ABCMdb

ABCA4 p.Asn965Ser

None has been submitted yet.

Publications

PMID: 10431237 [PubMed] Bodzioch M et al: "The gene encoding ATP-binding cassette transporter 1 is mutated in Tangier disease."

No. Sentence Comment

50 The mutation detected in TD3 does not affect these amino acids, but the identical exchange of asparagine 965 to serine in the first Walker A motif GHNGAGKT of ABCR is responsible for Stargardt macular dystrophy18. Login to comment

PMID: 22863181 [PubMed] Strom SP et al: "Molecular diagnosis of putative Stargardt disease probands by exome sequencing."

No. Sentence Comment

55 Table 1 Clinical Information and Genetic Findings of Putative Stargardt Disease Cases\ SampleAge Sex Acuity OD Acuity OS Clinical Notes ERG Findings Color vision ABCA4 variants PRPH2 variants Other variants STGD-01 19 Male 20/400 20/160 Peripapillary sparing, discrete flecks; nummular atrophy Normal rod Abnormal cone No testing p.N965S p.R2038W . Login to comment
105 Exome sequencing identified two missense variants (p.N965S and p.R2038W) previously reported as disease-causing in STGD [19]. Login to comment
75 Table 1 Clinical Information and Genetic Findings of Putative Stargardt Disease Cases Sample Age Sex Acuity OD Acuity OS Clinical Notes ERG Findings Color vision ABCA4 variants PRPH2 variants Other variants STGD-01 19 Male 20/400 20/160 Peripapillary sparing, discrete flecks; nummular atrophy Normal rod Abnormal cone No testing p.N965S p.R2038W . Login to comment
101 Exome sequencing identified two missense variants (p.N965S and p.R2038W) previously reported as disease-causing in STGD [19]. Login to comment

PMID: 22661472 [PubMed] Testa F et al: "Correlation between photoreceptor layer integrity and visual function in patients with Stargardt disease: implications for gene therapy."

No. Sentence Comment

66 Clinical and Molecular Data of STGD Patients Patient ID/Fam Age (y) Visual Acuity OCT ft (lm) MP (dB) IS/OS* Fundus† FAF‡ ERG§ mfERGjj Mutation 1 Mutation 2 4/2 50 0.0715 134 5.25 - 1 - 2 4 G1961E 250InsCAAA 5/2 47 0.1 127 14.2 2 1 1 1 3 G1961E 250InsCAAA 6/3 33 0.05 125 9.8 2 2 2 1 3 G1961E R2149X 7/4 18 0.085 135 0 - 2 - 3 4 5917del G 5917del G 8/5 16 0.095 104 0.9 3 2 3 3 4 L541P; A1038V L541P; A1038V 9/6 71 0.03 109 0 3 3 3 2 4 IVS35þ2t > c G1961E 11/7 46 0.2 137 9.35 2 1 2 1 1 Y850K A1598D 13/8 35 0.017 163 0 - 3 - 3 4 L541P R1098C 15/10 20 0.1 135.5 11.05 2 1 1 1 4 IVS35þ2t > c G1961E 16/11 20 0.47 96 16.7 2 1 2 1 2 L541P; A1038V L541P; A1038V 17/11 34 0.1 114.5 7.55 2 1 2 1 3 L541P; A1038V L541P; A1038V 18/11 18 1 134 16.15 1 1 1 1 3 L541P; A1038V L541P; A1038V 19/12 12 0.12 242 6.5 3 1 2 1 2 L541P; A1038V L541P; A1038V 20/13 28 0.1 111 14.2 2 2 2 1 3 R1443H IVS35þ2t > c 21/14 34 0.2 152 14.15 2 1 2 2 4 R653C G1961E 22/15 69 0.079 122 0 3 3 3 3 4 I1562T R2149X 23/15 46 0.55 162 1.05 3 3 3 3 4 I1562T IVS45þ1g > c 25/16 28 0.11 105.5 3.1 3 2 2 3 4 R212C R212C 26/17 13 0.084 138.5 0.2 3 2 3 1 3 R18W C1490Y 27/4 20 0.0775 131 0 - 3 - 3 4 5917del G 5917del G 28/4 23 0.042 159.5 0 - 3 - 3 4 5917del G 5917del G 30/18 29 0.0375 103 0 3 3 3 3 4 N965S G1961E 31/19 17 0.1 102 9 3 2 2 3 4 L541P F655C 38/20 20 0.225 95 16 2 1 1 3 4 L541P G1961E 39/21 20 0.17 146 16.7 2 1 1 1 3 G1961E R2030X 42/22 43 0.575 127 7.05 2 1 2 1 2 250insCAAA G1961E 43/23 12 0.1 117.5 11.55 2 2 2 1 3 IVS40þ5g > a IVS15-8g > a 44/24 29 0.1 149 18.5 2 1 2 1 3 G1961E 4736del6bpins2bp 46/25 38 0.0075 182.5 0 - 3 - 3 4 G618R G1972R 48/26 35 0.46 133.5 12.25 2 1 - 1 3 4538insC G1961E 50/27 13 0.2 122.5 17.35 2 1 2 1 3 IVS35þ2t > c G1961E 51/28 24 0.065 123 0 3 3 3 3 4 250InsCAAA V767D 52/29 14 1 147 6.15 1 1 1 3 4 L2027F A1881V 53/30 45 0.1 120 6.05 3 2 2 1 3 G1961E R2030X 54/30 24 0.09 159 2.65 3 3 3 3 4 V767D R2030X 55/31 34 0.085 150 5.15 3 3 3 3 4 N96H IVS40þ5g > a 56/32 48 0.0335 118.5 4.4 - 3 - 2 4 IVS35þ2t > c G1961E 58/32 52 0.05 124 5.8 3 2 2 2 4 IVS35þ2t > c G1961E 60/33 43 0.065 163 15.95 2 1 - 1 2 250InsCAAA G1961E 61/34 45 0.03 187.5 4.5 1 1 1 2 1 R1640Q G1961E 64/35 33 0.0665 158 0 3 3 3 3 4 C2150R 2626InsTTT 65/35 38 0.008 172 0.05 3 3 3 3 4 C2150R 2626InsTTT 66/36 42 0.4 137 0.95 3 2 2 1 3 N96D IVS40þ5g > a 67/37 14 0.235 132 0.15 3 2 3 3 4 IVS6-2a > t IVS6-2a > t 69/38 19 0.09 120 0 3 1 2 1 3 R511H N529S 70/39 42 0.515 140 0.4 3 3 3 3 4 IVS40þ5g > a N965S 72/40 33 0.096 116.5 5.1 3 2 2 1 3 N96D L2140Q 73/41 17 0.1 160 14.35 2 2 2 3 4 G690D A1598D 74/42 36 0.0125 142.5 0 3 3 3 3 4 N96H N96H 75/43 45 0.2 214.5 11.7 2 1 2 1 3 IVS35þ2t > c G1961E 77/44 19 0.34 137.5 11.75 2 1 - 1 3 G1961E G618R 81/45 66 0.335 163 2 - 3 - 2 4 N96D G1961E 82/46 41 0.1 116.5 0.15 3 3 3 3 4 4538insC IVS40þ5g > a 83/47 17 0.395 165 19.25 1 1 1 1 2 G1961E IVS45þ1g > c 84/47 26 0.135 120 16.2 2 1 2 1 3 G1961E IVS45þ1g > c 85/48 10 0.16 149.5 12.4 2 2 2 1 3 IVS35þ2t > c IVS40þ5g > a 87/40 25 0.9 155 15 2 1 2 1 2 N96D L2140Q 88/49 32 0.0715 144 0.1 - 3 - 3 4 IVS45þ1g > c R2149X 89/50 14 0.1185 147 1.85 3 1 - 3 4 P402A 250insCAAA 90/51 35 0.07 116.5 0 - 3 - 3 4 A1598D R2030X 94/52 30 0.1 144 12.85 2 1 - 1 1 A1598D G1961E Fam, family; OCT ft, optical coherence tomography foveal thickness; MP, microperimetry; IS/OS, inner-outer segment junction; FAF, fundus autofluorescence; ERG, electroretinogram; mfERG, multifocal-electroretinogram. Login to comment
67 Clinical and Molecular Data of STGD Patients Patient ID/Fam Age (y) Visual Acuity OCT ft (lm) MP (dB) IS/OS* Fundusߤ FAFߥ ERG&#a7; mfERGjj Mutation 1 Mutation 2 4/2 50 0.0715 134 5.25 - 1 - 2 4 G1961E 250InsCAAA 5/2 47 0.1 127 14.2 2 1 1 1 3 G1961E 250InsCAAA 6/3 33 0.05 125 9.8 2 2 2 1 3 G1961E R2149X 7/4 18 0.085 135 0 - 2 - 3 4 5917del G 5917del G 8/5 16 0.095 104 0.9 3 2 3 3 4 L541P; A1038V L541P; A1038V 9/6 71 0.03 109 0 3 3 3 2 4 IVS35&#fe;2t > c G1961E 11/7 46 0.2 137 9.35 2 1 2 1 1 Y850K A1598D 13/8 35 0.017 163 0 - 3 - 3 4 L541P R1098C 15/10 20 0.1 135.5 11.05 2 1 1 1 4 IVS35&#fe;2t > c G1961E 16/11 20 0.47 96 16.7 2 1 2 1 2 L541P; A1038V L541P; A1038V 17/11 34 0.1 114.5 7.55 2 1 2 1 3 L541P; A1038V L541P; A1038V 18/11 18 1 134 16.15 1 1 1 1 3 L541P; A1038V L541P; A1038V 19/12 12 0.12 242 6.5 3 1 2 1 2 L541P; A1038V L541P; A1038V 20/13 28 0.1 111 14.2 2 2 2 1 3 R1443H IVS35&#fe;2t > c 21/14 34 0.2 152 14.15 2 1 2 2 4 R653C G1961E 22/15 69 0.079 122 0 3 3 3 3 4 I1562T R2149X 23/15 46 0.55 162 1.05 3 3 3 3 4 I1562T IVS45&#fe;1g > c 25/16 28 0.11 105.5 3.1 3 2 2 3 4 R212C R212C 26/17 13 0.084 138.5 0.2 3 2 3 1 3 R18W C1490Y 27/4 20 0.0775 131 0 - 3 - 3 4 5917del G 5917del G 28/4 23 0.042 159.5 0 - 3 - 3 4 5917del G 5917del G 30/18 29 0.0375 103 0 3 3 3 3 4 N965S G1961E 31/19 17 0.1 102 9 3 2 2 3 4 L541P F655C 38/20 20 0.225 95 16 2 1 1 3 4 L541P G1961E 39/21 20 0.17 146 16.7 2 1 1 1 3 G1961E R2030X 42/22 43 0.575 127 7.05 2 1 2 1 2 250insCAAA G1961E 43/23 12 0.1 117.5 11.55 2 2 2 1 3 IVS40&#fe;5g > a IVS15-8g > a 44/24 29 0.1 149 18.5 2 1 2 1 3 G1961E 4736del6bpins2bp 46/25 38 0.0075 182.5 0 - 3 - 3 4 G618R G1972R 48/26 35 0.46 133.5 12.25 2 1 - 1 3 4538insC G1961E 50/27 13 0.2 122.5 17.35 2 1 2 1 3 IVS35&#fe;2t > c G1961E 51/28 24 0.065 123 0 3 3 3 3 4 250InsCAAA V767D 52/29 14 1 147 6.15 1 1 1 3 4 L2027F A1881V 53/30 45 0.1 120 6.05 3 2 2 1 3 G1961E R2030X 54/30 24 0.09 159 2.65 3 3 3 3 4 V767D R2030X 55/31 34 0.085 150 5.15 3 3 3 3 4 N96H IVS40&#fe;5g > a 56/32 48 0.0335 118.5 4.4 - 3 - 2 4 IVS35&#fe;2t > c G1961E 58/32 52 0.05 124 5.8 3 2 2 2 4 IVS35&#fe;2t > c G1961E 60/33 43 0.065 163 15.95 2 1 - 1 2 250InsCAAA G1961E 61/34 45 0.03 187.5 4.5 1 1 1 2 1 R1640Q G1961E 64/35 33 0.0665 158 0 3 3 3 3 4 C2150R 2626InsTTT 65/35 38 0.008 172 0.05 3 3 3 3 4 C2150R 2626InsTTT 66/36 42 0.4 137 0.95 3 2 2 1 3 N96D IVS40&#fe;5g > a 67/37 14 0.235 132 0.15 3 2 3 3 4 IVS6-2a > t IVS6-2a > t 69/38 19 0.09 120 0 3 1 2 1 3 R511H N529S 70/39 42 0.515 140 0.4 3 3 3 3 4 IVS40&#fe;5g > a N965S 72/40 33 0.096 116.5 5.1 3 2 2 1 3 N96D L2140Q 73/41 17 0.1 160 14.35 2 2 2 3 4 G690D A1598D 74/42 36 0.0125 142.5 0 3 3 3 3 4 N96H N96H 75/43 45 0.2 214.5 11.7 2 1 2 1 3 IVS35&#fe;2t > c G1961E 77/44 19 0.34 137.5 11.75 2 1 - 1 3 G1961E G618R 81/45 66 0.335 163 2 - 3 - 2 4 N96D G1961E 82/46 41 0.1 116.5 0.15 3 3 3 3 4 4538insC IVS40&#fe;5g > a 83/47 17 0.395 165 19.25 1 1 1 1 2 G1961E IVS45&#fe;1g > c 84/47 26 0.135 120 16.2 2 1 2 1 3 G1961E IVS45&#fe;1g > c 85/48 10 0.16 149.5 12.4 2 2 2 1 3 IVS35&#fe;2t > c IVS40&#fe;5g > a 87/40 25 0.9 155 15 2 1 2 1 2 N96D L2140Q 88/49 32 0.0715 144 0.1 - 3 - 3 4 IVS45&#fe;1g > c R2149X 89/50 14 0.1185 147 1.85 3 1 - 3 4 P402A 250insCAAA 90/51 35 0.07 116.5 0 - 3 - 3 4 A1598D R2030X 94/52 30 0.1 144 12.85 2 1 - 1 1 A1598D G1961E Fam, family; OCT ft, optical coherence tomography foveal thickness; MP, microperimetry; IS/OS, inner-outer segment junction; FAF, fundus autofluorescence; ERG, electroretinogram; mfERG, multifocal-electroretinogram. Statistics Our set of data is described by continuous (BCVA, OCT foveal thickness, and macular sensitivities) and categorical (fundus, FAF, IS/ OS, ERG, and mfERG groups) variables. Login to comment

