ABCMdb

ABCA1 p.Lys939Met

Predicted by SNAP2:	A: D (80%), C: D (75%), D: D (95%), E: D (91%), F: D (85%), G: D (91%), H: D (80%), I: D (80%), L: D (85%), M: D (75%), N: D (91%), P: D (91%), Q: D (80%), R: D (75%), S: D (85%), T: D (85%), V: D (80%), W: D (91%), Y: D (80%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, L: D, M: D, N: D, P: D, Q: D, R: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] The mammalian ABC transporter ABCA1 induces lipid-... Biochim Biophys Acta. 2012 Mar;1821(3):373-80. doi: 10.1016/j.bbalip.2011.07.005. Epub 2011 Jul 20. Bocer T, Zarubica A, Roussel A, Flis K, Trombik T, Goffeau A, Ulaszewski S, Chimini G
The mammalian ABC transporter ABCA1 induces lipid-dependent drug sensitivity in yeast.
Biochim Biophys Acta. 2012 Mar;1821(3):373-80. doi: 10.1016/j.bbalip.2011.07.005. Epub 2011 Jul 20., [PMID:21787882]

Abstract [show]
ABCA1 belongs to the A class of ABC transporter, which is absent in yeast. ABCA1 elicits lipid translocation at the plasma membrane through yet elusive processes. We successfully expressed the mouse Abca1 gene in Saccharomyces cerevisiae. The cloned ABCA1 distributed at the yeast plasma membrane in stable discrete domains that we name MCA (membrane cluster containing ABCA1) and that do not overlap with the previously identified punctate structures MCC (membrane cluster containing Can1p) and MCP (membrane cluster containing Pma1p). By comparison with a nonfunctional mutant, we demonstrated that ABCA1 elicits specific phenotypes in response to compounds known to interact with membrane lipids, such as papuamide B, amphotericin B and pimaricin. The sensitivity of these novel phenotypes to the genetic modification of the membrane lipid composition was studied by the introduction of the cho1 and lcb1-100 mutations involved respectively in phosphatidylserine or sphingolipid biosynthesis in yeast cells. The results, corroborated by the analysis of equivalent mammalian mutant cell lines, demonstrate that membrane composition, in particular its phosphatidylserine content, influences the function of the transporter. We thus have reconstituted in yeast the essential functions associated to the expression of ABCA1 in mammals and characterized new physiological phenotypes prone to genetic analysis. This article is a part of a Special Issue entitled Advances in High Density Lipoprotein Formation and Metabolism: A Tribute to John F. Oram (1945-2010).

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
39 Two additional vectors, bearing the nonfunctional mutant, pTB1A1MM and pTB2A1MM were generated by replacing the central fragment of ABCA1 gene by a fragment containing K939M and K1952M mutations in the Walker A motif in both nucleotide binding domains [2,4]. Login to comment

[hide] ATP hydrolysis-dependent conformational changes in... J Lipid Res. 2012 Jan;53(1):126-36. Epub 2011 Oct 25. Nagao K, Takahashi K, Azuma Y, Takada M, Kimura Y, Matsuo M, Kioka N, Ueda K
ATP hydrolysis-dependent conformational changes in the extracellular domain of ABCA1 are associated with apoA-I binding.
J Lipid Res. 2012 Jan;53(1):126-36. Epub 2011 Oct 25., [PMID:22028339]

