ABCMdb

ABCA1 p.Lys939Met

None has been submitted yet.

Publications

PMID: 21787882 [PubMed] Bocer T et al: "The mammalian ABC transporter ABCA1 induces lipid-dependent drug sensitivity in yeast."

No. Sentence Comment

39 Two additional vectors, bearing the nonfunctional mutant, pTB1A1MM and pTB2A1MM were generated by replacing the central fragment of ABCA1 gene by a fragment containing K939M and K1952M mutations in the Walker A motif in both nucleotide binding domains [2,4]. Login to comment

PMID: 22028339 [PubMed] Nagao K et al: "ATP hydrolysis-dependent conformational changes in the extracellular domain of ABCA1 are associated with apoA-I binding."

No. Sentence Comment

7 Chambenoit et al. reported that substituting the Walker A lysine residue in either NBD with methionine (K939M or K1952M) abolishes the ability of apoA-I to bind to ABCA1-expressing cells and inhibits cholesterol secretion to apoA-I (12). Login to comment
26 Plasmids The expression vectors for wild-type ABCA1, ABCA1-K939M, ABCA1-K1952M, and ABCA1-K939M,K1952M that were tagged with GFP at the C terminus were generated as previously described (7, 13). Login to comment
45 Because a 3-Å crosslinker can cross-link apoA-I with ABCA1 (19) and the K939M mutant cannot bind or be cross-linked to apoA-I (22), it is likely that apoA-I interacts with specific conformations of the ECDs that are linked by the two disulfide bonds and formed in an ATP-dependent manner. Login to comment
88 HEK293 cells stably expressing wild-type (wt) ABCA1 or the Walker A lysine mutants ABCA1-K939M, ABCA1-K1952M, or ABCA1-K939M,K1952M were incubated for 24 h in DMEM containing 0.02% BSA with or without 5 ␮g/ml apoA-I. Login to comment
119 However, cholesterol efflux was impaired in cells expressing ABCA1-K939M,K1952M, a mutant in which the Walker A lysines in both NBDs are replaced with methionines, or the single Walker A lysine mutants ABCA1-K939M or ABCA1-K1952M, in which the Walker A lysine in NBD1 or NBD2 is replaced with methionine (Fig. 3B). Login to comment
135 We consistently observed stronger ATP binding to NBD2 in ABCA1-K939M,K1952M-TEV-GFP, although the reason for this higher-affinity interaction is unknown. Login to comment
140 The K939M mutation reduced the photoaffinity labeling of incubated with 5 ␮M [␣32 P]8N3ATP for 10 min at 37°C and then UV irradiated on ice after the free nucleotides were removed (Fig. 4B). Login to comment
142 The K939M mutation decreased the photoaffinity labeling by approximately 40%, and vanadate did not affect the labeling. Login to comment
144 Interestingly, the addition of vanadate significantly (1.7-fold) enhanced the photoaffinity labeling of ABCA1-K1952M, suggesting that vanadate stabilizes the nucleotide at NBD1 after ATP hydrolysis. Login to comment
145 There was no photoaffinity-labeled band with ABCA1-K939M,K1952M. Login to comment
147 These results suggest that the occluded nucleotide in the NBD of wild-type ABCA1, ABCA1-K939M, and ABCA1-K1952M is not ATP but ADP, that both NBDs occlude ADP after ATP hydrolysis, and that the features of the two NBDs of ABCA1 are quite different. Login to comment
160 Then cells were fixed and NBD2 with [␣32 P]8N3ATP, apparently consistent with the decrease in the photoaffinity labeling of the full-length K939M mutant, although immunoprecipitation and subsequent protease digestion make it difficult to quantitatively compare the mutants (Fig. 6B). Login to comment
161 Nevertheless, there was no signal for the K939M mutant with [␥32 P]8N3ATP. Login to comment
27 Plasmids The expression vectors for wild-type ABCA1, ABCA1-K939M, ABCA1-K1952M, and ABCA1-K939M,K1952M that were tagged with GFP at the C terminus were generated as previously described (7, 13). Login to comment
46 Because a 3-&#c5; cross-linker can cross-link apoA-I with ABCA1 (19) and the K939M mutant cannot bind or be cross-linked to apoA-I (22), it is likely that apoA-I interacts with specific conformations of the ECDs that are linked by the two disulfide bonds and formed in an ATP-dependent manner. Login to comment
89 HEK293 cells stably expressing wild-type (wt) ABCA1 or the Walker A lysine mutants ABCA1-K939M, ABCA1-K1952M, or ABCA1-K939M,K1952M were incubated for 24 h in DMEM containing 0.02% BSA with or without 5 òe;g/ml apoA-I. Login to comment
120 However, cholesterol efflux was impaired in cells expressing ABCA1-K939M,K1952M, a mutant in which the Walker A lysines in both NBDs are replaced with methionines, or the single Walker A lysine mutants ABCA1-K939M or ABCA1-K1952M, in which the Walker A lysine in NBD1 or NBD2 is replaced with methionine (Fig. 3B). Login to comment
137 We consistently observed stronger ATP binding to NBD2 in ABCA1-K939M,K1952M-TEV-GFP, although the reason for this higher-affinity interaction is unknown. Login to comment
149 These results suggest that the occluded nucleotide in the NBD of wild-type ABCA1, ABCA1-K939M, and ABCA1-K1952M is not ATP but ADP, that both NBDs occlude ADP after ATP hydrolysis, and that the features of the two NBDs of ABCA1 are quite different. Login to comment
163 Then cells were fixed and NBD2 with [ॷ32 P]8N3ATP, apparently consistent with the decrease in the photoaffinity labeling of the full-length K939M mutant, although immunoprecipitation and subsequent protease digestion make it difficult to quantitatively compare the mutants (Fig. 6B). Login to comment
164 Nevertheless, there was no signal for the K939M mutant with [ॹ32 P]8N3ATP. Login to comment