PMID: 22735453 [PubMed] Quazi F et al: "ABCA4 is an N-retinylidene-phosphatidylethanolamine and phosphatidylethanolamine importer."

No. Sentence Comment

145 To gain further insight into the molecular mechanisms underlying ABCA4-mediated transport activity and Stargardt disease, we examined the functional properties of ABCA4-containing G863A and N965S mutations associated with Stargardt disease and Walker A mutations, K969M in NBD1, K1978M in NBD2 and the double mutant K969M/1978M. Login to comment
146 The K1978M mutant expressed at the same level as WT ABCA4, whereas the G863A, N965S, K969M and K969M/ K1978M mutants expressed within 50% that of WT ABCA4. Login to comment
168 Percent-relative NBD-PE flipping plotted as a mean with error bars representing ± s.d. for n = 3. mutants showing essentially undetectable activity and the G863A and N965S Stargardt mutants displaying ~18 and 37% of WT activity (Fig. 6b). Login to comment
172 Addition of ATP resulted in release of the substrate from the G863A, N965S and K1978M mutants, but impaired release from the K969M mutant and no significant release from the K969M/K1978M double mutant. Login to comment
189 However, retinal readily reacts with PE, I a E ABCA4 W i l d - t y p e G 8 6 3 A N 9 6 5 S K 9 6 9 M K 9 6 9 M / K 1 9 7 8 M K 1 9 7 8 M ABCA4 kDa 250 250 I E I E I E I E I E 150 100 75 50 37 25 e % N-retinylidene PE binding 120 - ATP + ATP 100 80 60 40 20 0 G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M W T b G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M 120 % Retinal transfer * * 100 80 60 40 20 0 W T c G863A N965S Retinal (µM) 250 % Basal ATPase activity 200 150 100 WT 50 0 0 10 20 30 40 50 60 d MM Retinal (µM) K969M K1978M % Basal ATPase activity 250 WT 200 150 100 50 0 0 10 20 30 40 50 60 f % NBD-PE flippase activity * * 120 100 80 60 40 20 0 G 8 6 3 A M M N 9 6 5 S K 9 6 9 M K 1 9 7 8 M W T Figure 6 | Effect of Walker A and Stargardt mutations on ATR transfer activity. Login to comment
219 The binding of N-retinyli- dene-PE and its release by ATP is not affected by the G863A and N965S mutations (Fig. 6e), but the basal- and retinal-stimulated ATPase activity and ATP-dependent retinal transfer activity are significantly reduced. Login to comment

PMID: 22247458 [PubMed] Cideciyan AV et al: "Macular function in macular degenerations: repeatability of microperimetry as a potential outcome measure for ABCA4-associated retinopathy trials."

No. Sentence Comment

42 Clinical and Molecular Characteristics of the ABCA4 Patients Patient Age (y)/Sex ABCA4 Mutation Clinical Diagnosis Visual Acuity* Kinetic Visual Field Extent (V-4e)†Allele 1 Allele 2 Foveal Fixation P1‡ 12/M N965S W821R STGD 20/20 97 P2‡ 17/F V989A IVS28ϩ5 GϾT STGD 20/100 90 P3 18/M G1961E R1129L§ STGD 20/100 105 P4 21/F R212C P68R STGD 20/125 101 P5 24/M P1511 del1ccgC R1705Q STGD 20/25 114 P6 31/M G863A R1108C STGD 20/25 105 P7 32/F IVS40ϩ5 GϾA V935A STGD 20/32 103 P8 34/M G1961E - CRD 20/32 98 P9 37/F R681X P309R STGD 20/20 109 P10 39/M G1961E C54Y§ STGD 20/40 101 P11‡ 42/F G1961E V256V STGD 20/32 105 P12‡ 46/F G1961E V256V STGD 20/32 106 P13 52/F G1961E P1380L STGD 20/40 105 P14 58/M D600E R18W§ STGD 20/40 84 Extrafoveal Fixation P15 11/M V256V T1526M CRD 20/200 102 P16 15/M C54Y IVS35ϩ2 TϾC STGD 20/200 96 P17‡ 16/F V989A IVS28ϩ5 GϾT STGD 20/100 100 P18 21; 16/M N965S W821R STGD 20/125 100 P19 19/F A1038V/L541P N965S STGD 20/400 90 P20 21/M G863A IVS35ϩ2 TϾC STGD 20/200 99 P21 22/F G1961E R152X STGD 20/50 104 P22 27/M G863A P1660S§ STGD 20/100 98 P23 27/F G1961E A1038V/L541P STGD 20/100 109 P24 29/M G1961E T1019M STGD 20/100 104 P25 33/M P1486L deletion of exon 7 STGD 20/400 98 P26 36/F G863A C1490Y STGD 20/100 93 P27 41/M A1038V/L541P - STGD 20/125 108 P28 49/F T1526M R2030Q STGD 20/125 98 P29 55/F W855X - STGD 20/160 87 P30 56/F G1961E IVS37ϩ1 GϾA§ STGD 20/125 89 P31 60/F G1961E M669 del2ccAT STGD 20/125 104 STGD, Stargardt disease; CRD, cone-rod dystrophy. Login to comment

PMID: 22229821 [PubMed] Duno M et al: "Phenotypic and genetic spectrum of Danish patients with ABCA4-related retinopathy."

