 1.35 13 0.70 1 0.05 2 0.11 1 0.05 1 0.05 20 1.07 1 0.05 Chile 72 21 36 11 3 0 44 22 4 3 1 1 100 45 7 5 0 2 0 2 0 Subtotal and frequency (%) 252 100 99 41.28 14 5.55 8 3.17 3 1.19 3 1.19 Colombia 184 77 7 2 1 2 1 34 13 2 1 1 Subtotal and frequency (%) 218 100 90 41.28 9 4.13 3 1.38 2 0.92 2 0.92 1 0.46 Costa Rica Frequency (%) 48 100 11 22.91 12 25.00 0 0 0 0 0 Cuba Frequency (%) 144 100 49 34.03 Ecuador 32 11 1 50 16 2 2 20 5 0 0 0 Subtotal and frequency (%) 102 100 32 31.37 2 1.96 1 0.98 2 1.96 Mexico 194 79 12 4 3 1 1 1 2 80 36 4 1 Subtotal and frequency (%) 274 100 115 41.97 16 5.84 5 1.82 3 1.09 1 0.36 1 0.36 1 0.36 2 0.73 Uruguay Frequency (%) 76 100 43 56.58 6 7.89 2 2.63 3 3.95 3 3.95 2 2.63 Venezuela 54 16 2 82 41 Subtotal and frequency (%) 136 100 57 41.91 2 1.47 Total 4354 2033 221 49 72 42 1 1 3 32 1 1 1 2 1 1 1 39 1 1 2 Frequency (%) 100 46.69 5.08 1.13 1.65 0.96 0.02 0.02 0.07 0.73 0.02 0.02 0.02 0.05 0.02 0.02 0.02 0.90 0.02 0.02 0.05 The five most frequent mutations are shown on the left-hand side, followed by the rest of the mutations in 5'-3' and exon-intron order. Login to comment
98 As an example, in the case of Argentina and Uruguay, the p.F508del mutation shows the highest frequencies (59% and Table 5 Mutations with frequencies less than 0.1% Panel A Mutation Number of chromosomes % Country p.R75X 3 0.07 Mexico c.W1089X 3 0.07 Argentina, Brazil c.406-1GNA 3 0.07 Mexico c.1898+1GNA 3 0.07 Argentina, Brazil c.2686_2687insTÌe; 3 0.07 Argentina, Brazil p.L206W 2 0.05 Brazil p.I506T 2 0.05 Mexico p.S589I 2 0.05 Argentina c.711+1GNT 2 0.05 Argentina c.935delA 2 0.05 Mexico c.2055_2063del 2 0.05 Mexico c.2347delG 2 0.05 Brazil c.2566_2567insTÌe; 2 0.05 Argentina c.2789+2_2789+3insA 2 0.05 Argentina c.3199_3204del 2 0.05 Mexico c.3272-26ANG 2 0.05 Argentina c.4016_4017insT 2 0.05 Argentina Panel B Mutation N % each Country p.L6VÌe;, p.W57X, p.Q220X, p.Y362XÌe;, p.I1027T, p.G1061R, p.R1283M, c.297-2ANG, c.1353_1354insTÌe;, c.1460_1461delATÌe;, c.1782delA, c.1898+3ANG, c.2184delA, c.2594_2595delGTÌe;, c.2869_2870insG, c.4005Ìe;1GNA, c.4005-1GNA# 17 0.02 Argentina p.R117H, p.H199Y, p.G551S, p.L558S, p.P750L, p.V754M, p.W1069X#, p.W1098CÌe;, p.W1204X, c.297-1GNAÌe;, c.846delTÌe;, c.1078delT, c.1716GNA, c.1924_1930del, c.4160_4161insGGGGÌe; 15 0.02 Mexico p.V201M, p.V232D, p.Y275XÌe;, p.R347P, p.R851L, p.Q1238X, c.3171delC, c.3617_3618delGAÌe;# 8 0.02 Brazil p.A559T, p.H609RÌe;, c.1215delG, c.1323_1324insAÌe;, c.2185_2186insC, c.3500-2ANGÌe;, c.3849+1GNA, 7 0.02 Colombia c.-834GNT 1 0.02 Uruguay The upper part (Panel A) shows the mutations found in more than one patient, whereas the lower part (Panel B) of the table shows all the mutations that are present only once in each country. Login to comment
111 As discussed, another way to disclose similarities or differences in the distribution of mutations in the CF patients from Latin Table 6 Screening panel of CFTR mutations Country Total number of mutations Minimum panel Detection power Uruguay 12 6 mutations: p.F508del, p.G542X, p.R1162X, p.N1303K (p.R334W, p.G85E) 78% Argentina 52 7 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.R334W, p.G85E) 71% M&#e9;xico 35 8 mutations: p.F508del, p.G542X, p.N1303K (p.R75X, p.I507del, p.S549N,c.406-1GNA, c.3849+10kbGNA) 58% Colombia 19 7 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.S549R, c.1811+1.6kbANG) 56% Brazil 41 6 mutations: p.F508del, p.G542X, p.R1162X, p.W1282X, p.N1303K (p.R334W) 53% The total number of mutations found in each country is indicated in the second column from left. Login to comment