PMID: 19202195 [PubMed] Nagao K et al: "Sodium taurocholate-dependent lipid efflux by ABCA1: effects of W590S mutation on lipid translocation and apolipoprotein A-I dissociation."

No. Sentence Comment

45 Cell culture Human embryonic kidney (HEK293) cells and WI-38 fibroblasts were grown in a humidified incubator (5% CO2) at 37°C in DMEM supplemented with 10% heat-inactivated FBS. Plasmids The expression vectors for wild-type ABCA1, ABCA1-W590S, and ABCA1-K939M,K1952M (MM), fused to GFP at their C termini, were generated as described previously (3, 18). Login to comment
43 Plasmids The expression vectors for wild-type ABCA1, ABCA1-W590S, and ABCA1-K939M,K1952M (MM), fused to GFP at their C termini, were generated as described previously (3, 18). Login to comment

PMID: 19258317 [PubMed] Hozoji M et al: "Formation of two intramolecular disulfide bonds is necessary for ApoA-I-dependent cholesterol efflux mediated by ABCA1."

No. Sentence Comment

90 ApoA-I bound to cells expressing wild-type ABCA1 but not to cells expressing ABCA1-MM (ABCA1(K939M/K1952M)), a mutant in which the Walker A lysines in both nucleotide-binding domains are replaced by methionines, although the expression level (data not shown) and surface expression (Fig. 4A) of the mutant were comparable with those of the wild-type protein, as reported (24). Login to comment
88 ApoA-I bound to cells expressing wild-type ABCA1 but not to cells expressing ABCA1-MM (ABCA1(K939M/K1952M)), a mutant in which the Walker A lysines in both nucleotide-binding domains are replaced by methionines, although the expression level (data not shown) and surface expression (Fig. 4A) of the mutant were comparable with those of the wild-type protein, as reported (24). Login to comment

PMID: 19170766 [PubMed] Azuma Y et al: "Retroendocytosis pathway of ABCA1/apoA-I contributes to HDL formation."