No. Sentence Comment

56 Table 1 Mutations identified by HRM in the initial 50 heterozygous patients Patient Mutation 1 (Asper) Mutation 2 (HRM) RefDNA Protein Exon/intron DNA Protein Exon/intron D043 c.2588G>C p.G863A 17 c.184 C>T p.P62S 3 New D069 c.3113C>T p.A1038V 21 c.1529 T>G p.L510R 11 New D050 c.2588G>C p.G863A 17 c.1529 T>G p.L510R 11 New D112 c.2894A>G p.N965S 19 c.1529 T>G p.L510R 11 New D099 c.6089G>A p.R2030Q 44 c.1529 T>G p.L510R 11 New D165 c.1822T>C p.F608L 13 c.2243 G>A p.C748Y 15 New D166 c.2588G>C p.G863A 17 c.2300 T>A p.V767D 15 Known D117 c.3191-2A>G na IVS21 c.2408delG na 16 New D135 c.2894A>G p.N965S 19 c.2408delG na 16 New D147 c.2894A>G p.N965S 19 c.2408delG na 16 New D173 c.4469G>A p.C1490Y 30 c.2915C>A p.T972N 19 Known D013* c.1622C>T p.L541P 12 c.1313C>T p.A1038V 21 Known D181 c.6089G>A p.R2030Q 44 c.3380 G>A p.G1127E 23 New D018 c.6449G>A p.C2150Y 47 c.3736 C>G p.L1246V 25 New D191 c.2588G>C p.G863A 17 c.4069 G>A p.A1357T 27 New D167 c.5461-10T>C na IVS38 c.4102 C>T p.R1368C 27 New D022 c.4462T>C p.C1488R 30 c.4102 C>T p.R1368C 27 New D108 c.1648G>A p.G550R 12 c.4102 C>T p.R1368C 27 New D414 c.2588G>C p.G863A 17 c.4653 G>A p.W1551X 32 New D027 c.2588G>C p.G863A 17 c.4668-2A>G na IVS32 New D136 c. Login to comment
58 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.5584 + 1G>A na IVS39 New D188 c.5461-10T>C na IVS38 c.5693G>A p.R1898H 40 Known D433 c.5882G>A p.G1961E 42 c.6005 + 1G>A na IVS43 Known D134 c.4667 + 2G>T na IVS32 c.6098 T>G p.L2033R 44 New D186 c.3322C>T p.R1108C 22 c.6386 + 1G>A na IVS46 New D182 c.6089G>A p.R2030Q 44 c.6386 + 1G>A na IVS46 New D189 c.2894A>G p.N965S 19 c.6478 A>G p.K2160E 47 New *p.L541P and p.A1038V might be located on the same allele. Login to comment
76 Among the novel mutations detected, the four p.L510R-carrying alleles are found in the Stargardt-flavimaculatus group in combination with p.G863A, p.2030Q, and the Danish founder mutation p.N965S (Table 4). Login to comment
77 In the generalized retinal dystrophy group the three c.2408delG mutations are found in combination with c.3191-2A>G and N965S. Login to comment
78 The stop mutation p.W1551X is combined with the mild mutation p.G863A though resulting in a serious phenotype. Login to comment
97 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773 + 5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005 + 1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773 + 3A>G* D110 p.[L541P+A1038V] c.5584 + 1G>A* D182 p.R2030Q c.6386 + 1G>A* D186 p.R1108C c.6386 + 1G>AA* D133 p.L510R IVS46 + 1G>A* Cone-rod dystrophy D134 c.4667 + 2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame. Login to comment
99 We have previously found the known p.N965S (c.2894A>G) mutation to account for 16.2% of the pathogenic alleles among patients of Danish origin,9 and together with the four new prevalent mutations, these five mutations account for 20% (49/240) of the pathogenic alleles. Login to comment
102 In fact p.[P541L+A1038V] was the third most common allele in our initial array analysis and is one of the most prevalent European mutations.23 HRM identified p.A1038V as the second mutation in D013, thus this mutation was missed by array analysis, and the patient is most likely "only" a carrier for the p.[P541L+A1038V]. Login to comment
60 [1622C>T+3113C>T] p.[L541P+A1038V] 12 c.5584ߙ+ߙ1G>A na IVS39 New D188 c.5461-10T>C na IVS38 c.5693G>A p.R1898H 40 Known D433 c.5882G>A p.G1961E 42 c.6005ߙ+ߙ1G>A na IVS43 Known D134 c.4667ߙ+ߙ2G>T na IVS32 c.6098 T>G p.L2033R 44 New D186 c.3322C>T p.R1108C 22 c.6386ߙ+ߙ1G>A na IVS46 New D182 c.6089G>A p.R2030Q 44 c.6386ߙ+ߙ1G>A na IVS46 New D189 c.2894A>G p.N965S 19 c.6478 A>G p.K2160E 47 New *p.L541P and p.A1038V might be located on the same allele. Login to comment
79 In the generalized retinal dystrophy group the three c.2408delG mutations are found in combination with c.3191-2A>G and N965S. Login to comment
100 Phenotype Patient Mutation 1 Mutation 2 Mutation 3 Stargardt-flavimaculatus D043 p.G863A p.P62S D050 p.G863A p.L510R D112 p.N965S p.L510R D069 p.A1038V p.L510R D099 p.R2030Q p.L510R D178 p.A1038V c.1843_1844delRG D166 p.G863A p.V767D D191 p.G863A p.A1357T D167 c.5461-10T>C p.R1368C D128 p.2408delG* p.T1415P D027 p.G863A c.4668-2A>G* D136 p.[L541P+A1038V] p.L1580S D048 c.3766dupTG* p.R1898H p.F655C D034 p.G863A c.4773ߙ+ߙ5G>A* D015 p. G1127K p.K2160E p.V552I D189 p.N965S p.K2160E D433 p.G1961E c.6005ߙ+ߙ1G>A* Generalized retinal dystrophy D117 c.3191-2A>G* c.2408delG* D135 p.N965S c.2408delG* D147 p.N965S c.2408delG* D173 p.C1490Y p.T972N D018 p.C2150Y p.L1246V D022 p.C1488R p.R1368C D108 p.G550R p.R1368C D414 p.G863A p.W1551X* D444 p.T901A c.4773ߙ+ߙ3A>G* D110 p.[L541P+A1038V] c.5584ߙ+ߙ1G>A* D182 p.R2030Q c.6386ߙ+ߙ1G>A* D186 p.R1108C c.6386ߙ+ߙ1G>AA* D133 p.L510R IVS46ߙ+ߙ1G>A* Cone-rod dystrophy D134 c.4667ߙ+ߙ2G>T* p.L2033R Atypical maculopathy D165 p.F608L p.C748Y D181 p.R2030Q p.G1127E D188 c.5461-10T>C p.R1898H *Predicted to compromise correct reading frame. Login to comment

PMID: 22328824 [PubMed] Roberts LJ et al: "Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients."

No. Sentence Comment

139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment

PMID: 22076985 [PubMed] Lazow MA et al: "Transition zones between healthy and diseased retina in choroideremia (CHM) and Stargardt disease (STGD) as compared to retinitis pigmentosa (RP)."

No. Sentence Comment

59 Characteristics of Patients with STGD Patient ID Eye Age Sex BCVA Mutation(s) (ABCA4) P8 12 OS 33 F 20/150 G1961E P9 2 OS 30 M 20/150 T1253M, G1961E P10 9817 OS 21 F 20/63 * P11 9 OS 19 M 20/150 IVS20ϩ5 GϾA, G1961E P12 6953 OD 49 F 20/50 * P13 11 OS 59 M 20/100 P1380L, S1696N P14 9831 OD 28 M 20/500 * P15 8813 OD 13 M 20/50 * P16 8 OS 34 M 20/100 G1961E, G1961E P17 6.1 OD 24 F 20/200 L541P/A1038V, G1961E P18 8833 OS 13 F 20/160 N965S, L2229P P19 8938 OD 13 M 20/200 A192T, R1300Q P20 5470 OD 28 F 20/100 * P21 9901 OS 41 M 20/160 I32V P22 9327 OS 11 F 20/63 G863A, A1695D P23 9386 OS 18 M 20/40 * P24 8862 OD 30 F 20/63 * P25 6.1 OD 21 F 20/150 L541P/A1038V, G1961E P26 6.2 OS 18 F 20/70 L541P/A1038V, G1961E P27 10 OS 23 F 20/150 L541P/A1038V, I1846T * Patient did not undergo genetic testing. Login to comment
31 Characteristics of Patients with STGD Patient ID Eye Age Sex BCVA Mutation(s) (ABCA4) P8 12 OS 33 F 20/150 G1961E P9 2 OS 30 M 20/150 T1253M, G1961E P10 9817 OS 21 F 20/63 * P11 9 OS 19 M 20/150 IVS20af9;5 Gb0e;A, G1961E P12 6953 OD 49 F 20/50 * P13 11 OS 59 M 20/100 P1380L, S1696N P14 9831 OD 28 M 20/500 * P15 8813 OD 13 M 20/50 * P16 8 OS 34 M 20/100 G1961E, G1961E P17 6.1 OD 24 F 20/200 L541P/A1038V, G1961E P18 8833 OS 13 F 20/160 N965S, L2229P P19 8938 OD 13 M 20/200 A192T, R1300Q P20 5470 OD 28 F 20/100 * P21 9901 OS 41 M 20/160 I32V P22 9327 OS 11 F 20/63 G863A, A1695D P23 9386 OS 18 M 20/40 * P24 8862 OD 30 F 20/63 * P25 6.1 OD 21 F 20/150 L541P/A1038V, G1961E P26 6.2 OS 18 F 20/70 L541P/A1038V, G1961E P27 10 OS 23 F 20/150 L541P/A1038V, I1846T * Patient did not undergo genetic testing. Login to comment

PMID: 21873672 [PubMed] Burke TR et al: "Quantification of peripapillary sparing and macular involvement in Stargardt disease (STGD1)."

No. Sentence Comment

112 Summary of Clinical, Demographic, and Genetic Data Patient Sex Age at Exam (y) Eye VA BCEA 1 SD (deg 2 ) Eccentricity of PRL (deg) ERG Group FAF Abnormalities Allele 1 Allele 2 Allele 3 Distribution Peripapillary Area 1 F 43 OS 20/20 0.73 0 II M - A1799D ND ND 2 M 30 OS 20/150 3.21 6 I M - T1253M G1961E ND 3 F 55 OD 20/30 1.82 0 I EM - G863A IVS28af9;5 Gb0e;T ND 4 M 44 OD 20/25 0.65 0 I M - E161K ND ND 5.1 F 24 OD 20/200 1.57 1 I M - L541P/A1038V G1961E ND 5.2 F 22 OD 20/30 2.74 1 I M - L541P/A1038V G1961E ND 6.1 F 21 OD 20/150 2.01 1 I M - L541P/A1038V G1961E ND 6.2 F 18 OS 20/100 3.09 4 I M - L541P/A1038V G1961E ND 7 F 27 OS 20/400 2.97 9* II EM Peripapillary atrophy L2027F G851D ND 8 M 34 OS 20/100 2.16 4 I M - G1961E G1961E ND 9 M 20 OS 20/150 2.77 4 I M - IVS20af9;5 Gb0e;A G1961E ND 10 F 23 OS 20/150 9.05 5 I M - L541P/A1038V I1846T ND 11 M 59 OS 20/100 6.52 10 II EM - P1380L S1696N ND 12 M 49 OD 20/150 9.97 1 I EM Nasalaf9;temporal flecks R1108H P1380L ND 13 M 47 OS 20/80 5.62 7 I EM - G863A Y106X ND 14 F 42 OD 20/200 9.53 9 I EM Temporal flecks N965S ND ND 15 M 14 OD 20/200 23.84 1 II EM Nasal flecks IVS38-10 Tb0e;C IVS40af9;5 Gb0e;A ND 16 M 52 OS 20/20 1.3 0 I M - IVS38-10 Tb0e;C ND ND 17 M 34 OS 20/30 2.8 1 I M - L541P/A1038V G1961E ND 18 F 33 OD 20/100 6 6 I M - G1961E R2077W ND 19 F 22 OS 20/60 11 4 I M - A854T A1038V C2150Y 20 F 34 OS 20/200 14.2 14 I EM - G1961E ND ND 21 F 19 OD 20/200 3.7 12 I EM - R602W M18821 ND 22 F 27 OD 20/400 9.6 9 II EM Peripapillary atrophy P1380L P1380L ND 23 F 18 OS 20/50 4.9 5 I EM - R1640W V1693I ND 24 M 22 OS 20/150 10.5 2 I EM - C54Y ND ND 25 M 44 OS 20/150 9.1 5 I EM - R1640W ND ND VA, visual acuity; Rel. Login to comment

PMID: 20647261 [PubMed] Schindler EI et al: "Deducing the pathogenic contribution of recessive ABCA4 alleles in an outbred population."

No. Sentence Comment

54 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text). Login to comment
57 Allele VF model Acuity model Occurrences Groupa Leu2027Phe 22.81 0.14 4 a Leu1201Arg 22.29 0.16 2 a Met316fs 20.71 20.15 4 a Gly1961Glu 18.08 0.26 8 a Gly863Ala 16.54 0.36 19 a Pro1380Leu 15.88 0.39 10 a Ala1038Val 15.19 20.03 12 a Leu541Pro 10.95 0.08 1 b Asn965Ser 9.3 0.07 3 b IVS40 + 5 9.29 0.22 9 b Val256Val 9.27 0.84 2 b Phe608Ile 7.24 0.48 2 b IVS38-10 5.75 0.37 14 b Arg1108Cys 1.29 0.81 6 b Leu1430fs 0.37 0.6 2 b Arg2077Trp 26.89 0.93 4 b a When analyzed as groups, A alleles have significantly milder effects on both visual acuity (P , 1023 ) and visual field (P , 1027 ) than B alleles (see text). Login to comment

PMID: 19265867 [PubMed] Passerini I et al: "Novel mutations in of the ABCR gene in Italian patients with Stargardt disease."