[hide] PGD for cystic fibrosis patients and couples at ri... Reprod Biomed Online. 2013 May;26(5):420-30. doi: 10.1016/j.rbmo.2013.01.006. Epub 2013 Jan 29. Rechitsky S, Verlinsky O, Kuliev A
PGD for cystic fibrosis patients and couples at risk of an additional genetic disorder combined with 24-chromosome aneuploidy testing.
Reprod Biomed Online. 2013 May;26(5):420-30. doi: 10.1016/j.rbmo.2013.01.006. Epub 2013 Jan 29., [PMID:23523379]

Abstract [show]
Preimplantation genetic diagnosis (PGD) for inherited disorders is presently applied for more than 300 different conditions. The most frequent PGD indication is cystic fibrosis (CF), the largest series of which is reviewed here, totalling 404 PGD cycles. This involved testing for 52 different CFTR mutations with almost half of the cases (195/404 cycles) performed for DeltaF508 mutation, one-quarter (103/404 cycles) for six other frequent mutations and only a few for the remaining 45 CFTR mutations. There were 44 PGD cycles performed for 25 CF-affected homozygous or double-heterozygous CF patients (18 male and seven female partners), which involved testing simultaneously for three mutations, resulting in birth of 13 healthy CF-free children and no misdiagnosis. PGD was also performed for six couples at a combined risk of producing offspring with CF and another genetic disorder. Concomitant testing for CFTR and other mutations resulted in birth of six healthy children, free of both CF and another genetic disorder in all but one cycle. A total of 96 PGD cycles for CF were performed with simultaneous aneuploidy testing, including microarray-based 24-chromosome analysis, as a comprehensive PGD for two or more conditions in the same biopsy material.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 Mutation Region Legacy name cDNA name Protein name # of Patient Number of cycles Number of transfers Number of embryos transferred Pregnancy Birth 125G/C c.-8G>C NA Promoter 1 2 2 2 1 (1) 0 E60X c.178G>T p.Glu60X Exon 3 1 1 1 1 0 0 G85E c.254G>A p.Gly85Glu Exon 3 1 1 1 2 1 1 R75Q c.224G>A p.Arg75Gln Exon 3 1 1 1 1 1 1 R75X c.223C>T p.Arg75X Exon 3 1 1 1 2 1 2 A120T c.358G>A p.Ala120Thr Exon 4 1 1 1 1 0 0 R117C c.349C>T p.Arg117Cys Exon 4 2 6 3 5 1 1 R117H c.350G>A p.Arg117His Exon 4 14 22 19 38 8 6 621+1G-T c.489 &#b1; 1G>T - Intron 4 4 7 4 6 2 1 852del22 c.720_741 p.Gly241GlufsX13 Exon 6 1 1 0 0 0 0 L206W c.617T>G p.Leu206Trp Exon 6 1 2 1 2 0 0 A349V c.1046C>T p.Ala349Val Exon 8 1 2 2 4 2 4 1078delT c.948delT p.Phe316LeufsX12 Exon 8 1 1 1 1 1 0 1154ins-TC c.1022_1023insTC p.Phe342HisfsX28 Exon 8 1 2 1 2 0 0 Q359K/T360K c. Login to comment

[hide] Novel CFTR variants identified during the first 3 ... J Mol Diagn. 2013 Sep;15(5):710-22. doi: 10.1016/j.jmoldx.2013.05.006. Epub 2013 Jun 28. Prach L, Koepke R, Kharrazi M, Keiles S, Salinas DB, Reyes MC, Pian M, Opsimos H, Otsuka KN, Hardy KA, Milla CE, Zirbes JM, Chipps B, O'Bra S, Saeed MM, Sudhakar R, Lehto S, Nielson D, Shay GF, Seastrand M, Jhawar S, Nickerson B, Landon C, Thompson A, Nussbaum E, Chin T, Wojtczak H
Novel CFTR variants identified during the first 3 years of cystic fibrosis newborn screening in California.
