ABCMdb

ABCA4 p.Arg602Trp

None has been submitted yet.

Publications

PMID: 21567408 [PubMed] Nakagawa H et al: "Ubiquitin-mediated proteasomal degradation of ABC transporters: a new aspect of genetic polymorphisms and clinical impacts."

No. Sentence Comment

155 Effect of Mutations and Nonsynonymous SNPs on Protein Trafficking, Maturation, or ERAD of ABC Transporters Protein AA Mutation/SNP Effect on Protein Reference ABCA1 W590S Mutation Functional defect 115 R587W Mutation Impaired glycol processing 115 Q597R Mutation Impaired glycol processing, ERAD 115,116 Y1532C Mutation Altered protein trafficking 117 R1925Q Mutation Altered protein trafficking 118 ABCA3 R43L Mutation Altered protein trafficking 119 L101P Mutation Altered protein trafficking 119 R280C Mutation Altered protein trafficking 119 ABCA4 L541P Mutation Mislocalization 120 R602W Mutation Mislocalization 120 A1038V Mutation Mislocalization 120 C1490Y Mutation Mislocalization 120 ABCB1a G268V Mutation ERAD 121 G341C Mutation ERAD 121 I1196S Mutation Reduced glycosylation 122 ABCB4 I541F Mutation Accumulation in ER 123 ABCB11a E135K Mutation Reduced level of mature protein 124 L198P Mutation Reduced level of mature protein 124 E297G Mutation Reduced level of mature protein 124 L413W Mutation Reduced level of mature protein 124 R432T Mutation Reduced level of mature protein 124 D482G Mutation Immature protein in ER 124,125 N490D Mutation Reduced level of mature protein 124 A570T Mutation Reduced level of mature protein 124 T655I Mutation Reduced level of mature protein 124 Y818F SNP Moderate reduction of protein 124 G982R Mutation Retention in ER 125 R1153C Mutation ERAD 125 R1286Q Mutation Retention in ER 125 ABCC2a R768W Mutation Impaired protein trafficking 126 I1173F Mutation Impaired protein maturation 127 R1392 Mutation Impaired protein maturation 128 M1393 Mutation Impaired protein maturation 129 ABCC4a E757K SNP Altered protein trafficking 23 ABCC7 F508 Mutation Misfolding, ERAD 36-39,130 G85E Mutation Impaired protein maturation 130-132 G91R Mutation Impaired protein maturation 130-132 N1303K Mutation Impaired protein maturation 130-132 ABCC8 WT Wild type Ubiquitin-proteasome degradation 133 A116P Mutation Ubiquitin-proteasome degradation 133 V187D Mutation Ubiquitin-proteasome degradation 133 F1388 Mutation Impaired protein trafficking 134 L1544P Mutation Impaired protein trafficking 135,136 ABCC11a G180R SNP Ubiquitin-proteasome degradation 50 27 Mutation Ubiquitin-proteasome degradation 50 ABCG2a V12M SNP Altered protein localization 96 Q141K SNP Ubiquitin-proteasome degradation 102 F208S SNP Ubiquitin-proteasome degradation 78,99 S441N SNP Ubiquitin-proteasome degradation 78,99 Mutations of ABCA1, ABCA3, ABCA4, ABCB4, ABCB11, ABCC2, ABCC7 (CFTR), and ABCC8 are associated with Tangier disease, fatal surfactant deficiency, Stargardt disease, progressive familial intrahepatic cholestasis type 3 (PFIC-3), progressive familial intrahepatic cholestasis type 2 (PFIC-2), Dubin-Johnson syndrome, cystic fibrosis, and familial hyperinsulinism, respectively. Login to comment

PMID: 11257260 [PubMed] Bertolini S et al: "A point mutation in ABC1 gene in a patient with severe premature coronary heart disease and mild clinical phenotype of Tangier disease."

No. Sentence Comment

117 In this work we report the characterization of a new point mutation (R527W) in the ABC1 gene in a subject with severe hypoalphalipoproteinemia associated with a ''mild expression`` of the typical clinical phenotype of Tangier disease. It is likely that R527W substitution is the cause of Tangier disease in our patient for the following reasons: (1) it was not found in 200 chromosomes from normolipidemic individuals; (2) it co-segregates with the low HDL-cholesterol phenotype in proband`s family; (3) the arginine at position 527 appears to be highly conserved in the evolution, being present in the same position in mouse ABC1 protein [20]; (4) the presence of R602W mutation in the ABCR protein (a photoreceptor specific ATP-binding cassette protein expressed in human retina, which has a 50% homology with ABC1 protein) causes Stargardt disease (a recessive form of macular dystrophy) [21]. Login to comment
116 In this work we report the characterization of a new point mutation (R527W) in the ABC1 gene in a subject with severe hypoalphalipoproteinemia associated with a ''mild expression`` of the typical clinical phenotype of Tangier disease. It is likely that R527W substitution is the cause of Tangier disease in our patient for the following reasons: (1) it was not found in 200 chromosomes from normolipidemic individuals; (2) it co-segregates with the low HDL-cholesterol phenotype in proband`s family; (3) the arginine at position 527 appears to be highly conserved in the evolution, being present in the same position in mouse ABC1 protein [20]; (4) the presence of R602W mutation in the ABCR protein (a photoreceptor specific ATP-binding cassette protein expressed in human retina, which has a 50% homology with ABC1 protein) causes Stargardt disease (a recessive form of macular dystrophy) [21]. Login to comment

PMID: 22427542 [PubMed] Fritsche LG et al: "A subgroup of age-related macular degeneration is associated with mono-allelic sequence variants in the ABCA4 gene."

No. Sentence Comment

88 The patient carries a heterozygous, complex disease allele (c.1622T>C, p.L541P; c.3113C>T, p.A1038V) in the ABCA4 gene. Login to comment
90 Due to lack of DNA from further family members, segregation of variants c.3113C>T (p.A1038V) / c.3752delA (p.Glu1251fs) and c.1804C>T (p.R602W) / c.1928T>G (p.V643G) could not be assessed further (Supplementary Table S5). Login to comment

PMID: 22328824 [PubMed] Roberts LJ et al: "Stargardt macular dystrophy: common ABCA4 mutations in South Africa--establishment of a rapid genetic test and relating risk to patients."

No. Sentence Comment

6 Results: Microarray screening results from a cohort of 181 patients affected with AARs revealed that seven ABCA4 mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a relatively high frequency. Login to comment
52 Four of the mutations were detected with SNaPshot PCR (p.Cys1490Tyr, p.Arg602Trp, c.5461-10T>C, and p.Leu2027Phe mutations; Table 2, Figure 1, Figure 2, and Figure 3) using the SNaPshot® Multiplex Ready Reaction Mix (Applied Biosystems, Warrington, UK), resolved on the ABI 3100 Genetic Analyzer (Applied Biosystems) and subsequently analyzed using the GeneMapper 3.0 GeneScan software (Applied Biosystems). Login to comment
61 Exon (mutation) Primer 5'-3' Annealing temperature Mutation detection technique Exon 5 (p.Arg152*) F: gacccatttccccttcaac 60 °C dHPLC, Cycle sequencing using the reverse primer R: aggctgggtgcttccctc Exon 6 (c.768G>T) F: ggtgtctttcctaccacag 57.9 °C dHPLC, Cycle sequencing using the forward primer R: aggaatcaccttgcaattgg Exon 13 (p.Arg602Trp) F: agctatccaagcccgttcc 63 °C SNaPshot PCR R: ccattagcgtgtcatggag Exon 17 (p.Gly863Ala) F: ctgcggtaaggtaggataggg 60 °C Allele-specific PCR R: cacaccgtttacatagagggc Exon 30 (p.Cys1490Tyr) F: gtcagcaactttgaggctg 63 °C SNaPshot PCR R: tccctctgtggcaggcag Intron38/Exon39 (c.5461-10T>C) F: gccccacctgctgaagag 63 °C SNaPshot PCR R: tcccagctttggacccag Exon 44 (p.Leu2027Phe) F: gaagcttctccagccctagc 63 °C SNaPshot PCR R: tgcactctcatgaaacaggc TABLE 2. Login to comment
63 Exon (mutation) Primer length (bp) with tail Primer sequence (with tail, 5'-3')* 13 (p.Arg602Trp) 34 R: tgttccagtgccacgaacccgccccagatgtacc 30 (p.Cys1490Tyr) 32 R: cttcgtggttactgagcttctccctggtgctg 39 (Intron 38) (c.5461-10T>C) 37 F: ccgatgtagttgaccccgtttccaacagtcctacttc 44 (p.Leu2027Phe) 41 R: tactctggatcttagtaggtaaagatgttctcgtcctgtga *ThenucleotidesequenceinboldisthesequencedesignedtobindcomplementarytothegenomicDNAsequence.Thenucleotide sequence not written in bold is the random nucleotide tail added to the primer sequence. Figure 1. Login to comment
64 An electropherogram of the multiplex SNaPshot reaction shows the results obtained for a sample that is heterozygous for the p.Arg602Trp and p.Cys1490Tyr mutations. Login to comment
65 The p.Arg602Trp alleles are indicated by blue and green peaks at 36 bp and 37 bp, respectively. Login to comment
73 However, seven mutations (p.Arg152*, c.768G>T, p.Arg602Trp, p.Gly863Ala, p.Cys1490Tyr, c.5461-10T>C, and p.Leu2027Phe) occurred at a significantly higher frequency, compared to the other variants in the cohort (Table 4). Login to comment
88 Functional analysis of the p.Arg602Trp and p.Cys1490Tyr mutations showed that these missense alleles result in misfolding and mislocalization of the ABCA4 protein, as well as a marked reduction in ATPase activity [12]. Login to comment
139 of alleles detected Frequency p.Cys54Tyr c. 161 G>A 2 0.55% p.Arg152* c. 454 C>T 12 3.31% p.Arg152Gln c. 455 G>A 3 0.83% p.Gly172Ser c. 514 G>A 1 0.28% p.Arg212Cys c. 634 C>T 1 0.28% p.Lys223Gln c. 667 A>C 1 0.28% p.V256V (Splice) c. 768 G>T 18 4.97% p.Pro291Leu c. 872 C>T 1 0.28% p.Trp439* c. 1317 G>A 1 0.28% p.Ala538Asp c. 1613 C>A 1 0.28% p.Leu541Pro c. 1622 T>C 1 0.28% p.Arg602Trp c. 1885C>T 30 8.29% p.Val643Met c. 1927 G>A 1 0.28% p.Arg653Cys c. 1957 C>T 1 0.28% p.Arg681* c. 2041 C>T 3 0.83% p.Val767Asp c. 2300 T>A 1 0.28% p.Trp855* c.2564_2571delGGTACCTT 2 0.55% p.Gly863Ala c. 2588 G>C 11 3.04% p.Val931Met c. 2791 G>A 1 0.28% p.Asn965Ser c. 2894 A>G 4 1.10% p.Val989Ala c. 2966 T>C 1 0.28% p.Gly991Arg c. 2971 G>C 1 0.28% p.Thr1019Met c. 3056 C>T 1 0.28% p.Ala1038Val c. 3113 C>T 3 0.83% p.Glu1087Lys c. 3259 G>A 1 0.28% p.Arg1108Cys c. 3322 C>T 2 0.55% p.Leu1201Arg c. 3602 T>G 4 1.10% p.Arg1300Gln c. 3899 G>A 4 1.10% p.Pro1380Leu c. 4139 C>T 3 0.83% p.Trp1408Arg c. 4222 T>C 1 0.28% - c. 4253+5G>A 1 0.28% p.Phe1440Ser c. 4319 T>C 1 0.28% p.Arg1443His c. 4328 G>A 1 0.28% p.Cys1490Tyr c.4469 G>A 54 14.92% p.Gln1513Pro fs*42 c. 4535 insC 1 0.28% p.Ala1598Asp c. 4793C>A 1 0.28% p.Arg1640Trp c. 4918 C>T 2 0.55% p.Ser1642Arg c. 4926 C>G 1 0.28% p.V1681_C1685del c. 5041 del15 1 0.28% - c. 5461-10T>C 24 6.63% - c. 5714+5 G>A 2 0.55% p.Pro1948Leu c. 5843 C>T 1 0.28% p.Gly1961Glu c. 5882 G>A 4 1.10% p.Leu2027Phe c.6079 C>T 30 8.29% p.Arg2030* c. 6088 C>T 1 0.28% p.Arg2030Gln c. 6089 G>A 3 0.83% p.Arg2038Trp c. 6112 C>T 1 0.28% p.Arg2107His c. 6320 G>A 2 0.55% p.Arg2118Glu fs*27 c. 6352 delA 1 0.28% p.Cys2150Tyr c. 6449 G>A 1 0.28% p.Gln2220* c. 6658 C>T 1 0.28% p.Gly863Ala mutation, which appears to have a founder effect in the Netherlands [13,15], the results obtained from the current study are in agreement with September et al.`s conclusions [9]. Login to comment
142 The results obtained from the control cohort screening indicate that the carrier frequency of the p.Cys1490Tyr, p.Arg602Trp, and p.Gly863Ala mutations is slightly higher compared to the other mutations (p.Leu2027Phe, c.768G>T, and p.Arg152*), with the c.5461-10T>C mutation not detected at all. Login to comment
166 Mutant alleles Cohort p.Cys1490Tyr p.Arg602Trp p.Leu2027Phe c.5461-10T>C c.768G>T p.Gly863Ala p.Arg152* Patient (n=72; 144 alleles) 16 (11.11%) 10 (6.94%) 12 (8.33%) 13 (9.03%) 13 (9.03%) 7 (4.86%) 7 (4.86%) Control (total; n=269; 538 alleles) 2 (0. Login to comment

PMID: 21873672 [PubMed] Burke TR et al: "Quantification of peripapillary sparing and macular involvement in Stargardt disease (STGD1)."