Abstract [show]
ATP-binding cassette protein A1 (ABCA1) plays a major role in cholesterol homeostasis and high-density lipoprotein (HDL) metabolism. Although it is predicted that apolipoprotein A-I (apoA-I) directly binds to ABCA1, the physiological importance of this interaction is still controversial and the conformation required for apoA-I binding is unclear. In this study, the role of the two nucleotide-binding domains (NBD) of ABCA1 in apoA-I binding was determined by inserting a TEV protease recognition sequence in the linker region of ABCA1. Analyses of ATP binding and occlusion to wild-type ABCA1 and various NBD mutants revealed that ATP binds equally to both NBDs and is hydrolyzed at both NBDs. The interaction with apoA-I and the apoA-I-dependent cholesterol efflux required not only ATP binding but also hydrolysis in both NBDs. NBD mutations and cellular ATP depletion decreased the accessibility of antibodies to a hemagglutinin (HA) epitope that was inserted at position 443 in the extracellular domain (ECD), suggesting that the conformation of ECDs is altered by ATP hydrolysis at both NBDs. These results suggest that ATP hydrolysis at both NBDs induces conformational changes in the ECDs, which are associated with apoA-I binding and cholesterol efflux.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7 Chambenoit et al. reported that substituting the Walker A lysine residue in either NBD with methionine (K939M or K1952M) abolishes the ability of apoA-I to bind to ABCA1-expressing cells and inhibits cholesterol secretion to apoA-I (12). Login to comment
26 Plasmids The expression vectors for wild-type ABCA1, ABCA1-K939M, ABCA1-K1952M, and ABCA1-K939M,K1952M that were tagged with GFP at the C terminus were generated as previously described (7, 13). Login to comment
45 Because a 3-Å crosslinker can cross-link apoA-I with ABCA1 (19) and the K939M mutant cannot bind or be cross-linked to apoA-I (22), it is likely that apoA-I interacts with specific conformations of the ECDs that are linked by the two disulfide bonds and formed in an ATP-dependent manner. Login to comment
88 HEK293 cells stably expressing wild-type (wt) ABCA1 or the Walker A lysine mutants ABCA1-K939M, ABCA1-K1952M, or ABCA1-K939M,K1952M were incubated for 24 h in DMEM containing 0.02% BSA with or without 5 ␮g/ml apoA-I. Login to comment
119 However, cholesterol efflux was impaired in cells expressing ABCA1-K939M,K1952M, a mutant in which the Walker A lysines in both NBDs are replaced with methionines, or the single Walker A lysine mutants ABCA1-K939M or ABCA1-K1952M, in which the Walker A lysine in NBD1 or NBD2 is replaced with methionine (Fig. 3B). Login to comment
135 We consistently observed stronger ATP binding to NBD2 in ABCA1-K939M,K1952M-TEV-GFP, although the reason for this higher-affinity interaction is unknown. Login to comment
140 The K939M mutation reduced the photoaffinity labeling of incubated with 5 ␮M [␣32 P]8N3ATP for 10 min at 37°C and then UV irradiated on ice after the free nucleotides were removed (Fig. 4B). Login to comment
142 The K939M mutation decreased the photoaffinity labeling by approximately 40%, and vanadate did not affect the labeling. Login to comment
144 Interestingly, the addition of vanadate significantly (1.7-fold) enhanced the photoaffinity labeling of ABCA1-K1952M, suggesting that vanadate stabilizes the nucleotide at NBD1 after ATP hydrolysis. Login to comment
145 There was no photoaffinity-labeled band with ABCA1-K939M,K1952M. Login to comment
147 These results suggest that the occluded nucleotide in the NBD of wild-type ABCA1, ABCA1-K939M, and ABCA1-K1952M is not ATP but ADP, that both NBDs occlude ADP after ATP hydrolysis, and that the features of the two NBDs of ABCA1 are quite different. Login to comment
160 Then cells were fixed and NBD2 with [␣32 P]8N3ATP, apparently consistent with the decrease in the photoaffinity labeling of the full-length K939M mutant, although immunoprecipitation and subsequent protease digestion make it difficult to quantitatively compare the mutants (Fig. 6B). Login to comment
161 Nevertheless, there was no signal for the K939M mutant with [␥32 P]8N3ATP. Login to comment
27 Plasmids The expression vectors for wild-type ABCA1, ABCA1-K939M, ABCA1-K1952M, and ABCA1-K939M,K1952M that were tagged with GFP at the C terminus were generated as previously described (7, 13). Login to comment
46 Because a 3-&#c5; cross-linker can cross-link apoA-I with ABCA1 (19) and the K939M mutant cannot bind or be cross-linked to apoA-I (22), it is likely that apoA-I interacts with specific conformations of the ECDs that are linked by the two disulfide bonds and formed in an ATP-dependent manner. Login to comment
89 HEK293 cells stably expressing wild-type (wt) ABCA1 or the Walker A lysine mutants ABCA1-K939M, ABCA1-K1952M, or ABCA1-K939M,K1952M were incubated for 24 h in DMEM containing 0.02% BSA with or without 5 òe;g/ml apoA-I. Login to comment
120 However, cholesterol efflux was impaired in cells expressing ABCA1-K939M,K1952M, a mutant in which the Walker A lysines in both NBDs are replaced with methionines, or the single Walker A lysine mutants ABCA1-K939M or ABCA1-K1952M, in which the Walker A lysine in NBD1 or NBD2 is replaced with methionine (Fig. 3B). Login to comment
137 We consistently observed stronger ATP binding to NBD2 in ABCA1-K939M,K1952M-TEV-GFP, although the reason for this higher-affinity interaction is unknown. Login to comment
149 These results suggest that the occluded nucleotide in the NBD of wild-type ABCA1, ABCA1-K939M, and ABCA1-K1952M is not ATP but ADP, that both NBDs occlude ADP after ATP hydrolysis, and that the features of the two NBDs of ABCA1 are quite different. Login to comment
163 Then cells were fixed and NBD2 with [ॷ32 P]8N3ATP, apparently consistent with the decrease in the photoaffinity labeling of the full-length K939M mutant, although immunoprecipitation and subsequent protease digestion make it difficult to quantitatively compare the mutants (Fig. 6B). Login to comment
164 Nevertheless, there was no signal for the K939M mutant with [ॹ32 P]8N3ATP. Login to comment

[hide] Sodium taurocholate-dependent lipid efflux by ABCA... J Lipid Res. 2009 Jun;50(6):1165-72. Epub 2009 Feb 8. Nagao K, Zhao Y, Takahashi K, Kimura Y, Ueda K
Sodium taurocholate-dependent lipid efflux by ABCA1: effects of W590S mutation on lipid translocation and apolipoprotein A-I dissociation.
J Lipid Res. 2009 Jun;50(6):1165-72. Epub 2009 Feb 8., [PMID:19202195]

Abstract [show]
ABCA1 plays a major role in HDL metabolism. Cholesterol secretion by ABCA1 is dependent on the presence of extracellular acceptors, such as lipid-free apolipoprotein A-I (apoA-I). However, the importance of the direct interaction between apoA-I and ABCA1 in HDL formation remains unclear. In contrast, ABCB4 mediates the secretion of phospholipids and cholesterol in the presence of sodium taurocholate (NaTC) but not in the presence of apoA-I. In this study, we analyzed apoA-I binding and NaTC-dependent lipid efflux by ABCA1. ABCA1 mediated the efflux of cholesterol and phospholipids in the presence of NaTC as well as in the presence of apoA-I in an ATP-dependent manner. The Tangier disease mutation W590S, which resides in the extracellular domain and impairs apoA-I-dependent lipid efflux, greatly decreased NaTC-dependent cholesterol and phospholipid efflux. However, the W590S mutation did not impair apoA-I binding and, conversely, retarded the dissociation of apoA-I from ABCA1. These results suggest that the W590S mutation impairs ATP-dependent lipid translocation and that lipid translocation or possibly lipid loading, facilitates apoA-I dissociation from ABCA1. NaTC is a good tool for analyzing ABCA1-mediated lipid efflux and allows dissection of the steps of HDL formation by ABCA1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 Cell culture Human embryonic kidney (HEK293) cells and WI-38 fibroblasts were grown in a humidified incubator (5% CO2) at 37°C in DMEM supplemented with 10% heat-inactivated FBS. Plasmids The expression vectors for wild-type ABCA1, ABCA1-W590S, and ABCA1-K939M,K1952M (MM), fused to GFP at their C termini, were generated as described previously (3, 18). Login to comment
43 Plasmids The expression vectors for wild-type ABCA1, ABCA1-W590S, and ABCA1-K939M,K1952M (MM), fused to GFP at their C termini, were generated as described previously (3, 18). Login to comment

[hide] Formation of two intramolecular disulfide bonds is... J Biol Chem. 2009 Apr 24;284(17):11293-300. Epub 2009 Mar 3. Hozoji M, Kimura Y, Kioka N, Ueda K
Formation of two intramolecular disulfide bonds is necessary for ApoA-I-dependent cholesterol efflux mediated by ABCA1.
J Biol Chem. 2009 Apr 24;284(17):11293-300. Epub 2009 Mar 3., [PMID:19258317]