J Mol Diagn. 2013 Sep;15(5):710-22. doi: 10.1016/j.jmoldx.2013.05.006. Epub 2013 Jun 28., [PMID:23810505]

Abstract [show]
California uses a unique method to screen newborns for cystic fibrosis (CF) that includes gene scanning and DNA sequencing after only one California-40 cystic fibrosis transmembrane conductance regulator (CFTR) panel mutation has been identified in hypertrypsinogenemic specimens. Newborns found by sequencing to have one or more additional mutations or variants (including novel variants) in the CFTR gene are systematically followed, allowing for prospective assessment of the pathogenic potential of these variants. During the first 3 years of screening, 55 novel variants were identified. Six of these novel variants were discovered in five screen-negative participants and three were identified in multiple unrelated participants. Ten novel variants (c.2554_2555insT, p.F1107L, c.-152G>C, p.L323P, p.L32M, c.2883_2886dupGTCA, c.2349_2350insT, p.K114del, c.-602A>T, and c.2822delT) were associated with a CF phenotype (42% of participants were diagnosed at 4 to 25 months of age), whereas 26 were associated with CFTR-related metabolic syndrome to date. Associations with the remaining novel variants were confounded by the presence of other diseases or other mutations in cis or by inadequate follow-up. These findings have implications for how CF newborn screening and follow-up is conducted and will help guide which genotypes should, and which should not, be considered screen positive for CF in California and elsewhere.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Newborns were screened using the California method, which includes i) analysis of serum immunoreactive trypsinogen (IRT) levels using the AutoDELFIA neonatal IRT L kit (PerkinElmer, Waltham, MA) in all newborn blood spot specimens, ii) CFTR mutation panel [29-40 mutations (the mutations on the California panel were selected for the most part according to allelic frequencies found in a comprehensively genotyped group of California CF cases to achieve a 95% race/ethnicity-specific rate of CF case detection in black, white, and Hispanic individuals in California and include c.1585-1G>A, c.1680-1G>A, c.1973-1985del13insAGAAA, c.2175_2176insA, c.164 &#fe; 2T>A (removed on August 12, 2008), c.2988 &#fe; 1G>A, c.3717 &#fe; 12191C>T, c.3744delA, c.274-1G>A, c.489 &#fe; 1G>T, c.579 &#fe; 1G>T, p.A559T, p.F311del, p.F508del, p.I507del, p.G542X, p.G551D, p.G85E, p.H199Y, p.N1303K, p.R1066C, p.R1162X, p.R334W, p.R553X, p.S549N, p.W1089X, p.W1204X (c.3611G>A), p.W1282X, c.1153_1154insAT [added October 4, 2007], c.1923_1931del9insA, c.3140-26A>G, c.531delT, c.803delA, c.54-5940_273 &#fe; 10250del21kb, p.P205S, p.Q98R, p.R75X, p.S492F [added December 12, 2007], c.3659delC, p.G330X, p.W1204X [c.3612G>A] [added August 12, 2008] [Signature CF 2.0 ASR; Asuragen Inc., Austin, TX])] testing of specimens with IRT 62 ng/mL (highest 