No. Sentence Comment

197 DNA construction We constructed plasmids for expressing human wild-type ABCA1, ABCA1(W590S) and ABCA1(K939M,K1952M)(MM) bearing an insertion of the influenza virus hemagglutinin (HA) epitope sequence between residues 207 and 208 (within the first extracellular loop), using the bicistronic expression vector pHaMAIRESneo. Login to comment

PMID: 18782226 [PubMed] Tanaka AR et al: "Formation of cholesterol-enriched structures by aberrant intracellular accumulation of ATP-binding cassette transporter A1."

No. Sentence Comment

73 Functional ABCA1 is essential for abnormal cholesterol accumulation in A1 bodies To determine whether ABCA1 function is required for the formation of A1 bodies, we studied the effect of the K939M ABCA1-GFP mutant on A1-body formation. Login to comment
74 ABCA1 has ATP binding/hydrolysis activity (Tanaka et al. 2001; Takahashi et al. 2006) and the mutant protein, in which lysine 939 in the Walker A motif of NBF1 is changed to methionine, is known to have lost ABCA1 function (Hamon et al. 2000), that is, the mutant does not have the ability to mediate apoA-I induced cholesterol efflux (Fig. 6A, WT+ and KM+), although both K939M ABCA1-GFP and the wild-type protein localized mainly to the plasma membrane (Fig. 6B, 0 h). Login to comment
75 Upon ALLN treatment, K939M ABCA1-GFP was translocated from the plasma membrane to intracellular compartments. Login to comment
110 Extracts from HEK-A1WT cells or HEK-K939M cells were analyzed by immunoblotting with anti-ABCA1 antibodies and anti-α-tubulin antibodies. Login to comment
111 (B) HEK-A1WT cells and HEK-K939M cells were treated with 10 μm ALLN for the indicated times. Login to comment
205 By using the K939M ABCA1-GFP mutant protein, which does not have the ability to mediate apoA-I induced cholesterol release, we confirmed that functional ABCA1-GFP plays a crucial role in the formation of A1 bodies, indicating that ABCA1-GFP has the ability to transport cellular cholesterol into A1 bodies or to keep LDL cholesterol into A1 bodies. Login to comment
294 K939M mutant ABCA1-GFP and HA-Rab4 construction Wild-type ABCA1-GFP was constructed as described previously (Tanaka et al. 2003). Login to comment
295 The DNA fragment (FbaI-AatII) containing the K939M missense mutation was generated using the polymerase chain reaction method with the following primer pairs: (5'-CTCAGTGGCTGTGATCATCAAGGGCATCG and 5'- GTGGTCGTCaTCCCCGCTCCATTGTGGCCC):(5`-GGGC CACAATGGAGCGGGGAtGACGACCAC and 5'-CTGTCCC CCAGGACGTCCGCTTCATCCATG), where the mutated nucleotide is shown in lower case. Login to comment
299 Cell culture, transfection, establishment of stable transfectants and cellular cholesterol release assay HEK293 cells stably expressing wild-type or K939M mutant ABCA1-GFP were selected and maintained in Dulbecco`s modified 902 Eagle`s medium (DMEM) supplemented with 10% fetal calf serum (FCS), 100 U/mL penicillin G, 100 μg/mL streptomycin, 0.25 μg/mL fungizone and 300 μg/mL geneticin at 37 °C in a 5% CO2 incubator. Login to comment

PMID: 16611739 [PubMed] Tam SP et al: "ABCA1 mediates high-affinity uptake of 25-hydroxycholesterol by membrane vesicles and rapid efflux of oxysterol by intact cells."

No. Sentence Comment

158 A: immunoblots of total membrane proteins (15 ␮g) from vesicles containing wild-type ABCA1 (KK) and mutant proteins containing Met substitutions of the highly conserved Walker A Lys of nucleotide binding domain (NBD1; K939M, MK), NBD2 (K1952M, KM), or both NBDs (K939M/K1952M, MM), as well as control vesicles of beta-glucuronidase (beta-gus). Login to comment

PMID: 16500904 [PubMed] Takahashi K et al: "Purification and ATPase activity of human ABCA1."