No. Sentence Comment

112 Summary of Clinical, Demographic, and Genetic Data Patient Sex Age at Exam (y) Eye VA BCEA 1 SD (deg 2 ) Eccentricity of PRL (deg) ERG Group FAF Abnormalities Allele 1 Allele 2 Allele 3 Distribution Peripapillary Area 1 F 43 OS 20/20 0.73 0 II M - A1799D ND ND 2 M 30 OS 20/150 3.21 6 I M - T1253M G1961E ND 3 F 55 OD 20/30 1.82 0 I EM - G863A IVS28af9;5 Gb0e;T ND 4 M 44 OD 20/25 0.65 0 I M - E161K ND ND 5.1 F 24 OD 20/200 1.57 1 I M - L541P/A1038V G1961E ND 5.2 F 22 OD 20/30 2.74 1 I M - L541P/A1038V G1961E ND 6.1 F 21 OD 20/150 2.01 1 I M - L541P/A1038V G1961E ND 6.2 F 18 OS 20/100 3.09 4 I M - L541P/A1038V G1961E ND 7 F 27 OS 20/400 2.97 9* II EM Peripapillary atrophy L2027F G851D ND 8 M 34 OS 20/100 2.16 4 I M - G1961E G1961E ND 9 M 20 OS 20/150 2.77 4 I M - IVS20af9;5 Gb0e;A G1961E ND 10 F 23 OS 20/150 9.05 5 I M - L541P/A1038V I1846T ND 11 M 59 OS 20/100 6.52 10 II EM - P1380L S1696N ND 12 M 49 OD 20/150 9.97 1 I EM Nasalaf9;temporal flecks R1108H P1380L ND 13 M 47 OS 20/80 5.62 7 I EM - G863A Y106X ND 14 F 42 OD 20/200 9.53 9 I EM Temporal flecks N965S ND ND 15 M 14 OD 20/200 23.84 1 II EM Nasal flecks IVS38-10 Tb0e;C IVS40af9;5 Gb0e;A ND 16 M 52 OS 20/20 1.3 0 I M - IVS38-10 Tb0e;C ND ND 17 M 34 OS 20/30 2.8 1 I M - L541P/A1038V G1961E ND 18 F 33 OD 20/100 6 6 I M - G1961E R2077W ND 19 F 22 OS 20/60 11 4 I M - A854T A1038V C2150Y 20 F 34 OS 20/200 14.2 14 I EM - G1961E ND ND 21 F 19 OD 20/200 3.7 12 I EM - R602W M18821 ND 22 F 27 OD 20/400 9.6 9 II EM Peripapillary atrophy P1380L P1380L ND 23 F 18 OS 20/50 4.9 5 I EM - R1640W V1693I ND 24 M 22 OS 20/150 10.5 2 I EM - C54Y ND ND 25 M 44 OS 20/150 9.1 5 I EM - R1640W ND ND VA, visual acuity; Rel. Login to comment

PMID: 21330655 [PubMed] Aguirre-Lamban J et al: "Further associations between mutations and polymorphisms in the ABCA4 gene: clinical implication of allelic variants and their role as protector/risk factors."

No. Sentence Comment

10 In addition, IVS48ϩ21CϾT and p.Arg943Gln were found to be in linkage disequilibrium with the p.Gly1961Glu and p.Arg602Trp mutations, respectively. Login to comment
72 Mutations and Polymorphisms in the Patient Cohort ABCA4 mutation screening demonstrated that the most frequent (Ͼ5%) disease-associated alleles were the following: p.Arg1129Leu, p.Gly1961Glu, p.Arg602Trp, c.3211insGT, and p.Leu2060Arg (Table 1; Fig. 1). Login to comment
83 Most Frequent ABCA4 Disease-Associated Alleles Identified in the Patient Cohort Exon Nucleotide Change Aminoacid Change Patients n (%) Allele Frequency n (%) Controls n (%) Allele Frequency n (%) P 23 c.3386GϾT p.Arg1129Leu 34 (26.6) 38 (14.8) 0 (0.0) 0 (0.0) 0.000 42 c.5882GϾA p.Gly1961Glu 18 (14.1) 18 (7.0) 1 (1.2) 1 (0.6) 0.001 13 c.1804CϾT p.Arg602Trp 8 (6.3) 9 (3.5) 0 (0.0) 0 (0.0) 0.020 22 c.3211insGT Frameshift 7 (5.5) 7 (2.7) 0 (0.0) 0 (0.0) 0.029 45 c.6179TϾG p.Leu2060Arg 7 (5.5) 7 (2.7) 0 (0.0) 0 (0.0) 0.029 Note that only the p.Gly1961Glu substitution was identified in both patients and control groups. Login to comment
88 p.Arg602Trp The p.Arg602Trp mutation was found to be the third most prevalent missense variant, with a frequency of 6.3% (Table 1). Login to comment
89 Using the Pearson`s ␹;2 test, a significant association was detected between this alteration and the p.Arg943Gln polymorphism (P Ͻ 0.001), since 62.5% of the patients showed both sequence variants. Login to comment
91 In contrast with this, the p.Leu1938Leu variant was less frequently detected among patients with p.Arg602Trp and had a frequency of 0% (P ϭ 0.05) (Table 3). Login to comment
94 p.Arg212H is p.Pro327Pro p.H is423Arg p.H is423H is IVS10+5delG p.Arg602Trp p.Arg943G ln c.3211insG T p.Arg1129Leu p.Pro1401Pro IVS33+48C >Tp.Leu1894Leu p-Leu1938Leu p.Pro1948Leu p.Pro1948Pro p.G ly1961G lup.Leu2060Argp.Asp2095Asp IVS48+21C >T - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - - p.Asn1868Ile p.Ile2023Ile p.Ile2083Ile p.Ser2255Ile PATIENTSCONTROLS FIGURE 1. Login to comment
109 Association between the Most Frequent ABCA4 Polymorphisms and Mutations Patients Variants Frequency P Status Predicted Effect Mutation, n (%) p.Arg1129Leu 34 (26.6) Present polymorphisms p.His423Arg 94.1% 0.000 Associated Risk IVS33؉48C>T 100% 0.011 Associated Risk IVS10ϩ5delG 20.6% 0.049 Associated Protector p.Leu1938Leu 17.6% 0.033 Associated Protector p.Ser2255Ile 2.9% 0.054 Associated Protector Mutation, n (%) p.Gly1961Glu 18 (14.1) Present polymorphisms p.Pro1948Pro 94.7% 0.000 Associated Risk p.Leu1938Leu 89.5% 0.000 Associated Risk p.Asp2095Asp 78.9% 0.000 Associated Risk IVS48؉21C>T 70.0% 0.000 Associated Risk IVS10؉5delG 57.9% 0.008 Associated Risk p.His423Arg 31.6% 0.016 Associated Protector p.Asn1868Ile 18.7% 0.039 Associated Protector Mutation, n (%) p.Arg602Trp 8 (6.3%) Present polymorphisms p.Arg943Gln 62.5% 0.000 Associated Risk p.Pro1401Pro 25% 0.044 Associated Protector p.Leu1938Leu 0% 0.041 Associated Protector Mutation, n (%) c.3211insGT 7 (5.5%) Present polymorphisms p.His423Arg 100% 0.021 Associated Risk p.Asn1868Ile 100% 0.000 Associated Risk IVS10ϩ5delG 0% 0.047 Associated Protector Mutation, n (%) p.Leu2060Arg 7 (5.5%) Present polymorphisms p.Leu1938Leu 100% 0.000 Associated Risk p.Pro1948Leu 100% 0.000 Associated Risk p.His423Arg 14.3% 0.019 Associated Protector TABLE 4. Login to comment
129 The p.Arg943Gln polymorphism is in linkage disequilibrium with the p.Arg602Trp mutation in Spanish STGD (P Ͻ 0.001, Table 3). Login to comment
136 We found an association between p.Arg602Trp and p.Arg943Gln that has not been observed in other populations. Login to comment
73 Mutations and Polymorphisms in the Patient Cohort ABCA4 mutation screening demonstrated that the most frequent (b0e;5%) disease-associated alleles were the following: p.Arg1129Leu, p.Gly1961Glu, p.Arg602Trp, c.3211insGT, and p.Leu2060Arg (Table 1; Fig. 1). Login to comment
84 Most Frequent ABCA4 Disease-Associated Alleles Identified in the Patient Cohort Exon Nucleotide Change Aminoacid Change Patients n (%) Allele Frequency n (%) Controls n (%) Allele Frequency n (%) P 23 c.3386Gb0e;T p.Arg1129Leu 34 (26.6) 38 (14.8) 0 (0.0) 0 (0.0) 0.000 42 c.5882Gb0e;A p.Gly1961Glu 18 (14.1) 18 (7.0) 1 (1.2) 1 (0.6) 0.001 13 c.1804Cb0e;T p.Arg602Trp 8 (6.3) 9 (3.5) 0 (0.0) 0 (0.0) 0.020 22 c.3211insGT Frameshift 7 (5.5) 7 (2.7) 0 (0.0) 0 (0.0) 0.029 45 c.6179Tb0e;G p.Leu2060Arg 7 (5.5) 7 (2.7) 0 (0.0) 0 (0.0) 0.029 Note that only the p.Gly1961Glu substitution was identified in both patients and control groups. Login to comment
92 In contrast with this, the p.Leu1938Leu variant was less frequently detected among patients with p.Arg602Trp and had a frequency of 0% (P afd; 0.05) (Table 3). Login to comment
149 The p.Arg943Gln polymorphism is in linkage disequilibrium with the p.Arg602Trp mutation in Spanish STGD (P b0d; 0.001, Table 3). Login to comment
156 We found an association between p.Arg602Trp and p.Arg943Gln that has not been observed in other populations. Login to comment

PMID: 19028736 [PubMed] Aguirre-Lamban J et al: "Molecular analysis of the ABCA4 gene for reliable detection of allelic variations in Spanish patients: identification of 21 novel variants."

No. Sentence Comment

80 Clinical science Br J Ophthalmol 2009;93:614-621. doi:10.1136/bjo.2008.145193 Table 1 Clinical findings of the Spanish patients with Stargardt disease (STGD), autosomal recessive cone-rod dystrophy and autosomal recessive retinitis pigmentosa Pedigree Age (years) Age (years) of onset Visual acuity Diagnosis Allele 1 Allele 2 Segregation OD OS Nucleotide changes (exons) Amino acid change Nucleotide changes (exons) Amino acid change ARDM-135 42 24 0.4 0.6 STGD c.5882G.A(42) p.Gly1961Glu c.1029_1030insT(8) p.Asn344fsX NP ARDM-240 15 13 0.2 0.16 STGD c.5882G.A(42) p.Gly1961Glu c.2285C.A(15) p.Ala762Glu Yes ARDM-225 32 25 0.25 0.50 STGD c.5882G.A(42) p.Gly1961Glu c.6559C.T(48) p.Gln2187X Yes ARDM-164 21 11 NA STGD c.3386G.T(23) p.Arg1129Leu c.700C.T(6) p.Gln234X Yes ARDM-162 50 16 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND Yes ARDM-198 27 19 0.1 0.1 STGD c.3386G.T(23) p.Arg1129Leu ND ND NP ARDM-125 31 9 0.3 0.4 STGD c.3211insGT(22) FS p.KNLFA1876dup Yes ARDM-158 24 9 0.2 0.2 STGD c.3211insGT(22) FS c.4537delC(30) p.Gln1513fsX1525 NP ARDM-165 40 30 NA STGD c.3211insGT(22) FS ND ND NP ARDM-167 49 23 0.05 0.05 STGD c.3211insGT(22) FS ND ND NP ARDM-146 32 13 0.06 0.1 STGD c.3056C.T(21) p.Thr1019Met c.6140T.A(44) p.Ile2047Asn Yes ARDM-40 46 9 0.1 0.1 STGD c.3056C.T(21) p.Thr1019Met c.3943C.T(27) p.Gln1315X Yes ARDM-90 26 8 Hand moving STGD c.5929G.A (43) p.Gly1977Ser IVS21-2A.T Yes ARDM-181 57 16 0.1 0.09 STGD c.3323G.A (22) p.Arg1108His IVS38+5G.A Yes ARDM-197 35 15 0.1 0.1 STGD c.4793C.A(34) (false +) p.Ala1598Asp (false +) c.5172G.T(36) p.Trp1724Cys Yes ARDM-183 63 55 0.150 0.175 STGD c.6079C.T(44) p.Leu2027Phe c.5929G.A(43) (false -) p.Gly1977Ser (false -) NP ARDM-38 35 6 0.01 0.02 STGD c.1804C.T(13) p.Arg602Trp c.4739delT(33) p.Leu1580fs Yes ARDM-163 48 32 0.01 0.32 STGD c.4457C.T(30) p.Pro1486Leu ND ND Yes ARDM-166 42 39 NA STGD c.6320G.A(46) p.Arg2107His ND ND Yes ARDM-222 26 23 NA STGD c.2791G.A(19) p.Val931Met ND ND NP ARDM-160 30 5 0.25 0.1 STGD ND ND ND ND Yes ARDM-173 49 7 NA STGD ND ND ND ND Yes ARDM-205 NA NA NA STGD c.4919G.A(35) p.Arg1640Gln ND ND NP ARDM-247 30 12 0.05 0.1 CRD c.3386G.T(23) p.Arg1129Leu c.6410G.A(47) p.Cys2137Tyr Yes ARDM-99 59 46 0.05 0.05 CRD c.4297G.A(29) p.Val1433Ile ND ND NP ARDM-131 27 15 0.9 0.7 CRD c.2701A.G(18) p.Thr901Ala ND ND Yes ARDM-100 28 4 0.2 0.16 CRD ND ND ND ND Yes ARDM-142 30 25 0.8 0.5 CRD ND ND ND ND Yes RP-773 38 20 0.05 0.05 RP c.33N86G.T(23) p.Arg1129Leu ND ND NP RP-959 53 10 0.1 0.1 RP c.466A.G(5) p.Ile156Val ND ND Yes RP-1058 37 6 0.2 0.6 RP c.4297G.A(29) p.Val1433Ile ND ND NP Twenty-seven out of 31 subjects were found to be compound heterozygous for mutations in the ABCA4 gene detected by microarray. Login to comment

PMID: 19365039 [PubMed] Roberts LJ et al: "Clinical utility of the ABCR400 microarray: basing a genetic service on a commercial gene chip."