1.5%), iii) CFTR gene scanning and sequence analysis (Ambry Test: CF; Ambry Genetics, Aliso Viejo, CA) for specimens found to have only one mutation after CFTR mutation panel testing, and iv) referral to 1 of 15 pediatric CF care centers (CFCs) for sweat chloride (SC) testing and follow-up of all newborns with either two CFTR mutations detected during panel testing or one CFTR mutation detected during panel testing and one (or more) additional CFTR mutation and/or variant detected during sequencing. Login to comment
59 of parents receiving CFTR mutation testing Diagnosis/ status Study participants with positive NBS results 1 W, H 83.5 p.F508del* c.2554_2555insTy 7T/9T 2 CF 2 H 527.0 p.F508del c.-877C>T p.F1107L 7T/9T 0 CF 3 W 86.5 p.F508del p.V562Iy c.-837T>Cy 5Tyz /9T 1 CF 4 H 222.3 p.F508del p.I556V c.1278delC NA 0 CF 5 H, O 93.5 p.F508del* c.-152G>Cy 7T/9T 2 CF 6 W, H, B, O 95.4 p.F508del* p.L323Py 5Tyz /9T 2 CF 7 H 70.5 p.F508del p.L32M 7T/9T 0 CF 8 W 209.5 p.F508del c.2883_2886dupGTCA 9T/9T 0 CF 9 H 155.7 p.F508del* c.2349_2350insT 7T/9T 1 CF 10 O 146.8 p.F508del* c.3718-24G>Ay 5Tyx /9T 2 CF 11 B 99.4 p.A559T* p.L206Wy c.-448A>G* 7T/9T 2 CF 12 W, H 90.3 p.P205S p.K114del 7T/7T 0 CF 13 H 69.7 p.P205S p.K114del 7T/7T 0 CF 14 H 82.9 c.274-1G>A* c.-602A>Ty 7T/7T 2 CF 15 W 106.6 p.F508del* c.-461A>Gy c.-983A>T* 7T/9T 2 CRMS 16 W, B 83.9 p.F508del c.4243-5C>T 5T*x /9T 1 CRMS 17 W 81.5 p.F508del* p.I1027T* p.Y325C 7T/9T 2 CRMS 18 H 70.7 p.F508del c.-967T>C 9T/9T 0 CRMS 19 W, H 62.4 p.F508del* c.-635A>G 7T/9T 1 CRMS 20 H 65.4 p.F508dely c.2490 &#fe; 14G>T* 7T/9T 2 CRMS 21 W 69.3 p.F508del* c.744-15T>Cy 7T/9T 2 CRMS 22 W, H, O 66.2 p.F508del p.D249Y 7T/9T 0 CRMS 23 H 94.8 p.F508del p.R811S 7T/9T 0 CRMS 24 W 75.8 p.F508del* p.H1375Ny 7T/9T 2 CRMS 25 H 63.0 p.F508del p.L136P 7T/9T 0 CRMS 26 W, O 63.0 p.F508del* p.M1140L 7T/9T 1 CRMS 27 W, O 91.7 p.F508del p.V1198M 9T/9T 0 CRMS 28 H 69.3 p.F508dely c.1767-13T>G* 7T/9T 2 CRMS 29 H 108.8 p.F508del p.V1322L 7T/9T 0 CRMS 30 H 96.4 p.F508dely p.C76R* 7T/9T 2 CRMS 31 H 69.0 c.3140-26A>G c.-510G>A* 7T/7T 1 CRMS 32 H 100.2 p.G542X c.-684G>A* 7T/9T 1 CRMS 33 H 84.1 c.1153_1154insAT* c.-730A>Gy 7T/7T 2 CRMS 34 H 62.9 c.1973_ 1985del13insAGAAA* p.D112Gy 7T/7T 2 CRMS 35 H 116.7 c.3744delA* p.T887P 7T/7T 1 CRMS 36 B 73.3 c.2988 &#fe; 1G>A c.-288G>C 7T/9T 0 CRMS 37 H 93.5 p.R75X c.3367 &#fe; 3A>C 7T/7T 0 CRMS 38 W, H 81.4 c.3717 &#fe; 12191C>T* c.-769A>Gy 7T/7T 2 CRMS 39 W 79.0 c.3717 &#fe; 12191C>Ty p.R668Cy p.T1396P* 7T/9T 2 CRMS 40 H 87.3 c.274-1G>A p.F315S 7T/7T 0 CRMS 41 H 79.7 p.G542X c.869 &#fe; 8G>T 7T/9T 0 CRMS 42 O 79.8 p.R553X p.T1478R 7T/7T 0 CRMS 43 H 70.5 p.A559T* c.-448A>G* 7T/7T 2 Carrier 44 B 76.2 p.A559T* c.-448A>G* 7T/7T 1 Carrier 45 W, H 69.2 p.G85E* c.744-15T>C* 5Tyz /7T 2 Carrier 46 W 69.1 p.N1303K* c.2490 &#fe; 14G>A* 7T/9T 1 Carrier 47 W, O 111.7 p.F508del c.3963 &#fe; 6G>T 7T/9T 0 ND{ 48 W 80.1 p.F508del p.R1128G 7T/9T 0 ND{ (table continues) sequencing. Login to comment