No. Sentence Comment

57 Table 2 Summary of the mutations identified in the ABCR gene in our series of STGD Italian patients Patient Allele 1 mutation Allele 2 mutation S 1 R212C T1019M S 8 V1433I V1433I S 21 A1598D A1598D S 33 N96K G978D S 56 A1598D G1961E S 70 R212C T1019M S 71 W700X WT S 74 6750delA V767D S 77 G1961E WT S 82 Q21X G1961E S 106 C1177X G1961E S 107 C1177X G1961E S 114 T970P-F1015E - S 115 T970P-F1015E - S 120 N415K G1961E S 162 324-327insT 324-327insT S 181 W1408X G1961E S 190 C1177X A1598D S 201 G1961E WT S 202 Q21X T970P-F1015E S 213 M840R G1961E S 231 WT WT S 236 C1177X G1961E S 237 WT WT S 241 V256 splice WT S 246 IVS6-1g4t R1108C S 260 L2221P 5109delG-I156V S 321 IVS9 þ 1G4C S1099X S 328 IVS42 þ 4delG IVS35 þ 2t4c S 346 E2096K WT S 347 IVS28 þ 5g4a WT S 353 P1484S-G1961E P68L S 354 P1484S-G1961E P68L S 355 P1484S-G1961E P68L S 360 G1961E 5961delGGAC S 364 IVS35 þ 2t4c G1961E S 365 L541P/A1038V G1961E S 377 IVS42 þ 4delG IVS35 þ 2t4c S 380 R653C WT S 413 R212C T1019M S 414 A1598D G1961E S 417 G1078E G1961E S 438 R1055W WT S 440 4021ins24bp T1526M-G1961E S 449 W1479X L2140Q S 450 W1479X L2140Q S 474 W1461X G 1977S S 486 WT WT S 492 R1098C/L1970F 6548insTGAA S 528 T977P IVS40 þ 5g4a S 531 G690V Q1332X S 532 R572X L1473M-4733delGTTT S 535 IVS40 þ 5g4a 5917delG S 550 IVS40 þ 5g4a 6750delA S 555 250insCAAA WT S 556 250insCAAA WT S 575 N96H G1961E S 590 W821R IVS40 þ 5g4a S 592 V931M R1108C S 593 V767D R2030X Table 2 (Continued ) Patient Allele 1 mutation Allele 2 mutation S 594 G172S G1961E S 602 P1380L G1961E S 607 E616K L1580S-K2172R S 640 250insCAAA S1696N S 694 IVS35 þ 2t4c G1961E S 725 IVS13 þ 1g4a Q1376 splice S 731 L541P-A1038V G1961E S 755 N965S IVS40 þ 5g4a S 789 E1087K G1977S S 968 T1019M G1961E S 992 R212C G1961E Bold values indicate novel mutations. Login to comment

PMID: 19230850 [PubMed] Molday RS et al: "The role of the photoreceptor ABC transporter ABCA4 in lipid transport and Stargardt macular degeneration."

No. Sentence Comment

134 Disease mutations, which are substituted in Stargardt disease, are shown in red italics - NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C); NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment
225 A subset of missense mutations reside in NBD1 (N965S, T971N, A1038V, S1071V, E1087K, R1108C, R1129L) and NBD2 (G1961E, L1971R, G1977S, L2027F, R2038W, R2077W, R2106C, R2107H). Login to comment
226 Several of these, including N965S, T971N, E1087K, L1971R, G1977S, reside inside or close to the Walker A and B motifs [29,90,92,95,97,100,102]. Login to comment

PMID: 19365039 [PubMed] Roberts LJ et al: "Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip."

No. Sentence Comment

31 Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5؅-3؅ PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 3Ј; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 3Ј; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction. Login to comment

PMID: 19074458 [PubMed] Cideciyan AV et al: "ABCA4 disease progression and a proposed strategy for gene therapy."

No. Sentence Comment

47 At age 11, P36 (A1038V;L541P/ N965S) had a sensitivity loss of 5.3 dB which was within normal limits; 8 years later at age 19 there was no significant change in sensitivity loss (5.6 dB). Login to comment
126 For four missense mutations occurring homozygously (L244P, R220C, N965S and P1380L), we assumed that each allele contributed equally to disease severity. Login to comment
151 Estimated severity of ABCA4 alleles and their properties ABCA4 allele Delay of retina-wide disease initiation (years)a In vitro or in vivo studiesb Molecular structural localizationc C2150Y 225.8 NBD-2 A1038V;L541P 214.0 35, 38 ECD-1/NBD-1 IVS38-10 T.C 211.1 L244P 25.7 ECD-1 E1122K 23.5 NBD-1 C54Y 22.1 35 ECD-1 IVS35þ2 T.C 22.1 R602W 21.8 38 ECD-1 V1896D 21.8 TM12 L1940P 21.4 NBD-2 Truncation mutationsd 0.0 E1087D 2.8 NBD-1 R220C 3.9 ECD-1 A1598D 3.9 ECD-2 R1640Q 3.9 ECD-2 R1098C 4.9 NBD-1 P1380L 7.4 35 TM7 N965S 7.6 35 NBD-1 V1433I 8.6 ECD-2 R1108C 10.4 35 NBD-1 T1526M 14.5 35 ECD-2 R2030Q 14.5 NBD-2 L2027F 15.1 35,37 NBD-2 G818E 17.3 35 TM5/TM6 S100P 18.2 ECD-1 L1201R 18.2 NBD-1 R18W 18.5 Nt D600E 18.5 ECD-1 L11P 21.7 Nt D654N 25.3 36 ECD-1 K2172R 27.9 NBD-2 IVS40þ5 G.A 28.1 G1961E 37.9 35 NBD-2 G1961R 44.0 NBD-2 a Delay of retina-wide disease initiation relative to the standard of age 10.6 years. Login to comment

PMID: 15192030 [PubMed] Stenirri S et al: "Denaturing HPLC profiling of the ABCA4 gene for reliable detection of allelic variations."

No. Sentence Comment

35 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28TϾC (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 ϩ 26 GϾA (13) 28 P1380L (4139CϾT) (14) 4 P143L (428C>T) (10) P1401P (4203CϾA) (15) 5 R152Q (455G>A) (4) 4253 ϩ 43GϾA (12) 6 571-1GϾT (4) 29 4253 ϩ 13GϾA (12) R212H (635G>A) (16) 4354-38GϾA (4) C230S (688T>A) (12) 30a 4466 ϩ 3GϾA (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14CϾT (13) P1512R (4535C>G) (4) H423R (1268ϾG) (13) 31 T1526M (4577C>T) (14) 1357 ϩ 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269CϾT) (13) 35 4947delC (14) 11 1387delTT (4) 5018 ؉ 2T>C (7) R500R (1500GϾA) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603AϾT) (13) R572Q (1715G>A) (17) L1894L (5682GϾC) (15) 13 Y639X (1917C>G) (17) 5714 ؉ 5G>A C641S (1922G>C) (4) 41 L1938L (5814AϾG) (12) 14 R653C (1957C>T) (12) 42 5836-43CϾA W700X (2099G>A) (4) 5836-11GϾA (15) 3607 ϩ 49TϾC P1948I (5843CϾT) (15) 15 V767D (2300T>A) (7) P1948P (5844AϾG) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33CϾTb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16AϾG (16) 18 2654-36CϾT (4) I2023I (6069CϾT) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828GϾA) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 ؉ 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964CϾT) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 ϩ 21CϾT (15) 22 E1087K (3259G>A) (14) 49 6730-3TϾC (15) R1098C (3292C>T) (12) S2255I (6764GϾT) (13) S1099P (3295T>C) (4) 6816 ϩ 28GϾC (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment
34 Exon Genotypesa Exon Genotypesa 1b M1V (1A>G) (11) 24 3523-28Tb0e;C (12) R18W (52C>T) (11) 25 G1203D (3608G>A)b 3 250_251insCAAA (7) 27 R1300X (3898C>T) (12) N96K (288C>A) R1300Q (3899G>A) (11) 302 af9; 26 Gb0e;A (13) 28 P1380L (4139Cb0e;T) (14) 4 P143L (428C>T) (10) P1401P (4203Cb0e;A) (15) 5 R152Q (455G>A) (4) 4253 af9; 43Gb0e;A (12) 6 571-1Gb0e;T (4) 29 4253 af9; 13Gb0e;A (12) R212H (635G>A) (16) 4354-38Gb0e;A (4) C230S (688T>A) (12) 30a 4466 af9; 3Gb0e;A (4) 641delG (9) 30b C1490Y (4469G>A) (17) 10 1240-14Cb0e;T (13) P1512R (4535C>G) (4) H423R (1268b0e;G) (13) 31 T1526M (4577C>T) (14) 1357 af9; 11delG (16) 33/34 A1598D (4793C>A) (4) H423H (1269Cb0e;T) (13) 35 4947delC (14) 11 1387delTT (4) 5018 d19; 2T>C (7) R500R (1500Gb0e;A) (4) 39 H1838Y (5512C>T) (14) 12 L541P (1622T>C) (14) 40 N1868I (5603Ab0e;T) (13) R572Q (1715G>A) (17) L1894L (5682Gb0e;C) (15) 13 Y639X (1917C>G) (17) 5714 d19; 5G>A C641S (1922G>C) (4) 41 L1938L (5814Ab0e;G) (12) 14 R653C (1957C>T) (12) 42 5836-43Cb0e;A W700X (2099G>A) (4) 5836-11Gb0e;A (15) 3607 af9; 49Tb0e;C P1948I (5843Cb0e;T) (15) 15 V767D (2300T>A) (7) P1948P (5844Ab0e;G) (15) 16 W821R (2461T>A) (14) G1961E (5882G>A) (14) 17 2588-33Cb0e;Tb 43 L1970F (5908C>T) (11) G863A (2588G>C) (17) 44 6006-16Ab0e;G (16) 18 2654-36Cb0e;T (4) I2023I (6069Cb0e;T) (14) T897I (2690C>T) (7) L2027F (6079C>T) (14) 19 R943Q (2828Gb0e;A) (13) 45 V2050L (6148G>C) (14) Y954D (2860T>G) (4) 46 R2107H (6320G>A) (18) N965S (2894A>G) (14) 6386 d19; 2G>C (10) 20 G978D (2933G>A) (4) 47 R2139W (6415C>T) (14) L988L (2964Cb0e;T) (4) R2149L (6446G>T) (4) 21 E1022K (3064G>A) (4) C2150Y (6449G>A) (19) A1038V (3113C>T) (14) 48 D2177N (6529G>A) (17) G1050D (3149G>A) (4) L2241V (6721C>G) (12) 3211_3212insGT (14) 6729 af9; 21Cb0e;T (15) 22 E1087K (3259G>A) (14) 49 6730-3Tb0e;C (15) R1098C (3292C>T) (12) S2255I (6764Gb0e;T) (13) S1099P (3295T>C) (4) 6816 af9; 28Gb0e;C (4) R1108C (3322C>T) (14) R1129L (3386G>T) (17) a Bold indicates disease-causing mutations. Login to comment

PMID: 14709597 [PubMed] Cideciyan AV et al: "Mutations in ABCA4 result in accumulation of lipofuscin before slowing of the retinoid cycle: a reappraisal of the human disease sequence."

No. Sentence Comment

47 Alleles demonstrated to have major abnormalities in vitro (7) could result in mild disease (P10: E1087K/G1961E) or severe disease (P5: G818E/ L541Pþ A1038V; or P9: N965S/N965S). Login to comment

PMID: 12397427 [PubMed] Zhang X et al: "Macular pigment and visual acuity in Stargardt macular dystrophy."

No. Sentence Comment

54 Blue light images (A, C); infrared images (B, D) Table 1 Visual acuity, macular pigment and ABCR mutations in patients with Stargardt dystrophy Patient Age/Sex Visual Acuity Macular Pigment Exon Allele 1 Exon Allele 2 OD OS OD OS 1 33F 0.67 0.38 + + ND ND 2 36F 1 0.5 + + ND ND 3 54F 0.48 0.6 + + 42 G1961E 42 G1061E 4 11M 0.8 1 + + NS NS 5 33F 0.67 0.4 +- + 20 V989A ND 6 12F 0.5 0.2 +- +- 30 C1490Y 40 GIVS+5A 7 47M 0.5 0.4 +- +- 17 G863A/R943Q 45 R2077W 8 53M 0.1 1 +- +- 14 W663X ND 9 29F 0.1 0.1 +- +- 26 3819insT ND 10 43M 0.005 0.005 - - 17 G863A/R943Q ND 11 32F 0.1 0.1 - - 19 N965S ND 12 29F 0.005 0.005 - - 23 R1129H ND 13 30F 0.1 0.1 - - 5 R152Q ND 14 63F 0.1 0.1 - - 42 G1961E ND 15 36M 0.07 0.1 - +- 13 Q636H 42 G1961E 16 41F 0.005 0.005 - - 12 L514P/A1038V ND NS: Not screened; ND: Not detected + Normal macular pigment; +- Partial macular pigment; - Absent macular pigment absorption of infrared light in the center of the macula where maximum absorption of blue light occurs, implying that the macula pigments in this subject`s foveas are normal. Login to comment

PMID: 11846518 [PubMed] Birch DG et al: "Visual function in patients with cone-rod dystrophy (CRD) associated with mutations in the ABCA4(ABCR) gene."