Abstract [show]
ABCA1 plays a major role in cholesterol homeostasis and high density lipoprotein (HDL) metabolism. ABCA1 contains disulfide bond(s) between its N- and C-terminal halves, but it remains unclear whether disulfide bond formation is important for the functions of ABCA1 and which cysteines are involved in disulfide bond formation. To answer these questions, we constructed >30 ABCA1 mutants in which 16 extracellular domain (ECD) cysteines were replaced with serines and examined disulfide bond formation, apoA-I binding, and HDL formation in these mutants. From the single cysteine replacements, two cysteines (Cys(75) and Cys(309)) in ECD1 were found to be essential for apoA-I binding. In contrast, in ECD2, only Cys(1477) was found to be essential for HDL formation, and no single cysteine replacement impaired apoA-I binding. The concurrent replacement of two cysteines, Cys(1463) and Cys(1465), impaired apoA-I binding and HDL formation, suggesting that four of five extracellular cysteines (Cys(75), Cys(309), Cys(1463), Cys(1465), and Cys(1477)) are involved in these functions of ABCA1. Trypsin digestion experiments suggested that one disulfide bond is not sufficient and that two intramolecular disulfide bonds (between Cys(75) and Cys(309) in ECD1 and either Cys(1463) or Cys(1465) and Cys(1477) in ECD2) are required for ABCA1 to be fully functional.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
90 ApoA-I bound to cells expressing wild-type ABCA1 but not to cells expressing ABCA1-MM (ABCA1(K939M/K1952M)), a mutant in which the Walker A lysines in both nucleotide-binding domains are replaced by methionines, although the expression level (data not shown) and surface expression (Fig. 4A) of the mutant were comparable with those of the wild-type protein, as reported (24). Login to comment
88 ApoA-I bound to cells expressing wild-type ABCA1 but not to cells expressing ABCA1-MM (ABCA1(K939M/K1952M)), a mutant in which the Walker A lysines in both nucleotide-binding domains are replaced by methionines, although the expression level (data not shown) and surface expression (Fig. 4A) of the mutant were comparable with those of the wild-type protein, as reported (24). Login to comment

[hide] Retroendocytosis pathway of ABCA1/apoA-I contribut... Genes Cells. 2009 Feb;14(2):191-204. Epub 2008 Jan 6. Azuma Y, Takada M, Shin HW, Kioka N, Nakayama K, Ueda K
Retroendocytosis pathway of ABCA1/apoA-I contributes to HDL formation.
Genes Cells. 2009 Feb;14(2):191-204. Epub 2008 Jan 6., [PMID:19170766]

Abstract [show]
ATP-binding cassette protein A1 (ABCA1) mediates transfer of cellular free cholesterol and phospholipids to apolipoprotein A-I (apoA-I), an extracellular acceptor in plasma, to form high-density lipoprotein (HDL). It is currently unknown to what extent ABCA1 endocytosis and recycling contribute to the HDL formation. To address this issue, we expressed human ABCA1 constructs with either an extracellular HA tag or an intracellular GFP tag in cells, and used this system to characterize endocytosis and recycling of ABCA1 and apoA-I. Under basal conditions, ABCA1 and apoA-I are endocytosed via a clathrin- and Rab5-mediated pathway and recycled rapidly back to the cell surface, at least in part via a Rab4-mediated route; approximately 30% of the endocytosed ABCA1 is recycled back to the cell surface. When receptor-mediated endocytosis is inhibited, the level of ABCA1 at the cell surface increases and apoA-I internalization is blocked. Under these conditions, apoA-I mediated cholesterol efflux from cells that have accumulated lipoprotein-derived cholesterol is decreased, whereas efflux from cells without excess cholesterol is increased. These results suggest that the retroendocytosis pathway of ABCA1/apoA-I contributes to HDL formation when excess lipoprotein-derived cholesterol has accumulated in cells.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
197 DNA construction We constructed plasmids for expressing human wild-type ABCA1, ABCA1(W590S) and ABCA1(K939M,K1952M)(MM) bearing an insertion of the influenza virus hemagglutinin (HA) epitope sequence between residues 207 and 208 (within the first extracellular loop), using the bicistronic expression vector pHaMAIRESneo. Login to comment

[hide] Formation of cholesterol-enriched structures by ab... Genes Cells. 2008 Aug;13(8):889-904. Tanaka AR, Kano F, Yamamoto A, Ueda K, Murata M
Formation of cholesterol-enriched structures by aberrant intracellular accumulation of ATP-binding cassette transporter A1.
Genes Cells. 2008 Aug;13(8):889-904., [PMID:18782226]

Abstract [show]
ATP-binding cassette transporter A1 (ABCA1) is a key transporter associated with excess cellular lipid efflux. Here, we report that in HEK293 cells ABCA1 functions in intracellular compartments along the endocytic pathway. Inhibition of ABCA1-GFP degradation with proteasome inhibitors induced the internalization of ABCA1 and the formation of intracellular round-shaped structures, designated "A1 bodies". Importantly, cholesterol was selectively accumulated in A1 bodies, and this depended on the cholesterol efflux activity of ABCA1. Treatment with either lactacystin or acetylated LDL, which reduces proteasome activity, resulted in internalization of ABCA1 in mouse peritoneal macrophages. By performing array analysis on macrophages treated with these reagents, we identified Rab4 as a key protein involved in the internalization and aberrant accumulation of ABCA1 in HEK cells. Treatment of the cells with proteasome inhibitors inhibited the degradation of Rab4, and Rab4 over-expression induced the formation of small A1 bodies. Furthermore, A1 bodies formation was substantially inhibited by silencing of the endogenous Rab4 gene. Taken together, our findings suggest that the endocytic ABCA1 possesses cholesterol efflux activity, and thus the cellular control of post-endocytic sorting, retention or recycling of functional ABCA1 in the endocytic vesicles, which is in part regulated by Rab4, is important for cholesterol metabolism in living cells.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
73 Functional ABCA1 is essential for abnormal cholesterol accumulation in A1 bodies To determine whether ABCA1 function is required for the formation of A1 bodies, we studied the effect of the K939M ABCA1-GFP mutant on A1-body formation. Login to comment
74 ABCA1 has ATP binding/hydrolysis activity (Tanaka et al. 2001; Takahashi et al. 2006) and the mutant protein, in which lysine 939 in the Walker A motif of NBF1 is changed to methionine, is known to have lost ABCA1 function (Hamon et al. 2000), that is, the mutant does not have the ability to mediate apoA-I induced cholesterol efflux (Fig. 6A, WT+ and KM+), although both K939M ABCA1-GFP and the wild-type protein localized mainly to the plasma membrane (Fig. 6B, 0 h). Login to comment
75 Upon ALLN treatment, K939M ABCA1-GFP was translocated from the plasma membrane to intracellular compartments. Login to comment
110 Extracts from HEK-A1WT cells or HEK-K939M cells were analyzed by immunoblotting with anti-ABCA1 antibodies and anti-α-tubulin antibodies. Login to comment
111 (B) HEK-A1WT cells and HEK-K939M cells were treated with 10 μm ALLN for the indicated times. Login to comment
205 By using the K939M ABCA1-GFP mutant protein, which does not have the ability to mediate apoA-I induced cholesterol release, we confirmed that functional ABCA1-GFP plays a crucial role in the formation of A1 bodies, indicating that ABCA1-GFP has the ability to transport cellular cholesterol into A1 bodies or to keep LDL cholesterol into A1 bodies. Login to comment
294 K939M mutant ABCA1-GFP and HA-Rab4 construction Wild-type ABCA1-GFP was constructed as described previously (Tanaka et al. 2003). Login to comment
295 The DNA fragment (FbaI-AatII) containing the K939M missense mutation was generated using the polymerase chain reaction method with the following primer pairs: (5'-CTCAGTGGCTGTGATCATCAAGGGCATCG and 5'- GTGGTCGTCaTCCCCGCTCCATTGTGGCCC):(5`-GGGC CACAATGGAGCGGGGAtGACGACCAC and 5'-CTGTCCC CCAGGACGTCCGCTTCATCCATG), where the mutated nucleotide is shown in lower case. Login to comment
299 Cell culture, transfection, establishment of stable transfectants and cellular cholesterol release assay HEK293 cells stably expressing wild-type or K939M mutant ABCA1-GFP were selected and maintained in Dulbecco`s modified 902 Eagle`s medium (DMEM) supplemented with 10% fetal calf serum (FCS), 100 U/mL penicillin G, 100 μg/mL streptomycin, 0.25 μg/mL fungizone and 300 μg/mL geneticin at 37 °C in a 5% CO2 incubator. Login to comment

