ABCMdb

ABCC2 p.Arg768Trp

ClinVar:	c.2302C>T , p.Arg768Trp D , Pathogenic
Predicted by SNAP2:	A: D (95%), C: D (95%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (91%), L: D (95%), M: D (95%), N: D (95%), P: D (95%), Q: D (95%), S: D (95%), T: D (95%), V: D (95%), W: D (80%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: D, F: D, G: D, H: D, I: D, K: D, L: D, M: D, N: D, P: D, Q: D, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Role of pharmacogenetics of ATP-binding cassette t... Pharmacol Ther. 2006 Nov;112(2):457-73. Cascorbi I
Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs.
Pharmacol Ther. 2006 Nov;112(2):457-73., [PMID:16766035]

Abstract [show]
Interindividual differences of drug response are an important cause of treatment failures and adverse drug reactions. The identification of polymorphisms explaining distinct phenotypes of drug metabolizing enzymes contributed in part to the understanding of individual variations of drug plasma levels. However, bioavailability also depends on a major extent from the expression and activity of drug transport across biomembranes. In particular efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (P-glycoprotein, P-gp), the ABCC (multidrug resistance-related protein, MRP) family and ABCG2 (breast cancer resistance protein, BCRP) have been identified as major determinants of chemoresistance in tumor cells. They are expressed in the apical membranes of many barrier tissue such as the intestine, liver, blood-brain barrier, kidney, placenta, testis and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics and clinical outcome of a variety of drugs. This review focuses on the functional significance of single nucleotide polymorphisms (SNP) of ABCB1, ABCC1, ABCC2, and ABCG2 in in vitro systems, in vivo tissues and drug disposition, as well as on the clinical outcome of major indications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
882 0.01 Exon 2 56 C>T P19L 0.01 Exon 3 234 A>G synonymous 0.01 Exon 3 299 G>A R100Q 0.01 Exon 7 842 G>A S281N 0.01 Exon 10 1249 G>A V417I 0.12 (0.21) Exon 10 1457 C>T T486I 0.03 Exon 18 2302 C>T R768W 0.01 (0.00) Exon 18 2366 C>T S789F 0.01 (0.00) slightly elevated activity, lower expressionb Exon 20 2647 G>A D883N 0.01 Exon 21 2882 A>G K961R 0.01 Exon 22 2934 G>A synonymous 0.05 Exon 22 3039 C>T synonymous 0.01 Exon 22 3057 G>T Q1019H 0.01 Exon 24 3321 G>T synonymous 0.01 Exon 25 3521 G>A R1174H 0.01 Exon 25 3563 T>A V1188E 0.01 Exon 26 3732 C>T N1244K 0.01 Exon 28 3972 C>T synonymous 0.21 (0.34) Exon 29 4100 C>G S1367C 0.01 Exon 30 4290 G>T synonymous 0.01 Exon 31 4348 G>A A1450T 0.01 (0.00) decreased activity, lower expressionb Exon 31 4488 C>T synonymous 0.01 Exon 32 4544 G>A C1515Y 0.01 a Haenisch et al. (in press). Login to comment

[hide] The identification of two germ-line mutations in t... Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21. Yoshioka S, Katayama K, Okawa C, Takahashi S, Tsukahara S, Mitsuhashi J, Sugimoto Y
The identification of two germ-line mutations in the human breast cancer resistance protein gene that result in the expression of a low/non-functional protein.
Pharm Res. 2007 Jun;24(6):1108-17. Epub 2007 Mar 21., [PMID:17373578]

Abstract [show]
PURPOSE: We examined the effects of the nine nonsynonymous germ-line mutations/SNPs in the breast cancer resistance protein (BCRP/ABCG2) gene on the expression and function of the protein. MATERIALS AND METHODS: We generated cDNAs for each of these mutants (G151T, C458T, C496G, A616C, T623C, T742C, T1291C, A1768T, and G1858A BCRP) and compared the effects of their exogenous expression in PA317 cells with a wild-type control. RESULTS: PA/F208S cells (T623C BCRP-transfectants) expressed marginal levels of a BCRP protein species (65kDa), which is slightly smaller than wild-type (70kDa), but this mutant did not appear on the cell surface or confer drug resistance. PA/F431L cells (T1291C BCRP-transfectants) were found to express both 70 kDa and 65 kDa BCRP protein products. In addition, although PA/F431L cells expressed 70 kDa BCRP at comparable levels to PA/WT cells, they showed only marginal resistance to SN-38. PA/T153M cells (C458T BCRP-transfectants) and PA/D620N cells (G1858A BCRP-transfectants) expressed lower amounts of BCRP and showed lower levels of resistance to SN-38 compared with PA/WT cells. CONCLUSIONS: We have shown that T623C BCRP encodes a non-functional BCRP and that T1291C BCRP encodes a low-functional BCRP. Hence, these mutations may affect the pharmacokinetics of BCRP substrates in patients harboring these alleles.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
156 R768W MRP2, which has the amino acid substitution in Signature C of the first ATP binding site of the protein, confers high serum bilirubin concentrations in the affected patients (28), and the mutant protein is not completely glycosylated (29). Login to comment

[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]

Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
101 Several molecular defects in MRP2 have been suggested to result in DJS including those which produce deficient protein maturation (Hashimoto et al., 2002; Keitel et al., 2003), proteasomal degradation (Keitel, 2003), impaired membrane sorting (Hashimoto et al., 2002; Mor-Cohen et al., 2001), loss in transport activity (Mor-Cohen et al., 2001), Figure 2 Predicted membrance topology of MRP2 (ABCC2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 2 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD in out Membrane Pro19Leu Phe39Tyr Arg100* Arg100Gln Ser281Asn Ser325* Asp333Gly Arg353His Arg412Gly Val417Ile Lys430Arg Thr486Ile Gly676Arg Trp709Arg Asn718Ser Ser789Phe Arg768Trp Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* Phe981Leu Gln1019His Arg1066* Arg1150His Arg1100Cys Arg1100His Ile1137Phe Ile1173Phe Val1188Glu Arg1174His Arg1181Leu Asn1244Lys Thr1273Ala Pro1291Leu Lys1299Gln Arg1310* Ser1367Cys Gln1382Arg Arg1392del Met1393del Ala1450Thr Thr1476Met Cys1515Tyr MRP2 (ABCC2) NBD NBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* NBD NBDNBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* 325 Table2MRP2(ABCC2)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Amino acidexchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 56C>TPro19LeuExon2--1[1]b -- 116T>APhe39TyrExon2--0[2]--rs927344 298C>TArg100*Exon3--[3]-DJS[3] 299G>AArg100GlnExon3--1[1]b -- 842G>ASer281AsnExon7-0[4]1[1]b -- 974C>GSer325*Exon8---Malayan[5]DJS[5] 998A>GAsp333GlyExon8--0[2]--rs17222674 1058G>AArg353HisExon9--0[2]--rs7080681 1271A>GArg412GlyExon10-[6]0[2]-DJS;Decreaseinmethotrexateelimination[6] 1249G>AVal417IleExon10-22[7]13[9]-lowermRNAand(protein)expressioninpreterm placenta[11] rs2273697 26[8]16[4]noeffectonRNAandproteinininduodenum[12] 19[10]noeffectonproteininliver[8] noeffectonconjugatedbilirubinlevelinserum[13] changesinlocalizationinneuroepithelialtumors[14] possibleassociationwithtenofovir-inducedrenal proximaltubulopathy[15] 1289A>GLys430ArgExon10-4[16]0[2]-- 1457C>TThr486IleExon10-0[4]3[1]b -- 2026G>CGly676Arg--0[2]-DJS[17] 2125T>CTrp709Arg--0[2]-DJS[17] 2153A>GAsn718SerExon17-0[4]0[2]--rs3740072 2302C>TArg768TrpExon18-0[18]1[9]-DJS;deficientmaturationandimpairedsorting[19] 2366C>TSer789PheExon18-0[18]1[9]-lowerexpressionandmembranelocalization[20] noeffectonconjugatedbilirubinlevelinserum[13]/ heterozygous 2647G>AAsp883AsnExon20--1[1]b -- 2677G>CGlu893GlnExon20--0[2]--rs3740071 2780T>GLeu927ArgExon21-1[10]0[2]-- (Continued) Table2(Continued) Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 2882A>GLys961ArgExon21--1[1]b --- 2901C>ATyr967*Exon22--0[2]--rs17222547 2943C>GPhe981LeuExon22-2[21]0[2]-Noinfluenceonpravastatinkinetics[21] 3057G>TGln1019HisExon22--1[1]b -- 3196C>TArg1066*Exon23-[22]0[2]-DJS;truncatedprotein[22][23] 3298C>TArg1100CysExon24-1[10]0[2]-- 3299G>AArg1100HisExon24-1[10]0[2]-- 3449G>AArg1150HisExon25--0[2]Israeli[24]DJS;impairedtransportactivityintransfectedcells althoughnormalexpressionandlocalization[24] 3517A>TIle1173PheExon25--0[2]Israeli[24]DJS;impairedproteinmaturationandproteasomal degradation[25] lowexpression,mislocation,andimpairedtransport activityintransfectedcells[24] 3521G>AArg1174HisExon25-0[4]1[1]b -- 3542G>TArg1181LeuExon25-0[4]0[2]--rs8187692 3563T>AVal1188GluExon25-7[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4],rs17222723 4[16]associatedwithanthracycline-induced cardiotoxicity[26] 6[8] 3732C>TAsn1244LysExon26--0[1]b -- 0[2] 3817A>GThr1273AlaExon27--0[2]--rs8187699 3872C>TPro1291LeuExon28--0[2]--rs17216317 3897A>CLys1299GlnExon28--0[2]--rs4148400 3928C>TArg1310*Exon28--0[2]-DJS[17,27] 4100C>GSer1367CysExon29--1[1]b -- 4145A>GGln1382ArgExon29--[28]-DJS;noeffectonmaturationorsorting,impaired substrate-inducedATPhydrolysis[19] 4175-80delArg1392delExon30--0[2]-DJS;deficientMRP2maturationandimpaired sortingtoapicalmembraneintransfectedcells[29] 327 4348G>AAla11450ThrExon31-0[18]1[9]-lowerexperssionandmembracelocalizationin transfectedcells[20] 4461C>TThr1476MetExon31-[30]1[2]-- 4544G>ACys1515TyrExon32-9[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4]rs8187710 5[10]associatedwithanthracycline-induced cardiotoxicity[26] 4[16] 6[8] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment

[hide] Pharmacogenetics of intestinal absorption. Curr Drug Deliv. 2008 Jul;5(3):153-69. Nakamura T, Yamamori M, Sakaeda T
Pharmacogenetics of intestinal absorption.
Curr Drug Deliv. 2008 Jul;5(3):153-69., [PMID:18673259]

Abstract [show]
The small intestine is the primary site of absorption for many drugs administered orally and so is the target tissue for pharmacotherapeutic strategies to control the oral absorption of drugs. Drug transporters, including the ATP-binding cassette (ABC) superfamily and the solute carrier (SLC) superfamily, have been considered to play a physiological role in regulating the absorption of xenobiotics, and variations in their expression level and function in the small intestine cause intra- and inter-individual variation in the oral absorption of drugs. Recent advances in molecular biology have suggested that genetic polymorphisms are associated with the expression level and function, and thereby inter-individual variation. In this review, the pharmacogenetics of these transporters is summarized, and their future significance in the clinical setting is discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
34 Arg768Trp induced by 2302C>T resulted in deficient maturation and impaired sorting, whereas Glu1382Arg induced by 4145A>G caused deficient transport [40]. Login to comment
36 Hirouchi and colleagues evaluated the cellular location and function of ABCC2 Val417Ile (1249G>A), Arg768Trp (2302C>T), Ser789Phe (2366C>T), and Ala1450Thr (4348G>A) variants in LLC-PK1 cells, finding that Ser789Phe and Ala1450Thr mutations caused less expression and mislocation [51]. Login to comment

[hide] Pharmacogenetics of ATP-binding cassette transport... Methods Mol Biol. 2010;596:95-121. Cascorbi I, Haenisch S
Pharmacogenetics of ATP-binding cassette transporters and clinical implications.
Methods Mol Biol. 2010;596:95-121., [PMID:19949922]

Abstract [show]
Drug resistance is a severe limitation of chemotherapy of various malignancies. In particular efflux transporters of the ATP-binding cassette family such as ABCB1 (P-glycoprotein), the ABCC (multidrug resistance-associated protein) family, and ABCG2 (breast cancer resistance protein) have been identified as major determinants of chemoresistance in tumor cells. Bioavailability depends not only on the activity of drug metabolizing enzymes but also to a major extent on the activity of drug transport across biomembranes. They are expressed in the apical membranes of many barrier tissues such as the intestine, liver, blood-brain barrier, kidney, placenta, testis, and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics of a variety of anticancer drugs and many others contributing to the clinical outcome of certain leukemias and further malignancies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
190 0.01* (0.00) c. 56 C>T P19L 0.01* c. 234 A>G Synonymous 0.01* c. 299 G>A R100Q 0.01* c. 842 G>A S281N 0.01* c. 1249 G>A V417I 0.13 (0.21) c. 1446 C>G (0.01) c. 1457 C>T T486I 0.03* (0.00) c. 2302 C>T R768W 0.01 (0.00) c. 2366 C>T S789F 0.01 (0.00) c. 2647 G>A D883N 0.01* c. 2882 A>G K961R 0.01* c. 2934 G>A Synonymous 0.05* c. 3039 C>T Synonymous 0.01* c. 3057 G>T Q1019H 0.01* c. 3321 G>T Synonymous 0.01* c. 3521 G>A R1174H 0.01* c. 3542 G>T (0.001) c. 3561 G>A (0.00) c. 3563 T>A V1188E 0.01* (0.05) c. 3732 C>T N1244K 0.01* c. 3972 C>T Synonymous 0.22* (0.34) c. 4100 C>G S1367C 0.01* c. 4290 G>T Synonymous 0.01* c. 4348 G>A A1450T 0.01 (0.00) c. 4488 C>T Synonymous 0.01* c. 4544 G>A C1515Y 0.01* (0.04) association to cholestatic or mixed type hepatitis whereas -24T carriers exhibited more often hepatocellular-type hepatitis after intake of drugs or herbal remedies (96). Login to comment

[hide] Polymorphism of the ABC transporter genes, MDR1, M... Pharmacogenetics. 2001 Mar;11(2):175-84. Ito S, Ieiri I, Tanabe M, Suzuki A, Higuchi S, Otsubo K
Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects.
Pharmacogenetics. 2001 Mar;11(2):175-84., [PMID:11266082]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
37 Four were associated with an amino acid substitution; G to A transversion at position 1249 (G1249A, Val to Ile at codon 417) in exon 10, C to T at 2302 (C2302T, Arg to Trp at 768) and C to T at 2366 (C2366T, Ser to Phe at 789) in exon 18, and G to A at 4348 (G4348A, Ala to Thr at 1450) in exon 31 (position numbering: Taniguchi et al., 1996; Toh et al., 1999) (Fig. 3). Login to comment

[hide] The MRP-related and BCRP/ABCG2 multidrug resistanc... Curr Drug Metab. 2004 Feb;5(1):21-53. Haimeur A, Conseil G, Deeley RG, Cole SP
The MRP-related and BCRP/ABCG2 multidrug resistance proteins: biology, substrate specificity and regulation.
Curr Drug Metab. 2004 Feb;5(1):21-53., [PMID:14965249]

Abstract [show]
Several members of different families of the ATP-binding cassette (ABC) superfamily of transport proteins are capable of transporting an extraordinarily structurally diverse array of endo- and xenobiotics and their metabolites across cell membranes. Together, these transporters play an important role in the absorption, disposition and elimination of these chemicals in the body. In tumor cells, increased expression of these drug transporters is associated with resistance to multiple chemotherapeutic agents. In this review, current knowledge of the biochemical, physiological and pharmacological properties of nine members of the multidrug resistance protein (MRP)-related ABCC family (MRP1, MRP2, MRP3, MRP4, MRP5, MRP6, MRP7, ABCC11 and ABCC12) as well as the G family member, ABCG2/BCRP, are summarized. A focus is placed on the structural similarities and differences of these drug transporters as well as the molecular determinants of their substrate specificities and transport activities. Factors that regulate expression of the MRP-related proteins and ABCG2/BCRP are also reviewed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
373 These include Arg768Trp and Gln1382Arg which have been recently characterized in vitro [275]. Login to comment
376 Inhibitors of MRP2 have been described but few, if any, are known to be highly specific for this transporter alone. studies showed that the maturation and apical localization of the NBD1 MRP2-Arg768Trp mutant was deficient while substrate-induced ATP hydrolysis was impaired in the NBD2 MRP2-Gln1382Arg mutant. Login to comment

[hide] Polymorphisms of MRP1 (ABCC1) and related ATP-depe... Pharmacogenet Genomics. 2005 Aug;15(8):523-33. Conseil G, Deeley RG, Cole SP
Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters.
Pharmacogenet Genomics. 2005 Aug;15(8):523-33., [PMID:16006996]

Abstract [show]
Genetic variations in drug metabolizing enzymes and targets are established determinants of adverse drug reactions and interactions, but less is known about the role of genetic polymorphisms in membrane transport proteins. MRP1 (ABCC1) is one of 13 polytopic membrane proteins that comprise the 'C' subfamily of the ATP-binding cassette (ABC) superfamily of transport proteins. MRP1 and related ABCC family members, including MRP2, 3, 4 and 5 (ABCC2, 3, 4 and 5), each have a distinctive pattern of tissue expression and substrate specificity. Together, these five transporters play important roles in the disposition and elimination of drugs and other organic anions, and in maintenance of blood-tissue barriers, as confirmed by enhanced chemosensitivity of respective knockout mice. Moreover, Mrp2 (Abcc2) deficient animals display mild conjugated hyperbilirubinemia, corresponding to a human condition known as Dubin-Johnson syndrome (DJS). Naturally occurring mutations in MRP/ABCC-related drug transporters have been reported, some of which are non-synonymous single nucleotide polymorphisms. The consequences of the resulting amino acid changes can sometimes be predicted from in vitro site-directed mutagenesis studies or from knowledge of mutations of analogous (conserved) residues in ABCC proteins that cause DJS, Pseudoxanthoma elasticum (ABCC6), cystic fibrosis (CFTR/ABCC7) or persistent hyperinsulinemic hypoglycemia of infancy (SUR1/ABCC8). Continual updating of databases of sequence variants and haplotype analysis, together with in vitro biochemical validation assays and pharmacological studies in knockout animals, should make it possible to determine how genetic variation in the MRP-related transporters contributes to the range of responses to drugs and chemicals observed in different human populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
157 For example, homozygous DJS mutations Arg768Trp (C2302T) and Gln1382Arg (A4145G) are located in NBD1 and NBD2, respectively, and in vitro studies have shown that both mutations have substantial phenotypic consequences [40]. Login to comment
158 Thus, the Arg768Trp mutation impairs maturation and sorting of MRP2 to the apical membrane, whereas the Gln1382Arg mutation decreases organic anion (LTC4) transport and substrate-induced ATP hydrolysis [45]. Login to comment