No. Sentence Comment

31 Diagnostic Assays Performed for Verification and Cosegregation Analysis of Mutations Identified Using the ABCR400 Microarray Mutation and Exon Primer 5؅-3؅ PCR Condition Diagnostic Assay C1490Y; exon 30 Forward: 5ЈGTCAGCAACTTTGAGGCTG 3Ј; Reverse: 5ЈTCCCTCTGTGGCAGGCAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Rsa I digest R602W; exon13 Forward: 5ЈAGCTATCCAAGCCCGTTCC 3Ј; Reverse: 5ЈCCATTAGCGTGTCATGGAG 3Ј 25 Cycles at 60°C Verification and cosegregation studies: Msp I digest L2027F; exon 44 Forward: 5ЈGAAGCTTCTCCAGCCCTAGC 3Ј; Reverse: 5ЈTGCACTCTCATGAAACAGGC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: Fnu4H I digest V256V; exon 6 Forward: 5ЈGGTGTCTTTCCTACCACAG 3Ј; Reverse: 5ЈAGGAATCACCTTGCAATTGG 3Ј 30 Cycles at 55°C Verification: direct sequencing using forward primer Cosegregation: dHPLC analysis IVS38-10TϾC; exon 39 Forward: 5ЈGCCCCACCCGCTGAAGAG 3Ј; Reverse: 5ЈTCCCAGCTTTGGACCCAG 3Ј 30 Cycles at 55°C Verification and cosegregation studies: direct sequencing using reverse primer G863A; exon 17 Forward: 5ЈCTGCGGTAAGGTAGGATAGGG 3Ј; Reverse: 5ЈCACACCGTTTACATAGAGGGC 3Ј; G863A-RevC: 5ЈTTTTTGAAGTGGGGTTCCATAGTCAG 3Ј; G863A-RevG: 5ЈGCGTGCTTGGGGTATGAAGTGGGGTTCCATAGTCAC 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation: allele-specific PCR, with G863A-RevC and G863A-RevG R152X and R152Q; exon 5 Forward: 5ЈGACCCATTTCCCCTTCAAC 3Ј; Reverse: 5ЈAGGCTGGGTGCTTCCCTC 3Ј; R152X-RevT: 5ЈTTAAAAAACGCTCTGTCATACATCTTTCAAGATATCCCTTATTCA 3Ј; R152X-RevC: 5ЈATCTTTCAAGATATCCCTTATTCG 3Ј 28 Cycles at 60°C Verification: direct sequencing using reverse primer. Cosegregation studies (R152Q): direct sequencing using reverse primer Cosegregation studies (R152X): allele-specific PCR with R152X-RevT and R152X-RevC P1380L; exon 28 Forward: 5ЈCCACCAGGGGCTGATTAG 3Ј; Reverse: 5ЈCCCAAACCCACAGAGGAG 3Ј 28 Cycles at 55°C Verification and cosegregation studies: Nci I digest N965S; exon 19 Forward: 5ЈTGGGGCCATGTAATTAGGC 3Ј; Reverse: 5ЈTGGGAAAGAGTAGACAGCCG 3Ј 28 Cycles at 58°C Verification and cosegregation studies: direct sequencing using forward primer G1961E; exon 42 Forward: 5ЈGTCACAGTTCTCAGTCCGG 3Ј; Reverse: 5ЈGGAGGAGAGGCAGGCAC 3Ј 28 Cycles at 60°C Verification and cosegregation studies: direct sequencing using reverse primer Rare mutations Previously published primers,8,9 except exon 14 forward: 5`CCTGTTTTCCTTTCCCTCCATC 3Ј; exon 14 reverse: 5ЈTCTTTGAGTGTCTCCCACGTTG 3Ј; exon 24 forward: 5`ATGTGTTGACTACACTTGGCAG 3Ј; exon 24 reverse: 5ЈGCATCACAACAGGACACACC 3Ј Various Verification and cosegregation analysis: direct sequencing using primer farthest from mutation Abbreviations: dHPLC, denaturing high-performance liquid chromatography; PCR, polymerase chain reaction. Login to comment

PMID: 19074458 [PubMed] Cideciyan AV et al: "ABCA4 disease progression and a proposed strategy for gene therapy."

No. Sentence Comment

151 Estimated severity of ABCA4 alleles and their properties ABCA4 allele Delay of retina-wide disease initiation (years)a In vitro or in vivo studiesb Molecular structural localizationc C2150Y 225.8 NBD-2 A1038V;L541P 214.0 35, 38 ECD-1/NBD-1 IVS38-10 T.C 211.1 L244P 25.7 ECD-1 E1122K 23.5 NBD-1 C54Y 22.1 35 ECD-1 IVS35þ2 T.C 22.1 R602W 21.8 38 ECD-1 V1896D 21.8 TM12 L1940P 21.4 NBD-2 Truncation mutationsd 0.0 E1087D 2.8 NBD-1 R220C 3.9 ECD-1 A1598D 3.9 ECD-2 R1640Q 3.9 ECD-2 R1098C 4.9 NBD-1 P1380L 7.4 35 TM7 N965S 7.6 35 NBD-1 V1433I 8.6 ECD-2 R1108C 10.4 35 NBD-1 T1526M 14.5 35 ECD-2 R2030Q 14.5 NBD-2 L2027F 15.1 35,37 NBD-2 G818E 17.3 35 TM5/TM6 S100P 18.2 ECD-1 L1201R 18.2 NBD-1 R18W 18.5 Nt D600E 18.5 ECD-1 L11P 21.7 Nt D654N 25.3 36 ECD-1 K2172R 27.9 NBD-2 IVS40þ5 G.A 28.1 G1961E 37.9 35 NBD-2 G1961R 44.0 NBD-2 a Delay of retina-wide disease initiation relative to the standard of age 10.6 years. Login to comment

PMID: 19365591 [PubMed] Maia-Lopes S et al: "ABCA4 mutations in Portuguese Stargardt patients: identification of new mutations and their phenotypic analysis."

No. Sentence Comment

68 Family Patient CFC Onset (age) VA (OD/OS) Nucleotide changes (exons) Effect changes [references] 1 4427 S 7 1/10 / 1/10 c.286A>G(3) / c.4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 4413 S 14 1/10 / 0.5/10 c.286A>G(3) / c.4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 4454 S 11 1/10 / 1/10 c.286A>G(3) / c. Login to comment
69 4139C>T(28) p.Asn96Asp [30]/p.Pro1380Leu [13] 2 4458 Mi 5 8/10 / 6/10 ND / ND ND/ND 4455 S 8 1/10 / 8/10 ND / ND ND/ND 3 4431 Mo 6 1,6/10 / 1,6/10 c.1804C>T(13) / c.IVS+5G>A(40) p.Arg602Trp [30]/SPLICE [11] 4 4626 S 6 FC / FC c.3211_3212insGT(22) / c.3211_3212insGT(22) p.Asp1048fs [5]/p.Asp1048fs [5] 5 4514 S 12 1/10 / 1/10 c.32T>C(1) / c. Login to comment

PMID: 16103129 [PubMed] Wiszniewski W et al: "ABCA4 mutations causing mislocalization are found frequently in patients with severe retinal dystrophies."

No. Sentence Comment

2 We analyzed a cohort of 29 arRP families for the mutations in ABCA4 with a commercial microarray, ABCR-400 in addition to direct sequencing and segregation analysis, and identified both mutant alleles in two families (7%): compound heterozygosity for missense (R602W) and nonsense (R408X) alleles and homozygosity for a complex [L541P; A1038V] allele. Login to comment
26 Functional studies of missense alleles [L541P; A1038V], R602W and C1490Y in transgenic frogs demonstrate that they do not translocate to rod OSs (ROSs). Login to comment
36 Sequence analysis of patient AR689-03 revealed compound heterozygosity for the missense ABCA4 alteration R602W and a nonsense allele, R408X. Login to comment
44 A WT 168-05 24 20/25 OD; 20/30 OS;VF , 308 OU RP N/A N/A 168-06 26 N/A RP N/A N/A AR192 192-03 9 20/20 OD; 20/25 OS;VF , 58 OU RP D2177N WT 192-04 19 20/30 OD; 20/40 OS;VF , 58 OU RP WT WT 192-05 19 20/30 OD; 20/40 OS;VF , 58 OU RP WT WT AR194 194-03 30 N/A RP D2177N WT 194-05 Childhood 20/25 OD; 20/40 OS RP N/A N/A 194-06 5 N/A RP D2177N WT 194-07 4 or 5 20/80 OU RP N/A N/A AR197 197-05 7 CF 3 feet OD; CF 2 feet OS RP [L541P; A1038V] [L541P; A1038V] 197-06 9 CF 5 feet OD; HM OS RP [L541P; A1038V] [L541P; A1038V] AR554 554-03 2 10/12 20/60 OU RP V2050L WT 554-04 1 9/12 N/A RP N/A N/A AR591 591-03 20 20/25 OU RP N/A N/A 591-04 8 20/20 OD; 20/25 OS;VF , 108 OU RP G1961E WT AR689 689-03 7 N/A RP R408X R602W 689-08 7 N/A RP N/A N/A OD, right eye; OS, left eye; OU, both eyes; VF, visual field; RP, retinitis pigementosa, WT, wild type; N/A, not available; CF, counting fingers; HM, hand motions. Login to comment
80 (C-L) Microphotographs of 2-week-old X. laevis tadpoles expressing R602W (C and D), [L541P; A1038V] (E and F), L541P (G and H), A1038V (I and J) and C1490Y (K and L). Login to comment
88 RP-associated mutants are misfolded and retained in the rod IS To investigate effects of the presumably severe arRP-associated R602W missense allele on ABCA4 localization, transgenic tadpoles were generated with the R602W construct. Login to comment
89 IF analysis of the retina demonstrated the retention of transgenic R602W in the IS (Fig. 2C and D). Login to comment
92 Functional studies of the arRP-associated complex allele [L541P; A1038V] also showed abnormal localization to rod IS although the IF studies revealed a different staining pattern than R602W, because the mutant protein forms fine aggregates in the IS (Fig. 2E and F). Login to comment
93 The aggregate formation suggests a mechanism distinct from that observed for R602W may be responsible for the retention of [L541P; A1038V] in the IS. Login to comment
101 Similar to the staining pattern found in R602W, the IS compartment was stained homogenously suggesting impaired folding. Login to comment
104 We employed this assay to examine the effects of [L541P; A1038V], R602W and C1490Y mutations on in vitro ATP hydrolysis. Login to comment
108 In addition, we observed a marked decrease in ATP hydrolytic activity compared with wild-type in both R602W (21.6%) and C1490Y (21.4%) alleles. Login to comment
113 Mutations: R602W, [L541P; A1038V] and C1490Y are frequently detected in patients with retinal diseases Mislocalization mutations R602W, [L541P; A1038V] and C1490Y have been reported as disease-associated mutations in patients with RP, CRD and STGD (18,20,32,33). Login to comment
119 WT and mutant constructs [L541P; A1038V], R602W and C1490Y ABCA4 were expressed in COS7 cells. Login to comment
136 Co-segregating compound heterozygous mutant alleles (R602W/R408X) and a homozygous complex allele [L541P; A1038V] were identified in two (AR689 and AR197) arRP families (Table 1). Login to comment
137 We hypothesized that the disease-associated missense mutations [L541P; A1038V], R602W and C1490Y could exert a possible effect on protein processing as this mechanism, which prevents altered proteins from locating to its physiologic compartment, was documented for other ABC transporters in related diseases including cystic fibrosis (CFTR) and Tangier disease (ABCA1). Login to comment
138 To examine this hypothesis, we generated transgenic X. laevis tadpoles expressing WT, [L541P; A1038V], R602W and C1490Y mutants and documented that the three mutant alleles cause mislocalization of ABCA4. Login to comment
146 Genotype-phenotype correlations among patients bearing one and two mislocalization-mutations Two mislocalization-alleles One mislocalization-allele RP STGD Allele 1 Allele 2 AO Allele 1 Allele 2 AO [L541P; A1038V] [L541P; A1038V] 7 [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 9 [L541P; A1038V] R1108H 13 [L541P; A1038V] G1961E 16 CRD [L541P; A1038V] G1961E 28 Allele 1 Allele 2 AO [L541P; A1038V] L2027F 13 [L541P; A1038V] [L541P; A1038V] 10 [L541P; A1038V] L2027F 12 [L541P; A1038V] C1490Y 12 [L541P; A1038V] P1380L 5 R602W R602W 7 [L541P; A1038V] T1019M 6 [L541P; A1038V] G1961E 7 STGD [L541P; A1038V] T1019M 6 Allele 1 Allele 2 AO R602W L2027F 9 [L541P; A1038V] [L541P; A1038V] 12 C1490Y G1961E 28 C1490Y C1490Y 7 C1490Y G1961E 13 C1490Y R602W 9 C1490Y L2027F 10 C1490Y R602W 10 C1490Y L2027F 18 C1490 L2027F 18 AO-age of onset (in years). Login to comment
150 The results of IF studies of rods expressing [L541P; A1038V], R602W and C1490Y mutants were quite distinct from those observed for WT and ABCA4 EGFP. Login to comment
179 Shown is a proposed topological model of ABCA4 with its membrane spanning domains and the mutations: L541P, R602W, A1038V and C1490 analyzed. Login to comment
199 To generate the retinal dystrophy associated ABCA4 alleles: [L541P; A1038V], L541P, A1038V, R602W and C1490Y ABCA4, the pXOP-ABCA4 plasmid was mutagenized with Quickchange PCR-based mutagenesis system (Biocrest, La Jolla, CA, USA). Login to comment
228 In particular, we searched for subjects with RP, CRD and STGD in whom two mislocalization-mutant alleles [L541P; A1038V], R602W and C1490Y] were detected. Login to comment

PMID: 15161829 [PubMed] September AV et al: "Mutation spectrum and founder chromosomes for the ABCA4 gene in South African patients with Stargardt disease."