No. Sentence Comment

207 In contrast, the ®t of the T ABLE III ABCR mutations in patients with ARRP and CRD hRmP exon # Base variation site Codon variation site # WT with mutation New mutation WT genotype RP CRD 3195 3424 5402 5398 4317 146 3793 2566 4800 4512 5581 4770 3 3 H Jxn 1 3 H Jxn 0 in 53 Yes G/G G/A 3 G161A C054Y 0 in 53 No G/G A/A G/A 6 C618G S206R 0 in 53 No C/C C/G 6 G574A A192T 0 in 53 No G/G G/A 9 C1222T R408stop 0 in 53 No C/C C/T 18 A2701G T901A 0 in 53 No A/A A/G 19 A2894G N965S 0 in 53 No A/A A/G 28 T4169C L1390P 0 in 53 Yes T/T T/C 33 3 H Jxn 2 3 H Jxn 0 in 53 Yes T/T T/C 35 C4926G S1642R 0 in 53 Yes C/C C/G 36 G5115T R1705L 0 in 53 No G/G G/T 36 deletion deletion 0 in 53 Yes no del deln 37 T5206C S1736P 0 in 53 No T/T T/C 42 G5882A G1961E 0 in 53 No G/G A/G 47 G6449A C2150Y 0 in 53 No G/G G/A phototransduction model to the cone a-waves revealed a reduction in gain of approximately 0.5 log unit. Login to comment

PMID: 11804194 [PubMed] Sun H et al: "Mechanistic studies of ABCR, the ABC transporter in photoreceptor outer segments responsible for autosomal recessive Stargardt disease."

No. Sentence Comment

108 basal ATPase activity than N965S, and all three show little or no retinal-stimulated ATP hydrolysis. Login to comment

PMID: 11328725 [PubMed] Webster AR et al: "An analysis of allelic variation in the ABCA4 gene."

No. Sentence Comment

102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment

PMID: 9973280 [PubMed] Lewis RA et al: "Genotype/Phenotype analysis of a photoreceptor-specific ATP-binding cassette transporter gene, ABCR, in Stargardt disease."

No. Sentence Comment

76 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196ϩ1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196ϩ2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585-1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714ϩ5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898ϩ1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005ϩ1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253ϩ5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160ϩ1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539ϩ1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS ϭ frameshift. Login to comment
77 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196af9;1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196af9;2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585afa;1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714af9;5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898af9;1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005af9;1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253af9;5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160af9;1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539af9;1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS afd; frameshift. Login to comment

PMID: 24097981 [PubMed] Quazi F et al: "Differential phospholipid substrates and directional transport by ATP-binding cassette proteins ABCA1, ABCA7, and ABCA4 and disease-causing mutants."

No. Sentence Comment

65 Mutations introduced by overlap extension PCR using Pfu AD DNA polymerase in ABCA1 included S100C, W590S, F593L, N935S, T929I, C1477R, T1512M, R2081W, and P2150L. Login to comment
66 Corresponding ABCA4 mutations determined by amino acid alignment with ABCA1 included S100P, W605S, F608L, T959I, N965S, C1502R, T1537M, R2107P, and P2180L. Login to comment
220 Error bars show S.E. Lipid Transport Activity of ABCA Transporters 34420 gardt disease (S100P, F608L, N965S, T959I, T1537M, and R2107P) (Fig. 6A, red). Login to comment
223 Finally, the null mutant C1502X associated with Stargardt disease was modified to C1502R to reflect the primary sequence change of the corresponding C1477R mutant in ABCA1 linked to Tangier disease. Login to comment
68 Corresponding ABCA4 mutations determined by amino acid alignment with ABCA1 included S100P, W605S, F608L, T959I, N965S, C1502R, T1537M, R2107P, and P2180L. Login to comment
218 Error bars show S.E. Lipid Transport Activity of ABCA Transporters 34420 gardt disease (S100P, F608L, N965S, T959I, T1537M, and R2107P) (Fig. 6A, red). Login to comment

PMID: 21510770 [PubMed] Burke TR et al: "Allelic and phenotypic heterogeneity in ABCA4 mutations."

No. Sentence Comment

7 The most common, L541P/A1038V, has been reported as a founder mutation in Hungaro-German populations.14,16,17 Furthermore "ethnic group-specific" ABCA4 alleles have been described in other populations also, C1490Y and R602W in South African patients,18 and N965S in a Danish population19 among others.20 In an attempt to explain the variability seen in ABCA4 retinal phenotypes and to correlate this with individual mutation effect, a model was proposed which correlated disease severity with residual ABCA4 function.14,21 Maugeri classified ABCA4 mutant alleles as "mild", "moderate", and "severe" based on the predicted effect of the mutation on the transport function of the protein, ie, the more severe the effect of the mutation on ABCA4 function, the more aggressive the disease phenotype. Login to comment

PMID: 21911583 [PubMed] Zernant J et al: "Analysis of the ABCA4 gene by next-generation sequencing."

No. Sentence Comment

68 (C) An example of a pedigree segregating a complex allele in which one variant (c.2894Ab0e;G, p.N965S) causes disease and the other, c.4283Cb0e;T, p.T1428M, is a benign polymorphism, although it was originally described as a rare mutation in patients of European descent. Login to comment

PMID: 23419329 [PubMed] Chacon-Camacho OF et al: "ABCA4 mutational spectrum in Mexican patients with Stargardt disease: Identification of 12 novel mutations and evidence of a founder effect for the common p.A1773V mutation."

No. Sentence Comment

100 Allele 1 Allele 2 Genotype Exon Nucleotide change Polypeptide change Exon Nucleotide change Polypeptide change Familial case # 1 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous 2 e NI e e NI e e 3 6 c.634C>T p.R212C (D) 38 c.5318C>T p.A1773V (D) Compound heterozygous 4 23 c.3386G>T p.R1129L (D) 28 c.4139C>T p.P1380L (D) Compound heterozygous 5 e NI e e NI e e 6 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous 7 e NI e e NI e e 8 16 c.2453G>A p.G818E (D) 28 c.4249_4251 delTTC p.F1417del (D; N) Compound heterozygous 9 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous Sporadic case # 1 8 c.868C>T p.R290W (D) e IVS8&#fe;1G>A Splicing (D; N) Compound heterozygous 2 38 c.5318C>T p.A1773V (D) - NI - Heterozygous 3 20 c.3041T>G p.L1014R (D) 1; 49 c.52C>T; c.6764G>T p.R18W (D); p.S2255I (B) Compound heterozygous 4 13; 19 c.1804C>T; c.2828G>A p.R602W (D); p.R943Q (U) 16 c.2453G>A p.G818E (D) Compound heterozygous 5 38 c.5324T>A p. I1775N (D; N) 38 c.5324T>A p.I1775N (D; N) Homozygous 6 e NI e e NI e e 7 49 c.6764G>T p.S2255I (B) 49 c.6764 G>T p.S2255I (B) Homozygous 8 19; 40 c.2828 G>A; c.5503A>T p.R943Q (U); p.N1868I (U) 3 c.265G>T p.E89* (D; N) Compound heterozygous 9 38 c.5335T>C p.Y1779H (D;N) 38 c.5335T>C p.Y1779H (D;N) Homozygous 10 16 c.2453G>A p.G818E (D) 16 c.2453G>A p.G818E (D) Homozygous 11 6 c.723A>T p.E241D (D;N) 36 c.5114G>A p.R1705Q (D) Compound heterozygous 12 2 c.71G>A (D) p.R24H e NI e Heterozygous 13 30 c.4537_4538insC p.Q1513Pfs*41 (D; N) e NI e Heterozygous 14 32 c.4667G>C p.R1556T (D; N) 32 c.4667G>C p.R1556T (D; N) Homozygous 15 45 c.6221G>T p.G2074V (D; N) 16 c.2453G>A p.G818E (D) Compound heterozygous 16 16; 41 c.2453G>A; c.5824G>C p. G818E (D); p. E1942Q (B;N) 46 c.6384A>G p.H2128R (D) Compound heterozygous 17 16 c.2453G>A p. G818E (D) e NI e Heterozygous 18 32 c.4653G>A p. W1551* (D; N) e NI e Heterozygous 19 23 c.3386G>T p. R1129L (D) e NI e Heterozygous 20 36 c.5045_5059del GTTGCCATCTGCGTG p.V1682_ V1686del (D; N) 29; 49 c.4328G>A; c.6764G>T p.R1443H (D); p.S2255I (B) Compound heterozygous 21 19 c.2894A>G p.N965S (D) 19 c.2894A>G p.N965S (D) Homozygous 22 e NI e e NI e e STGD accounts for approximately 7% of all retinal dystrophies; it is one of the most common genetic forms of juvenile or early adult onset macular degeneration. Login to comment
119 ABCA4 Exon # Nucleotide change Predicted protein effect Number of alleles Population genotypic frequency in EVS Population allelic frequency in EVS (%) 1 c.52C>T p.R18W 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 2 c.71G>A p.R24H 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 3 c.265G>T p.E89* (N) 1 NR NR 6 c.634C>T p.R212C 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 6 c.723A>T p.E241D (N) 1 NR NR 8 c.868C>T p.R290W 1 NR NR IVS8 IVS8 &#fe; 1G>A Splicing mutation (N) 1 NR NR 13 c.1804C>T p.R602W 1 NR NR 16 c.2453G>A p.G818E 7 NR NR 19 c.2828G>A p.R943Q 2 AA &#bc; 8/AG &#bc; 400/GG &#bc; 6095 A &#bc; 3.199/G &#bc; 96.801 19 c.2894A>G p.N965S 2 GG &#bc; 0/GA &#bc; 1/AA &#bc; 6502 G &#bc; 0.008/A &#bc; 99.992 20 c.3041T>G p.L1014R 1 NR NR 23 c.3386G>T p.R1129L 2 NR NR 28 c.4139C>T p.P1380L 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 28 c.4249_4251del TTC p.F1417del (N) 1 NR NR 29 c.4328G>A p.R1443H 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 30 c.4537_4538insC p.Q1513Pfs*41 (N) 1 NR NR 32 c.4653G>A p.W1551* (N) 1 NR NR 32 c.4667G>C p.R1556T (N) 2 NR NR 36 c.5044_5058del GTTGCCATCTGCGTG p.V1682_V1686del (N) 1 NR NR 36 c.5114G>A p.R1705Q 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 38 c.5318C>T p.A1773V 8 NR NR 38 c.5324T>A p.I1775N (N) 2 NR NR 38 c.5335T>C p.Y1779H (N) 2 NR NR 40 c.5503A>T p.N1868I 1 TT &#bc; 16/TA &#bc; 589/AA &#bc; 5898 T &#bc; 4.775/A &#bc; 95.225 41 c.5824G>C p.E1942Q (N) 1 NR NR 45 c.6221G>T p.G2074V (N) 1 NR NR 46 c.6384A>G p.H2128R 1 NR NR 49 c.6764G>T p.S2255I 4 TT &#bc; 516/TG &#bc; 1473/GG &#bc; 4514 T &#bc; 19.26/G &#bc; 80.74 gold standard for ABCA4 mutational screening. Login to comment

PMID: 23499370 [PubMed] Fujinami K et al: "A longitudinal study of stargardt disease: clinical and electrophysiologic assessment, progression, and genotype correlations."