[hide] Insight in eukaryotic ABC transporter function by ... FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19. Frelet A, Klein M
Insight in eukaryotic ABC transporter function by mutation analysis.
FEBS Lett. 2006 Feb 13;580(4):1064-84. Epub 2006 Jan 19., 2006-02-13 [PMID:16442101]

Abstract [show]
With regard to structure-function relations of ATP-binding cassette (ABC) transporters several intriguing questions are in the spotlight of active research: Why do functional ABC transporters possess two ATP binding and hydrolysis domains together with two ABC signatures and to what extent are the individual nucleotide-binding domains independent or interacting? Where is the substrate-binding site and how is ATP hydrolysis functionally coupled to the transport process itself? Although much progress has been made in the elucidation of the three-dimensional structures of ABC transporters in the last years by several crystallographic studies including novel models for the nucleotide hydrolysis and translocation catalysis, site-directed mutagenesis as well as the identification of natural mutations is still a major tool to evaluate effects of individual amino acids on the overall function of ABC transporters. Apart from alterations in characteristic sequence such as Walker A, Walker B and the ABC signature other parts of ABC proteins were subject to detailed mutagenesis studies including the substrate-binding site or the regulatory domain of CFTR. In this review, we will give a detailed overview of the mutation analysis reported for selected ABC transporters of the ABCB and ABCC subfamilies, namely HsCFTR/ABCC7, HsSUR/ABCC8,9, HsMRP1/ABCC1, HsMRP2/ABCC2, ScYCF1 and P-glycoprotein (Pgp)/MDR1/ABCB1 and their effects on the function of each protein.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
326 Baculovirus-mediated expression in Sf21 insect cells.. Membrane vesicle transport [146] HsMRP2 R768W impaired maturation and sorting to the apical membrane SDM. Login to comment
494 The missense mutation C1302T results in an amino acid exchange, R768W, which causes a deficient maturation of the protein leading to a diminished glycosylation, impaired sorting to the apical membrane and degradation via the proteasome pathway. Login to comment

[hide] Multidrug resistance associated proteins as determ... Curr Drug Metab. 2007 Dec;8(8):787-802. Yu XQ, Xue CC, Wang G, Zhou SF
Multidrug resistance associated proteins as determining factors of pharmacokinetics and pharmacodynamics of drugs.
Curr Drug Metab. 2007 Dec;8(8):787-802., [PMID:18220559]

Abstract [show]
The multidrug resistance associated proteins (MRP1, MRP2, MRP3, MRP4, MRP5, MRP6, MRP7, MRP8 and MRP9) belong to the ATP-binding cassette superfamily (ABCC family) of transporters. They are expressed differentially in the liver, kidney, intestine, brain and other tissues. These transporters are localized to the apical and/or basolateral membrane of the hepatocytes, enterocytes, renal proximal tubule cells and endothelial cells of the blood-brain barrier. Several MRPs (mainly MRP1-3) are associated with tumor resistance which is often caused by an increased efflux and decreased intracellular accumulation of natural product anticancer drugs and other anticancer agents. MRPs transport a structurally diverse array of important endogenous substances and xenobiotics and their metabolites (in particular conjugates) with different substrate specificity and transport kinetics. Most MRPs are subject to induction and inhibition by a variety of compounds. Several nuclear receptors, including pregnane X receptor (PXR), liver X receptor (LXR), and farnesoid receptor (FXR) participate in the regulation of MRPs. MRPs play an important role in the absorption, distribution and elimination of various drugs in the body and thus may affect their efficacy and toxicity and cause drug-drug interactions. MRPs located in the blood-brain barrier can restrict the penetration of compounds into the central nervous system. Mutation of MRP2 causes Dubin-Johnson syndrome, while mutations in MRP6 are responsible for pseudoxanthoma elasticum. More recently, mutations in mouse Mrp6/Abcc6 gene is associated with dystrophic cardiac calcification (DCC), a disease characterized by hydroxyapatite deposition in necrotic myocytes. A single nucleotide polymorphism, 538G>A in the MRP8/ABCC11 gene, is responsible for determination of earwax type. A better understanding of the function and regulating mechanism of MRPs can help minimize and avoid drug toxicity, unfavourable drug-drug interactions, and to overcome drug resistance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
405 Important Single Nucleotide Polymorphisms (SNPs) of MRP Genes MRP Chromosomal location Amino acid variation Nucleotide variation Location References Cys43Ser Thr73Ile G128C C218T Exon2 Exon2 [239] Arg433Ser G1299T Exon10 [258] Gly671Val G2012T Exon16 [259] Arg723Gln G2168A Exon17 [239] MRP1 16p13.11-p13.12 Arg1058Gln G3173A Exon23 [239] C-24T Promoter [100, 239] Val417Ile G1249A Exon10 [100, 238, 239] Gly676Arg G2026C Exon16 [237] Try709Arg T2125C Exon17 [236] Arg768Trp Ser789Phe C2302T C2366T Exon18 Exon18 [100, 238, 239] I1173F R1150H A3517T G3449A Exon25 Exon25 [240] Ile1324Ile C3972T Exon28 [100, 239] MRP2 10q23-24 Ala1450Thr G4348A Exon31 [100, 238, 239] (Table 2) contd…. Login to comment

[hide] Molecular genetics of pseudoxanthoma elasticum: ty... Hum Mutat. 2005 Sep;26(3):235-48. Miksch S, Lumsden A, Guenther UP, Foernzler D, Christen-Zach S, Daugherty C, Ramesar RK, Lebwohl M, Hohl D, Neldner KH, Lindpaintner K, Richards RI, Struk B
Molecular genetics of pseudoxanthoma elasticum: type and frequency of mutations in ABCC6.
Hum Mutat. 2005 Sep;26(3):235-48., [PMID:16086317]

Abstract [show]
Pseudoxanthoma elasticum (PXE) is a systemic heritable disorder that affects the elastic tissue in the skin, eye, and cardiovascular system. Mutations in the ABCC6 gene cause PXE. We performed a mutation screen in ABCC6 using haplotype analysis in conjunction with direct sequencing to achieve a mutation detection rate of 97%. This screen consisted of 170 PXE chromosomes in 81 families, and detected 59 distinct mutations (32 missense, eight nonsense, and six likely splice-site point mutations; one small insertion; and seven small and five large deletions). Forty-three of these mutations are novel variants, which increases the total number of PXE mutations to 121. While most mutations are rare, three nonsense mutations, a splice donor site mutation, and the large deletion comprising exons 23-29 (c.2996_4208del) were identified as relatively frequent PXE mutations at 26%, 5%, 3.5%, 3%, and 11%, respectively. Chromosomal haplotyping with two proximal and two distal polymorphic markers flanking ABCC6 demonstrated that most chromosomes that carry these relatively frequent PXE mutations have related haplotypes specific for these mutations, which suggests that these chromosomes originate from single founder mutations. The types of mutations found support loss-of-function as the molecular mechanism for the PXE phenotype. In 76 of the 81 families, the affected individuals were either homozygous for the same mutation or compound heterozygous for two mutations. In the remaining five families with one uncovered mutation, affected showed allelic compound heterozygosity for the cosegregating PXE haplotype. This demonstrates pseudo-dominance as the relevant inheritance mechanism, since disease transmission to the next generation always requires one mutant allelic variant from each parent. In contrast to other previous clinical and molecular claims, our results show evidence only for recessive PXE. This has profound consequences for the genetic counseling of families with PXE.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
290 R760W in ABCC6 aligns with R768W in ABCC2, and R765Q in ABCC6 is comparable with R560T in ABCC7. Login to comment

[hide] Does the A118G polymorphism at the mu-opioid recep... Anesthesiology. 2002 Oct;97(4):814-9. Lotsch J, Zimmermann M, Darimont J, Marx C, Dudziak R, Skarke C, Geisslinger G
Does the A118G polymorphism at the mu-opioid receptor gene protect against morphine-6-glucuronide toxicity?
Anesthesiology. 2002 Oct;97(4):814-9., [PMID:12357145]