No. Sentence Comment

7 The most common variants identified included the C1490Y, L2027F, R602W, V256splice, R152X, and 2588G3C mutations. Login to comment
15 There seems to be at least two different origins for the common C1490Y mutation, as well as two for the R602W mutation, thereby suggesting several founder effects for STGD in SA. Login to comment
71 List of 16 Different Potential Disease-Associated Sequence Variants Identified in 64 SA Subjects with arSTGD Nucleotide Change Amino Acid Change Families (N ‫؍‬ 64) Exon Reference C454T R152X 4 5 3,33 G455A R152Q 1 5 35 C634T R212C 1 6 16,27 G768T (Splice donor) V256splice 5 6 15 C1885T R602W 6 13 9 2588G3C G863A 4 17 8 T3047C V989A 1 20 11 T4319C F1440S 1 29 9 G4328A* R1443H 1 29 This study G4469A C1490Y 19 30 15,9 G5077A V16931 1 36 36 C6079T L2027F 8 44 8 C6088A R2030X 1 44 9,37 C6112T R2038W 2 44 5 IVS45ϩ7G3A Splice donor 1 45 26 6352⌬A* Frameshift 1 46 This study No individuals positive for the R1443H variant were identified in 47 control individuals of Indian ancestry. Login to comment
99 Likewise, two STGD-associated haplotypes for the R602W variant were identified in two unrelated families. Login to comment
119 The C1490Y sequence variant was the most common disease-associated variant identified in this study (19/64; 30%), followed by the L2027F (8/64; 13%), the R602W variant (6/64; 9%), the V256splice variant (5/64; 8%), and the 2588G3C and R152X sequence variants occurred at equal frequencies (4/64; 6%). Login to comment
121 Five (C1490Y, L2027F, R602W, V256splice and R152X) of the six common sequence variants identified were at a higher frequency in the SA STGD cohort than in populations from Europe and the United States. Login to comment
122 Of interest, the C1490Y, R602W, V256splice, and R152X variants were found to be some of the rarer ABCA4 mutations observed in populations of Europe. Login to comment
125 AO (y) Phenotype Mutation 1 Mutation 2 224.1 9 STGD C1490Y R602W 170.2 10 STGD C1490Y R602W 241.1 9 STGD C1490Y 25883C 448.1 20 STGD C1490Y 2588G3C 113.3 10 STGD C1490Y L2027F 209.1 18 STGD C1490Y L2027F 165.4 10 STGD C1490Y V256splice 166.3 27 STGD C1490Y R152X 151.4 5 STGD C1490Y ND 219.1 5 (rapid clinical progression was observed by 9 years) STGD C1490Y ND 223.1 9 STGD C1490Y ND 307.1 9 STGD C1490Y ND 319.3 9 STGD C1490Y ND 385.1 10 STGD C1490Y ND 226.1 10 STGD C1490Y ND 142.2 10 STGD C1490Y ND 273.1 11 STGD C1490Y ND 382.1 12 STGD C1490Y ND 449.1 14 STGD C1490Y ND 344.2 ND STGD C1490Y ND 374.1 10 STGD L2027F 6352⌬A† 305.1 18 STGD L2027F R2038W 377.1 25 STGD L2027F R2038W 276.1 27 STGD L2027F R212C 204.4 8 STGD L2027F ND 135.4 13 STGD L2027F ND 446.1 9 STGD R602W ND 109.3 11 STGD R602W ND 110.7 13 STGD R602W ND 438.3 12 STGD R602W ND 123.1 9 STGD V256splice R152X 105.1* 10 STGD AND atypical RP V256splice R152X 24 129.3* 10 (rapid clinical progression was observed) STGD V256splice ND 163.22 10 STGD V256splice ND 173.1 8 STGD 2588G3C ND 9.4 27 STGD 2588G3C R152X 330.2 29 STGD R152Q V989A 372.1 31 STGD R1443H† R2030X 141.3 11 STGD F1440S IVS45ϩ7G3A (splice site mutation) 206.3 ND STGD V1693I ND Rows are arranged according to the age of onset (AO) starting with the earliest AO for the most common sequence variant. Login to comment
137 The 10 ABCA4 Disease-Associated Haplotypes Identified in the 10 STGD Families Investigated Family D1S188 Marker ABCA4 MutationD1S406 D1S236 166 14 6 12 C1490Y 170 15 4 9 C1490Y 151 15 4 9 C1490Y 204 9 5 14 L2027F 135 9 5 14 L2027F 105 8 4 14 V256splice 129 8 4 14 V256splice 170 10 5 12 R602W 110 16 6 3 R602W 9 7 5 14 2588G3C 9 16 5 4 R152X 105 16 5 4 R152X 166 16 5 4 R152X 141 8 3 6 F1440S 141 9 5 14 IVS45ϩ7G3A The numbers in column 1 denote the identity number of the family. Login to comment
165 Likewise, two STGD-associated haplotypes for the R602W variant were identified in two unrelated families. Login to comment

PMID: 11328725 [PubMed] Webster AR et al: "An analysis of allelic variation in the ABCA4 gene."

No. Sentence Comment

102 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 2 106delT FS NS 0 0 1 Ͻ0.01 2 160 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 3 161G 3 A Cys54Tyr NS 0 0 6 Ͻ0.01 3 179C 3 T Ala60Val NS 0 0 2 Ͻ0.01 3 194G 3 A Gly65Glu NS 0 0 2 Ͻ0.01 3 223T 3 G Cys75Gly NS 0 0 2 Ͻ0.01 3 247delCAAA FS NS 0 0 2 Ͻ0.01 3 298C 3 T Ser100Pro NS 0 0 1 Ͻ0.01 5 454C 3 T Arg152Stop NS 0 0 2 Ͻ0.01 6 574G 3 A Ala192Thr NS 0 0 1 Ͻ0.01 6 618C 3 G Ser206Arg NS 0 0 3 Ͻ0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 Ͻ0.01 6 661delG FS NS 0 0 1 Ͻ0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 Ͻ0.01 6 746A 3 C Asp249Gly NS 0 0 1 Ͻ0.01 8 899C 3 A Thr300Asn NS 0 0 1 Ͻ0.01 8 997C 3 T Arg333Trp NS 0 0 1 Ͻ0.01 9 1140T 3 A Asn380Lys NS 0 0 1 Ͻ0.01 9 1222C 3 T Arg408Stop NS 0 0 1 Ͻ0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 Ͻ0.01 10 1344delG FS NS 0 0 1 Ͻ0.01 11 1411G 3 A Glu471Lys NS 0 0 3 Ͻ0.01 11 1513delATCAC FS NS 0 0 1 Ͻ0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 Ͻ0.01 13 1805G 3 A Arg602Gln NS 0 0 1 Ͻ0.01 13 1819G 3 T Gly607Trp NS 0 0 1 Ͻ0.01 13 1823T 3 A Phe608Ile NS 0 0 1 Ͻ0.01 13 1927G 3 A Val643Met NS 0 0 1 Ͻ0.01 14 1989G 3 T Trp663Stop NS 0 0 1 Ͻ0.01 14 2005delAT FS NS 0 0 3 Ͻ0.01 14 2041C 3 T Arg681Stop NS 0 0 2 Ͻ0.01 14 2147C 3 T Thr716Met NS 0 0 1 Ͻ0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 Ͻ0.01 15 2294G 3 A Ser765Asn NS 0 0 1 Ͻ0.01 15 2300T 3 A Val767Asp NS 0 0 2 Ͻ0.01 16 2385del16bp FS NS 0 0 1 Ͻ0.01 16 2453G 3 A Gly818Glu NS 0 0 1 Ͻ0.01 16 2461T 3 A Trp821Arg NS 0 0 1 Ͻ0.01 16 2546T 3 C Val849Ala NS 0 0 4 Ͻ0.01 16 2552G 3 A Gly851Asp NS 0 0 1 Ͻ0.01 16 2560G 3 A Ala854Thr NS 0 0 1 Ͻ0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 Ͻ0.01 18 2690C 3 T Thr897Ile NS 0 0 1 Ͻ0.01 18 2701A 3 G Thr901Ala NS 0 1 0 Ͻ0.01 18 2703A 3 G Thr901Arg NS 0 0 2 Ͻ0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 Ͻ0.01 20 2894A 3 G Asn965Ser NS 0 0 3 Ͻ0.01 19 2912C 3 A Thr971Asn NS 0 0 1 Ͻ0.01 19 2915C 3 A Thr972Asn NS 0 0 1 Ͻ0.01 20 2920T 3 C Ser974Pro NS 0 0 1 Ͻ0.01 20 2966T 3 C Val989Ala NS 0 0 2 Ͻ0.01 20 2977del8bp FS NS 0 0 1 Ͻ0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 Ͻ0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 Ͻ0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 Ͻ0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 Ͻ0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 Ͻ0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 Ͻ0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 Ͻ0.01 22 3323G 3 A Arg1108His NS 0 0 1 Ͻ0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 Ͻ0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n ‫؍‬ 182) Control (n ‫؍‬ 96) STGD (n ‫؍‬ 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 Ͻ0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 Ͻ0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 Ͻ0.01 26 3835delGATTCT FS NS 0 0 1 Ͻ0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 Ͻ0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 Ͻ0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 Ͻ0.01 28 4234C 3 T Gln1412stop NS 0 0 1 Ͻ0.01 29 4297G 3 A Val1433Ile NS 1 0 0 Ͻ0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 Ͻ0.01 30 4353 - 1g 3 t Splice site NS 0 0 1 Ͻ0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 Ͻ0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 Ͻ0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 Ͻ0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 Ͻ0.01 30 4531insC FS NS 0 0 2 Ͻ0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 Ͻ0.01 30 4539 ϩ 1g 3 t Splice site NS 0 0 1 Ͻ0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 Ͻ0.01 33 4733delGTTT FS NS 0 0 1 Ͻ0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 Ͻ0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 Ͻ0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 Ͻ0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 Ͻ0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 Ͻ0.01 36 5077G 3 A Val1693Ile NS 0 0 1 Ͻ0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 Ͻ0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 Ͻ0.01 36 5212del11bp FS NS 0 0 1 Ͻ0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 Ͻ0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 Ͻ0.01 37 5288delG FS NS 0 0 1 Ͻ0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 Ͻ0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 Ͻ0.01 39 5584 ϩ 5g 3 a Splice site 0.02 Yes 0 0 6 Ͻ0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 Ͻ0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 Ͻ0.01 40 5687T 3 A Val1896Asp NS 0 0 1 Ͻ0.01 40 5693G 3 A Arg1898His NS 0 0 1 Ͻ0.01 40 5714 ϩ 5g 3 a Splice site NS 0 0 1 Ͻ0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu Ͻ0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 Ͻ0.01 43 5917delG FS NS 0 0 1 Ͻ0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 Ͻ0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 Ͻ0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 Ͻ0.01 45 6148A 3 C Val2050Leu NS 1 0 0 Ͻ0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 Ͻ0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 Ͻ0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 Ͻ0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 Ͻ0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 Ͻ0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 Ͻ0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 Ͻ0.01 48 6707delTCACACAG FS NS 0 0 1 Ͻ0.01 48 6729 ϩ 1g 3 a Splice site NS 0 0 1 Ͻ0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 Ͻ0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment
103 Thirty-Three Truncated and 98 Amino Acid-Changing Variants in the ABCA4 Gene Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 2 106delT FS NS 0 0 1 b0d;0.01 2 160 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 3 161G 3 A Cys54Tyr NS 0 0 6 b0d;0.01 3 179C 3 T Ala60Val NS 0 0 2 b0d;0.01 3 194G 3 A Gly65Glu NS 0 0 2 b0d;0.01 3 223T 3 G Cys75Gly NS 0 0 2 b0d;0.01 3 247delCAAA FS NS 0 0 2 b0d;0.01 3 298C 3 T Ser100Pro NS 0 0 1 b0d;0.01 5 454C 3 T Arg152Stop NS 0 0 2 b0d;0.01 6 574G 3 A Ala192Thr NS 0 0 1 b0d;0.01 6 618C 3 G Ser206Arg NS 0 0 3 b0d;0.01 6 634C 3 T Arg212Cys 0.02 Yes 0 0 7 0.01 6 635G 3 A Arg212His NS 2 2 6 0.01 6 658C 3 T Arg220Cys NS 0 0 2 b0d;0.01 6 661delG FS NS 0 0 1 b0d;0.01 666delAAAGACGGTGC 6 GC FS NS 0 0 1 b0d;0.01 6 746A 3 C Asp249Gly NS 0 0 1 b0d;0.01 8 899C 3 A Thr300Asn NS 0 0 1 b0d;0.01 8 997C 3 T Arg333Trp NS 0 0 1 b0d;0.01 9 1140T 3 A Asn380Lys NS 0 0 1 b0d;0.01 9 1222C 3 T Arg408Stop NS 0 0 1 b0d;0.01 10 1268A 3 G His423Arg NS 1 0 7 0.01 10 1335C 3 G Ser445Arg NS 0 0 1 b0d;0.01 10 1344delG FS NS 0 0 1 b0d;0.01 11 1411G 3 A Glu471Lys NS 0 0 3 b0d;0.01 11 1513delATCAC FS NS 0 0 1 b0d;0.01 12 1622T 3 C Leu541Pro 0.001 Yes 0 0 11 0.01 13 1804C 3 T Arg602Trp NS 0 0 3 b0d;0.01 13 1805G 3 A Arg602Gln NS 0 0 1 b0d;0.01 13 1819G 3 T Gly607Trp NS 0 0 1 b0d;0.01 13 1823T 3 A Phe608Ile NS 0 0 1 b0d;0.01 13 1927G 3 A Val643Met NS 0 0 1 b0d;0.01 14 1989G 3 T Trp663Stop NS 0 0 1 b0d;0.01 14 2005delAT FS NS 0 0 3 b0d;0.01 14 2041C 3 T Arg681Stop NS 0 0 2 b0d;0.01 14 2147C 3 T Thr716Met NS 0 0 1 b0d;0.01 15 2291G 3 A Cys764Tyr NS 0 0 1 b0d;0.01 15 2294G 3 A Ser765Asn NS 0 0 1 b0d;0.01 15 2300T 3 A Val767Asp NS 0 0 2 b0d;0.01 16 2385del16bp FS NS 0 0 1 b0d;0.01 16 2453G 3 A Gly818Glu NS 0 0 1 b0d;0.01 16 2461T 3 A Trp821Arg NS 0 0 1 b0d;0.01 16 2546T 3 C Val849Ala NS 0 0 4 b0d;0.01 16 2552G 3 A Gly851Asp NS 0 0 1 b0d;0.01 16 2560G 3 A Ala854Thr NS 0 0 1 b0d;0.01 17 2588G 3 C Gly863Ala 0.0006 No 2 2 28 0.02 17 2617T 3 C Phe873Leu NS 0 0 1 b0d;0.01 18 2690C 3 T Thr897Ile NS 0 0 1 b0d;0.01 18 2701A 3 G Thr901Ala NS 0 1 0 b0d;0.01 18 2703A 3 G Thr901Arg NS 0 0 2 b0d;0.01 19 2828G 3 A Arg943Gln NS 20 13 37 0.05 19 2883delC FS NS 0 0 1 b0d;0.01 20 2894A 3 G Asn965Ser NS 0 0 3 b0d;0.01 19 2912C 3 A Thr971Asn NS 0 0 1 b0d;0.01 19 2915C 3 A Thr972Asn NS 0 0 1 b0d;0.01 20 2920T 3 C Ser974Pro NS 0 0 1 b0d;0.01 20 2966T 3 C Val989Ala NS 0 0 2 b0d;0.01 20 2977del8bp FS NS 0 0 1 b0d;0.01 20 3041T 3 G Leu1014Arg NS 0 0 1 b0d;0.01 21 3055A 3 G Thr1019Ala NS 0 0 1 b0d;0.01 21 3064G 3 A Glu1022Lys NS 0 0 1 b0d;0.01 21 3091A 3 G Lys1031Glu NS 0 0 1 b0d;0.01 21 3113G 3 T Ala1038Val 0.001 Yes 1 0 17 0.01 22 3205insAA FS NS 0 0 1 b0d;0.01 22 3261G 3 A Glu1087Lys NS 0 0 2 b0d;0.01 22 3322C 3 T Arg1108Cys 0.04 Yes 0 0 6 b0d;0.01 22 3323G 3 A Arg1108His NS 0 0 1 b0d;0.01 23 3364G 3 A Glu1122Lys NS 0 0 1 b0d;0.01 (continues) Exon Nucleotide Change Effect (A) (B) AMD (n d1d; 182) Control (n d1d; 96) STGD (n d1d; 374) Allele Prevalence 23 3386G 3 T Arg1129Leu NS 0 0 3 b0d;0.01 24 3531C 3 A Cys1158Stop NS 0 0 1 b0d;0.01 25 3749T 3 C Leu1250Pro NS 0 0 1 b0d;0.01 26 3835delGATTCT FS NS 0 0 1 b0d;0.01 27 3940C 3 A Pro1314Thr NS 0 1 0 b0d;0.01 28 4139C 3 T Pro1380Leu 0.001 Yes 0 0 10 0.01 28 4222T 3 C Trp1408Arg NS 0 0 2 b0d;0.01 28 4223G 3 T Trp1408Leu NS 0 0 2 b0d;0.01 28 4234C 3 T Gln1412stop NS 0 0 1 b0d;0.01 29 4297G 3 A Val1433Ile NS 1 0 0 b0d;0.01 29 4319T 3 C Phe1440Ser NS 0 0 1 b0d;0.01 30 4353 afa; 1g 3 t Splice site NS 0 0 1 b0d;0.01 30 4457C 3 T Pro1486Leu NS 0 0 1 b0d;0.01 30 4462T 3 C Cys1488Arg NS 0 0 3 b0d;0.01 30 4463G 3 T Cys1488Phe NS 0 0 2 b0d;0.01 30 4469G 3 A Cys1490Tyr NS 0 0 3 b0d;0.01 30 4531insC FS NS 0 0 2 b0d;0.01 32 4538A 3 G Gln1513Arg NS 0 0 1 b0d;0.01 30 4539 af9; 1g 3 t Splice site NS 0 0 1 b0d;0.01 31 4574T 3 C Leu1525Pro NS 0 0 1 b0d;0.01 33 4733delGTTT FS NS 0 0 1 b0d;0.01 4859delATAACAinsTCC 35 T FS NS 0 0 1 b0d;0.01 36 4909G 3 A Ala1637Thr NS 0 0 1 b0d;0.01 35 4918C 3 T Arg1640Trp NS 0 0 1 b0d;0.01 35 4919G 3 A Arg1640Gln NS 0 0 1 b0d;0.01 35 4954T 3 G Tyr1652Asp NS 0 0 1 b0d;0.01 36 5077G 3 A Val1693Ile NS 0 0 1 b0d;0.01 36 5186T 3 C Leu1729Pro NS 0 0 2 b0d;0.01 36 5206T 3 C Ser1736Pro NS 0 0 1 b0d;0.01 36 5212del11bp FS NS 0 0 1 b0d;0.01 37 5225delTGGTGGTGGGC FS NS 0 0 1 b0d;0.01 del LPA 37 5278del9bp 1760 NS 0 0 1 b0d;0.01 37 5288delG FS NS 0 0 1 b0d;0.01 38 5395A 3 G Asn1799Asp NS 0 0 1 b0d;0.01 38 5451T 3 G Asp1817Glu NS 1 0 4 b0d;0.01 39 5584 af9; 5g 3 a Splice site 0.02 Yes 0 0 6 b0d;0.01 40 5603A 3 T Asn1868Ile 0.0006 No 20 7 79 0.08 40 5651T 3 A Val1884GLu NS 0 0 1 b0d;0.01 40 5657G 3 A Gly1886Glu NS 0 0 1 b0d;0.01 40 5687T 3 A Val1896Asp NS 0 0 1 b0d;0.01 40 5693G 3 A Arg1898His NS 0 0 1 b0d;0.01 40 5714 af9; 5g 3 a Splice site NS 0 0 1 b0d;0.01 42 5843CA 3 TG Pro1948Leu NS 11 7 28 0.04 42 5882G 3 A Gly1961Glu b0d;0.0001 Yes 1 0 43 0.03 43 5908C 3 T Leu1970Phe NS 1 0 1 b0d;0.01 43 5917delG FS NS 0 0 1 b0d;0.01 44 6079C 3 T Leu2027Phe 0.01 Yes 0 0 9 0.01 44 6088C 3 T Arg2030Stop NS 0 0 2 b0d;0.01 44 6089G 3 A Arg2030Gln NS 0 0 1 b0d;0.01 44 6112A 3 T Arg2038Trp NS 0 0 1 b0d;0.01 45 6148A 3 C Val2050Leu NS 1 0 0 b0d;0.01 46 6212A 3 T Tyr2071Phe NS 0 0 1 b0d;0.01 45 6229C 3 T Arg2077Trp NS 0 0 2 b0d;0.01 46 6320G 3 A Arg2107His 0.01 Yes 0 0 10 0.01 46 6383A 3 G His2128Arg NS 0 0 1 b0d;0.01 47 6446G 3 T Arg2149Leu NS 0 0 1 b0d;0.01 47 6449G 3 A Cys2150Tyr NS 0 0 5 b0d;0.01 48 6529G 3 A Asp2177Asn NS 2 0 0 b0d;0.01 48 6686T 3 C Leu2229Pro NS 0 0 1 b0d;0.01 48 6707delTCACACAG FS NS 0 0 1 b0d;0.01 48 6729 af9; 1g 3 a Splice site NS 0 0 1 b0d;0.01 49 6764G 3 T Ser2255Ile 0.009 No 16 4 54 0.06 49 6788G 3 T Arg2263Leu NS 0 0 1 b0d;0.01 (A) The probability under the null hypothesis of similar prevalence of each variant in Stargardt (STGD) compared with non-STGD alleles (two-tailed Fisher`s exact test); (B) compatability of the variant existing in a ratio of 100:1 in STGD to control alleles, calculated using the binomial distribution. Login to comment