[hide] ABCA1 mediates high-affinity uptake of 25-hydroxyc... Am J Physiol Cell Physiol. 2006 Sep;291(3):C490-502. Epub 2006 Apr 12. Tam SP, Mok L, Chimini G, Vasa M, Deeley RG
ABCA1 mediates high-affinity uptake of 25-hydroxycholesterol by membrane vesicles and rapid efflux of oxysterol by intact cells.
Am J Physiol Cell Physiol. 2006 Sep;291(3):C490-502. Epub 2006 Apr 12., [PMID:16611739]

Abstract [show]
ATP Binding Cassette (ABC) transporter, ABCA1, plays a pivotal role in reverse cholesterol transport by mediating the cellular efflux of phospholipid and cholesterol. Studies using intact cells strongly suggest that ABCA1 acts as a phospholipid floppase, but there has been no direct demonstration that the protein is a primary active sterol transporter. Using membrane vesicles from insect Sf21 cells, we found that ABCA1 mediated ATP-dependent uptake of [(3)H]25-hydroxycholesterol with an apparent K(m) of 0.7 muM. Consistent with this high apparent affinity, expression of ABCA1 in human embryonic kidney cells both increased rapid efflux of 25-hydroxcholesterol and prevented oxysterol-mediated repression of low-density lipoprotein (LDL) receptor and 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase mRNAs. Comparison of wild-type and ABCA1(-/-) murine fibroblasts indicates that 25-hydroxycholesterol is effluxed approximately 5-fold more rapidly by wild-type cells. In addition, the rate of efflux from the wild-type but not the ABCA1(-/-) fibroblasts is increased a further twofold by inducers of ABCA1 expression. Thus under the experimental conditions employed, endogenous ABCA1 is a major contributor to 25-hydroxycholesterol efflux from wild-type fibroblasts. Evidence from in vitro studies indicates that oxysterols are potent inducers of genes involved in cellular cholesterol efflux and metabolism, including the ABCA1 gene, and repressors of genes involved in cholesterol synthesis or uptake. Our observations raise the possibility that efflux of oxysterols by ABCA1 could contribute to a homeostatic mechanism, which both attenuates oxysterol-induced expression of its cognate gene and alleviates repression of genes encoding proteins, such as HMG-CoA reductase and LDL receptor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
158 A: immunoblots of total membrane proteins (15 ␮g) from vesicles containing wild-type ABCA1 (KK) and mutant proteins containing Met substitutions of the highly conserved Walker A Lys of nucleotide binding domain (NBD1; K939M, MK), NBD2 (K1952M, KM), or both NBDs (K939M/K1952M, MM), as well as control vesicles of beta-glucuronidase (beta-gus). Login to comment

[hide] Purification and ATPase activity of human ABCA1. J Biol Chem. 2006 Apr 21;281(16):10760-8. Epub 2006 Feb 24. Takahashi K, Kimura Y, Kioka N, Matsuo M, Ueda K
Purification and ATPase activity of human ABCA1.
J Biol Chem. 2006 Apr 21;281(16):10760-8. Epub 2006 Feb 24., [PMID:16500904]