Abstract [show]
BACKGROUND: Some, but not all, patients with renal dysfunction suffer from side effects after morphine administration because of accumulation of the active metabolite morphine-6-glucuronide (M6G). The current study aims to identify genetic causes that put patients at risk for, or protect them from, opioid side effects related to high plasma M6G. Candidate genetic causes are the single nucleotide polymorphism (SNP) A118G of the mu-opioid-receptor gene (OPRM1), which has recently been identified to result in decreased potency of M6G, and mutations in the MDR1-gene coding P-glycoprotein, of which morphine and M6G might be a substrate. METHODS: Two men, aged 87 and 65 yr, with renal failure (creatinine clearance of 6 and 9 ml/min) received 30 mg/day oral morphine for pain treatment. Both patients had sufficient analgesia from morphine. However, while one patient tolerated morphine well despite high plasma M6G of 1735 nM, in the patient with M6G plasma concentrations of 941 nM it caused severe sleepiness and drowsiness. Patients were genotyped for known SNPs of the OPRM1 and MDR1 genes. RESULTS: The patient who tolerated morphine well despite high plasma M6G was a homozygous carrier of the mutated G118 allele of the mu-opioid-receptor gene, which has been previously related to decreased M6G potency. In contrast, the patient who suffered from side effects was "wild-type" for this mutation. No other differences were found between the OPRM1 and MDR1 genes. CONCLUSIONS: The authors hypothesize that the A118G single nucleotide polymorphism of the mu-opioid-receptor is among the protective factors against M6G-related opioid toxicity. The observation encourages the search for pharmacogenetic reasons that cause interindividual variability of the clinical effects of morphine.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
106 33 T/T T/T MDR1 2 A61G Asn21Asp 11.2 20.6 9 A/G A/G Forward: 5Ј-AGG AGC AAA GAA GAA GAA CTT TTT TAA ACT GAT C-3Ј 9.3 17.6 8 Reverse: 5Ј-GAT TCC AAA GGC TAG CTT GC-3Ј 5 T307C Phe103Leu 0.6 1.2 9 T/T T/T Forward: 5Ј-GTG GTT GCA CAC AGT CAG CA-3Ј Reverse: 5Ј-GGA GGA TGT CTA ATT ACC TGG TCA-3Ј 11 G1199A Ser400Asn 5.5 11.1 9 G/G G/G Forward: 5Ј-CAG CTA TTC GAA GAG TGG GC-3Ј 6.5 12.9 8 Reverse: 5Ј-CCG TGA GAA AAA AAC TTC AAG G-3Ј 21 G2677T Ala893Ser 41.6 49.2 9 T/T T/T Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј 63.9 43.4 8 Reverse: 5Ј-GTT TGA CTC ACC TTC CCA G-3Ј 21 G2677A Ala893Thr 0.9 2 9 NA NA Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј Reverse: 5Ј-TTT AGT TTG ACT CAC CTT CCC G-3Ј 26 A3320C Gln1107Pro 0.2 0.4 9 A/A A/A 26 C3396T Ala1132Ala 0.3 0.5 8 C/C C/C Forward: 5Ј-ATC TGT GAA CTC TTG TTT TCA GC-3Ј 26 C3435T Ile1145Ile 50.3 47.7 8 T/T T/T Reverse: 5Ј-TCG ATG AAG GCA TGT ATG TTG-3Ј 53.9 50.5 9 - - MRP2 10 G1249A Val417Ile 12.5 20.8 34 G/G G/G Forward: 5Ј-GGG TCC TAA TTT CAA TCC TTA-3Ј Reverse: 5Ј-TAT TCT TCT GGG TGA CTT TTT-3Ј 18 C2302T Arg768Trp 1 2.1 34 C/C C/C Forward: 5Ј-GGA GTA GTG CTT AAT ATG AAT-3Ј 18 C2366T Ser789Phe 1 2.1 34 C/C C/C Reverse: 5Ј-CCC ACC CCA CCT TTA TAT CTT-3Ј 28 C3972T Ile132Ile 21.9 35.4 34 C/T C/T Forward: 5Ј-TGC TAC CCT TCT CCT GTT CTA-3Ј Reverse: 5Ј-ATC CAG GCC TTC CTT CAC TCC-3Ј 31 G4348A Ala1450Thr 1 2.1 34 G/G G/G Forward: 5Ј-AGG AGC TAA CAC ATG GTT GCT-3Ј Reverse: 5Ј-GGG TTA AGC CAT CCG TGT CAA-3Ј † Sequence is not translated. Login to comment

[hide] A T3587G germ-line mutation of the MDR1 gene encod... Mol Cancer Ther. 2006 Apr;5(4):877-84. Mutoh K, Mitsuhashi J, Kimura Y, Tsukahara S, Ishikawa E, Sai K, Ozawa S, Sawada J, Ueda K, Katayama K, Sugimoto Y
A T3587G germ-line mutation of the MDR1 gene encodes a nonfunctional P-glycoprotein.
Mol Cancer Ther. 2006 Apr;5(4):877-84., [PMID:16648557]

Abstract [show]
The human multidrug resistance gene 1 (MDR1) encodes a plasma membrane P-glycoprotein (P-gp) that functions as an efflux pump for various structurally unrelated anticancer agents. We have identified two nonsynonymous germ-line mutations of the MDR1 gene, C3583T MDR1 and T3587G MDR1, in peripheral blood cell samples from Japanese cancer patients. Two patients carried the C3583T MDR1 allele that encodes H1195Y P-gp, whereas a further two carried T3587G MDR1 that encodes I1196S P-gp. Murine NIH3T3 cells were transfected with pCAL-MDR-IRES-ZEO constructs carrying either wild-type (WT), C3583T, or T3587G MDR1 cDNA and selected with zeocin. The resulting zeocin-resistant mixed populations of transfected cells were designated as 3T3/WT, 3T3/H1195Y, and 3T3/I1196S, respectively. The cell surface expression of I1196S P-gp in 3T3/I1196S cells could not be detected by fluorescence-activated cell sorting, although low expression of I1196S P-gp was found by Western blotting. H1195Y P-gp expression levels in 3T3/H1195Y cells were slightly lower than the corresponding WT P-gp levels in 3T3/WT cells. By immunoblotting analysis, both WT P-gp and H1195Y P-gp were detectable as a 145-kDa protein, whereas I1196S P-gp was visualized as a 140-kDa protein. 3T3/I1196S cells did not show any drug resistance unlike 3T3/H1195Y cells. Moreover, a vanadate-trap assay showed that the I1196S P-gp species lacks ATP-binding activity. Taken together, we conclude from these data that T3587G MDR1 expresses a nonfunctional P-gp and this is therefore the first description of such a germ-line mutation. We contend that the T3587G MDR1 mutation may affect the pharmacokinetics of MDR1-related anticancer agents in patients carrying this allele.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
190 R768W MRP2, which has an amino acid substitution in signature C of the first ATP-binding site of the protein, is associated with relatively high serum bilirubin concentrations in affected patients (38) and this mutant protein is not properly glycosylated (36). Login to comment

[hide] Influence of polymorphisms of ABCB1 and ABCC2 on m... Pharmacogenomics J. 2007 Feb;7(1):56-65. Epub 2006 Jun 20. Haenisch S, Zimmermann U, Dazert E, Wruck CJ, Dazert P, Siegmund W, Kroemer HK, Warzok RW, Cascorbi I
Influence of polymorphisms of ABCB1 and ABCC2 on mRNA and protein expression in normal and cancerous kidney cortex.
Pharmacogenomics J. 2007 Feb;7(1):56-65. Epub 2006 Jun 20., [PMID:16788565]

Abstract [show]
There is increasing evidence that polymorphisms of the adenosine 5' triphosphate membrane transporters ABCB1 (P-glycoprotein, MDR1) may affect expression and function, whereas less information is available about the impact of ABCC2 (multidrug resistance-associated protein (MRP2)) single-nucleotide polymorphisms . Particularly, their role in human kidney for drug elimination and in the etiology of renal cell carcinoma is poorly understood. ABCB1 and ABCC2 mRNA and protein expression levels were determined by real-time polymerase chain reaction or immunohistochemistry in kidney cancer and adjacent unaffected cortex tissue of 82 nephrectomized renal cell cancer (RCC) patients (63 clear-cell RCC (CCRCC), 19 non-CCRCC). The DNA of all patients was genotyped for ABCB1 -2352G>A, -692T>C, 2677G>T/A (Ala893Ser/Thr), and 3435C>T, and ABCC2 -24C>T, 1249G>A (Val417Ile) and 3972C>T. ABCB1 and ABCC2 were less expressed in CCRCC than in normal cortex on mRNA as well as on protein level. Although the overall genotype frequency distribution did not differ between the patients and a matched control group, ABCB1 2677T/A and 3435T genotypes were associated with higher (P=0.02 and P=0.04) and ABCC2 -24 T with lower mRNA levels in normal tissues (0.03). The expression of ABCB1 and ABCC2 was not related to genetic variants in RCC tissue. In a reporter gene assay in HepG2 cells, the ABCC2 -24T construct showed an 18.7% reduced activity (P=0.003). In conclusion, ABCB1 and ABCC2 genotypes modulate the expression in the unaffected renal cortex of RCC patients, possibly contributing to inter-individual differences in drug and xenobiotics elimination. Their role in RCC cancer susceptibility or chemotherapy resistance needs further elucidation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 The earlier described ABCC2 SNPs, namely 2302C4T (Arg768Trp), 2366C4T (Ser789Phe) and 4348G4A (Ala1450Thr),43 could not be found in our Caucasian volunteers (data not shown). Login to comment

[hide] Molecular aspects of organic compound transport ac... J Gastroenterol Hepatol. 1999 May;14(5):405-12. Kamisako T, Gabazza EC, Ishihara T, Adachi Y
Molecular aspects of organic compound transport across the plasma membrane of hepatocytes.
J Gastroenterol Hepatol. 1999 May;14(5):405-12., [PMID:10355502]