PMID: 10634594 [PubMed] Papaioannou M et al: "An analysis of ABCR mutations in British patients with recessive retinal dystrophies."

No. Sentence Comment

45 Neither of these putative TABLE 1. List of Mutations Found in 70 Patients of British Origin Nucleotide Change Amino Acid Change No. of Patients (/70) Phenotype No. of Controls (/96) G161A Cys-54-Tyr 1 STG/FFM NF A286G Asn-96-Asp 1 STG/FFM NF A286C Asn-96-His 1 STG/FFM NF A466G Ile-156-Val 1 STG/FFM NF C1220T Ala-407-Val 6 STG/FFM, arCRD NF T1271C Val-424-Ala 2 STG/FFM, arRP NF C1335G Ser-445-Arg 1 STG/FFM NF C1804T Arg-602-Trp 1 STG/FFM NF C2337A Cys-779-Ter 1 STG/FFM NF *G2588C Gly-863-Ala 5 STG/FFM 2/176 3392delC 1147 Ter 1 STG/FFM NF T4286C Val-1429-Ala 1 STG/FFM NF 4774-2A3C Splice acceptor 2 STG/FFM NF †C4918T Arg-1640-Trp 1 STG/FFM NF C5107G Gln-1703-Lys 1 STG/FFM NF 5161delAC Frameshift 1 STG/FFM NF C5337G Tyr-1779-Ter 1 STG/FFM NF C6088T Arg-2030-Ter 1 arCRD NF 6282ϩ7G3A Splice donor 1 STG/FFM NF G6449A Cys-2150-Tyr 2 arCRD NF A6479G Lys-2160-Arg 1 STG/FFM NF * Independently reported by Allikmets et al.6 † Independently reported by Rozet et al.8 NF, not found in 96 ethnically matched control individuals. Login to comment

PMID: 9973280 [PubMed] Lewis RA et al: "Genotype/Phenotype analysis of a photoreceptor-specific ATP-binding cassette transporter gene, ABCR, in Stargardt disease."

No. Sentence Comment

76 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196ϩ1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196ϩ2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585-1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714ϩ5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898ϩ1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005ϩ1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253ϩ5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160ϩ1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539ϩ1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS ϭ frameshift. Login to comment
178 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET ‫ע‬ SD (YEARS)Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 ‫ע‬ 12.7 51961GrA AR307 10 A1038V AR290 16 5714ϩ5GrA AR314 25 5898ϩ1GrT AR336 39 A1038V R572P AR321 6 12.5 ‫ע‬ 6.9 S1071L AR358 6 L1970F AR428 6 5196ϩ2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 ‫ע‬ 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 ‫ע‬ 4.5 C75G AR427 12 C1490Y AR370 13 2160ϩ1GrC AR218 14 4253ϩ5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 ‫ע‬ 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade. Login to comment
77 2 0071GrA R24H 1 19 2894ArG N965S 3 36 5196af9;1GrA Splice 2 3 0161GrA C54Y 1 21 3113CrT A1038V 16 5196af9;2TrC Splice 1 0179CrT A60V 1 22 3211insGT FS 1 37 5281del9 PAL1761del 1 0203CrG P68R 1 3212CrT S1071L 1 38 5459GrC R1820P 1 0223TrG C75G 1 3215TrC V1072A 1 39 5512CrT H1838Y 1 6 0634CrT R212C 1 3259GrA E1087K 1 5527CrT R1843W 1 0664del13 FS 1 3322CrT R1108C 6 40 5585afa;1GrA Splice 1 0746ArG D249G 1 23 3364GrA E1122K 1 5657GrA G1886E 1 8 1007CrG S336C 1 3385GrT R1129C 1 5693GrA R1898H 4 1018TrG Y340D 1 3386GrT R1129L 2 5714af9;5GrA Splice 8 11 1411GrA E471K 1 24 3602TrG L1201R 1 42 5882GrA G1961E 16 12 1569TrG D523E 1 25 3610GrA D1204N 1 5898af9;1GrT Splice 3 1622TrC L541P 1 28 4139CrT P1380L 4 43 5908CrT L1970F 1 1715GrA R572Q 2 4216CrT H1406Y 1 5929GrA G1977S 1 1715GrC R572P 1 4222TrC W1408R 4 6005af9;1GrT Splice 1 13 1804CrT R602W 1 4232insTATG FS 1 44 6079CrT L2027F 11 1822TrA F608I 2 4253af9;5GrT Splice 1 6088CrT R2030X 1 1917CrA Y639X 1 29 4297GrA V1433I 1 6089GrA R2030Q 1 1933GrA D645N 1 4316GrA G1439D 2 6112CrT R2038W 1 14 2005delAT FS 1 4319TrC F1440S 1 45 6148GrC V2050L 2 2090GrA W697X 1 4346GrA W1449X 1 6166ArT K2056X 1 2160af9;1GrC Splice 1 30a 4462TrC C1488R 2 6229CrT R2077W 1 16 2453GrA G818E 1 4457CrT P1486L 1 46 6286GrA E2096K 1 2461TrA W821R 1 30b 4469GrA C1490Y 3 6316CrT R2106C 1 2536GrC D846H 1 4539af9;1GrT Splice 1 47 6391GrA E2131K 1 2552GrC G851D 1 31 4577CrT T1526M 7 6415CrT R2139W 1 17 2588GrC G863A 11 4594GrA D1532N 3 6445CrT R2149X 1 19 2791GrA V931M 2 35 4947delC FS 1 48 6543del36 1181del12 1 2827CrT R943W 1 36 5041del15 VVAIC1681del 2 6709insG FS 1 2884delC FS 1 5087GrA S1696N 1 NOTE.-FS afd; frameshift. Login to comment
179 Table 2 ABCR Allelic Series MUTATION(S) PEDIGREE AGE AT ONSET (YEARS) MEAN AGE AT ONSET cf2; SD (YEARS) Allele 1 Allele 2 G863A Y340D, R772Q AR31 8 19.6 cf2; 12.7 51961GrA AR307 10 A1038V AR290 16 5714af9;5GrA AR314 25 5898af9;1GrT AR336 39 A1038V R572P AR321 6 12.5 cf2; 6.9 S1071L AR358 6 L1970F AR428 6 5196af9;2TrC AR71 7 G1961E AR417 8 L2027F AR181 9 R1898H AR78 14 G863A AR290 16 G1961E AR274 20 R1108C AR393 20 R1108C AR376 25 P1380L W1408R AR341 6 8.2 cf2; 1.5 E1122K AR534 8 2005delAT AR357 8 D1532N AR423 9 W821R AR534 10 G1961E A1038V AR417 8 14.3 cf2; 4.5 C75G AR427 12 C1490Y AR370 13 2160af9;1GrC AR218 14 4253af9;5GrT AR373 19 A1038V AR274 20 L2027F R602W AR88 9 13.0 cf2; 5.5 A1038V AR181 9 R2149X AR263 9 T1526M AR326 19 T1526M AR391 19 (70%) had onset in the first 2 decades of life, but 11 (16%) had onset in the 3d decade and 6 (9%) in the 4th decade. Login to comment

PMID: 21510770 [PubMed] Burke TR et al: "Allelic and phenotypic heterogeneity in ABCA4 mutations."