No. Sentence Comment

20 Like these xenobiotic transporters, ABCA1 K939M mutant, in which lysine, indispensable for the hydrolysis of ATP by various ABC proteins (8-11), was substituted by methionine, was impaired in apoA-I-dependent PL and cholesterol efflux (3, 5). Login to comment
22 However, because the ABCA1 K939M mutant is defective in its interaction with apoA-I (3, 5), it is also possible that ATP binding and/or ATP hydrolysis cause conformational changes of ABCA1, which are required for the interaction with apoA-I, and ABCA1 functions as a regulator in HDL formation (12) as SUR does in the ATP-sensitive potassium channel complex (13). Login to comment
33 2 The abbreviations used are: ABCA1, ATP-binding cassette protein A1; ABCA1 MM, ABCA1 K939M-K1952M; MDR, multidrug resistance; MRP, multidrug resistance-related protein; NBF, nucleotide-binding fold; apo, apolipoprotein; HDL, high density lipoprotein; FC, free cholesterol; PL, phospholipid; PC, phosphatidylcholine; PS, phosphatidylserine; PE, phosphatidylethanolamine; SM, sphingomyelin; PG, phosphatidylglycerol; POPC, 1-palmitoyl-2-oleoylphosphatidylcholine; DPPC, 1,2-dipalmitoylphosphatidylcholine; POPS, 1-palmitoyl-2-oleoylphosphatidylserine; DPPE, 1,2- dipalmitoylphosphatidylethanolamine; DPPG, 1,2-dipalmitoylphosphatidylglycerol; Sf9, Spodoptera frugiperda 9; HEK, human embryo kidney; NGF, N-glycosidase F; DDM, n-dodecyl-beta-D-maltoside; NTA, nitrilotriacetic acid. Login to comment
49 To construct the NBF1 Walker A lysine mutant, ABCA1 K939M, DNA fragments containing a K939M missense mutation were generated by a two-step PCR method with two pairs of primers, 5Ј-GGGCCACAATGGAGCGGGGATGACGACCAC-3Ј and 5Ј-CTGTCCCCCAGGACGTCCGCTTCATCCATG-3Ј and 5Ј-GTG- GTCGTCATCCCCGCTCCATTGTGGCCC-3Ј and 5Ј-CTCAGTG- GCTGTGATCATCAAGGGCATCG-3Ј. Login to comment
117 ABCA1 K939M-K1952M protein, expressed and purified in the same procedure, was as pure as the wild type (Figs. Login to comment
149 To confirm that ATPase activity is derived from purified ABCA1, a baculovirus for ABCA1 K939M-K1952M mutant, in which lysine 939 and lysine 1952 in the Walker A motif of nucleotide binding folds were replaced by methionines, was constructed. Login to comment
151 Purified ABCA1 K939M-K1952M protein showed little ATPase activity, less than 10 nmol/min/mg of protein (Fig. 5). Login to comment
166 E, purified ABCA1 K939M-K1952M mutant, 0.5 ␮g (Coomassie Brilliant Blue R-250 staining). Login to comment
214 A, ATPase activity was measured in the presence of various concen- trationsofMgATP.F,wildtype;E,K939M-K1952M mutant. Login to comment
270 As the ABCA1 K939M mutant, whose Walker A lysine residue is substituted by methionine, is reported to be defect in its interaction with apoA-I, we expected that apoA-I would affect the ATP hydrolysis of ABCA1; however, we found no clear effects of apoA-I on the ATP hydrolysis of purified ABCA1 either before or after reconstitution in liposomes under our examination conditions (Fig. 8). Login to comment
32 2 The abbreviations used are: ABCA1, ATP-binding cassette protein A1; ABCA1 MM, ABCA1 K939M-K1952M; MDR, multidrug resistance; MRP, multidrug resistance-related protein; NBF, nucleotide-binding fold; apo, apolipoprotein; HDL, high density lipoprotein; FC, free cholesterol; PL, phospholipid; PC, phosphatidylcholine; PS, phosphatidylserine; PE, phosphatidylethanolamine; SM, sphingomyelin; PG, phosphatidylglycerol; POPC, 1-palmitoyl-2-oleoylphosphatidylcholine; DPPC, 1,2-dipalmitoylphosphatidylcholine; POPS, 1-palmitoyl-2-oleoylphosphatidylserine; DPPE, 1,2- dipalmitoylphosphatidylethanolamine; DPPG, 1,2-dipalmitoylphosphatidylglycerol; Sf9, Spodoptera frugiperda 9; HEK, human embryo kidney; NGF, N-glycosidase F; DDM, n-dodecyl-beta-D-maltoside; NTA, nitrilotriacetic acid. Login to comment
46 To construct the NBF1 Walker A lysine mutant, ABCA1 K939M, DNA fragments containing a K939M missense mutation were generated by a two-step PCR method with two pairs of primers, 5b18;-GGGCCACAATGGAGCGGGGATGACGACCAC-3b18; and 5b18;-CTGTCCCCCAGGACGTCCGCTTCATCCATG-3b18; and 5b18;-GTG- GTCGTCATCCCCGCTCCATTGTGGCCC-3b18; and 5b18;-CTCAGTG- GCTGTGATCATCAAGGGCATCG-3b18;. Login to comment
114 ABCA1 K939M-K1952M protein, expressed and purified in the same procedure, was as pure as the wild type (Figs. 1B and 2E). Login to comment
145 To confirm that ATPase activity is derived from purified ABCA1, a baculovirus for ABCA1 K939M-K1952M mutant, in which lysine 939 and lysine 1952 in the Walker A motif of nucleotide binding folds were replaced by methionines, was constructed. Login to comment
147 Purified ABCA1 K939M-K1952M protein showed little ATPase activity, less than 10 nmol/min/mg of protein (Fig. 5). Login to comment
162 E, purified ABCA1 K939M-K1952M mutant, 0.5 òe;g (Coomassie Brilliant Blue R-250 staining). Login to comment
208 A, ATPase activity was measured in the presence of various concen- trationsofMgATP.F,wildtype;E,K939M-K1952M mutant. Login to comment
262 Another critical issue in ABCA1-mediated pre-betaHDL formation is the role of apoA-I. Cellular cholesterol and PL efflux mediated by ABCA1 is fully dependent on lipid-free apoA-I. As the ABCA1 K939M mutant, whose Walker A lysine residue is substituted by methionine, is reported to be defect in its interaction with apoA-I, we expected that apoA-I would affect the ATP hydrolysis of ABCA1; however, we found no clear effects of apoA-I on the ATP hydrolysis of purified ABCA1 either before or after reconstitution in liposomes under our examination conditions (Fig. 8). Login to comment