[hide] Does extensive genotyping and nasal potential diff... Thorax. 2014 Mar;69(3):254-60. doi: 10.1136/thoraxjnl-2013-203832. Epub 2013 Oct 21. Ooi CY, Dupuis A, Ellis L, Jarvi K, Martin S, Ray PN, Steele L, Kortan P, Gonska T, Dorfman R, Solomon M, Zielenski J, Corey M, Tullis E, Durie P
Does extensive genotyping and nasal potential difference testing clarify the diagnosis of cystic fibrosis among patients with single-organ manifestations of cystic fibrosis?
Thorax. 2014 Mar;69(3):254-60. doi: 10.1136/thoraxjnl-2013-203832. Epub 2013 Oct 21., [PMID:24149827]

Abstract [show]
BACKGROUND: The phenotypic spectrum of cystic fibrosis (CF) has expanded to include patients affected by single-organ diseases. Extensive genotyping and nasal potential difference (NPD) testing have been proposed to assist in the diagnosis of CF when sweat testing is inconclusive. However, the diagnostic yield of extensive genotyping and NPD and the concordance between NPD and the sweat test have not been carefully evaluated. METHODS: We evaluated the diagnostic outcomes of genotyping (with 122 mutations included as disease causing), sweat testing and NPD in a prospectively ascertained cohort of undiagnosed patients who presented with chronic sino-pulmonary disease (RESP), chronic/recurrent pancreatitis (PANC) or obstructive azoospermia (AZOOSP). RESULTS: 202 patients (68 RESP, 42 PANC and 92 AZOOSP) were evaluated; 17.3%, 22.8% and 59.9% had abnormal, borderline and normal sweat chloride results, respectively. Only 17 (8.4%) patients were diagnosable as having CF by genotyping. Compared to sweat testing, NPD identified more patients as having CF (33.2%) with fewer borderline results (18.8%). The level of agreement according to kappa statistics (and the observed percentage of agreement) between sweat chloride and NPD in RESP, PANC and AZOOSP subjects was 'moderate' (65% observed agreement), 'poor' (33% observed agreement) and 'fair' (28% observed agreement), respectively. The degree of agreement only improved marginally when subjects with borderline sweat chloride results were excluded from the analysis. CONCLUSIONS: The diagnosis of CF or its exclusion is not always straightforward and may remain elusive even with comprehensive evaluation, particularly among individuals who present at an older age with single-organ manifestations suggestive of CF.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
127 ߤ14/24 (58%) were not identified with two CF-causing mutations: 12 carried one CF-causing mutation (DF508/-(x5); DF508/5 T (x3); DF508/D1152H; R75X/V456A; 1717-1G>A/Q1291H; 1717-1G>A/5 T) and two had no CF-causing mutation (D579G/D579G; -/-). Login to comment

[hide] Cystic fibrosis carrier screening in a North Ameri... Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19. Zvereff VV, Faruki H, Edwards M, Friedman KJ
Cystic fibrosis carrier screening in a North American population.