Abstract [show]
ATP-binding cassette protein A1 (ABCA1) plays a major role in cholesterol homeostasis and high density lipoprotein metabolism. Apolipoprotein A-I binds to ABCA1 and cellular cholesterol and phospholipids, mainly phosphatidylcholine, are loaded onto apoA-I to form pre-beta high density lipoprotein (HDL). It is proposed that ABCA1 translocates phospholipids and cholesterol directly or indirectly to form pre-beta HDL. To explore the mechanism of ABCA1-mediated pre-beta HDL formation, we expressed human ABCA1 in insect Sf9 cells and purified it. Trypsin limited-digestion of purified ABCA1 in the detergent-soluble form suggested that it retained conformation similar to ABCA1 expressed in the membranes of human fibroblast WI-38 cells. Purified ABCA1 showed robust ATPase activity when reconstituted in liposomes made of synthetic phosphatidylcholine. ABCA1 showed lower ATPase activity when reconstituted in liposomes containing phosphatidylserine, phosphatidylethanolamine, or phosphatidylglycerol and also showed weak specificity in acyl chain species. ATPase activity was reduced by the addition of cholesterol and decreased by 25% in the presence of 20% cholesterol. Beta-sitosterol and campesterol showed similar inhibitory effects but stigmasterol did not, suggesting structure-specific interaction between ABCA1 and sterols. Glibenclamide suppressed ABCA1 ATPase, suggesting that it inhibits apoA-I-dependent cellular cholesterol efflux by suppressing ABCA1 ATPase activity. These results suggest that the ATPase activity of ABCA1 is stimulated preferentially by phospholipids with choline head groups, phosphatidylcholine and sphingomyelin. This study with purified human ABCA1 provides the first biochemical basis of the mechanism for HDL formation mediated by ABCA1.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
20 Like these xenobiotic transporters, ABCA1 K939M mutant, in which lysine, indispensable for the hydrolysis of ATP by various ABC proteins (8-11), was substituted by methionine, was impaired in apoA-I-dependent PL and cholesterol efflux (3, 5). Login to comment
22 However, because the ABCA1 K939M mutant is defective in its interaction with apoA-I (3, 5), it is also possible that ATP binding and/or ATP hydrolysis cause conformational changes of ABCA1, which are required for the interaction with apoA-I, and ABCA1 functions as a regulator in HDL formation (12) as SUR does in the ATP-sensitive potassium channel complex (13). Login to comment
33 2 The abbreviations used are: ABCA1, ATP-binding cassette protein A1; ABCA1 MM, ABCA1 K939M-K1952M; MDR, multidrug resistance; MRP, multidrug resistance-related protein; NBF, nucleotide-binding fold; apo, apolipoprotein; HDL, high density lipoprotein; FC, free cholesterol; PL, phospholipid; PC, phosphatidylcholine; PS, phosphatidylserine; PE, phosphatidylethanolamine; SM, sphingomyelin; PG, phosphatidylglycerol; POPC, 1-palmitoyl-2-oleoylphosphatidylcholine; DPPC, 1,2-dipalmitoylphosphatidylcholine; POPS, 1-palmitoyl-2-oleoylphosphatidylserine; DPPE, 1,2- dipalmitoylphosphatidylethanolamine; DPPG, 1,2-dipalmitoylphosphatidylglycerol; Sf9, Spodoptera frugiperda 9; HEK, human embryo kidney; NGF, N-glycosidase F; DDM, n-dodecyl-beta-D-maltoside; NTA, nitrilotriacetic acid. Login to comment
49 To construct the NBF1 Walker A lysine mutant, ABCA1 K939M, DNA fragments containing a K939M missense mutation were generated by a two-step PCR method with two pairs of primers, 5Ј-GGGCCACAATGGAGCGGGGATGACGACCAC-3Ј and 5Ј-CTGTCCCCCAGGACGTCCGCTTCATCCATG-3Ј and 5Ј-GTG- GTCGTCATCCCCGCTCCATTGTGGCCC-3Ј and 5Ј-CTCAGTG- GCTGTGATCATCAAGGGCATCG-3Ј. Login to comment
117 ABCA1 K939M-K1952M protein, expressed and purified in the same procedure, was as pure as the wild type (Figs. Login to comment
149 To confirm that ATPase activity is derived from purified ABCA1, a baculovirus for ABCA1 K939M-K1952M mutant, in which lysine 939 and lysine 1952 in the Walker A motif of nucleotide binding folds were replaced by methionines, was constructed. Login to comment
151 Purified ABCA1 K939M-K1952M protein showed little ATPase activity, less than 10 nmol/min/mg of protein (Fig. 5). Login to comment
166 E, purified ABCA1 K939M-K1952M mutant, 0.5 ␮g (Coomassie Brilliant Blue R-250 staining). Login to comment
214 A, ATPase activity was measured in the presence of various concen- trationsofMgATP.F,wildtype;E,K939M-K1952M mutant. Login to comment
270 As the ABCA1 K939M mutant, whose Walker A lysine residue is substituted by methionine, is reported to be defect in its interaction with apoA-I, we expected that apoA-I would affect the ATP hydrolysis of ABCA1; however, we found no clear effects of apoA-I on the ATP hydrolysis of purified ABCA1 either before or after reconstitution in liposomes under our examination conditions (Fig. 8). Login to comment
32 2 The abbreviations used are: ABCA1, ATP-binding cassette protein A1; ABCA1 MM, ABCA1 K939M-K1952M; MDR, multidrug resistance; MRP, multidrug resistance-related protein; NBF, nucleotide-binding fold; apo, apolipoprotein; HDL, high density lipoprotein; FC, free cholesterol; PL, phospholipid; PC, phosphatidylcholine; PS, phosphatidylserine; PE, phosphatidylethanolamine; SM, sphingomyelin; PG, phosphatidylglycerol; POPC, 1-palmitoyl-2-oleoylphosphatidylcholine; DPPC, 1,2-dipalmitoylphosphatidylcholine; POPS, 1-palmitoyl-2-oleoylphosphatidylserine; DPPE, 1,2- dipalmitoylphosphatidylethanolamine; DPPG, 1,2-dipalmitoylphosphatidylglycerol; Sf9, Spodoptera frugiperda 9; HEK, human embryo kidney; NGF, N-glycosidase F; DDM, n-dodecyl-beta-D-maltoside; NTA, nitrilotriacetic acid. Login to comment
46 To construct the NBF1 Walker A lysine mutant, ABCA1 K939M, DNA fragments containing a K939M missense mutation were generated by a two-step PCR method with two pairs of primers, 5b18;-GGGCCACAATGGAGCGGGGATGACGACCAC-3b18; and 5b18;-CTGTCCCCCAGGACGTCCGCTTCATCCATG-3b18; and 5b18;-GTG- GTCGTCATCCCCGCTCCATTGTGGCCC-3b18; and 5b18;-CTCAGTG- GCTGTGATCATCAAGGGCATCG-3b18;. Login to comment
114 ABCA1 K939M-K1952M protein, expressed and purified in the same procedure, was as pure as the wild type (Figs. 1B and 2E). Login to comment
145 To confirm that ATPase activity is derived from purified ABCA1, a baculovirus for ABCA1 K939M-K1952M mutant, in which lysine 939 and lysine 1952 in the Walker A motif of nucleotide binding folds were replaced by methionines, was constructed. Login to comment
147 Purified ABCA1 K939M-K1952M protein showed little ATPase activity, less than 10 nmol/min/mg of protein (Fig. 5). Login to comment
162 E, purified ABCA1 K939M-K1952M mutant, 0.5 òe;g (Coomassie Brilliant Blue R-250 staining). Login to comment
208 A, ATPase activity was measured in the presence of various concen- trationsofMgATP.F,wildtype;E,K939M-K1952M mutant. Login to comment
262 Another critical issue in ABCA1-mediated pre-betaHDL formation is the role of apoA-I. Cellular cholesterol and PL efflux mediated by ABCA1 is fully dependent on lipid-free apoA-I. As the ABCA1 K939M mutant, whose Walker A lysine residue is substituted by methionine, is reported to be defect in its interaction with apoA-I, we expected that apoA-I would affect the ATP hydrolysis of ABCA1; however, we found no clear effects of apoA-I on the ATP hydrolysis of purified ABCA1 either before or after reconstitution in liposomes under our examination conditions (Fig. 8). Login to comment