PMID: 16443932 [PubMed] Nofer JR et al: "Apolipoprotein A-I activates Cdc42 signaling through the ABCA1 transporter."

No. Sentence Comment

5 Similar effects were observed in HEK293 cells overexpressing ABCA1-green fluorescent protein (GFP) fusion protein, but not ABCA1-GFP (K939M), which fails to hydrolyze ATP, or a nonfunctional ABCA1-GFP with a truncated C terminus. Login to comment
52 ABCA1-W-GFP variant with the disrupted first Walker A motif of ABCA1 was constructed by PCR-based mutagenesis, creating a missense mutation of K939M. Login to comment
51 ABCA1-W-GFP variant with the disrupted first Walker A motif of ABCA1 was constructed by PCR-based mutagenesis, creating a missense mutation of K939M. Login to comment

PMID: 16158173 [PubMed] Takahashi K et al: "ABC proteins: key molecules for lipid homeostasis."

No. Sentence Comment

103 The Walker A lysine mutation K939M in the first nucleotide-binding fold, resulting in a defect in HDL formation, impaired ATPase activity. Login to comment

PMID: 11309399 [PubMed] Wang N et al: "ATP-binding cassette transporter A1 (ABCA1) functions as a cholesterol efflux regulatory protein."

No. Sentence Comment

27 ABCA1-M-Flag was constructed by polymerase chain reaction-based mutagenesis, which created a missense mutation of K939M and disrupted the first Walker A motif of ABCA1. Login to comment

PMID: 23479619 [PubMed] Nagata KO et al: "ABCA1 dimer-monomer interconversion during HDL generation revealed by single-molecule imaging."

No. Sentence Comment

131 Human ABCA1 and ABCA1-MM (with two point mutations of K939M and K1952M) were fused with EGFP or monomeric (m)EGFP at their carboxyl termini, where an mEGFP mutant was modified from EGFP by introducing a mutation corresponding to an A206K monomeric mutant (33). Login to comment

PMID: 23559627 [PubMed] Wang S et al: "ABCA1 mediates unfolding of apolipoprotein AI N terminus on the cell surface before lipidation and release of nascent high-density lipoprotein."

No. Sentence Comment

3 Although not discovered in a Tangier disease subject, the K939M mutation in the first ATP-binding domain has been shown to be defective in phosphatidylserine translocation, apoAI binding, and cholesterol efflux.9-11 In addition to nHDL, apoAI can spontaneously form reconstituted HDL (rHDL) particles in vitro when incubated with dimyristoylphosphatidylcholine (DMPC) dispersions or liposomes but not when incubated with the physiologically (c) 2013 American Heart Association, Inc. Arterioscler Thromb Vasc Biol is available at http://atvb.ahajournals.org DOI: 10.1161/ATVBAHA.112.301195 Objective-To gain insight into the mechanism by which ABCA1 generates nascent high-density lipoprotein. Login to comment
4 Approach and Results-HEK293 cells were stably transfected with ABCA1 vectors, encoding wild type, and the W590S and C1477R Tangier disease mutation isoforms, along with the K939M ATP-binding domain mutant. Login to comment
6 The W590S isoform had decreased plasma membrane remodeling and lipid efflux activities, and the C1477R isoform had decreased apoAI binding, and lipid efflux activities, whereas the K939M isoform did not bind apoAI, remodel the membrane, or efflux cholesterol. Login to comment
24 HEK293 cells were stably transfected with different murine ABCA1-green fluorescent protein (GFP) fusion vectors encoding WT, K939M, W590S, and C1477R isoforms, the latter 2 identified as Tangier disease-causing mutations in the first and second large extracellular domains, respectively.6 Several clonally derived cell lines from each construction were screened by confocal fluorescence microscopy and flow cytometry to select lines for further study with equivalent ABCA1 expression. Login to comment