Abstract [show]
Many organic compounds are taken up from the blood by membrane transporters, taken across the sinosuidal membrane of hepatocytes and then excreted into bile via the bile canalicular membrane. The hepatic uptake of conjugated bile acids is mediated by the sodium taurocholate cotransporting polypeptide. Many organic anions and bulky organic cations are incorporated into hepatocytes by the organic anion transporting polypeptide, while small organic cations are transported by the organic cation transporter. At the canalicular membrane, organic compounds are excreted into bile by ATP-binding cassette transporters which hydrolyse ATP to ADP. Excretion of monovalent bile acids is mediated by the canalicular bile salt transporter and that of organic anions, including divalent bile acid, conjugates, are mediated by the multi-drug resistance-associated protein 2, also termed canalicular multi-specific organic anion transporter. Organic cations are excreted into bile by the multi-drug resistance gene product (MDR) 1 and phospholipids are excreted by MDR3 (mdr2 in mice and rats). The clinical syndromes associated with alterations of these transporters are also discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
72 Studies carried out using antibodies raised against the C-terminal of MRP2 failed to demonstrate the presence of MRP2 in the canalicular membrane of a patient with Dubin-Johnson syndrome, suggesting that the lack of MRP2 is the cause of this syndrome.46 Recently, various gene abnormalities have been reported in a patient with Dubin-Johnson syndrome: a R768W, R1066X and splicing abnormality (1669del147) each in a homozygote, and a compound heterozygote with R768W and 2272del168.50,51 Bile acid transport In the early 1980s, potential-dependent transport in the canalicular membrane was reported to be involved in bile acid excretion from hepatocytes into bile.52 However,the physiological membrane potential (-35--40 mV) in hepatocytes is not high enough to create a concentration gradient between blood and bile (100-1000-fold difference required). Login to comment

[hide] ATP-binding cassette transporters as pharmacogenet... Clin Chim Acta. 2012 Sep 8;413(17-18):1326-37. Epub 2011 Oct 5. Shuker N, Bouamar R, Weimar W, van Schaik RH, van Gelder T, Hesselink DA
ATP-binding cassette transporters as pharmacogenetic biomarkers for kidney transplantation.
Clin Chim Acta. 2012 Sep 8;413(17-18):1326-37. Epub 2011 Oct 5., [PMID:21996082]

Abstract [show]
Immunosuppressive drugs used in organ transplantation are highly effective in preventing acute rejection. However, the clinical use of these drugs is complicated by the fact that they display highly variable pharmacokinetics and pharmacodynamics between individual patients. The influence of genetic variation on the interindividual variability in immunosuppressive drug disposition, efficacy, and toxicity has been explored in recent years. The polymorphically-expressed ATP-binding cassette (ABC) transporter proteins, in particular ABCB1 and ABCC2, have been investigated extensively because they play an important role in the absorption, distribution and elimination of many immunosuppressive drugs in use today. From these studies it can be concluded that polymorphisms in ABCB1 and ABCC2 have no consistent effect on immunosuppressant pharmacokinetics and toxicity although polymorphisms in ABCB1 appear to be related to the risk of developing calcineurin inhibitor-related nephrotoxicity. However, the latter needs to be replicated before an individual's ABCB1 genotype can become a useful marker that is applied in clinical practice. Future studies evaluating the influence of ABC transporter gene polymorphisms should explore the relationship with intracellular rather than systemic drug concentrations further in well-designed clinical studies. Until then, single-nucleotide polymorphisms in ABC transporter genes are not suitable to act as biomarkers for solid organ transplantation.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
870 Several other ABCC2 SNPs such as 2302CNT (Arg768Trp), 2366CNT (Ser789Phe; both in exon 18), and the 4348GNA (Ala1450Th; in exon 31) were not found in this population whereas their allele frequency in an Asian population was about 1% [8,48,49]. Login to comment

[hide] Sustained intrahepatic glutathione depletion cause... Biochim Biophys Acta. 2012 Jun;1822(6):980-7. Epub 2012 Feb 8. Sekine S, Mitsuki K, Ito K, Kugioka S, Horie T
Sustained intrahepatic glutathione depletion causes proteasomal degradation of multidrug resistance-associated protein 2 in rat liver.
Biochim Biophys Acta. 2012 Jun;1822(6):980-7. Epub 2012 Feb 8., [PMID:22330094]

Abstract [show]
Multidrug resistance-associated protein 2 (MRP2) is a member of a family of efflux transporters that are involved in biliary excretion of organic anions from hepatocytes. Disrupted canalicular localization and decreased protein expression of MRP2 have been observed in patients with chronic cholestatic disorder and hepatic failure without a change in its mRNA expression. We have previously demonstrated that post-transcriptional regulation of the rapid retrieval of rat MRP2 from the canalicular membrane to the intracelluar compartment occurs under conditions of acute (~30min) oxidative stress. However, it is unclear whether MRP2 expression is decreased during its sustained internalization during chronic oxidative stress. The present study employed buthionine sulfoximine (BSO) to induce chronic oxidative stress in the livers of Sprague-Dawley rats and then examined the protein expression and localization of MRP2. Canalicular MRP2 localization was altered by BSO treatment for 2h without changing the hepatic protein expression of MRP2. While the 8h after exposure to BSO, hepatic MRP2 protein expression was decreased, and the canalicular localization of MRP2 was disrupted without changing the mRNA expression of MRP2. The BSO-induced reduction in MRP2 protein expression was suppressed by pretreatment with N-benzyloxycarbonyl (Cbz)-Leu-Leu-leucinal ( MG-132), a proteasomal inhibitor. Furthermore, the modification of MRP2 by small ubiquitin-relatedmodifier 1 (SUMO-1) was impaired in BSO-treated rat liver,while that by ubiquitin (Ub) and MRP2 was enhanced. Taken together, the results of this study suggest the sustained periods of low GSH content coupled with altered modification of MRP2 by Ub/SUMO-1 were accompanied by proteasomal degradation of MRP2.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
19 Certain DJS mutations (e.g., missence mutations R768W and I1173F; deletion mutation R1392, M1393) have been reported to cause defects in canalicular sorting and rapid proteasomal degradation of the hMRP2 protein [2-4]. Login to comment

[hide] Genetic association analysis of transporters ident... Pharmacogenet Genomics. 2012 Jun;22(6):447-65. Grover S, Gourie-Devi M, Bala K, Sharma S, Kukreti R
Genetic association analysis of transporters identifies ABCC2 loci for seizure control in women with epilepsy on first-line antiepileptic drugs.
Pharmacogenet Genomics. 2012 Jun;22(6):447-65., [PMID:22565165]