[hide] Apolipoprotein A-I activates Cdc42 signaling throu... J Lipid Res. 2006 Apr;47(4):794-803. Epub 2006 Jan 28. Nofer JR, Remaley AT, Feuerborn R, Wolinnska I, Engel T, von Eckardstein A, Assmann G
Apolipoprotein A-I activates Cdc42 signaling through the ABCA1 transporter.
J Lipid Res. 2006 Apr;47(4):794-803. Epub 2006 Jan 28., [PMID:16443932]

Abstract [show]
It has been suggested that the signal transduction initiated by apolipoprotein A-I (apoA-I) activates key proteins involved in cholesterol efflux. ABCA1 serves as a binding partner for apoA-I, but its participation in apoA-I-induced signaling remains uncertain. We show that the exposure of human fibroblasts to ABCA1 ligands (apolipoproteins and amphipathic helical peptides) results in the generation of intracellular signals, including activation of the small G-protein Cdc42, protein kinases (PAK-1 and p54JNK), and actin polymerization. ApoA-I-induced signaling was abrogated by glyburide, an inhibitor of the ABC transporter family, and in fibroblasts from patients with Tangier disease, which do not express ABCA1. Conversely, induction of ABCA1 expression with the liver X receptor agonist, T0901317, and the retinoid X receptor agonist, R0264456, potentiated apoA-I-induced signaling. Similar effects were observed in HEK293 cells overexpressing ABCA1-green fluorescent protein (GFP) fusion protein, but not ABCA1-GFP (K939M), which fails to hydrolyze ATP, or a nonfunctional ABCA1-GFP with a truncated C terminus. We further found that Cdc42 coimmunoprecipitates with ABCA1 in ABCA1-GFP-expressing HEK293 cells exposed to apoA-I but not in cells expressing ABCA1 mutants. We conclude that ABCA1 transduces signals from apoA-I by complexing and activating Cdc42 and downstream kinases and, therefore, acts as a full apoA-I receptor.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Similar effects were observed in HEK293 cells overexpressing ABCA1-green fluorescent protein (GFP) fusion protein, but not ABCA1-GFP (K939M), which fails to hydrolyze ATP, or a nonfunctional ABCA1-GFP with a truncated C terminus. Login to comment
52 ABCA1-W-GFP variant with the disrupted first Walker A motif of ABCA1 was constructed by PCR-based mutagenesis, creating a missense mutation of K939M. Login to comment
51 ABCA1-W-GFP variant with the disrupted first Walker A motif of ABCA1 was constructed by PCR-based mutagenesis, creating a missense mutation of K939M. Login to comment

[hide] ABC proteins: key molecules for lipid homeostasis. Med Mol Morphol. 2005 Mar;38(1):2-12. Takahashi K, Kimura Y, Nagata K, Yamamoto A, Matsuo M, Ueda K
ABC proteins: key molecules for lipid homeostasis.
Med Mol Morphol. 2005 Mar;38(1):2-12., [PMID:16158173]

Abstract [show]
Forty-nine ABC protein genes exist on human chromosomes. Eukaryotic ABC proteins were originally recognized as drug efflux pumps involved in the multidrug resistance of cancer cells. However, it is now realized that one of their major physiological roles is cellular lipid transport and homeostasis, and their dysfunction is often associated with human diseases. ABCA1 and ABCA7 mediate the apolipoprotein-dependent formation of a high-density lipoprotein-cholesterol complex. ABCA3 is indispensable for pulmonary surfactant secretion. ABCG5 and ABCG8 are involved in the secretion of plant sterols and cholesterol into bile. However, the primary substrates and mechanism of action of these ABC proteins have not been precisely defined. In this review article, we first describe the general structure and functions of eukaryotic ABC proteins. The current model of ABCA1 functionality is then explained based on studies on a topological model, subcellular localization, apoA-I dependence of HDL formation, functional defects of Tangier disease mutants, and ATP hydrolysis of purified ABCA1. ABCA1 is supposed to function as a transporter of lipids as well as a receptor for apoA-I. ABCA3 is likely involved in accumulating phospholipids and cholesterol in lamellar bodies and in generating multivesicular structures.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
103 The Walker A lysine mutation K939M in the first nucleotide-binding fold, resulting in a defect in HDL formation, impaired ATPase activity. Login to comment

[hide] ATP-binding cassette transporter A1 (ABCA1) functi... J Biol Chem. 2001 Jun 29;276(26):23742-7. Epub 2001 Apr 17. Wang N, Silver DL, Thiele C, Tall AR
ATP-binding cassette transporter A1 (ABCA1) functions as a cholesterol efflux regulatory protein.
J Biol Chem. 2001 Jun 29;276(26):23742-7. Epub 2001 Apr 17., [PMID:11309399]

Abstract [show]
ABCA1, an ATP-binding cassette transporter mutated in Tangier disease, promotes cellular phospholipid and cholesterol efflux by loading free apoA-I with these lipids. This process involves binding of apoA-I to the cell surface and phospholipid translocation by ABCA1. The goals of this study were to examine the relationship between ABCA1-mediated lipid efflux and apolipoprotein binding and to determine whether phospholipid and cholesterol efflux are coupled. Inhibition of lipid efflux by glybenclamide treatment or by mutation of the ATP-binding cassette of ABCA1 showed a close correlation between lipid efflux, the binding of apoA-I to cells, and cross-linking of apoA-I to ABCA1. The data suggest that a functionally important apoA-I binding site exists on ABCA1 and that the binding site could also involve lipids. After using cyclodextrin preincubation to deplete cellular cholesterol, ABCA1-mediated cholesterol efflux was abolished but phospholipid efflux and the binding of apoA-I were unaffected. The conditioned media from cyclodextrin-pretreated, ABCA1-expressing cells readily promoted cholesterol efflux when added to fresh cells not expressing ABCA1, indicating that cholesterol efflux can be dissociated from phospholipid efflux. Further, using a photoactivatable cholesterol analog, we showed that ABCA1 did not bind cholesterol directly, even though several other cholesterol-binding proteins specifically bound the cholesterol analog. The data suggest that the binding of apoA-I to ABCA1 leads to the formation of phospholipid-apoA-I complexes, which subsequently promote cholesterol efflux in an autocrine or paracrine fashion.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 ABCA1-M-Flag was constructed by polymerase chain reaction-based mutagenesis, which created a missense mutation of K939M and disrupted the first Walker A motif of ABCA1. Login to comment