25 As previously described,5,9 WT, W590S, C1477R, and K939M ABCA1-GFP fusions were processed correctly in cells and expressed on the plasma membrane (Figure 1A). Login to comment
29 In contrast, the C1477R and K939M isoform-expressing cells had no significant increase in apoAI binding compared with control cells (by ANOVA posttest). Login to comment
31 We were able to take advantage of this nonspecific apoAI binding to the control and the C1477R and K939M isoform-expressing cells in cell studies described below. Login to comment
33 The W590S cells had a small 1.26-fold increase in cell surface PS (P<0.05 versus control by ANOVA posttest), whereas the K939M-ABCA1 isoform had no cell surface PS increase (Figure 2B). Login to comment
39 A, Confocal microscopy of wild type (WT), W590S, C1477R, and K939M ABCA1-GFP isoforms shows cell surface expression. Login to comment
40 B, Similar expression levels of WT, W590S, C1477R, and K939M ABCA1-GFP cell lines shown by flow cytometry (n=3; mean&#b1;SD; different numbers above the bars show P<0.001, by ANOVA posttest). Login to comment
44 In a separate study, we found that the K939M cells had efflux to apoAI similar to the nontransfected control HEK cells, thus they had no detectable ABCA1 activity as had been previously determined.5 In the presence of the weak detergent NaTC, the control HEK cells increased cholesterol efflux to 2.62% (a 5.36-fold increase versus absence of acceptor). Login to comment
62 A, Alexa647-labeled apoAI binding to nontransfected cells (HEK) and cells stably transfected with wild type (WT), W590S, C1477R, and K939M ABCA1-green fluorescent protein (GFP) vectors assayed by flow cytometry (n=3; mean&#b1;SD; P<0.0005 for HEK in the presence or absence of labeled apoAI by t test; for the 5 cell types in the presence of labeled apoAI different numbers above the bars show P<0.001; by ANOVA posttest). Login to comment
69 Here, we took advantage of the high sensitivity of flow cytometry and our observation that even control HEK cells and cells expressing the apoAI-binding defective C1477R and K939M-ABCA1 isoforms bound apoAI nonspecifically, enabling us to determine the Bodipy-TMR/Alexa647 ratio of each cell. Login to comment
72 The C1447R and K939M apoAI-binding deficient mutants displayed intermediate activity with Bodipy-TMR/Alexa647 ratio peaks of 1.0 (1.43-fold increase versus control HEK cells). Login to comment
76 Finally, the defective K939M isoform retains only one activity: apoAI unfolding (also reduced). Login to comment
84 Medium recovered from control HEK cells and the defective K939M-ABAC1 isoform Figure 3. Login to comment
132 Interestingly, the 2 ABCA1 isoforms with impaired apoAI binding, C1447R and K939M, also displayed some, albeit reduced, apoAI unfolding activity compared with nontransfected HEK cells (Figure 4A). Login to comment
133 Because the K939M isoform is also deficient in plasma membrane remodeling, this partial unfolding activity cannot be attributed to this membrane remodeling. Login to comment
152 It is of interest that both the apoAI binding and the plasma membrane remodeling activities are disrupted in the K939M isoform without totally abolishing this apoAI unfolding activity. Login to comment
158 The levels of apoAI in the Int and U states are increased by specific binding to ABCA1, but these apoAI states are still present in cells expressing the C1447C and K939M-ABCA1 isoforms that lack high-affinity apoAI binding. Login to comment