No. Sentence Comment

7 The most common, L541P/A1038V, has been reported as a founder mutation in Hungaro-German populations.14,16,17 Furthermore "ethnic group-specific" ABCA4 alleles have been described in other populations also, C1490Y and R602W in South African patients,18 and N965S in a Danish population19 among others.20 In an attempt to explain the variability seen in ABCA4 retinal phenotypes and to correlate this with individual mutation effect, a model was proposed which correlated disease severity with residual ABCA4 function.14,21 Maugeri classified ABCA4 mutant alleles as "mild", "moderate", and "severe" based on the predicted effect of the mutation on the transport function of the protein, ie, the more severe the effect of the mutation on ABCA4 function, the more aggressive the disease phenotype. Login to comment

PMID: 23419329 [PubMed] Chacon-Camacho OF et al: "ABCA4 mutational spectrum in Mexican patients with Stargardt disease: Identification of 12 novel mutations and evidence of a founder effect for the common p.A1773V mutation."

No. Sentence Comment

100 Allele 1 Allele 2 Genotype Exon Nucleotide change Polypeptide change Exon Nucleotide change Polypeptide change Familial case # 1 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous 2 e NI e e NI e e 3 6 c.634C>T p.R212C (D) 38 c.5318C>T p.A1773V (D) Compound heterozygous 4 23 c.3386G>T p.R1129L (D) 28 c.4139C>T p.P1380L (D) Compound heterozygous 5 e NI e e NI e e 6 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous 7 e NI e e NI e e 8 16 c.2453G>A p.G818E (D) 28 c.4249_4251 delTTC p.F1417del (D; N) Compound heterozygous 9 38 c.5318C>T p.A1773V (D) 38 c.5318C>T p.A1773V (D) Homozygous Sporadic case # 1 8 c.868C>T p.R290W (D) e IVS8&#fe;1G>A Splicing (D; N) Compound heterozygous 2 38 c.5318C>T p.A1773V (D) - NI - Heterozygous 3 20 c.3041T>G p.L1014R (D) 1; 49 c.52C>T; c.6764G>T p.R18W (D); p.S2255I (B) Compound heterozygous 4 13; 19 c.1804C>T; c.2828G>A p.R602W (D); p.R943Q (U) 16 c.2453G>A p.G818E (D) Compound heterozygous 5 38 c.5324T>A p. I1775N (D; N) 38 c.5324T>A p.I1775N (D; N) Homozygous 6 e NI e e NI e e 7 49 c.6764G>T p.S2255I (B) 49 c.6764 G>T p.S2255I (B) Homozygous 8 19; 40 c.2828 G>A; c.5503A>T p.R943Q (U); p.N1868I (U) 3 c.265G>T p.E89* (D; N) Compound heterozygous 9 38 c.5335T>C p.Y1779H (D;N) 38 c.5335T>C p.Y1779H (D;N) Homozygous 10 16 c.2453G>A p.G818E (D) 16 c.2453G>A p.G818E (D) Homozygous 11 6 c.723A>T p.E241D (D;N) 36 c.5114G>A p.R1705Q (D) Compound heterozygous 12 2 c.71G>A (D) p.R24H e NI e Heterozygous 13 30 c.4537_4538insC p.Q1513Pfs*41 (D; N) e NI e Heterozygous 14 32 c.4667G>C p.R1556T (D; N) 32 c.4667G>C p.R1556T (D; N) Homozygous 15 45 c.6221G>T p.G2074V (D; N) 16 c.2453G>A p.G818E (D) Compound heterozygous 16 16; 41 c.2453G>A; c.5824G>C p. G818E (D); p. E1942Q (B;N) 46 c.6384A>G p.H2128R (D) Compound heterozygous 17 16 c.2453G>A p. G818E (D) e NI e Heterozygous 18 32 c.4653G>A p. W1551* (D; N) e NI e Heterozygous 19 23 c.3386G>T p. R1129L (D) e NI e Heterozygous 20 36 c.5045_5059del GTTGCCATCTGCGTG p.V1682_ V1686del (D; N) 29; 49 c.4328G>A; c.6764G>T p.R1443H (D); p.S2255I (B) Compound heterozygous 21 19 c.2894A>G p.N965S (D) 19 c.2894A>G p.N965S (D) Homozygous 22 e NI e e NI e e STGD accounts for approximately 7% of all retinal dystrophies; it is one of the most common genetic forms of juvenile or early adult onset macular degeneration. Login to comment
119 ABCA4 Exon # Nucleotide change Predicted protein effect Number of alleles Population genotypic frequency in EVS Population allelic frequency in EVS (%) 1 c.52C>T p.R18W 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 2 c.71G>A p.R24H 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 3 c.265G>T p.E89* (N) 1 NR NR 6 c.634C>T p.R212C 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 6 c.723A>T p.E241D (N) 1 NR NR 8 c.868C>T p.R290W 1 NR NR IVS8 IVS8 &#fe; 1G>A Splicing mutation (N) 1 NR NR 13 c.1804C>T p.R602W 1 NR NR 16 c.2453G>A p.G818E 7 NR NR 19 c.2828G>A p.R943Q 2 AA &#bc; 8/AG &#bc; 400/GG &#bc; 6095 A &#bc; 3.199/G &#bc; 96.801 19 c.2894A>G p.N965S 2 GG &#bc; 0/GA &#bc; 1/AA &#bc; 6502 G &#bc; 0.008/A &#bc; 99.992 20 c.3041T>G p.L1014R 1 NR NR 23 c.3386G>T p.R1129L 2 NR NR 28 c.4139C>T p.P1380L 1 TT &#bc; 0/TC &#bc; 2/CC &#bc; 6501 T &#bc; 0.015/C &#bc; 99.985 28 c.4249_4251del TTC p.F1417del (N) 1 NR NR 29 c.4328G>A p.R1443H 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 30 c.4537_4538insC p.Q1513Pfs*41 (N) 1 NR NR 32 c.4653G>A p.W1551* (N) 1 NR NR 32 c.4667G>C p.R1556T (N) 2 NR NR 36 c.5044_5058del GTTGCCATCTGCGTG p.V1682_V1686del (N) 1 NR NR 36 c.5114G>A p.R1705Q 1 AA &#bc; 0/AG &#bc; 1/GG &#bc; 6502 A &#bc; 0.008/G &#bc; 99.992 38 c.5318C>T p.A1773V 8 NR NR 38 c.5324T>A p.I1775N (N) 2 NR NR 38 c.5335T>C p.Y1779H (N) 2 NR NR 40 c.5503A>T p.N1868I 1 TT &#bc; 16/TA &#bc; 589/AA &#bc; 5898 T &#bc; 4.775/A &#bc; 95.225 41 c.5824G>C p.E1942Q (N) 1 NR NR 45 c.6221G>T p.G2074V (N) 1 NR NR 46 c.6384A>G p.H2128R 1 NR NR 49 c.6764G>T p.S2255I 4 TT &#bc; 516/TG &#bc; 1473/GG &#bc; 4514 T &#bc; 19.26/G &#bc; 80.74 gold standard for ABCA4 mutational screening. Login to comment
126 Interestingly, five out of 46 mutant alleles (11%) were complex alleles (p.R18W &#fe; p.S2255I; p.R602W &#fe; p.R943W; p.R943W &#fe; p.N1868I; p.G818E &#fe; p.E1942Q; and p.R1443H &#fe; p.S2255I), a frequency that is in agreement with previous reports (Lewis et al., 1999; Shroyer et al., 2001; Zernant et al., 2011). Login to comment

PMID: 23695285 [PubMed] Heathfield L et al: "Stargardt disease: towards developing a model to predict phenotype."

No. Sentence Comment

13 This study considers a South African cohort of 118 individuals who express biallelic combinations of seven founder mutations in ABCA4 (c.454C4T (p.Arg152*), c.768G4T (p.Val256Val), c.1804C4T (p.Arg602Trp), c.2588G4C (p.Gly863Ala), c.4469G4A (p.Cys1490Tyr), c.5461-10T4C, c.6079C4T (p.Leu2027Phe)), which collectively account for 36% of STGD cases studied to date in South Africa.19,20 These data, together with clinical information for each patient, were used to test the genotype-phenotype model. Login to comment
30 To illustrate the utility of this model, consider the population of individuals expressing the mutation pair c.4469G4A (p.Cys1490Tyr) and c.1804C4T (p.Arg602Trp). Login to comment
31 The average AOO for this group of individuals is predicted as (0.0460 &#fe; 0.0528&#fe; 0.04680.0295)1 &#bc; 8.61 years, where 0.0460 is the intercept term, 0.0528 is the regression coefficient for c.4469G4A (p.Cys1490Tyr), 0.0468 is the regression coefficient for c.1804C4T (p.Arg602Trp) and 0.0295 is the regression coefficient for c.4469G4A (p.Cys1490Tyr): c.1804C4T (p.Arg602Trp). Login to comment
33 Table 1 A summary of the 23 mutation combinations observed in 118 patients with STGD, showing the number of patients per combination and the average and median AOO (in years) per combination Mutation 1 Mutation 2 Number of patients Average AOO (years) Median AOO (years) c.5461-10T4C c.768G4T (p.Val256Val) 1 6 6 c.5461-10T4C c.5461-10T4C 2 6.5 6.5 c.1804C4T (p.Arg602Trp) c.768G4T (p.Val256Val) 3 6.7 6 c.5461-10T4C c.454C4T (p.Arg152*) 3 7 8 c.4469G4A (p.Cys1490Tyr) c.454C4T (p.Arg152*) 6 7.8 8 c.768G4T (p.Val256Val) c.454C4T (p.Arg152*) 4 8 9 c.768G4T (p.Val256Val) c.768G4T (p.Val256Val) 1 8 8 c.4469G4A (p.Cys1490Tyr) c.4469G4A (p.Cys1490Tyr) 9 8.1 8 c.6079C4T (p.Leu2027Phe) c.454 C4T (p.Arg152*) 7 8.2 7 c.4469G4A (p.Cys1490Tyr) c.1804C4T (p.Arg602Trp) 13 8.6 8 c.4469G4A (p.Cys1490Tyr) c.5461-10T4C 13 8.8 9 c.4469G4A (p.Cys1490Tyr) c.768G4T (p.Val256Val) 10 10.3 9 c.4469G4A (p.Cys1490Tyr) c.6079C4T (p.Leu2027Phe) 12 10.3 9.5 c.6079C4T (p.Leu2027Phe) c.5461-10T4C 3 11 10 c.1804C4T (p.Arg602Trp) c.5461-10T4C 1 11 11 (c.1804C4T (p.Arg602Trp) c.6079C4T (p.Leu2027Phe) 8 12 11 c.6079C4T (p.Leu2027Phe) c.768G4T (p.Val256Val) 6 12.5 13 c.768G4T (p.Val256Val) c.2588G4C (p.Gly863Ala) 3 16.7 18 c.1804C4T (p.Arg602Trp) c.2588G4C (p.Gly863Ala) 2 17.5 17.5 c.4469G4A (p.Cys1490Tyr) c.2588G4C (p.Gly863Ala) 4 18.5 19 c.5461-10T4C c.2588G4C (p.Gly863Ala) 1 20 20 c.6079C4T (p.Leu2027Phe) c.6079C4T (p.Leu2027Phe) 2 28 28 c.2588G4C (p.Gly863Ala) c.454C4T (p.Arg152*) 4 28 30 In some cases, the average AOO of a given mutation differed significantly depending on the mutational context in which it occurred. Login to comment
45 Table 2 Covariates included in the generalised linear model (with inverse link function) with their respective coefficients, standard errors and P-values Covariate Coefficient Standard error P-value (Intercept) 0.0460 0.0106 3.53e 05 c.4469G4A (p.Cys1490Tyr) 0.0528 0.0076 2.71e 10 c.1804C4T (p.Arg602Trp) 0.0468 0.0085 2.33e 07 c.6079C4T (p.Leu2027Phe) 0.0090 0.0089 0.3117 c.5461-10T4C 0.0562 0.0106 6.59e 07 c.768G4T (p.Val256Val) 0.0507 0.0083 2.06e 08 c.2588G4C (p.Gly863Ala) 0.0413 0.0081 1.58e 06 c.454C4T (p.Arg152*) 0.0311 0.0080 0.0002 c.4469G4A (p.Cys1490Tyr) (homozygous) 0.0336 0.0144 0.0214 c.4469G4A (p.Cys1490Tyr): c.5461-10T4C 0.0419 0.0146 0.0049 c.4469G4A (p.Cys1490Tyr): c.1804C4T (p.Arg602Trp) 0.0295 0.0145 0.0442 c.4469G4A (p.Cys1490Tyr): c.768G4T (p.Val256Val) 0.0520 0.0134 0.0002 c.6079C4T (p.Leu2027Phe): c.454C4T (p.Arg152*) 0.0519 0.0158 0.0013 Figure 1 Graph depicting the actual and predicted average AOO with 95% confidence bands for each mutation combination observed in five or more patients. Login to comment
50 For example, consider again the population of individuals expressing the mutation combination c.4469G4A (p.Cys1490Tyr) and c.1804C4T (p.Arg602Trp). Login to comment
52 However, if the regression coefficient for c.4469G4A (p.Cys1490Tyr):c.1804C4T (p.Arg602Trp) ( 0.0295) was not included, ie, (0.0460 &#fe; 0.0528 &#fe; 0.0468)1 &#bc; 6.868, the predicted average AOO would be an underestimation of the true value. Login to comment
53 The mutation combinations not detected in the cohort were c.454C4T (p.Arg152*) (homozygous), c.1804C4T (p.Arg602Trp) (homozygous), c.2588G4C (p.Gly863Ala) (homozygous), c.454C4T (p.Arg152*):c.1804C4T (p.Arg602Trp) and c.2588G4C (p.Gly863Ala): c.6079C4T (p.Leu2027Phe). Login to comment

PMID: 23755871 [PubMed] Riveiro-Alvarez R et al: "Outcome of ABCA4 disease-associated alleles in autosomal recessive retinal dystrophies: retrospective analysis in 420 Spanish families."