Abstract [show]
OBJECTIVE: The ATP-binding cassette (ABC) superfamily of transporters is known to efflux antiepileptic drugs (AEDs) primarily in the brain, gastrointestinal tract, liver, and kidneys. In addition, they are also known to be involved in estrogen disposition and may modulate seizure susceptibility and drug response. The objective of the present study was to investigate the role of genetic variants from ABC transporters in seizure control in epilepsy patients treated with monotherapy of first-line AEDs for 12 months. METHODS: On the basis of gene coverage and functional significance, a total of 98 single nucleotide polymorphisms from ABCB1, ABCC1, and ABCC2 were genotyped in 400 patients from North India. Of these, 216 patients were eligible for therapeutic assessment. Genetic variants were compared between the 'no-seizures' and the 'recurrent-seizures' groups. Bonferroni corrections for multiple comparisons and adjustment for covariates were performed before assessment of associations. RESULTS: Functionally relevant promoter polymorphisms from ABCC2: c.-1549G>A and c.-1019A>G either considered alone or in haplotype and diplotype combinations were observed for a significant association with seizure control in women (odds ratio>3.5, P<10, power>95%). Further, low protein-expressing CGT and TGT (c.-24C>T, c.1249G>A, c.3972C>T) haplotypes were always observed to be present in combination with the AG (c.-1549G>A, c.-1019A>G) haplotype that was over-represented in women with 'no seizures'. CONCLUSION: The distribution of the associated variants supports the involvement of ABCC2 in controlling seizures in women possibly by lowering of its expression. The biological basis of this finding could be an altered interaction of ABCC2 with AEDs and estrogens. These results necessitate replication in a larger pool of patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
89 - 24C > T 50 UTR k Promoter activity [haplotype containing (- 1549A)-(- 24T)] [33] k mRNA expression [29] m Expression and activity [35] m Expression [haplotype containing (- 24C)-1249A- 3972C] [36] k Expression [haplotype containing (- 24C)- 1249G- 3972T, (-24T)-1249G- 3972C or (-24T)-1249G- 3972T] [36] k Clearance of mycophenolic acid [35] k Clearance of methotrexate [37] k Clearance of irinotecan (ABCC2*2 containing the wild-type C allele) [29] 0.137 5 rs4919395 chr10:101542963 c.33 + 329G > A Intron 1 0.384 6 rs2756104 chr10:101544026 c.34 - 339C > T Intron 1 0.392 7 rs927344 chr10:101544447 c.116T > A Exon 2 (Phe39Tyr) 0.000 8 rs4148385 chr10:101548177 c.207+ 3639C > A Intron 2 0.382 9 rs2180990 chr10:101548974 c.208 - 3017C > G Intron 2 0.392 10 rs35191126 chr10:101549533:34 c.208 - 2458_208 - 2457G > delG Intron 2 0.384 11 rs4148389 chr10:101549911 c.208 - 2080A > G Intron 2 0.396 12 rs2804400 chr10:101553259 c.334 - 49C > T Intron 3 0.394 13 rs2756109 chr10:101558746 c.868 - 218T > G Intron 7 0.364 14 rs7080681 chr10:101560169 c.1058G > A Exon 9 (Arg353His) 0.000 15 rs2273697 chr10:101563815 c.1249G > A Exon 10 (Val417Ile) m mRNA expression [38] m Expression [haplotype containing (- 24C)-1249A- 3972C] [36] k Expression [haplotype containing (- 24C)- 1249G- 3972T, (-24T)-1249G- 3972C or (-24T)-1249G- 3972T] [36] k Clearance of irinotecan (ABCC*2 containing G allele) [34] 0.271 16 rs113646094 chr10:101564012 c.1446C > G Exon 10 (Thr482Thr) m mRNA expression [39] 0.002 17 rs2073337 chr10:101567426 c.1668 + 148A > G Intron 12 0.388 18 rs2756114 chr10:101569483 c.1816 - 408T > C Intron 13 0.393 19 rs3740074 chr10:101571528 c.1967+ 169T > C Intron 15 0.368 20 rs4148394 chr10:101572343 c.1968 - 432A > C Intron 15 0.206 21 rs3740072 chr10:101577123 c.2153A > G Exon 17 (Asn718Ser) 0.000 22 rs56199535 chr10:101578577 c.2302C > T Exon 18 (Arg768Trp) 0.000 23 rs56220353 chr10:101578641 c.2366C > G/T Exon 18 (Ser789Cys/Phe) k Activity, k expression and impaired membrane localization [40] 0.000 24 rs2002042 chr10:101587931 c.2621 - 2133C > T Intron 19 0.204 25 rs11442349 chr10:101589215:16 c.2621 - 849_2621 - 848T > delT Intron 19 0.375 26 rs3740071 chr10:101590120 c.2677C > G Exon 20 (Gln893Glu) 0.000 27 rs7898096 chr10:101593385 c.3259 -752G > A Intron 23 0.000 28 rs17216345 chr10:101594274 c.3396T > C Exon 24 (Ile1132Ile) 0.027 29 rs72558200 chr10:101595882 c.3449 G > A Exon 25 (Arg1150His) 0.000 30 rs72558201 chr10:101595950 c.3517 A > T Exon 25 (Ile1173Phe) 0.000 31 rs8187692 chr10:101595975 c.3542G > T Exon 25 (Leu1181Arg) 0.000 32 rs17222723 chr10:101595996 c.3563T > A Exon 25 (Val1188Glu) m Expression [41] 0.016 ABCC2 polymorphism and response to AEDs Grover et al. 451 or liver functioning. Login to comment

[hide] Functional analysis of nonsynonymous single nucleo... Pharmacogenet Genomics. 2011 Aug;21(8):506-15. Megaraj V, Zhao T, Paumi CM, Gerk PM, Kim RB, Vore M
Functional analysis of nonsynonymous single nucleotide polymorphisms of multidrug resistance-associated protein 2 (ABCC2).
Pharmacogenet Genomics. 2011 Aug;21(8):506-15., [PMID:21691255]

Abstract [show]
BACKGROUND: Multidrug resistance-associated protein 2 (MRP2; ABCC2) mediates the biliary excretion of glutathione, glucuronide, and sulfate conjugates of endobiotics and xenobiotics. Single nucleotide polymorphisms (SNPs) of MRP2 contribute to interindividual variability in drug disposition and ultimately in drug response. OBJECTIVES: To characterize the transport function of human wild-type (WT) MRP2 and four SNP variants, S789F, A1450T, V417I, and T1477M. METHODS: The four SNP variants were expressed in Sf9 cells using recombinant baculovirus infection. The kinetic parameters [Km, (mumol/l); V(max), (pmol/mg/min); the Hill coefficient] of ATP-dependent transport of leukotriene C(4) (LTC(4)), estradiol-3-glucuronide (E(2)3G), estradiol-17beta-glucuronide (E(2)17G), and tauroursodeoxycholic acid (TUDC) were determined in Sf9-derived plasma membrane vesicles. Transport activity was normalized for expression level. RESULTS: The V(max) for transport activity was decreased for all substrates for S789F, and for all substrates except E(2)17G for A1450T. V417I showed decreased apparent affinity for LTC(4), E(2)3G, and E(2)17G, whereas transport was similar between wild-type (WT) and T1477M, except for a modest increase in TUDC transport. Examination of substrate-stimulated MRP2-dependent ATPase activity of S789F and A1450T, SNPs located in MRP2 nucleotide-binding domains (NBDs), demonstrated significantly decreased ATPase activity and only modestly decreased affinity for ATP compared with WT. CONCLUSION: SNPs in the NBDs (S789F in the D-loop of NBD1, or A1450T near the ABC signature motif of NBD2) variably decreased the transport of all substrates. V417I in membrane spanning domain 1 selectively decreased the apparent affinity for the glutathione and glucuronide conjugated substrates, whereas the T1477M SNP in the carboxyl terminus altered only TUDC transport.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
183 Expression of S789F (located in NBD1) was decreased to 59% of that of WT MRP2; a nearby but different mutation in NBD1 (R768W) of MRP2 was shown to be localized in the cytoplasm with an endoplasmic reticulum-like distribution [50]. Login to comment

[hide] Mutational analysis of ABCC2 gene in two siblings ... Clin Genet. 2010 Dec;78(6):598-600. doi: 10.1111/j.1399-0004.2010.01497.x. Pacifico L, Carducci C, Poggiogalle E, Caravona F, Antonozzi I, Chiesa C, Maggiore G
Mutational analysis of ABCC2 gene in two siblings with neonatal-onset Dubin Johnson syndrome.
Clin Genet. 2010 Dec;78(6):598-600. doi: 10.1111/j.1399-0004.2010.01497.x., [PMID:21044052]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
27 Mutation analysis showed that both siblings were compound heterozygous for missense mutation on exon 18: p.R768W (c.2302 C>T) and nonsense mutation on exon 23 p.R1066X (c.3196 C>T). Login to comment
28 The study of allelic segregation in Letter to the Editor R100X R393W IVS6_IVS7del L441M IVS13 +2 T>A IVS15 +2 T>C G676R IVS18 +2 T>C R768W * 2748_2883del * R1066X * 3399_3400del L1173F 3615_3843del* Y1275X * R1310X Q1382R R1392_M1393del S325X W709R T1273A IVS8 +4 A>G 1256_1272delins CT 4292_4293delR1150H E1352Q * Exon 1 32 Fig. 1. Login to comment
37 In particular, the missense mutation (p.R768W) has been identified in homozygosis as well as in compound heterozygosis in different populations (Japanese, Caucasian) (4, 11-15), suggesting that this is a common allele in the DJS patients. Login to comment
42 The missense mutation R768W found in our patients is indeed located in the Walker C motif of the first ABC domain. Login to comment
43 Immunochemical data by Hashimoto et al. (16) in a DJS patient with the R768W mutation have shown that MRP2 protein could not be expressed in the canalicular membrane of hepatocytes of such patient Pulse chase analysis revealed that the precursor form of the wild-type MRP2 were converted to the mature form, which is resistant to endoglycosidase H in about 60 min while the precursor form of the R768W MRP2, which is sensitive to endoglycosidase H, was rapidly degraded within 120 min and did not mature to the fully glycosylated form (16). Login to comment
44 Thus the mutation R768W MRP2 appears to block the maturation process of MRP2 protein during membrane sorting, plausibly from endoplasmic reticulum to the Golgi apparatus. Login to comment
47 In this case our patients will result functionally hemyzygotes for R768W mutation. Login to comment
51 In that vein, it may be of interest that Toh et al. found higher bilirubin levels in patients with R768W mutation compared to those with other mutations, and they also suggested that this mutation might cause more severe disruption of the transporter activity (4). Login to comment
101 Materna V, Lage H. Homozygous mutation Arg768Trp in the ABC-transporter encoding gene MRP2/cMOAT/ABCC2 causes Dubin-Johnson syndrome in a Caucasian patient. Login to comment

[hide] ABCC2/Abcc2: a multispecific transporter with domi... Drug Metab Rev. 2010 Aug;42(3):402-36. Jemnitz K, Heredi-Szabo K, Janossy J, Ioja E, Vereczkey L, Krajcsi P
ABCC2/Abcc2: a multispecific transporter with dominant excretory functions.
Drug Metab Rev. 2010 Aug;42(3):402-36., [PMID:20082599]