No. Sentence Comment

89 Clinical Data and Molecular Genetic Status of 59 Patients With Stargardt Disease Pt Onset (y) Age (y) logMAR VA Variants Identifieda BL FU BL FU 1 16 17 26 0.0/1.0 0.0/0.48 c.768G>T / p.Gly863Ala / p.Arg943Gln 2 15 17 25 0.78/0.78 1.0/1.0 p. Arg1443His 3 11 18 27 0.78/1.0 1.0/1.0 p.Trp439* / p.Gly863Ala / p.Leu1970Phe 4 19 21 32 0.78/0.78 1.0/1.0 p.Leu2027Phe 5 10 22 30 0.48/0.48 1.0/0.78 p.Gly863Ala / p.Arg943Gln / c.5461-10 T>C 6 18 26 37 0.78/1.0 1.0/1.0 p.Pro1380Phe 7 25 28 40 0.78/1.0 1.3/0.78 ND 8 24 29 38 1.0/0.78 1.0/1.0 p.Phe418Ser / p.Leu2027Phe 9 24 31 44 1.0/1.0 1.3/1.0 c.4253&#fe;5 G>T / p.Gly1507Arg 10 26 32 44 0.78/0.78 1.0/1.0 p.Cys1490Tyr / p.Arg2030Gln 11 31 34 46 0.18/0.3 0.6/0.7 ND 12 17 35 47 1.0/1.0 1.0/1.0 p.Asn96His 13 23 35 45 1.0/0.3 1.0/0.48 p.Gly1513Profs*1554 14 33 37 48 0.18/1.48 1.0/1.3 ND 15 38 40 51 0.18/0.78 1.0/1.0 p.Arg2107His 16 42 43 53 0.0/0.0 1.0/1.0 ND 17 22 48 59 1.0/1.0 1.0/1.0 p.Cys54Tyr 18 20 49 59 1.0/0.6 1.0/1.0 p.Pro1380Leu / p.Gly1961Glu 19 35 50 61 1.0/0.3 1.0/1.0 p.Arg1108Cys 20 25 56 67 1.3/0.18 1.0/1.0 p.Trp439* / p.Gly863Ala 21 48 59 71 1.0/0.78 1.0/1.0 p. Ile156 Val / p. Cys1455Arg / p. Phe1839Ser 22 21 22 31 0.3/1.0 1.0/1.0 p.Arg2107His 23 21 23 33 1.0/1.0 1.0/1.0 p.Gly863Ala 24 48 64 73 0.0/1.0 0.18/3.0 p.Tyr1652* 25 17 19 29 0.78/0.3 1.0/1.0 c.5461-10 T>C 26 17 21 33 1.0/0.78 1.0/1.0 ND 27 27 53 66 1.78/1.78 1.3/1.0 p.Ser1071Cysfs*1084 28 5 14 21 0.78/0.78 1.0/1.0 p.Arg408* / p.Val675lle 29 9 15 27 1.08/1.08 1.0/1.0 p.Cys2150Tyr 30 14 24 32 1.0/0.78 1.0/1.0 ND 31 18 28 39 1.0/1.0 1.0/1.0 p.Gly863Ala / p.Arg1108Cys / p.Arg943Gln 32 14 29 37 1.0/1.0 1.0/1.0 p.Arg653Cys / p.Arg2030Gln 33 19 29 40 1.0/1.0 1.0/1.08 ND 34 34 40 49 0.3/0.48 1.0/1.0 p.Gly863Ala / p.Glu1087Lys 35 25 43 54 1.0/1.0 1.0/1.0 p.Cys54Tyr / p.Gly863Ala 36 38 60 69 1.0/1.0 1.3/1.08 p.Val931Met / c.5461-10 T>C 37 10 11 20 1.0/0.78 1.3/1.3 p.Pro1380Leu 38 10 15 23 1.0/1.0 1.3/1.3 p.Ser1071Cysfs*1084 / p.Pro1380Leu 39 24 25 38 1.56/0.3 2.0/2.0 c.5461-10 T>C / c.5714&#fe;5 G>A 40 18 26 36 1.3/1.3 2.0/1.3 ND 41 32 33 45 0.48/0.48 1.0/1.0 ND 42 32 35 46 1.3/0.0 3.0/1.0 p.Cys54Tyr 43 30 35 45 0.48/0.48 2.0/1.3 ND 44 15 41 49 1.3/1.3 2.0/1.3 p.Asn965Ser 45 8 8 20 0.78/0.78 1.0/1.0 p.Thr1019Met 46 10 11 23 1.0/1.0 1.0/1.0 p.Thr1019Met 47 8 12 24 2.0/1.56 1.78/1.48 p.Cys2150Tyr 48 17 18 26 1.0/0.78 1.3/1.0 c.5461-10 T>C / p.Leu2027Phe 49 8 21 33 1.3/1.3 2.0/2.0 p.Asp574Aspfs*582 50 8 27 39 2.0/1.56 1.78/1.48 c.5461-10 T>C 51 24 31 43 1.18/1.18 1.08/1.3 p.Arg1640Trp / p.Leu2027Phe Continued on next page respective electrophysiologic traces appear in Figure 2. Login to comment

PMID: 23953153 [PubMed] Fujinami K et al: "Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function."

No. Sentence Comment

141 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency 2 c.71G>A, p.Arg24His 1 0.36% 2 c.161G>A, p.Cys54Tyr 3 1.07% 3 c.223T>G, p.Cys75Gly 1 0.36% 5 c.455G>A, p.Arg152Gln 1 0.36% 5 c.454C>T, p.Arg152* 1 0.36% 5 c.466 A>G, p.Ile156Val 2 0.71% 6 c.634C>T, p. Arg212Cys 3 1.07% 6 c.656G>C, p.Arg219Thr 1 0.36% 6 c.666_678delAAAGACGGTGCGC, p.Lys223_Arg226delfs 2 0.71% 6 c.768G>T, Splicing site 4 1.42% 8 c.1037A>C, p.Lys346Thr 1 0.36% 10 c.1222C>T, p.Arg408* 3 1.07% 12 c.1622T>C, p.Leu541Pro 2 0.71% 12 c.1648 G>T, p.Gly550* 1 0.36% 13 c.1804C>T, p.Arg602Trp 1 0.36% 13 c.1817G>A, p.Gly606Asp 1 0.36% 13 c.1922G>C, p.Cys641Ser 1 0.36% Int 13 c.1937&#fe;1G>A, Splicing site 2 0.71% 14 c.1957C>T, p.Arg653Cys 2 0.71% 17 c.2588G>C, p.Gly863Ala 19 6.79% 18 c.2701A>G, p.Thr901Ala 1 0.36% 19 c.2791G>A, p.Val931Met 2 0.71% 19 c.2894A>G, p.Asn965Ser 1 0.36% 20 c.2966T>C, p.Vla989Ala 3 1.07% 20 c.2971G>C, p.Gly991Arg 2 0.71% 21 c.3056C>T, p.Thr1019Met 1 0.36% 21 c.3113C>T, p.Ala1038Val 3 1.07% 21 c.3064G>A, p.Glu1022Lys 2 0.71% 22 c.3211_3212insGT, p.Ser1071Cysfs 6 2.14% 22 c.3259G>A, p.Glu1087Lys 4 1.43% 22 c.3292C>T, p.Arg1098Cys 1 0.36% 22 c.3322C>T, p.Arg1108Cys 5 1.79% 22 c.3323G>A, p.Arg1108His 1 0.36% 23 c.3364G>A, p.Glu1122Lys 1 0.36% 23 c.3386G>A, p.Arg1129His 1 0.36% 24 c.3602T>G, p.Leu1201Arg 3 1.07% 27 c.3898C>T, p.Arg1300* 2 0.71% 28 c.4139C>T, p.Pro1380Leu 14 5.00% 28 c.4222T>C, p.Trp1408Arg 1 0.36% 28 c.4234C>T, p.Gly1412* 1 0.36% 28 c.4253&#fe;5G>T, Splice site 1 0.36% 28 c.4253&#fe;4C>T, Splice site 1 0.36% 29 c.4283C>T, p.Thr1428Met 1 0.36% 29 c.4319T>C, p.Phe1440Ser 1 0.36% 29 c.4462T>C, p.Cys1488Arg 1 0.36% 30 c.4469G>A, p.Cys1490Tyr 5 1.79% 30 c.4537_4538insC, p.Gly1513Profs 1 0.36% 31 c.4577C>T, p.Thr1526Met 2 0.71% 33 c.4715C>T, p.Thr1572Met 1 0.36% Continued on next page TABLE 3. Login to comment

PMID: 23982839 [PubMed] Fujinami K et al: "ABCA4 gene screening by next-generation sequencing in a British cohort."