No. Sentence Comment

88 Based on our data, the likely severe ABCA4 missense mutations, resulting in an early disease onset and severe disease, include, among others: p.Leu541Pro, p.Arg602Trp, p.Thr1019Met, p.Leu1940Pro, and p.His1838Asp. Login to comment
90 These results are supported by previous findings that the p.Leu541Pro and p.Arg602Trp variants result in mislocalized protein,22 the p.Leu1940Pro and IVS38e10T/C variants confer much earlier onset of the disease,23 and the p.His1838Asp variant, in a complex allele with the p.Gly1961Glu mutation, results in an early-onset, severe disease.24 Although the above estimates are simplified because they do not take into account environmental factors and genetic variation at other loci in these patients, they serve as a good basis for association with disease onset and disease severity. Login to comment

PMID: 23953153 [PubMed] Fujinami K et al: "Clinical and molecular analysis of Stargardt disease with preserved foveal structure and function."

No. Sentence Comment

141 Allele Frequencies of 72 ABCA4 Variants Identified in a Comparison Groupa With the Typical Stargardt Disease (140 Patients Without Evidence of Foveal Sparing on Autofluorescence Imaging) Exon Nucleotide Substitution and Amino Acid Change Number of Alleles Allele Frequency 2 c.71G>A, p.Arg24His 1 0.36% 2 c.161G>A, p.Cys54Tyr 3 1.07% 3 c.223T>G, p.Cys75Gly 1 0.36% 5 c.455G>A, p.Arg152Gln 1 0.36% 5 c.454C>T, p.Arg152* 1 0.36% 5 c.466 A>G, p.Ile156Val 2 0.71% 6 c.634C>T, p. Arg212Cys 3 1.07% 6 c.656G>C, p.Arg219Thr 1 0.36% 6 c.666_678delAAAGACGGTGCGC, p.Lys223_Arg226delfs 2 0.71% 6 c.768G>T, Splicing site 4 1.42% 8 c.1037A>C, p.Lys346Thr 1 0.36% 10 c.1222C>T, p.Arg408* 3 1.07% 12 c.1622T>C, p.Leu541Pro 2 0.71% 12 c.1648 G>T, p.Gly550* 1 0.36% 13 c.1804C>T, p.Arg602Trp 1 0.36% 13 c.1817G>A, p.Gly606Asp 1 0.36% 13 c.1922G>C, p.Cys641Ser 1 0.36% Int 13 c.1937&#fe;1G>A, Splicing site 2 0.71% 14 c.1957C>T, p.Arg653Cys 2 0.71% 17 c.2588G>C, p.Gly863Ala 19 6.79% 18 c.2701A>G, p.Thr901Ala 1 0.36% 19 c.2791G>A, p.Val931Met 2 0.71% 19 c.2894A>G, p.Asn965Ser 1 0.36% 20 c.2966T>C, p.Vla989Ala 3 1.07% 20 c.2971G>C, p.Gly991Arg 2 0.71% 21 c.3056C>T, p.Thr1019Met 1 0.36% 21 c.3113C>T, p.Ala1038Val 3 1.07% 21 c.3064G>A, p.Glu1022Lys 2 0.71% 22 c.3211_3212insGT, p.Ser1071Cysfs 6 2.14% 22 c.3259G>A, p.Glu1087Lys 4 1.43% 22 c.3292C>T, p.Arg1098Cys 1 0.36% 22 c.3322C>T, p.Arg1108Cys 5 1.79% 22 c.3323G>A, p.Arg1108His 1 0.36% 23 c.3364G>A, p.Glu1122Lys 1 0.36% 23 c.3386G>A, p.Arg1129His 1 0.36% 24 c.3602T>G, p.Leu1201Arg 3 1.07% 27 c.3898C>T, p.Arg1300* 2 0.71% 28 c.4139C>T, p.Pro1380Leu 14 5.00% 28 c.4222T>C, p.Trp1408Arg 1 0.36% 28 c.4234C>T, p.Gly1412* 1 0.36% 28 c.4253&#fe;5G>T, Splice site 1 0.36% 28 c.4253&#fe;4C>T, Splice site 1 0.36% 29 c.4283C>T, p.Thr1428Met 1 0.36% 29 c.4319T>C, p.Phe1440Ser 1 0.36% 29 c.4462T>C, p.Cys1488Arg 1 0.36% 30 c.4469G>A, p.Cys1490Tyr 5 1.79% 30 c.4537_4538insC, p.Gly1513Profs 1 0.36% 31 c.4577C>T, p.Thr1526Met 2 0.71% 33 c.4715C>T, p.Thr1572Met 1 0.36% Continued on next page TABLE 3. Login to comment

PMID: 23982839 [PubMed] Fujinami K et al: "ABCA4 gene screening by next-generation sequencing in a British cohort."

No. Sentence Comment

55 1 c.161G>A p.C54Y DC c.2297G>T p.G766V DC 2 2 c.223T>G p.C75G DC c.5088C>G p.S1696R DC 2 3 c.740A>C p.N247T DC c.1433T>C p.I478T B c.2345G>A p.W782* DC 2 4 c.768G>T Splice site DC 1 5 c.1222C>T p.R408* DC c.2568C>A p.Y856* DC 2 6 c.1804C>T p.R602W DC c.859-9T>C Splice site PDC 2 7 c.1805G>A p.R602Q DC c.5113C>T p.R1705W DC 2 8 c.1922G>C p.C641S DC 1 9 c.1957C>T p.R653C DC 1 10 c.1957C>T p.R653C DC 1 11 c.2588G>C p.G863A DC c.655A>T p.R219* DC 2 Allele 2 (p.R219*) was APEX-false-negative 12 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 13 c.2588G>C p.G863A DC c.1906C>T p.Q636* DC 2 14 c.2588G>C p.G863A DC 1 15 c.2588G>C p.G863A DC 1 16 c.2894A>G p.N965S DC c.3322C>T p.R1108C DC 2 Allele 2 (p.R1108C) was APEX-false-negative 17 c.3064G>A p.E1022K DC c.6729&#fe;4_&#fe;18delAGTTGGCCCTGGGGC Splice site DC 2 18 c.3064G>A p.E1022K DC 1 19 c.3208_3209insGT p.S1071fs DC c.2942C>T p.P981L DC c.6529G>A p.D2177N B 2 20 c.3208_3209insGT p.S1071fs DC c.1519G>T p.D507Y DC 2 21 c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 2 22 c.3208_3209insGT p.S1071fs DC 1 23 c.3292C>T p.R1098C DC c.3299T>A p.I1100N DC 2 24 c.3322C>T p.R1108C DC c.4978delC p.L1661* DC 2 25 c.3386G>A p.R1129H DC c.3208_3209insGT p.S1071fs DC c.4634G>A p.S1545N DC 3 Allele 2 (p.S1071fs) was APEX false-negative and allele 1 (p.R1129H) was NGS false-negative 26 c.4139C>T p.P1380L DC c.3191-1G>T Splice site DC 2 27 c.4139C>T p.P1380L DC c.3398T>C p.I1133T PDC 2 28 c.4139C>T p.P1380L DC c.4070C>A p.A1357E DC 2 29 c.4139C>T p.P1380L DC c.4773G>C Splice site DC 2 30 c.4139C>T p.P1380L DC 1 31 c.4139C>T p.P1380L DC 1 32 c.4139C>T p.P1380L DC 1 33 c.4234C>T p.Q1412* DC 1 34 c.4319T>C p.F1440S DC 1 35 c.4328G>A p.R1443H DC c.180delG p.M61fs DC 2 36 c.4469G>A p.C1490Y DC c.1726G>C p.D576H DC 2 37 c.4469G>A p.C1490Y DC 1 38 c.4537_4538insC p.Q1513fs DC c.5578C>T p.R1860W DC 2 Allele 1 (p.Q1513fs) was NGS-false-negative 39 c.4577C>T p.T1526M DC 1 T ABLE 2. Continued Pt Allele 1 Detected by APEX Allele 2 Detected by NGS Allele 3 Detected by NGS Total N of DC Variants Comments DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. DNA Change Protein Change/ Effect Pred. Patho. Login to comment
62 Hum Var Score (0-1) Site Wt CV Mt CV CV % Variation 3 c.161G>A p.C54Y 1 1 [ [ Lewis RA, et al. 11 Tol. 0.11 PRD 0.994 No change 1/13006 db SNP (rs150774447) 3 c.223T>G p.C75G 1 2 [ [ Lewis RA, et al. 11 Del. NA POD 0.603 No change ND 5 c.466A>G p.I156V 2 77, 78 [ [ Papaioannou M, et al. 16 Tol. 0.46 B 0.003 No change 16/13006 db SNP (rs112467008) Benign 6 c.655A>T p.R219* 1 11 [ Xi Q, et al. 27 ND 6 c.740A>C p.N247T 1 3 [ [ APEX Del. NA B 0.135 No change ND 6 c.768G>T Splice site 1 4 [ [ Klevering BJ, et al. 22 Tol. 0.56 NA Don. 70.4 58 Site broken (17.51) ND 9 c.1222C>T p.R408* 1 5 [ [ Webster AR, et al. 7 ND 12 c.1726G>C p.D576H 1 36 [ Downs K, et al. 25 POD 0.688 Acc. 68.1 39.1 Site broken (42.54) 1/13006 13 c.1804C>T p.R602W 1 6 [ [ Lewis RA, et al. 11 Del. 0.00 B 0.129 No change ND db SNP (rs 6179409) 13 c.1805G>A p.R602Q 1 7 [ [ Webster AR, et al. 7 Del. 0.04 PRD 0.513 Acc. 48.9 77.9 New site (&#fe;59.14) 2/13006 db SNP (rs61749410) 13 c.1906C>T p.Q636* 3 12, 13, 60 [ Zernant J, et al. 5 No change 1/13006 db SNP (rs145961131) 13 c.1922G>C p.C641S 1 8 [ [ Stenirri S, et al. 24 Del. 0.00 No change ND db SNP (rs61749416) 14 c.1957C>T p.R653C 2 9, 10 [ [ Rivera A, et al. 17 Del. 0.00 PRD 0.999 No change ND db SNP (rs61749420) 17 c.2588G>C p.G863A/ p.DelG863 5 11, 12, 13, 14, 15 [ [ Lewis RA, et al. 11 / Maugeri A, et al. 29 Del. 0.00 PRD 0.996 No change 68/13006 db SNP (rs76157638) 18 c.2701A>G p.T901A 1 74 [ [ APEX Tol. 0.82 B 0.008 23/13006 db SNP (rs139655975) Benign 19 c.2894A>G p.N965S 1 16 [ [ Lewis RA, et al. 11 Del. 0.03 PRD 0.981 Acc. 53.4 82.3 New site (&#fe;54.26) ND db SNP (rs201471607) 20 c.2971G>C p.G991R 1 67 [ [ Yatsenko AN, et al. 13 Del. 0.02 PRD 0.999 No change 28/13006 db SNP (rs147484266) Benign 22 c.3064G>A p.E1022K 2 17, 18 [ [ Webster AR, et al. 7 Del. 0.00 PRD 1.000 No change ND db SNP (rs61749459) 22 c.3208_3209insGT p.S1071fs 5 19, 20, 21, 22, 25 [ [ APEX ND False-negative in APEX in patient 25 22 c.3292C>T p.R1098C 1 23 [ [ Rivera A, et al. 17 Del. NA PRD 0.999 No change ND 22 c.3322C>T p.R1108C 3 16, 24, 61 [ [ Rozet JM, et al. 10 Del. 0.00 PRD 0.986 No change 1/13006 db SNP (rs61750120) False-negative in APEX in patients 16 and 61 23 c.3386G>A p.R1129H 1 25 [ Zernant J, et al. 5 PRD 0.989 No change ND False-negative in NGS in patient 25 24 c.3602T>G p.L1201R 4 72, 73, 74, 79 [ [ Lewis RA, et al. 11 Tol. 0.37 B 0.052 Don. 61.3 73.7 New site (20.08) 416/13006 db SNP (rs61750126) Benign 28 c.4139C>T p.P1380L 7 30, 31, 32, 33, 34, 35, 36 [ [ Lewis RA, et al. 11 Del. 0.01 B 0.377 No change 2/13006 db SNP (rs61750130) 28 c.4234C>T p.Q1412* 1 33 [ [ Rivera A, et al. 17 ND db SNP (rs61750137) 29 c.4283C>T p.T1428M 1 76 [ [ APEX Tol. 0.15 B 0.010 No change 2/13006 db SNP (rs1800549) Benign 29 c.4319T>C p.F1440S 1 34 [ [ Lewis RA, et al. 11 Del. 0.00 POD 0.744 No change ND dbSNP (rs61750141) 29 c.4326C>A p.N1442K 1 64 [ Zernant J, et al. 5 Tol. NA POD 0.374 No change ND 29 c.4328G>A p.R1443H 1 35 [ [ Rivera A, et al. 17 Del. 0.02 PRD 0.999 No change 1/13006 dbSNP (rs61750142) IVS29 c.4352&#fe;1G>A Splice site 1 73 [ Zernant J, et al. 5 Don. 82.3 55.4 WT site broken (32.62) ND 30 c.4469G>A p.C1490Y 2 36, 37 [ [ Lewis RA, et al. 11 Del. 0.00 PRD 0.994 No change ND dbSNP (rs61751402) 30 c.4538A>G p.Q1513R 1 67 [ Webster AR, et al. 7 Tol. NA Benign 0.043 Acc. 91.7 62.8 Site broken (31.55) ND T ABLE 3. Continued Exon/ IVS Nucleotide Substitution Protein Change/ Effect N of Alleles Identified Pt Method Previous Report SIFT Polyphen 2 HSF Matrix Allele Freq. by EVS Reference Comment APEX NGS Pred. Tol. Index (0-1) Pred. Login to comment

PMID: 24011517 [PubMed] Utz VM et al: "Identification of three ABCA4 sequence variations exclusive to African American patients in a cohort of patients with Stargardt disease."

