ABCMdb

PMID: 18782226

Tanaka AR, Kano F, Yamamoto A, Ueda K, Murata M
Formation of cholesterol-enriched structures by aberrant intracellular accumulation of ATP-binding cassette transporter A1.
Genes Cells. 2008 Aug;13(8):889-904., [PubMed]

Sentences

No. Mutations Sentence Comment

14 ABCA1 p.Gln597Arg ABCA1 p.Arg587Trp Previously, we have reported that the defect in HDL assembly in two point mutants of ABCA1 (R587W, Q597R) responsible for familial HDL deficiency is due to the impaired localization to the plasma membrane (Tanaka et al. 2003). Login to comment 73 ABCA1 p.Lys939Met Functional ABCA1 is essential for abnormal cholesterol accumulation in A1 bodies To determine whether ABCA1 function is required for the formation of A1 bodies, we studied the effect of the K939M ABCA1-GFP mutant on A1-body formation. Login to comment 74 ABCA1 p.Lys939Met ABCA1 has ATP binding/hydrolysis activity (Tanaka et al. 2001; Takahashi et al. 2006) and the mutant protein, in which lysine 939 in the Walker A motif of NBF1 is changed to methionine, is known to have lost ABCA1 function (Hamon et al. 2000), that is, the mutant does not have the ability to mediate apoA-I induced cholesterol efflux (Fig. 6A, WT+ and KM+), although both K939M ABCA1-GFP and the wild-type protein localized mainly to the plasma membrane (Fig. 6B, 0 h). Login to comment 75 ABCA1 p.Lys939Met Upon ALLN treatment, K939M ABCA1-GFP was translocated from the plasma membrane to intracellular compartments. Login to comment 110 ABCA1 p.Lys939Met Extracts from HEK-A1WT cells or HEK-K939M cells were analyzed by immunoblotting with anti-ABCA1 antibodies and anti-α-tubulin antibodies. Login to comment 111 ABCA1 p.Lys939Met (B) HEK-A1WT cells and HEK-K939M cells were treated with 10 μm ALLN for the indicated times. Login to comment 205 ABCA1 p.Lys939Met By using the K939M ABCA1-GFP mutant protein, which does not have the ability to mediate apoA-I induced cholesterol release, we confirmed that functional ABCA1-GFP plays a crucial role in the formation of A1 bodies, indicating that ABCA1-GFP has the ability to transport cellular cholesterol into A1 bodies or to keep LDL cholesterol into A1 bodies. Login to comment 294 ABCA1 p.Lys939Met K939M mutant ABCA1-GFP and HA-Rab4 construction Wild-type ABCA1-GFP was constructed as described previously (Tanaka et al. 2003). Login to comment 295 ABCA1 p.Lys939Met The DNA fragment (FbaI-AatII) containing the K939M missense mutation was generated using the polymerase chain reaction method with the following primer pairs: (5'-CTCAGTGGCTGTGATCATCAAGGGCATCG and 5'- GTGGTCGTCaTCCCCGCTCCATTGTGGCCC):(5`-GGGC CACAATGGAGCGGGGAtGACGACCAC and 5'-CTGTCCC CCAGGACGTCCGCTTCATCCATG), where the mutated nucleotide is shown in lower case. Login to comment 299 ABCA1 p.Lys939Met Cell culture, transfection, establishment of stable transfectants and cellular cholesterol release assay HEK293 cells stably expressing wild-type or K939M mutant ABCA1-GFP were selected and maintained in Dulbecco`s modified 902 Eagle`s medium (DMEM) supplemented with 10% fetal calf serum (FCS), 100 U/mL penicillin G, 100 μg/mL streptomycin, 0.25 μg/mL fungizone and 300 μg/mL geneticin at 37 °C in a 5% CO2 incubator. Login to comment