PMID: 24097981 [PubMed] Quazi F et al: "Differential phospholipid substrates and directional transport by ATP-binding cassette proteins ABCA1, ABCA7, and ABCA4 and disease-causing mutants."

No. Sentence Comment

66 Corresponding ABCA4 mutations determined by amino acid alignment with ABCA1 included S100P, W605S, F608L, T959I, N965S, C1502R, T1537M, R2107P, and P2180L. Login to comment
67 ABCA1-MM was constructed to harbor the Walker A-motif lysine-to-methionine mutations K939M/K1952M by the nested PCR method; ABCA4-MM had the corresponding K969M/ K1969M Walker A mutations (37), and ABCA7-MM had the Lipid Transport Activity of ABCA Transporters NOVEMBER 29, 2013ߦVOLUME 288ߦNUMBER 48 JOURNAL OF BIOLOGICAL CHEMISTRY 34415 at SEMMELWEIS UNIV OF MEDICINE on December 3, K847M/K1833M Walker A mutations. Login to comment
69 ABCA1-MM was constructed to harbor the Walker A-motif lysine-to-methionine mutations K939M/K1952M by the nested PCR method; ABCA4-MM had the corresponding K969M/ K1969M Walker A mutations (37), and ABCA7-MM had the Lipid Transport Activity of ABCA Transporters NOVEMBER 29, 2013ߦVOLUME 288ߦNUMBER 48 JOURNAL OF BIOLOGICAL CHEMISTRY 34415 at SEMMELWEIS UNIV OF MEDICINE on December 3, K847M/K1833M Walker A mutations. Login to comment