Genet Med. 2014 Jul;16(7):539-46. doi: 10.1038/gim.2013.188. Epub 2013 Dec 19., [PMID:24357848]

Abstract [show]
PURPOSE: The aim of this study was to compare the mutation frequency distribution for a 32-mutation panel and a 69-mutation panel used for cystic fibrosis carrier screening. Further aims of the study were to examine the race-specific detection rates provided by both panels and to assess the performance of extended panels in large-scale, population-based cystic fibrosis carrier screening. Although genetic screening for the most common CFTR mutations allows detection of nearly 90% of cystic fibrosis carriers, the large number of other mutations, and their distribution within different ethnic groups, limits the utility of general population screening. METHODS: Patients referred for cystic fibrosis screening from January 2005 through December 2010 were tested using either a 32-mutation panel (n = 1,601,308 individuals) or a 69-mutation panel (n = 109,830). RESULTS: The carrier frequencies observed for the 69-mutation panel study population (1/36) and Caucasian (1/27) and African-American individuals (1/79) agree well with published cystic fibrosis carrier frequencies; however, a higher carrier frequency was observed for Hispanic-American individuals (1/48) using the 69-mutation panel as compared with the 32-mutation panel (1/69). The 69-mutation panel detected ~20% more mutations than the 32-mutation panel for both African-American and Hispanic-American individuals. CONCLUSION: Expanded panels using race-specific variants can improve cystic fibrosis carrier detection rates within specific populations. However, it is important that the pathogenicity and the relative frequency of these variants are confirmed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
63 This threshold could not be reached Table 1ߒ CFTR allele frequency identified by the CF32 mutation panel Varianta Number of detected alleles Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 31,142 68.69 R117Hb p.R117H 5,198 11.46 G542Xb p.G542X 1,162 2.56 G551Db p.G551D 989 2.18 W1282Xb p.W1282X 824 1.82 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 706 1.56 N1303Kb p.N1303K 648 1.43 R553Xb p.R553X 487 1.07 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 436 0.96 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 410 0.90 1717-1G>Ab c.1585-1G>A 388 0.86 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 382 0.84 I507delb p.I507del 258 0.57 R334Wb p.R334W 257 0.57 R1162Xb p.R1162X 211 0.47 G85Eb p.G85E 199 0.44 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 170 0.37 R347Hc p.R347H 160 0.35 3659delCb c.3528delC 155 0.34 3876delAc c.3744delA 153 0.34 R560Tb p.R560T 132 0.29 S549Nc p.S549N 125 0.28 3905insTc c.3773dupT 121 0.27 R347Pb p.R347P 117 0.26 2184delAb c.2052delA 107 0.24 A455Eb p.A455E 106 0.23 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 65 0.14 394delTTc c.262_263delTT 56 0.12 V520Fc p.V520F 54 0.12 1078delTc c.948delT 52 0.11 2183AA>Ga,c c.2051_2052delAAinsG 37 0.08 S549Rc p.S549R 31 0.07 Total 45,338 100 a 2183AA>G variant was added to the panel in 2010. b Variants from ACMG/ACOG CF screening panel. c Classified as a CF-causing mutation by the CFTR2 Database. ACMG, American College of Medical Genetics and Genomics; ACOG, American College of Obstetricians and Gynecologists; CF, cystic fibrosis; HGVS, Human Genome Variation Society. Table 2ߒ Continued on next page Table 2ߒ CFTR allele frequency identified by