[hide] ABCA1 dimer-monomer interconversion during HDL gen... Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5034-9. doi: 10.1073/pnas.1220703110. Epub 2013 Mar 11. Nagata KO, Nakada C, Kasai RS, Kusumi A, Ueda K
ABCA1 dimer-monomer interconversion during HDL generation revealed by single-molecule imaging.
Proc Natl Acad Sci U S A. 2013 Mar 26;110(13):5034-9. doi: 10.1073/pnas.1220703110. Epub 2013 Mar 11., [PMID:23479619]

Abstract [show]
The generation of high-density lipoprotein (HDL), one of the most critical events for preventing atherosclerosis, is mediated by ATP-binding cassette protein A1 (ABCA1). ABCA1 is known to transfer cellular cholesterol and phospholipids to apolipoprotein A-I (apoA-I) for generating discoidal HDL (dHDL) particles, composed of 100-200 lipid molecules surrounded by two apoA-I molecules; however, the regulatory mechanisms are still poorly understood. Here we observed ABCA1-GFP and apoA-I at the level of single molecules on the plasma membrane via a total internal reflection fluorescence microscope. We found that about 70% of total ABCA1-GFP spots are immobilized on the plasma membrane and estimated that about 89% of immobile ABCA1 molecules are in dimers. Furthermore, an ATPase-deficient ABCA1 mutant failed to be immobilized or form a dimer. We found that the lipid acceptor apoA-I interacts with the ABCA1 dimer to generate dHDL and is followed by ABCA1 dimer-monomer interconversion. This indicates that the formation of the ABCA1 dimer is the key for apoA-I binding and nascent HDL generation. Our findings suggest the physiological significance of conversion of the ABCA1 monomer to a dimer: The dimer serves as a receptor for two apoA-I molecules for dHDL particle generation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
131 Human ABCA1 and ABCA1-MM (with two point mutations of K939M and K1952M) were fused with EGFP or monomeric (m)EGFP at their carboxyl termini, where an mEGFP mutant was modified from EGFP by introducing a mutation corresponding to an A206K monomeric mutant (33). Login to comment

[hide] ABCA1 mediates unfolding of apolipoprotein AI N te... Arterioscler Thromb Vasc Biol. 2013 Jun;33(6):1197-205. doi: 10.1161/ATVBAHA.112.301195. Epub 2013 Apr 4. Wang S, Gulshan K, Brubaker G, Hazen SL, Smith JD
ABCA1 mediates unfolding of apolipoprotein AI N terminus on the cell surface before lipidation and release of nascent high-density lipoprotein.
Arterioscler Thromb Vasc Biol. 2013 Jun;33(6):1197-205. doi: 10.1161/ATVBAHA.112.301195. Epub 2013 Apr 4., [PMID:23559627]

Abstract [show]
OBJECTIVE: To gain insight into the mechanism by which ABCA1 generates nascent high-density lipoprotein. APPROACH AND RESULTS: HEK293 cells were stably transfected with ABCA1 vectors, encoding wild type, and the W590S and C1477R Tangier disease mutation isoforms, along with the K939M ATP-binding domain mutant. Apolipoprotein AI (ApoAI) binding, plasma membrane remodeling, cholesterol efflux, apoAI cell surface unfolding, and apoAI cell surface lipidation were determined, the latter 2 measured using novel fluorescent apoAI indicators. The W590S isoform had decreased plasma membrane remodeling and lipid efflux activities, and the C1477R isoform had decreased apoAI binding, and lipid efflux activities, whereas the K939M isoform did not bind apoAI, remodel the membrane, or efflux cholesterol. However, all ABCA1 isoforms led to apoAI unfolding at the cell surface, which was higher for the isoforms that increased apoAI binding. ApoAI lipidation was not detected on ABCA1-expressing cells, only in the conditioned medium, consistent with rapid release of nascent high-density lipoprotein from ABCA1-expressing cells. CONCLUSIONS: We identified a third activity of ABCA1, the ability to unfold the N terminus of apoAI on the cell surface. Our results support a model in which unfolded apoAI on the cell surface is an intermediate in its lipidation and that, once apoAI is lipidated, it forms an unstable structure that is rapidly released from the cells to generate high-density lipoprotein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Although not discovered in a Tangier disease subject, the K939M mutation in the first ATP-binding domain has been shown to be defective in phosphatidylserine translocation, apoAI binding, and cholesterol efflux.9-11 In addition to nHDL, apoAI can spontaneously form reconstituted HDL (rHDL) particles in vitro when incubated with dimyristoylphosphatidylcholine (DMPC) dispersions or liposomes but not when incubated with the physiologically (c) 2013 American Heart Association, Inc. Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org DOI: 10.1161/ATVBAHA.112.301195 Objective-To gain insight into the mechanism by which ABCA1 generates nascent high-density lipoprotein. Login to comment
4 Approach and Results-HEK293 cells were stably transfected with ABCA1 vectors, encoding wild type, and the W590S and C1477R Tangier disease mutation isoforms, along with the K939M ATP-binding domain mutant. Login to comment
6 The W590S isoform had decreased plasma membrane remodeling and lipid efflux activities, and the C1477R isoform had decreased apoAI binding, and lipid efflux activities, whereas the K939M isoform did not bind apoAI, remodel the membrane, or efflux cholesterol. Login to comment
24 HEK293 cells were stably transfected with different murine ABCA1-green fluorescent protein (GFP) fusion vectors encoding WT, K939M, W590S, and C1477R isoforms, the latter 2 identified as Tangier disease-causing mutations in the first and second large extracellular domains, respectively.6 Several clonally derived cell lines from each construction were screened by confocal fluorescence microscopy and flow cytometry to select lines for further study with equivalent ABCA1 expression. Login to comment
25 As previously described,5,9 WT, W590S, C1477R, and K939M ABCA1-GFP fusions were processed correctly in cells and expressed on the plasma membrane (Figure 1A). Login to comment
29 In contrast, the C1477R and K939M isoform-expressing cells had no significant increase in apoAI binding compared with control cells (by ANOVA posttest). Login to comment
31 We were able to take advantage of this nonspecific apoAI binding to the control and the C1477R and K939M isoform-expressing cells in cell studies described below. Login to comment
33 The W590S cells had a small 1.26-fold increase in cell surface PS (P<0.05 versus control by ANOVA posttest), whereas the K939M-ABCA1 isoform had no cell surface PS increase (Figure 2B). Login to comment
39 A, Confocal microscopy of wild type (WT), W590S, C1477R, and K939M ABCA1-GFP isoforms shows cell surface expression. Login to comment
40 B, Similar expression levels of WT, W590S, C1477R, and K939M ABCA1-GFP cell lines shown by flow cytometry (n=3; mean&#b1;SD; different numbers above the bars show P<0.001, by ANOVA posttest). Login to comment
44 In a separate study, we found that the K939M cells had efflux to apoAI similar to the nontransfected control HEK cells, thus they had no detectable ABCA1 activity as had been previously determined.5 In the presence of the weak detergent NaTC, the control HEK cells increased cholesterol efflux to 2.62% (a 5.36-fold increase versus absence of acceptor). Login to comment
62 A, Alexa647-labeled apoAI binding to nontransfected cells (HEK) and cells stably transfected with wild type (WT), W590S, C1477R, and K939M ABCA1-green fluorescent protein (GFP) vectors assayed by flow cytometry (n=3; mean&#b1;SD; P<0.0005 for HEK in the presence or absence of labeled apoAI by t test; for the 5 cell types in the presence of labeled apoAI different numbers above the bars show P<0.001; by ANOVA posttest). Login to comment
69 Here, we took advantage of the high sensitivity of flow cytometry and our observation that even control HEK cells and cells expressing the apoAI-binding defective C1477R and K939M-ABCA1 isoforms bound apoAI nonspecifically, enabling us to determine the Bodipy-TMR/Alexa647 ratio of each cell. Login to comment
72 The C1447R and K939M apoAI-binding deficient mutants displayed intermediate activity with Bodipy-TMR/Alexa647 ratio peaks of 1.0 (1.43-fold increase versus control HEK cells). Login to comment
76 Finally, the defective K939M isoform retains only one activity: apoAI unfolding (also reduced). Login to comment
84 Medium recovered from control HEK cells and the defective K939M-ABAC1 isoform Figure 3. Login to comment
132 Interestingly, the 2 ABCA1 isoforms with impaired apoAI binding, C1447R and K939M, also displayed some, albeit reduced, apoAI unfolding activity compared with nontransfected HEK cells (Figure 4A). Login to comment
133 Because the K939M isoform is also deficient in plasma membrane remodeling, this partial unfolding activity cannot be attributed to this membrane remodeling. Login to comment
152 It is of interest that both the apoAI binding and the plasma membrane remodeling activities are disrupted in the K939M isoform without totally abolishing this apoAI unfolding activity. Login to comment
158 The levels of apoAI in the Int and U states are increased by specific binding to ABCA1, but these apoAI states are still present in cells expressing the C1447C and K939M-ABCA1 isoforms that lack high-affinity apoAI binding. Login to comment