No. Sentence Comment

55 1 c.161G>A p.C54Y DC c.2297G>T p.G766V DC 2 2 c.223T>G p.C75G DC c.5088C>G p.S1696R DC 2 3 c.740A>C p.N247T DC c.1433T>C p.I478T B c.2345G>A p.W782* DC 2 4 c.768G>T Splice site DC 1 5 c.1222C>T p.R408* DC c.2568C>A p.Y856* DC 2 6 c.1804C>T p.R602W DC c.859-9T>C Splice site PDC 2 7 c.1805G>A p.R602Q DC c.5113C>T p.R1705W DC 2 8 c.1922G>C p.C641S DC 1 9 c.1957C>T p.R653C DC 1 10 c.1957C>T p.R653C DC 1 11 c.2588G>C p.G863A DC c.655A>T p.R219* DC 2 Allele 2 (p.R219*) was APEX-false-negative 12 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 13 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 14 c.2588G>C p.G863A DC 1 15 c.2588G>C p.G863A DC 1 16 c.2894A>G p.N965S DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 17 c.3064G>A p.E1022K DC c.6729&#fe;4_&#fe;18delAGTTGGCCCTGGGGC Splice site DC 2 18 c.3064G>A p.E1022K DC 1 19 c.3208_3209insGT p.S1071fs DC c.2942C>T p.P981L DC c.6529G>A p.D2177N B 2 20 c.3208_3209insGT p.S1071fs DC c.1519G>T p.D507Y DC 2 21 c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 2 22 c.3208_3209insGT p.S1071fs DC 1 23 c.3292C>T p.R1098C DC c.3299T>A p.I1100N DC 2 24 c.3322C>T p.R1108C DC c.4978delC p.L1661* DC 2 25 c.3386G>A p.R1129H DC c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 3 Allele 2 (p.S1071fs) was APEX false-negative and allele 1 (p.R1129H) was NGS false-negative 26 c.4139C>T p.P1380L DC c.3191-1G>T Splice site DC 2 27 c.4139C>T p.P1380L DC c.3398T>C p.I1133T PDC 2 28 c.4139C>T p.P1380L DC c.4070C>A p.A1357E DC 2 29 c.4139C>T p.P1380L DC c.4773G>C Splice site DC 2 30 c.4139C>T p.P1380L DC 1 31 c.4139C>T p.P1380L DC 1 32 c.4139C>T p.P1380L DC 1 33 c.4234C>T p.Q1412* DC 1 34 c.4319T>C p.F1440S DC 1 35 c.4328G>A p.R1443H DC c.180delG p.M61fs DC 2 36 c.4469G>A p.C1490Y DC c.1726G>C p.D576H DC 2 37 c.4469G>A p.C1490Y DC 1 38 c.4537_4538insC p.Q1513fs DC c.5578C>T p.R1860W DC 2 Allele 1 (p.Q1513fs) was NGS-false-negative 39 c.4577C>T p.T1526M DC 1 T ABLE 2. Continued Pt Allele 1 Detected by APEX Allele 2 Detected by NGS Allele 3 Detected by NGS Total N of DC Variants Comments DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. Login to comment
62 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 3 c.161G>A p.C54Y 1 1 [ [ Lewis RA, et al. 11 Tol. 0.11 PRD 0.994 No change 1/13006 db SNP (rs150774447) 3 c.223T>G p.C75G 1 2 [ [ Lewis RA, et al. 11 Del. NA POD 0.603 No change ND 5 c.466A>G p.I156V 2 77, 78 [ [ Papaioannou M, et al. 16 Tol. 0.46 B 0.003 No change 16/13006 db SNP (rs112467008) Benign 6 c.655A>T p.R219* 1 11 [ Xi Q, et al. 27 ND 6 c.740A>C p.N247T 1 3 [ [ APEX Del. NA B 0.135 No change ND 6 c.768G>T Splice site 1 4 [ [ Klevering BJ, et al. 22 Tol. 0.56 NA Don. 70.4 58 Site broken (17.51) ND 9 c.1222C>T p.R408* 1 5 [ [ Webster AR, et al. 7 ND 12 c.1726G>C p.D576H 1 36 [ Downs K, et al. 25 POD 0.688 Acc. 68.1 39.1 Site broken (42.54) 1/13006 13 c.1804C>T p.R602W 1 6 [ [ Lewis RA, et al. 11 Del. 0.00 B 0.129 No change ND db SNP (rs 6179409) 13 c.1805G>A p.R602Q 1 7 [ [ Webster AR, et al. 7 Del. 0.04 PRD 0.513 Acc. 48.9 77.9 New site (&#fe;59.14) 2/13006 db SNP (rs61749410) 13 c.1906C>T p.Q636* 3 12, 13, 60 [ Zernant J, et al. 5 No change 1/13006 db SNP (rs145961131) 13 c.1922G>C p.C641S 1 8 [ [ Stenirri S, et al. 24 Del. 0.00 No change ND db SNP (rs61749416) 14 c.1957C>T p.R653C 2 9, 10 [ [ Rivera A, et al. 17 Del. 0.00 PRD 0.999 No change ND db SNP (rs61749420) 17 c.2588G>C p.G863A/ p.DelG863 5 11, 12, 13, 14, 15 [ [ Lewis RA, et al. 11 / Maugeri A, et al. 29 Del. 0.00 PRD 0.996 No change 68/13006 db SNP (rs76157638) 18 c.2701A>G p.T901A 1 74 [ [ APEX Tol. 0.82 B 0.008 23/13006 db SNP (rs139655975) Benign 19 c.2894A>G p.N965S 1 16 [ [ Lewis RA, et al. 11 Del. 0.03 PRD 0.981 Acc. 53.4 82.3 New site (&#fe;54.26) ND db SNP (rs201471607) 20 c.2971G>C p.G991R 1 67 [ [ Yatsenko AN, et al. 13 Del. 0.02 PRD 0.999 No change 28/13006 db SNP (rs147484266) Benign 22 c.3064G>A p.E1022K 2 17, 18 [ [ Webster AR, et al. 7 Del. 0.00 PRD 1.000 No change ND db SNP (rs61749459) 22 c.3208_3209insGT p.S1071fs 5 19, 20, 21, 22, 25 [ [ APEX ND False-negative in APEX in patient 25 22 c.3292C>T p.R1098C 1 23 [ [ Rivera A, et al. 17 Del. NA PRD 0.999 No change ND 22 c.3322C>T p.R1108C 3 16, 24, 61 [ [ Rozet JM, et al. 10 Del. 0.00 PRD 0.986 No change 1/13006 db SNP (rs61750120) False-negative in APEX in patients 16 and 61 23 c.3386G>A p.R1129H 1 25 [ Zernant J, et al. 5 PRD 0.989 No change ND False-negative in NGS in patient 25 24 c.3602T>G p.L1201R 4 72, 73, 74, 79 [ [ Lewis RA, et al. 11 Tol. 0.37 B 0.052 Don. 61.3 73.7 New site (20.08) 416/13006 db SNP (rs61750126) Benign 28 c.4139C>T p.P1380L 7 30, 31, 32, 33, 34, 35, 36 [ [ Lewis RA, et al. 11 Del. 0.01 B 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4234C>T p.Q1412* 1 33 [ [ Rivera A, et al. 17 ND db SNP (rs61750137) 29 c.4283C>T p.T1428M 1 76 [ [ APEX Tol. 0.15 B 0.010 No change 2/13006 db SNP (rs1800549) Benign 29 c.4319T>C p.F1440S 1 34 [ [ Lewis RA, et al. 11 Del. 0.00 POD 0.744 No change ND dbSNP (rs61750141) 29 c.4326C>A p.N1442K 1 64 [ Zernant J, et al. 5 Tol. NA POD 0.374 No change ND 29 c.4328G>A p.R1443H 1 35 [ [ Rivera A, et al. 17 Del. 0.02 PRD 0.999 No change 1/13006 dbSNP (rs61750142) IVS29 c.4352&#fe;1G>A Splice site 1 73 [ Zernant J, et al. 5 Don. 82.3 55.4 WT site broken (32.62) ND 30 c.4469G>A p.C1490Y 2 36, 37 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.994 No change ND dbSNP (rs61751402) 30 c.4538A>G p.Q1513R 1 67 [ Webster AR, et al. 7 Tol. NA Benign 0.043 Acc. 91.7 62.8 Site broken (31.55) ND T ABLE 3. Continued Exon/ IVS Nucleotide Substitution Protein Change/ Effect N of Alleles Identified Pt Method Previous Report SIFT Polyphen 2 HSF Matrix Allele Freq. by EVS Reference Comment APEX NGS Pred. Tol. Index (0-1) Pred. Login to comment

PMID: 24011517 [PubMed] Utz VM et al: "Identification of three ABCA4 sequence variations exclusive to African American patients in a cohort of patients with Stargardt disease."

No. Sentence Comment

121 Population-Specific ABCA4 Alleles in Patients with Stargardt Disease References Population Allele Protein Rivera et al.28 Hargitai et al.12 Hungaro-German c.1622T>C/c.3113C>T p.L541P/p.A1038V September et al.47 Afrikaner c.4469G>A p.C1490Y September et al.47 Afrikaner c.1804C>T p.R602W Rosenberg et al.48 Danish c.2894A>G p.N965S Maugeri et al.27 Western European c.2588G>C p.G863A Maia-Lopes et al.49 Portuguese c.32T>C p.L11P Valverde et al.29 Spanish c.5882G>A p.R1129L Fumagalli et al.50 Italian c.2099G>A p.W700X VOL. 156, NO. 6 ALL AUTHORS HAVE COMPLETED AND SUBMITTED THE ICMJE FORM FOR DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST, and the following were reported. Login to comment

PMID: 24453473 [PubMed] Kjellstrom U et al: "Association between genotype and phenotype in families with mutations in the ABCA4 gene."

No. Sentence Comment

96 Subject ABCA4 allele 1 ABCA4 allele 2 Phenotype* Nucleotide change Effect Nucleotide change Effect 1 Ia c768 G>T V256V/splice c2894 A>G N965S/missense arRP 1 Ib c768 G>T V256V/splice ৄ ৄ NVP 1 Ic c768 G>T V256V/splice ৄ ৄ NVP 1 IIa c768 G>T V256V/splice c768 G>T V256V/splice CRD 2 Ia c5917 delG V1973X/frameshift ৄ ৄ NVP 2 Ib c5917 delG V1973X/frameshift c5882 G>A G1961E/missense STGD 2 IIa c5917 delG V1973X/frameshift c5917 delG V1973X/frameshift CRD 2 IIb c5917 delG V1973X/frameshift c5882 G>A G1961E/missense STGD 2 IIc c5917 delG V1973X/frameshift c5882 G>A G1961E/missense STGD 2 II d c5882 G>A G1961E/missense ৄ ৄ NVP 3 Ia c768 G>T V256V/splice c3113 C>T A1038V/missense STGD 3 Ib c768 G>T V256V/splice ৄ ৄ NVP 3 IIa c768 G>T V256V/splice c768 G>T V256V/splice STGD Abbreviations: arRP; autosomal recessive retinitis pigmentosa, CRD; cone rod dystrophy, STGD; Stargardt disease, NVP; no visual problems *clinical presentation at last visit T able 3. Login to comment

PMID: 24550365 [PubMed] Huang WC et al: "Inner and outer retinal changes in retinal degenerations associated with ABCA4 mutations."

No. Sentence Comment

74 Characteristics of the ABCA4-Related Retinal Disease Patients Patient Age at Visits, y Sex Allele 1 Allele 2 Previous Report*ߤ P1 9, 12 M E341G F608I P2 9, 15 M R681X C2150Y P28* P3ߥ 12 M N965S W821R P1ߤ P4 13, 16 M V256V T1526M P21*, P15ߤ P5 14, 20 F W1408R IVS40&#fe;5 G>A P49* P6ߥ 16 F V989A IVS28&#fe;5 G>T P17ߤ P7ߥ 16 M N965S W821R P18ߤ P8 18, 20 F Y362X IVS38-10 T>C P9ߥ 18 F V989A IVS28&#fe;5 G>T P10 18, 22 M G1961E R1129L P3ߤ P11 20 M R1640Q c.5174_5175insG P12ߥ 20 M G1961E G1961E/P68L P13 22, 25 M G863A IVS35&#fe;2 T>C P20ߤ P14 22, 24 F G1961E R152X P12*, P21ߤ P15ߥ 23 M G1961E G1961E/P68L P16 25, 27 M G1961E R152X P11* P17 26, 32 F L1940P R1129L P64* P18 27, 34 F R1925G A1038V/L541P P19 27, 29 M c.4530_4531insC R1705Q P52*, P5ߤ P20 28, 30 F G1961E A1038V/L541P P23ߤ P21 31, 35 M T1019M G1961E P34* P22ߥ 32, 37 M P1486L Deletion of exon 7 P25ߤ P23 33, 35 M G863A R1108C P29*, P6ߤ P24 34, 37 F IVS40&#fe;5 G>A V935A P32*, P7ߤ P25 34 M G1961E &#a7; P8ߤ P26 37, 43 F C54Y G863A P4* P27 39, 44 F G863A C1490Y P30*, P26ߤ P28 40 M G1961E C54Y P7*, P10ߤ P29 41 F IVS38-10 T>C E1087D P59* P30ߥ 43, 47 F G1961E V256V P23*, P11ߤ P31ߥ 47, 51 F P1486L Deletion of exon 7 P32 47 M Y245X Y245X P20* P33ߥ 48, 51 F G1961E V256V P22*, P12ߤ P34 48, 50 F c.3208_3209insTG IVS40&#fe;5 G>A P35 50, 54 M V1433I L2027F P50* P36ߥ 52, 55 F T1526M R2030Q P55*, P28ߤ P37 53, 59 F G1961E P1380L P47*, P13ߤ P38ߥ 53, 61 M L1940P IVS40&#fe;5 G>A P61* P39 58 M D600E R18W P2*, P14ߤ P40 59, 62 M E1122K G1961E P44* P41 59, 62 F R1640Q G1961E P58* P42ߥ 62 F T1526M R2030Q P54* P43ߥ 64, 68 M L1940P IVS40&#fe;5 G>A P62* P44 68 F R1108C IVS40&#fe;5 G>A P42* P45 71 F IVS38-10 T>C &#a7; Novel variants are bold and italicized. Login to comment

PMID: 24713488 [PubMed] Bertelsen M et al: "Generalized choriocapillaris dystrophy, a distinct phenotype in the spectrum of ABCA4-associated retinopathies."