Abstract [show]
ABCC2/Abcc2 (MRP2/Mrp2) is expressed at major physiological barriers, such as the canalicular membrane of liver cells, kidney proximal tubule epithelial cells, enterocytes of the small and large intestine, and syncytiotrophoblast of the placenta. ABCC2/Abcc2 always localizes in the apical membranes. Although ABCC2/Abcc2 transports a variety of amphiphilic anions that belong to different classes of molecules, such as endogenous compounds (e.g., bilirubin-glucuronides), drugs, toxic chemicals, nutraceuticals, and their conjugates, it displays a preference for phase II conjugates. Phenotypically, the most obvious consequence of mutations in ABCC2 that lead to Dubin-Johnson syndrome is conjugate hyperbilirubinemia. ABCC2/Abcc2 harbors multiple binding sites and displays complex transport kinetics.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 Interestingly, two missense mutations, R768W and Q1382R, of the nucleotide-binding domains (NBDs) behaved differently. Login to comment
89 However, the precursor form of the R768W remained sensitive to Endo H and was degraded within 120 minutes (Hashimoto et al., 2002). Login to comment

[hide] Influence of genetic polymorphisms on intestinal e... Pharmacogenet Genomics. 2008 Apr;18(4):357-65. Haenisch S, May K, Wegner D, Caliebe A, Cascorbi I, Siegmund W
Influence of genetic polymorphisms on intestinal expression and rifampicin-type induction of ABCC2 and on bioavailability of talinolol.
Pharmacogenet Genomics. 2008 Apr;18(4):357-65., [PMID:18334920]

Abstract [show]
OBJECTIVES: To evaluate whether ABCC2 gene polymorphisms are associated with expression and/or function of the efflux pump. METHODS: We investigated the allele frequency of ABCC2 -24C>T, -23G>A, c.1249G>A, c.1446C>G, c.1457C>T, c.2302C>T, c.2366C>T, c.3542G>T, c.3561G>A, c.3563T>A, c.3972C>T, c.4348G>A, and 4544G>A in 374 nonrelated German healthy volunteers and determined the impact on duodenal mRNA and protein content of ABCC2. For functional analysis, the disposition of intravenously (30 mg) and orally administered talinolol (100 mg) was measured among 31 individuals. Moreover, the effects of rifampicin-type induction (600 mg, 8 days) of duodenal ABCC2 were quantified in 22 participants with regard to genetic polymorphisms. RESULTS: The allele frequencies were 18.3% (-24T), 21.1% (1249A), 1.4% (1446G), 0.1% (3542T), 4.5% (3563A), 34.2% (3972T), and 4.4% (4544A); carriers of -23G>A, 1457C>T, 2302C>T, 2366C>T, 3561G>A, and 4348G>A were not identified. The -24T allele was in strong linkage with 3972T, and 3563A with 4544A, whereas 1249A was weakly linked with other variant alleles. None of the single nucleotide polymorphisms investigated influenced significantly intestinal ABCC2 mRNA and protein content. The variant ABCC2 1249G>A (V417I), however, was associated with lower oral bioavailability (P=0.001), and increased residual clearance of intravenous talinolol (P=0.021). Intestinal ABCC2 mRNA and protein expression were upregulated by rifampicin treatment, a genetic influence could be detected in only four cases heterozygote for 3563T>A or 4544G>A. CONCLUSION: The 1249G>A (V417I) polymorphism is obviously associated with higher activity of the intestinal transporter.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
38 Genotyping The ABCC2 SNPs -24C > T (rs717620), c.1249G > A (V417I, rs2273697), c.2302C > T (Arg768Trp), c.2366C > T (Ser789Phe), c.3972C > T (I1324I, rs3740066), c.4348G > A (Ala1450Thr) were genotyped using PCR-restriction fragment length polymorphism (RFLP) analysis. Login to comment

[hide] Genetic background of Japanese patients with adult... Hepatol Res. 2007 Oct;37(10):777-83. Epub 2007 May 22. Hayashi H, Wakusawa S, Yano M, Okada T
Genetic background of Japanese patients with adult-onset storage diseases in the liver.
Hepatol Res. 2007 Oct;37(10):777-83. Epub 2007 May 22., [PMID:17517077]

Abstract [show]
In contrast to primary lysosomal diseases in young subjects, adult-onset liver storage disorders may be explained by non-lysosomal genetic defects. The aim of the present review is to summarize the genetic backgrounds of Japanese patients with hemochromatosis of unknown etiology, Wilson disease of primary copper toxicosis, and the black liver of Dubin-Johnson syndrome. Three patients with middle-age onset hemochromatosis were homozygous for mutations of HJV and two patients were homozygous for mutations of TFR2. Minor genes other than HJV and TFR2 might be involved in Japanese patients. Five of the six patients with Wilson disease were compound heterozygous, while the remaining patient was heterozygous for the mutation in ATP7B responsible for copper toxicosis. Involvement of MURR1 was not proved in the heterozygote of ATP7B. Because of ferroxidase deficiency,most patients had secondary lysosomes shared by cuprothioneins and iron complex. Six patients with Dubin-Johnson syndrome were homozygous or compound heterozygous for mutant MRP2. Despite complex metabolic disorders, the syndrome had a single genetic background. Thus, most patients with adult-onset lysosomal proliferation in the liver had genetic defects in non-lysosomal organelles, named the secondary lysosomal diseases. The proliferating lysosomes in these conditions seemed to be heterogeneous in their matrices.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
76 Fifty years after the first identification of lysosomes,1,2 three Table 3 Results of mutation analysis for patients with Dubin-Johnson syndrome Patient Age (years)/Sex MRP2 Mutation 1 Mutation 2 1 21/male 298C > T (R100X) 298C > T (R100X) 2 26/male 1177C > T (R393W) 2302C > T (R768W) 3 23/female 1967 + 2T > C (1901del67: exon 15 skipping) 1967 + 2T > C (1901del67: exon 15 skipping) 4 25/male 1967 + 2T > C (1901del67: exon 15 skipping) 2026G > C (G676R) 5 28/female 2125T > C (W709R) 2125T > C (W709R) 6 28/male 2439 + 2T > C (2272del168: exon 18 skipping) 2439 + 2T > C (2272del168: exon 18 skipping) adult-onset storage disorders of the liver were found to be secondary lysosomal diseases with the genetic defects outside of lysosomes. Login to comment

[hide] MRP2 haplotypes confer differential susceptibility... Pharmacogenet Genomics. 2007 Jun;17(6):403-15. Choi JH, Ahn BM, Yi J, Lee JH, Lee JH, Nam SW, Chon CY, Han KH, Ahn SH, Jang IJ, Cho JY, Suh Y, Cho MO, Lee JE, Kim KH, Lee MG
MRP2 haplotypes confer differential susceptibility to toxic liver injury.
Pharmacogenet Genomics. 2007 Jun;17(6):403-15., [PMID:17502832]