No. Sentence Comment

121 Population-Specific ABCA4 Alleles in Patients with Stargardt Disease References Population Allele Protein Rivera et al.28 Hargitai et al.12 Hungaro-German c.1622T>C/c.3113C>T p.L541P/p.A1038V September et al.47 Afrikaner c.4469G>A p.C1490Y September et al.47 Afrikaner c.1804C>T p.R602W Rosenberg et al.48 Danish c.2894A>G p.N965S Maugeri et al.27 Western European c.2588G>C p.G863A Maia-Lopes et al.49 Portuguese c.32T>C p.L11P Valverde et al.29 Spanish c.5882G>A p.R1129L Fumagalli et al.50 Italian c.2099G>A p.W700X VOL. 156, NO. 6 ALL AUTHORS HAVE COMPLETED AND SUBMITTED THE ICMJE FORM FOR DISCLOSURE OF POTENTIAL CONFLICTS OF INTEREST, and the following were reported. Login to comment

PMID: 24444108 [PubMed] Ortube MC et al: "Whole exome sequencing detects homozygosity for ABCA4 p.Arg602Trp missense mutation in a pediatric patient with rapidly progressive retinal dystrophy."

No. Sentence Comment

0 CASE REPORT Open Access Whole exome sequencing detects homozygosity for ABCA4 p.Arg602Trp missense mutation in a pediatric patient with rapidly progressive retinal dystrophy Maria Carolina Ortube1* , Samuel P Strom2,3 , Stanley F Nelson2,3 , Steven Nusinowitz1 , Ariadna Martinez1 and Michael B Gorin1,3 Abstract Background: A pediatric patient presented with rapidly progressive vision loss, nyctalopia and retinal dystrophy. Login to comment
1 This is the first report of homozygosity for the p.Arg602Trp mutation in the ABCA4 gene. Login to comment
15 DNA analysis by whole exomic sequencing revealed homozygosity of p.Arg602Trp in the ABCA4 gene. Login to comment
24 After 2 years of ophthalmic follow-up we performed exomic sequencing and identified a likely pathogenic homozygous variant in ABCA4 (p.Arg602Trp). Login to comment
26 Here we provide a comprehensive phenotypic characterization of a young patient homozygous for this highly pathogenic p.Arg602Trp variant. Login to comment
96 Whole exome sequencing identified a homozygous ABCA4 missense variant (p.Arg602Trp) that has been identified as a Stargardt Disease mutation [7,8]. Login to comment
102 Whole exomic sequencing (WES) identified a total of 14 homozygous rare coding variants, including p.Arg602Trp in ABCA4 (Additional file 1). Login to comment
112 Compound heterozygous cases that included the p.Arg602Trp mutation of the ABCA4 gene have been described in early onset, autosomal recessive retinitis pigmentosa families [7,8]. Login to comment
165 Grants Foundation Fighting Blindness Harold and Pauline Price Chair Research to Prevent Blindness Shorter version: Homozygous ABCA4 p.Arg602Trp missense mutation. Login to comment
225 Arch Ophthalmol 2012, 130(2):171-179. doi:10.1186/1471-2350-15-11 Cite this article as: Ortube et al.: Whole exome sequencing detects homozygosity for ABCA4 p.Arg602Trp missense mutation in a pediatric patient with rapidly progressive retinal dystrophy. Login to comment

PMID: 24677105 [PubMed] Burke TR et al: "Quantitative fundus autofluorescence in recessive Stargardt disease."

No. Sentence Comment

84 [A854T; A1038V]; p.C2150Y 512 2.3 26 F 52 1 0.70 0.48 I - p.R212C 722 2.0 27 F 52 13 1.00 1.00 - I p.A1038V; p.A848D 459 4.1 28 M 20 5 0.30 0.40 I - p.L2027F; p.R1108H 507 2.3 29 M 23 7 1.00 1.00 I I p.G1961E; p.R2030Q 334 347 2.4 2.0 30 M 44 26 0.70 0.70 - II p.P1380L; p.R1108H 453 4.7 31 F 30 22 1.00 1.30 - I p.G1961E; c.6005&#fe;1G > T 428 2.3 32 M 12 8 0.40 0.40 I - p.W821R; p.C2150Y 306 2.0 33 F 20 9 0.88 0.88 III III p.R602W; p.M1882I 650 655 2.6 2.5 34 F 47 4 0.40 0.40 I - p.G1961E; p.R1129C 400 2.5 35 F 19 3 0.70 0.48 II II p. Login to comment

PMID: 24763286 [PubMed] Zhang X et al: "Molecular diagnosis of putative Stargardt disease by capture next generation sequencing."

No. Sentence Comment

130 Among these four reported mutations, p.A1773V in ABCA4 was reported as one of the founder mutations (up to17%) in Latin American population [18]; p.R2038W mutation in USA, Estonia and South African population; p.R602W mutation in USA, South African population [2,3,19]; G607R in the German population[20]. Login to comment
131 Taken together, this study confirmed that these four mutations are pathogenic mutations and among these four reported mutations, p.A1773V, p.R2038W and p.R602W may have higher allele frequencies since they were frequently reported in different populations. Login to comment
156 Allele frequency Family Gene Identified Mutations (Exon) Reported or novel SIFT PolyPhen PANTHER 1000G ESP6500 In-house A ABCA4 c.5318C.T;p.A1773V (Exon 38) Reported D $ PD $ T $ 0 0 0 c.4128+1 G.T (Exon 27) Novel N/A N/A N/A 0 0 0 B ABCA4 c.6112C.T; p.R2038W (Exon 44) Reported D $ PD $ De $ 0 0.00008 0 c.1804C.T; p. R602W (Exon 13) Reported D $ Benign De $ 0 0 0 C ABCA4 c.1819G.A;p.G607R(Exon 13, Homo*) Reported D $ PD $ De $ 0 0.000077 0 D ABCA4 c.6095A.G; p.H2032R (Exon 44) Novel D $ PD $ De $ 0 0 0 c.3420C.G;p.C1140W (Exon 23) Novel D $ PD $ De $ 0 0 0 E PROM1 c.730C.T; p.R244X (Exon 6) Novel N/A N/A N/A 0 0 0 c.1983+1 C.T (Exon18) Novel N/A N/A N/A 0 0 0 $ D: Damaging; PD, Possibly damaging; T, Tolerated; DE,Deleterious; N/A, No Answer; *Homo, Homozygous mutation; , SIFT (http://sift.jcvi.org/); PolyPhen (http://genetics.bwh.harvard.edu/pph2/). Login to comment

PMID: 26161775 [PubMed] Xin W et al: "Identification of Genetic Defects in 33 Probands with Stargardt Disease by WES-Based Bioinformatics Gene Panel Analysis."

No. Sentence Comment

68 Patient Nucleotide Amino Acid State Computational Prediction Allele Frequency in Reported ID Change Change P/SS Proven SIFT 1000G EVS ExAC NC RC QT058 c.6173T>G p.L2058R Het PrD D D NA NA NA 0/192 0/456 Novel c.4773 +1G>T Splicing defect Het SSA NA NA NA NA NA - 0/456 Pang et al. 2002; Riveiro-Alvarez et al. 2013 QT085 c.6173T>G p.L2058R Het PrD D D NA NA NA 0/192 0/456 Novel c.5932delA p. K1978Qfs*13 Het NA NA NA NA NA NA 0/192 0/456 Novel QT292 c.6389T>A p.M2130K Het PoD D D NA NA NA - 0/456 Yi et al. 2012 c.6118C>T p.R2040* Het NA NA NA NA NA 2/121394 0/192 0/456 Baum et al. 2003 QT302 c.6816 +1G>A Splicing defect Het SSA NA NA NA NA NA - 0/456 Robert et al. 2014 c.4555delA p.T1519Rfs*7 Het NA NA NA NA NA NA 0/192 0/456 Novel QT398 c.4352 +1G>A Splicing defect Het SSA NA NA NA NA 1/121268 - 0/456 Ernest et al. 2009 c.1804C>T p.R602W Het PoD D D NA NA 6/119038 - 2/456 Lewis et al. 1999; Wiszniewski et al. 2005; Heathfield et al. 2013 QT431 c.5646G>A p.M1882I Het PoD D D NA NA 3/121340 - 0/456 Zernant et al. 2011 c.1804C>T p.R602W Het B D D NA NA 6/119038 - 2/456 Lewis et al. 1999; Wiszniewski et al. 2005; Heathfield et al. 2013 QT458 c.4555delA p.T1519Rfs*7 Het NA NA NA NA NA NA 0/192 0/456 Novel c.164A>G p.H55R Het PoD D D NA NA NA - 0/456 Thiadens et al. 2012 QT727 c.161-2A>G Splicing defect Het SSA NA NA NA NA NA 0/192 0/456 Novel c.101_106del p.S34_L35del Het NA NA NA NA NA NA 0/192 0/456 Novel QT833 c.2424C>G p.Y808* Het NA NA NA NA NA NA - 0/456 Zhou et al. 2014 c.1560delG p.V521Sfs*47 Het NA NA NA NA NA NA 0/192 0/456 Novel QT1137 c.6284A>T p.D2095V Het PrD D D NA NA NA 0/192 0/456 Novel c.22C>T p.Q8* Het NA NA NA NA 0.0001 NA 0/192 0/456 Novel QT1160 c.240_241del p.C81Ffs*17 Het NA NA NA NA NA NA 0/192 0/456 Novel c.101_106del p.S34_L35del Het NA NA NA NA NA NA 0/192 0/456 Novel QT1175 c.4195G>T p.E1399* Het NA NA NA NA NA 2/120596 0/192 0/456 Novel c.2894A>G p.N965S Het PrD D D NA 0.0001 21/ 121302 - 0/456 Allikmets et al. 1997; Shanks et al. 2013; Bertelsen et al. 2014 QT1182 c.4773 +1G>T Splicing defect Hom SSA NA NA NA NA NA - 0/456 Pang et al. 2002; Riveiro-Alvarez et al. 2013 QT1198 c.5646G>A p.M1882I Het B D D NA NA 3/121340 - 0/456 Zernant et al. 2011 c.2894A>G p.N965S Het PrD D D NA 0.0001 21/ 121302 - 0/456 Allikmets et al. 1997;Shanks et al. 2013; Bertelsen et al. 2014 QT1200 c.6563T>C p.F2188S Het B D D NA 0.0005 2/121380 - 1/456 Fukui et al. 2002 c.858+2T>A Splicing defect Het SSA NA NA NA NA NA - 0/456 Zhang et al. 2014 QT1230 c.6317G>C p.R2106P Het PrD D D NA NA NA 0/192 0/456 Novel c.101_106del p.S34_L35del Het NA NA NA NA NA NA 0/192 0/456 Novel QT1277 c.6479 +2T>C Splicing defect Het SSA NA NA NA NA NA 0/192 0/456 Novel (Continued) Table 1. Login to comment

PMID: 26311262 [PubMed] Noupuu K et al: "Recessive Stargardt disease phenocopying hydroxychloroquine retinopathy."

No. Sentence Comment

53 [5461-10T > C] P2 55, F White 20/20 20/20 Mottling + flecks Mottling + flecks p. [A1357V]; [G1961E] P3 57, M African-American 20/20 20/20 BEM + flecks BEM + flecks p. [R2107H] P4 10, F White 20/30 20/25 BEM + flecks BEM + flecks p. [E160*]; [R1108C] P5 26, F African-American 20/30 20/20 Mottling + flecks Mottling + flecks p. [R2107H]; [E526A] P6 19, F Asian-Caucasian 20/25 20/25 BEM BEM p. [R602W] P7 26, M African-Arab 20/20 20/20 BEM BEM p. [R1300*]; [R2106C] P8 25, M White 20/20 20/40 BEM BEM p. [Q1003*]; [G1961E] Abbreviations: M male, F female, BCVA best-corrected visual acuity, OD right eye, OS left eye, BEM bull`s eye maculopathy Fig. 1 Thinning of the parafoveal region with relative foveal sparing presenting as the hydroxychloroquine retinopathy- associated parafoveal outer retina thinning phenotype in patients with recessive Stargardt disease (STGD1). Login to comment