No. Sentence Comment

13 Most patients harbored at least one mutation classified as ''severe,`` the most common of which was the p.N965S variant that had been found previously at a high frequency among patients with ABCA4-associated retinal dystrophies in Denmark. Login to comment
82 The most frequent mutations in the cohort were the p.N965S Danish founder TABLE 1. Login to comment
114 Two ABCA4 mutations were detected in patient D109 from generation III; a common Danish missense mutation p.N965S and a nonsense mutation p.Q1412*. Login to comment
123 Summary of Detected Potential Pathogenic Variants (Known and Novel [in Bold Face]) Found in the ABCA4 Gene of Patients With Generalized Choriocapillaris Dystrophy Patient Method Mutation 1 Mutation 2 Nucleotide Protein Nucleotide Protein D513 NGS c.203C>T p.P68L c.2894A>G p.N965S D514 Microarray, NGS c.2894A>G p.N965S c.5461-10T>C - D516 NGS c.4926C>G p.S1642R c.5041_5055del p.V1681_C1685del D517 NGS c.5169C>G p.Y1723* c.6079C>T p.L2027F D137 Microarray, NGS c.2894A>G p.N965S c.2894A>G p.N965S D801 Microarray, NGS c.6386&#fe;1G>A Aberrant splicing c.4234C>T p.Q1412* D109 Microarray c.2894A>G p.N965S c.4234C>T p.Q1412* D040 Microarray c.6229C>T p.R2077W c.6229C>T p.R2077W D159 Microarray c.3113C>T p.L541P/A1038V c.3113C>T p.L541P/A1038V D129 Microarray c.2894A>G p.N965S c.3322C>T p.R1108C D115 Microarray c.2894A>G p.N965S c.3113C>T p.L541P/A1038V D033 Microarray c.2894A>G p.N965S c.2041C>T p.R681* D023 Microarray c.203C>T p.P68L c.3329-2A>G Aberrant splicing D001 Microarray c.666_678del p.K223_R226delfs c.4667&#fe;2T>C Aberrant splicing D147 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D162 Microarray c.3329-2A>G Aberrant splicing c.6089G>A p.R2030Q D022 Microarray, HRM c.4462T>C p.C1488R c.4102C>T p.R1368C D112 Microarray, HRM c.2894A>G p.N965S c.1529T>G p.L510R D108 Microarray, HRM c.1648G>A p.G550R c.4102C>T p.R1368C D107 Microarray c.666_678del p.K223_R226delfs c.2588G>C p.G863A D070 Microarray c.2588G>C p.G863A c.2588G>C p.G863A D116 Microarray c.2300T>A p.V767D c.5461-10T>C - D135 Microarray, HRM c.2894A>G p.N965S c.2408delG p.G803fs D117 Microarray, HRM c.3191-2A>G Aberrant splicing c.2408delG p.G803fs D186 Microarray, HRM c.3322C>T p.R1108C c.6386&#fe;1G>A Aberrant splicing D173 Microarray, HRM c.4469G>A p.C1490Y c.2915C>A p.T972N TABLE 3. Login to comment
124 In Silico Analysis of ABCA4 Variants Detected in This Study Using Alamut 2.2 Software cDNA Variant Protein Variant Effect on Protein Function AGVGD Class SIFT Prediction Effect on Protein PPH2 Prediction Effect on Protein TASTER Prediction Effect on Splicing Missense variants c.203C>T p.P68L C65 Deleterious Probably damaging Disease causing c.1529T>G p.L510R C65 Deleterious Benign Polymorphism c.1622T>C p.L541P Reduced ATP binding mislocali- zation26,27 C65 Deleterious Probably damaging Disease causing c.1648G>A p.G550R C65 Deleterious Possibly damaging Disease causing New acceptor site c.2300T>A p.V767D Reduced protein28 C65 Deleterious Benign Disease causing c.2588G>C p.G863A Reduced protein level, reduced ATP binding, reduced ATPase activity26 C55 Deleterious Possibly damaging Disease causing Predicted change at acceptor site 1 bp upstream: 11.1%, creating a new stronger acceptor 3 bp downstream c.2894A>G p.N965S Reduced ATP binding26 C45 Deleterious Probably damaging Disease causing New acceptor site c.2915C>A p.T972N C55 Deleterious Probably damaging Disease causing c.3113C>T p.A1038V Reduced ATP binding, reduced ATP hydrolysis26 C65 Deleterious Benign Disease causing c.3322C>T p.R1108C Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing c.4102C>T p.R1368C C65 Deleterious Probably damaging Disease causing c.4462T>C p.C1488R C65 Deleterious Possibly damaging Disease causing c.4469G>A p.C1490Y Misfolding, mislocali- zation27 C65 Deleterious Probably damaging Disease causing Cryptic donor strongly activated c.4926C>G p.S1642R C25 Deleterious Benign Disease causing c.6079C>T p.L2027F Reduced ATP binding26,29 C15 Deleterious Probably damaging Disease causing c.6089G>A p.R2030Q C35 Deleterious Probably damaging Disease causing c.6229C>T p.R2077W Reduced ATP binding26 C65 Deleterious Probably damaging Disease causing Deletion/frame-shift/stop variants c.666_678del p.K223_ R226delfs c.2041C>T p.R681* c.2408delG p.G803fs c.4234C>T p.Q1412* c.5041_5055del p.V1681_ C1685del c.5169C>G p.Y1723* Splicing affecting variants c.3191-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.3329-2A>G Predicted change at acceptor site 2 bps downstream: 100% c.4667&#fe;2T>C Predicted change at donor site 2 bps upstream: 100% generalized choriocapillaris dystrophy have the occasional hallmarks of early Stargardt disease, such as vermillion fundus, fundus hyperautofluorescence, and a dark choroid on fluorescein angiograms. Login to comment
127 The Danish p.N965S founder mutation was among the most frequent mutations found in our patients, and this mutation is believed to lead to moderate-to-severe retinal phenotypes, because ABCA4 protein dysfunction results in impaired ATP hydrolysis. Login to comment

PMID: 25324290 [PubMed] van Huet RA et al: "Foveal sparing in Stargardt disease."

No. Sentence Comment

302 Rosenberg T, Klie F, Garred P, Schwartz M. N965S is a common ABCA4 variant in Stargardt-related retinopathies in the Danish population. Login to comment

PMID: 26161775 [PubMed] Xin W et al: "Identification of Genetic Defects in 33 Probands with Stargardt Disease by WES-Based Bioinformatics Gene Panel Analysis."

No. Sentence Comment

68 Patient Nucleotide Amino Acid State Computational Prediction Allele Frequency in Reported ID Change Change P/SS Proven SIFT 1000G EVS ExAC NC RC QT058 c.6173T>G p.L2058R Het PrD D D NA NA NA 0/192 0/456 Novel c.4773 +1G>T Splicing defect Het SSA NA NA NA NA NA - 0/456 Pang et al. 2002; Riveiro-Alvarez et al. 2013 QT085 c.6173T>G p.L2058R Het PrD D D NA NA NA 0/192 0/456 Novel c.5932delA p. K1978Qfs*13 Het NA NA NA NA NA NA 0/192 0/456 Novel QT292 c.6389T>A p.M2130K Het PoD D D NA NA NA - 0/456 Yi et al. 2012 c.6118C>T p.R2040* Het NA NA NA NA NA 2/121394 0/192 0/456 Baum et al. 2003 QT302 c.6816 +1G>A Splicing defect Het SSA NA NA NA NA NA - 0/456 Robert et al. 2014 c.4555delA p.T1519Rfs*7 Het NA NA NA NA NA NA 0/192 0/456 Novel QT398 c.4352 +1G>A Splicing defect Het SSA NA NA NA NA 1/121268 - 0/456 Ernest et al. 2009 c.1804C>T p.R602W Het PoD D D NA NA 6/119038 - 2/456 Lewis et al. 1999; Wiszniewski et al. 2005; Heathfield et al. 2013 QT431 c.5646G>A p.M1882I Het PoD D D NA NA 3/121340 - 0/456 Zernant et al. 2011 c.1804C>T p.R602W Het B D D NA NA 6/119038 - 2/456 Lewis et al. 1999; Wiszniewski et al. 2005; Heathfield et al. 2013 QT458 c.4555delA p.T1519Rfs*7 Het NA NA NA NA NA NA 0/192 0/456 Novel c.164A>G p.H55R Het PoD D D NA NA NA - 0/456 Thiadens et al. 2012 QT727 c.161-2A>G Splicing defect Het SSA NA NA NA NA NA 0/192 0/456 Novel c.101_106del p.S34_L35del Het NA NA NA NA NA NA 0/192 0/456 Novel QT833 c.2424C>G p.Y808* Het NA NA NA NA NA NA - 0/456 Zhou et al. 2014 c.1560delG p.V521Sfs*47 Het NA NA NA NA NA NA 0/192 0/456 Novel QT1137 c.6284A>T p.D2095V Het PrD D D NA NA NA 0/192 0/456 Novel c.22C>T p.Q8* Het NA NA NA NA 0.0001 NA 0/192 0/456 Novel QT1160 c.240_241del p.C81Ffs*17 Het NA NA NA NA NA NA 0/192 0/456 Novel c.101_106del p.S34_L35del Het NA NA NA NA NA NA 0/192 0/456 Novel QT1175 c.4195G>T p.E1399* Het NA NA NA NA NA 2/120596 0/192 0/456 Novel c.2894A>G p.N965S Het PrD D D NA 0.0001 21/ 121302 - 0/456 Allikmets et al. 1997; Shanks et al. 2013; Bertelsen et al. 2014 QT1182 c.4773 +1G>T Splicing defect Hom SSA NA NA NA NA NA - 0/456 Pang et al. 2002; Riveiro-Alvarez et al. 2013 QT1198 c.5646G>A p.M1882I Het B D D NA NA 3/121340 - 0/456 Zernant et al. 2011 c.2894A>G p.N965S Het PrD D D NA 0.0001 21/ 121302 - 0/456 Allikmets et al. 1997;Shanks et al. 2013; Bertelsen et al. 2014 QT1200 c.6563T>C p.F2188S Het B D D NA 0.0005 2/121380 - 1/456 Fukui et al. 2002 c.858+2T>A Splicing defect Het SSA NA NA NA NA NA - 0/456 Zhang et al. 2014 QT1230 c.6317G>C p.R2106P Het PrD D D NA NA NA 0/192 0/456 Novel c.101_106del p.S34_L35del Het NA NA NA NA NA NA 0/192 0/456 Novel QT1277 c.6479 +2T>C Splicing defect Het SSA NA NA NA NA NA 0/192 0/456 Novel (Continued) Table 1. Login to comment

PMID: 26593885 [PubMed] Sciezynska A et al: "Next-generation sequencing of ABCA4: High frequency of complex alleles and novel mutations in patients with retinal dystrophies from Central Europe."

No. Sentence Comment

201 of patients Early 13 (50%) 27 (60%) 21 (100%) 61 Late 13 (50%) 18 (40%) 0 (0%) 31 Early &#fe; late 26 45 21 92 or p.N965S in Danish patients (Rosenberg et al., 2007) have not been detected in any of our patients. Login to comment