[hide] Differential phospholipid substrates and direction... J Biol Chem. 2013 Nov 29;288(48):34414-26. doi: 10.1074/jbc.M113.508812. Epub 2013 Oct 4. Quazi F, Molday RS
Differential phospholipid substrates and directional transport by ATP-binding cassette proteins ABCA1, ABCA7, and ABCA4 and disease-causing mutants.
J Biol Chem. 2013 Nov 29;288(48):34414-26. doi: 10.1074/jbc.M113.508812. Epub 2013 Oct 4., [PMID:24097981]

Abstract [show]
ABCA1, ABCA7, and ABCA4 are members of the ABCA subfamily of ATP-binding cassette transporters that share extensive sequence and structural similarity. Mutations in ABCA1 cause Tangier disease characterized by defective cholesterol homeostasis and high density lipoprotein (HDL) deficiency. Mutations in ABCA4 are responsible for Stargardt disease, a degenerative disorder associated with severe loss in central vision. Although cell-based studies have implicated ABCA proteins in lipid transport, the substrates and direction of transport have not been firmly established. We have purified and reconstituted ABCA1, ABCA7, and ABCA4 into liposomes for fluorescent-lipid transport studies. ABCA1 actively exported or flipped phosphatidylcholine, phosphatidylserine, and sphingomyelin from the cytoplasmic to the exocytoplasmic leaflet of membranes, whereas ABCA7 preferentially exported phosphatidylserine. In contrast, ABCA4 transported phosphatidylethanolamine in the reverse direction. The same phospholipids stimulated the ATPase activity of these ABCA transporters. The transport and ATPase activities of ABCA1 and ABCA4 were reduced by 25% in the presence of 20% cholesterol. Nine ABCA1 Tangier mutants and the corresponding ABCA4 Stargardt mutants showed significantly reduced phospholipid transport activity and subcellular mislocalization. These studies provide the first direct evidence for ABCA1 and ABCA7 functioning as phospholipid transporters and suggest that this activity is an essential step in the loading of apoA-1 with phospholipids for HDL formation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 Corresponding ABCA4 mutations determined by amino acid alignment with ABCA1 included S100P, W605S, F608L, T959I, N965S, C1502R, T1537M, R2107P, and P2180L. Login to comment
67 ABCA1-MM was constructed to harbor the Walker A-motif lysine-to-methionine mutations K939M/K1952M by the nested PCR method; ABCA4-MM had the corresponding K969M/ K1969M Walker A mutations (37), and ABCA7-MM had the Lipid Transport Activity of ABCA Transporters NOVEMBER 29, 2013ߦVOLUME 288ߦNUMBER 48 JOURNAL OF BIOLOGICAL CHEMISTRY 34415 at SEMMELWEIS UNIV OF MEDICINE on December 3, K847M/K1833M Walker A mutations. Login to comment
69 ABCA1-MM was constructed to harbor the Walker A-motif lysine-to-methionine mutations K939M/K1952M by the nested PCR method; ABCA4-MM had the corresponding K969M/ K1969M Walker A mutations (37), and ABCA7-MM had the Lipid Transport Activity of ABCA Transporters NOVEMBER 29, 2013ߦVOLUME 288ߦNUMBER 48 JOURNAL OF BIOLOGICAL CHEMISTRY 34415 at SEMMELWEIS UNIV OF MEDICINE on December 3, K847M/K1833M Walker A mutations. Login to comment