the CF69 mutation panel Varianta Allele frequency Mutation (%) Legacy nomenclature HGVS nomenclature F508delb p.F508del 1,868 60.49 R117Hb p.R117H 274 8.87 D1152Hc p.D1152H 125 4.05 G542Xb p.G542X 98 3.17 L206Wd p.L206W 73 2.36 3120ߙ+ߙ1G>Ab c.2988ߙ+ߙ1G>A 65 2.10 G551Db p.G551D 47 1.52 N1303Kb p.N1303K 42 1.36 W1282Xb p.W1282X 38 1.23 3849ߙ+ߙ10kbC>Tb c.3717ߙ+ߙ12191C>T 28 0.91 3876delAd c.3744delA 28 0.91 F311dele p.F312del 24 0.78 I507delb p.I507del 24 0.78 R553Xb p.R553X 24 0.78 R117Cd p.R117C 22 0.71 621ߙ+ߙ1G>Tb c.489ߙ+ߙ1G>T 21 0.68 1717-1G>Ab c.1585-1G>A 18 0.58 S549Nd p.S549N 18 0.58 R334Wb p.R334W 17 0.55 2789ߙ+ߙ5G>Ab c.2657ߙ+ߙ5G>A 16 0.52 G85Eb p.G85E 14 0.45 3199del6e c.3067_3072delATAGTG 12 0.39 R1066Cd p.R1066C 11 0.36 1898ߙ+ߙ1G>Ab c.1766ߙ+ߙ1G>A 10 0.32 R347Hd p.R347H 10 0.32 R1162 Xb p.R1162X 9 0.29 W1089Xd p.W1089X 9 0.29 2184delAb c.2052delA 8 0.26 2307insAd c.2175dupA 8 0.26 1078delTd c.948delT 7 0.23 R75Xd p.R75X 7 0.23 3120G>Ad c.2988 G>A 6 0.19 3659delCb c.3528delC 6 0.19 Q493Xd p.Q493X 6 0.19 R1158Xd p.R1158X 6 0.19 R560Tb p.R560T 6 0.19 1812-1G>Ad c.1680-1G>A 5 0.16 2055del9>Ad c.1923_1931del9insA 5 0.16 406-1G>Ad c.274-1G>A 5 0.16 A559Td p.A559T 5 0.16 R347Pb p.R347P 5 0.16 S1255Xd p.S1255X 5 0.16 1677delTAd c.1545_1546delTA 4 0.13 711ߙ+ߙ1G>Tb c.579ߙ+ߙ1G>T 4 0.13 E60Xd p.E60X 4 0.13 R352Qd p.R352Q 4 0.13 Y1092Xd p.Y1092X 4 0.13 2183AA>Gd c.2051_2052delAAinsG 3 0.10 3791delCd c.3659delC 3 0.10 3905insTd c.3773dupT 3 0.10 by 10 variants: the 2143delT, A455E, S549R, Y122X, and M1101K mutations, typically observed in Caucasians; 935delA, 2869insG, and Q890X in Hispanics; and 405+3A>C and G480C in the African-American population. Login to comment
79 Six of these variants were specific to African Americans (R75X, G480C, A559T, 2307insA, 3791delC, and S1255X). Login to comment
115 The extended panel detected 21.7% more mutations (P < 0.01) using six additional race-specific (R75X, G480C, A559T, 2307insA, S1255X, and 3791delC) and seven panethnic variants (see Supplementary Table S2 online). Login to comment

[hide] The improvement of the best practice guidelines fo... Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99. Girardet A, Viart V, Plaza S, Daina G, De Rycke M, Des Georges M, Fiorentino F, Harton G, Ishmukhametova A, Navarro J, Raynal C, Renwick P, Saguet F, Schwarz M, SenGupta S, Tzetis M, Roux AF, Claustres M
The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus.
Eur J Hum Genet. 2015 May 27. doi: 10.1038/ejhg.2015.99., [PMID:26014425]

Abstract [show]
Cystic fibrosis (CF) is one of the most common indications for preimplantation genetic diagnosis (PGD) for single gene disorders, giving couples the opportunity to conceive unaffected children without having to consider termination of pregnancy. However, there are no available standardized protocols, so that each center has to develop its own diagnostic strategies and procedures. Furthermore, reproductive decisions are complicated by the diversity of disease-causing variants in the CFTR (cystic fibrosis transmembrane conductance regulator) gene and the complexity of correlations between genotypes and associated phenotypes, so that attitudes and practices toward the risks for future offspring can vary greatly between countries. On behalf of the EuroGentest Network, eighteen experts in PGD and/or molecular diagnosis of CF from seven countries attended a workshop held in Montpellier, France, on 14 December 2011. Building on the best practice guidelines for amplification-based PGD established by ESHRE (European Society of Human Reproduction and Embryology), the goal of this meeting was to formulate specific guidelines for CF-PGD in order to contribute to a better harmonization of practices across Europe. Different topics were covered including variant nomenclature, inclusion criteria, genetic counseling, PGD strategy and reporting of results. The recommendations are summarized here, and updated information on the clinical significance of CFTR variants and associated phenotypes is presented.European Journal of Human Genetics advance online publication, 27 May 2015; doi:10.1038/ejhg.2015.99.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
79 (unknown) Q39X c.115C4T p.Gln39* P67L c.200C4T p.Pro67Leu R75X c.223C4T p.Arg75* 405+1G4A c.273+1G4A 406-1G4A c.274-1G4A E92X c.274G4T p.Glu92* E92K c.274G4A p.Glu92Lys Q98X c.292C4T p.Gln98* 457TAT4G c.325_327delTATinsG p.Tyr109Glyfs*4 D110H c.328G4C p.Asp110His R117C c.349C4T p.Arg117Cys Y122X c.366 T4A p.Tyr122* 574delA c.442delA p.Ile148Leufs*5 444delA c.313delA p.Ile105Serfs*2 663delT c.531delT p.Ile177Metfs*12 G178R c.532G4A p.Gly178Arg 711+3 A4G c.579+3 A4G 711+5G4A c.579+5G4A 712-1G4T c.580-1G4T H199Y c.595C4T p.His199Tyr P205S c.613C4T p.Pro205Ser L206W c.617 T4G p.Leu206Trp Q220X c.658C4T p.Gln220* 852del22 c.720_741delAGGGAGAAT GATGATGAAGTAC p.Gly241Glufs*13 1078delT c.948delT p.Phe316Leufs*12 G330X c.988G4T p.Gly330* Table 1 (Continued ) HGVS nomenclature Legacy name cDNA nucleotide name Protein name R334W c.1000C4T p.Arg334Trp I336K c.1007 T4A p.Ile336Lys T338I c.1013C4T p.Thr338Ile 1154insTC c.1021_1022dupTC p.Phe342Hisfs*28 S341P c.1021 T4C p.Ser341Pro R347H c.1040G4A p.Arg347His 1213delT c.1081delT p.Trp361Glyfs*8 1248+1G4A c.1116+1G4A 1259insA c.1130dupA p.Gln378Alafs*4 W401X(TAG) c.1202G4A p.Trp401* W401X(TGA) c.1203G4A p.Trp401* 1341+1G4A c.1209+1G4A 1461ins4 c.1329_1330insAGAT p.Ile444Argfs*3 1525-1G4A c.1393-1G4A S466X c.1397C4A or c.1397C4G p.Ser466* L467P c.1400 T4C p.Leu467Pro S489X c.1466C4A p.Ser489* S492F c.1475C4T p.Ser492Phe 1677delTA c.1545_1546delTA p.Tyr515* V520F c.1558G4T p.Val520Phe 1717-1G4A c.1585-1G4A 1717-8G4A c.1585-8G4A S549R c.1645 A4C p.Ser549Arg S549N c.1646G4A p.Ser549Asn S549R c.1647 T4G p.Ser549Arg Q552X c.1654C4T p.Gln552* A559T c.1675G4A p.Ala559Thr 1811+1.6kbA4G c.1680-886 A4G 1812-1G4A c.1680-1G4A R560K c.1679G4A p.Arg560Lys E585X c.1753G4T p.Glu585* 1898+3 A4G c.1766+3 A4G 2143delT c.2012delT p.Leu671* 2184insA c.2052_2053insA p.Gln685Thrfs*4 2184delA c.2052delA p.Lys684Asnfs*38 R709X c.2125C4T p.Arg709* K710X c.2128 A4T p.Lys710* 2307insA c.2175dupA p.Glu726Argfs*4 L732X c.2195 T4G p.Leu732* 2347delG c.2215delG p.Val739Tyrfs*16 R764X c.2290C4T p.Arg764* 2585delT c.2453delT p.Leu818Trpfs*3 E822X c.2464G4T p.Glu822* 2622+1G4A c.2490+1G4A E831X c.2491G4T p.Glu831* W846X c.2537G4A p.Trp846* W846X (2670TGG4TGA) c.2538G4A p.Trp846* R851X c.2551C4T p.Arg851* 2711delT c.2583delT p.Phe861Leufs*3 S945L c.2834C4T p.Ser945Leu 2789+2insA c.2657+2_2657+3insA Q890X c.2668C4T p.Gln890* L927P c.2780 T4C p.Leu927Pro 3007delG c.2875delG p.Ala959Hisfs*9 G970R c.2908G4C p.Gly970Arg 3120G4A c.2988G4A function variants that cause CF disease when paired together; (ii) variants that retain residual CFTR function and are compatible with milder phenotypes such as CFTR-RD; (iii) variants with no clinical consequences; and (iv) variants of unproven or uncertain clinical relevance. Login to comment