Abstract [show]
OBJECTIVES: Multidrug resistance protein 2 (MRP2, ABCC2) plays an important role in the biliary clearance of a wide variety of endogenous and exogenous toxic compounds. Therefore, polymorphisms and mutations in the MRP2 gene may affect individual susceptibility to hepatotoxic reactions. METHODS: Associations between genetic variations of MRP2 and toxic hepatitis were investigated using integrated population genetic analysis and functional molecular studies. RESULTS: Using a gene scanning method, 12 polymorphisms and mutations were found in the MRP2 gene in a Korean population. Individual variation at these sites was analyzed by conventional DNA screening in 110 control subjects and 94 patients with toxic hepatitis induced mostly by herbal remedies. When haplotypes were identified, over 85% of haploid genes belonged to the five most common haplotypes. Among these, a haplotype containing the g.-1774delG polymorphism showed a strong association with cholestatic or mixed-type hepatitis, and a haplotype containing the g.-1549G>A, g.-24C>T, c.334-49C>T, and c.3972C>T variations was associated with hepatocellular-type hepatitis. A comprehensive functional study of these sites revealed that genetic variations in the promoter of this gene are primarily responsible for the susceptibility to toxic liver injuries. The g.-1774delG variation and the combined variation of g.-1549G>A and g.-24C>T decreased MRP2 promoter activity by 36 and 39%, respectively. In addition, the promoter carrying the g.-1774delG allele showed a defect in the bile acid-induced induction of promoter activity. CONCLUSIONS: These results suggest that genetic variations of MRP2 are an important predisposing factor for herbal-induced or drug-induced toxic liver injuries.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
93 The pGL3 plasmids containing WT or mutant MRP2 promoters were Table 3 Oligonucleotide primers used in the genotyping and functional molecular studies Primer name Nucleotide sequence Primers for SNaPshot or SNaPIT PCR primers c.334-49C > T Sense 50 -CAT GGG TCC TGG AAA GGT T-30 Antisense 50 -CCC CAT GGT ACC TCC TCA T-30 c.1249G > A (p.V417I) Sense 50 -TTT GTC CAT GGG TCC TAA TTT-30 Antisense 50 -ATG AAG TTG GTC ACA TCC ATG-30 c.1457C > T (p.T486I) Sense 50 -ATG GTG CTT GTA ATC CCA ATT-30 Antisense 50 -TTG CCC AAA CTC CCA TTA-30 c.2620 + 3A > G Sense 50 -AAA AAA GGA GAG TTT GCT AAG AAT C-30 Antisense 50 -ATA CTG AGC AGT TCA GGA ATT AGA TAT T-30 c.2934G > A (p.S978S) Sense 50 -AGT TCT ACT AAT ATT GAG GTG GGG A-30 Antisense 50 -AAT AAA AGC CAC AGA ATT CAT CA-30 c.3972C > T (p.I1324I) Sense 50 -TAC CGA CCT GAG CTG GAT C-30 Antisense 50 -CAT CCA GGC CTT CCT TCA-30 c.4147 - 35G > A Sense 50 -GTA GCC ACT CCG AGC CTT AG-30 Antisense 50 -GGA ATC AGA CCT GGA TGA AAA-30 c.4508 + 12G > A Sense 50 -CCC ACA GGC TGC ACA CCA T-30 Antisense 50 -TGT TAC TGT TGA GCA AGG GTT A-30 Genotyping primers c.334 - 49C > T 50 -TCT GAA GAA TAC TGC CAC TAA CCG A-30 c.1249G > A (p.V417I) 50 -GAC ATC AGG TTC ACT GTT TCT CCA A-30 c.1457C > T (p.T486I) 50 -GGG TGA CTT TTT CTT TAC CTG AAT G-30 c.2620 + 3A > G 50 -CTA TCT TGT CCC AAT CCT TCT TAC A-30 c.2934G > A (p.S978S) 50 -ACC TAC AAG CAA TAG GAT TGT TTT C-30 c.3972C > T (p.I1324I) 50 -CTC CAC CTA CCT TCT CCA TGC TAC C-30 c.4147 - 35G > A 50 -GAA CTC CGA GGT CCT TTT CTG GCA T-30 c.4508 + 12G > A 50 -AAG CCA TCC GTG TCA AGC CCT GTC C-30 Primers for the DNA sequencing of MRP2 promoter regions g. - 1774delG Sense 50 -GAT TCT CCA CCC TCT CTT TT-30 Antisense 50 -CAT TCA GTG TGG GAG AAA AT-30 g. - 1549G > A Sense 50 -CCC ACT TTT TAA TTT GTT AGT GTA-30 Antisense 50 -CTG GGA CTA CAG GCA CAT-30 g. - 24C > T and g. - 23G > A Sense 50 -TAG GCT CAC ACT GGA TAA GC-30 Antisense 50 -TGC ACA TCT AAC ATT TCT GG-30 Mutagenic primers - 24C-T 50 -CAA TCA TAT TAA TAG AAG AGT CTT CGT TCC AGA CGC AGT CCA GGA A-30 c.1249G > A (p.V417I) 50 -GGA AGG AGT ACA CCA TTG GAG AAA CAG TGA ACC TGA TGT C-30 c.2302C > T (p.R768W) 50 -AAA TCT TAG TGG GGG TCA GAA GCA GTG GAT CAG CCT GGC CAG-30 c.2934G > A (p.S978S) 50 -CTA CAA GCA ATA GGA TTG TTT TCA ATA TTC TTC ATC ATC-30 c.3972C > T (p.I1324I) 50 -GAG GGA TCA CTT GTG ACA TTG GTA GCA TGG AGA AGG TAG G-30 Primers for MRP2 promoter cloning First round PCR ( - 2314 to + 348) Sense 50 -AGA TTC ATG ACT TCC TGG CTC CTT-30 Antisense 50 -ACA ACA ATT CTC CTT CCT CAC ACG-30 Second round PCR ( - 2229 to -1) Sense (KpnI site) 50 -CGG GGT ACC TTG ATG AAC ATT TAG ATT CT-30 Antisense (NheI site) 50 -CTA GCT AGC GAT TCC TGG ACT GCG TCT GG-30 RT-PCR primers for exon 4 splicing Sense (exon 3) 50 -CGT GTA TAA ATC CAG GAC CAA GAG A-30 Antisense (exon 5) 50 -GGA GAT GAA GAA CAG GCA GGA GTA G-30 PCR, polymerase chain reaction; RT-PCR, reverse transcription-polymerase chain reaction. Login to comment
141 The p.R768W mutation, which was known to cause the DJS by misfolding and premature degradation of MRP2 protein [14], was used as a positive control of MRP2 dysfunction. Login to comment
142 None of the common coding region variants, p.V417I, c.2934G > A, or c.3972C > T, induced identifiable defects in protein expression, whereas p.R768W evoked a definite decrease (Fig. 2a). Login to comment
143 Consistent with protein expression levels, MRP2-mediated CF efflux was decreased only in p.R768W, and none of the common variants in the coding regions showed significant changes in transport activity (Fig. 2b). Login to comment
149 Fig. 2 30 kDa 0 20 40 60 80 100 120 Transportactivity(%) 140 WT 190 kDa MRP2 Neomycin phosphotransferase II (a) (b) WT p.V417I c.2934G > A (Ser978) c.3972C > T (Ile1324) p.R768W Mock (c) 500 400 300 200 100 CC CT TT MRP2 exon 4 β-actin (1) (2) (3) (4) (5) (6) bp 300 p.V417I c.2934G > A (Ser978) c.3972C > T (Ile1324) p.R768W Functional studies of intragenic variations. Login to comment
152 p.R768W was used as a positive control bearing defective protein expression. Login to comment

[hide] The apical conjugate efflux pump ABCC2 (MRP2). Pflugers Arch. 2007 Feb;453(5):643-59. Epub 2006 Jul 18. Nies AT, Keppler D
The apical conjugate efflux pump ABCC2 (MRP2).
Pflugers Arch. 2007 Feb;453(5):643-59. Epub 2006 Jul 18., [PMID:16847695]

Abstract [show]
ABCC2 is a member of the multidrug resistance protein subfamily localized exclusively to the apical membrane domain of polarized cells, such as hepatocytes, renal proximal tubule epithelia, and intestinal epithelia. This localization supports the function of ABCC2 in the terminal excretion and detoxification of endogenous and xenobiotic organic anions, particularly in the unidirectional efflux of substances conjugated with glutathione, glucuronate, or sulfate, as exemplified by leukotriene C(4), bilirubin glucuronosides, and some steroid sulfates. The hepatic ABCC2 pump contributes to the driving forces of bile flow. Acquired or hereditary deficiency of ABCC2, the latter known as Dubin-Johnson syndrome in humans, causes an increased concentration of bilirubin glucuronosides in blood because of their efflux from hepatocytes via the basolateral ABCC3, which compensates for the deficiency in ABCC2-mediated apical efflux. In this article we provide an overview on the molecular characteristics of ABCC2 and its expression in various tissues and species. We discuss the transcriptional and posttranscriptional regulation of ABCC2 and review approaches to the functional analysis providing information on its substrate specificity. A comprehensive list of sequence variants in the human ABCC2 gene summarizes predicted and proven functional consequences, including variants leading to Dubin-Johnson syndrome.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
139 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment
140 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment

[hide] Identification of a novel 974C-->G nonsense mutati... Am J Gastroenterol. 2006 Oct;101(10):2427-32. Epub 2006 Sep 4. Corpechot C, Ping C, Wendum D, Matsuda F, Barbu V, Poupon R
Identification of a novel 974C-->G nonsense mutation of the MRP2/ABCC2 gene in a patient with Dubin-Johnson syndrome and analysis of the effects of rifampicin and ursodeoxycholic acid on serum bilirubin and bile acids.
Am J Gastroenterol. 2006 Oct;101(10):2427-32. Epub 2006 Sep 4., [PMID:16952291]

Abstract [show]
Rifampicin (RIF) and ursodeoxycholic acid (UDCA) therapies have beneficial effects in chronic cholestatic diseases. These may result in part from the induction of multidrug-resistance protein 2 (MRP2/ABCC2) expression in the liver and kidney. However, the precise mechanisms by which RIF and UDCA act in cholestasis remain unclear. In the present study, we report the effects of chronic administration of both drugs in a patient with Dubin-Johnson syndrome (DJS), an inherited autosomal recessive disorder characterized by the absence of functional MRP2 protein at the canalicular hepatocyte membrane. A novel 974C-->G nonsense mutation was identified in the MRP2 gene sequence from this patient. RIF induced further increase in conjugated bilirubinemia, whereas concomitant administration of RIF and UDCA led to a dramatic rise in serum bile acid concentrations. These biochemical effects, which are in marked contrast to those observed in cholestatic settings, were concomitant with an increased MRP3, but not MRP4, expression on basolateral hepatocyte membrane. Such findings highlight the key role of MRP2 in the pharmacological properties of RIF and UDCA and suggest that both drugs should be used with caution in pathologic settings in which MRP2 expression may be downregulated, as in advanced stage of cholestatic diseases.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
78 Mutations in the MRP2/ABCC2 Gene Associated with DJS Nucleotide Mutation Exon Predicted Effect Reference 298C→T 3 R100X 27 974C→G 8 S325X This article IVS8 + 4A→G Intron 8 Aberrant splicing 28 1177C→T 9 R393W 29 1256insCT/ delAAACAG TGAACCT- GATG 10 Frameshift 30 1271A→G 10 R412G 31 1815 + 2T→A 13 Skipped exon 32, 33 1967 + 2T→C 15 Skipped exon 34, 35 2026G→C 16 G676R 35 2125T→C 17 W709R 36 2302C→T 18 R768W 32, 37, 38 2439 + 2T→C 18 Skipped exon 32, 35, 37 3196C→T 23 R1066X 39, 40 3449G→A 25 R1150H 41 3517A→T 25 I1173F 41 3928C→T 28 R1310X 27, 33 4145A→G 29 Q1382R 37 4175delGGATGA 30 R1392 + M1393 deletion 40 4292delCA 30 Frameshift 30 DISCUSSION Identification of a Novel Nonsense Mutation of the MRP2/ABCC2 Gene Up to now, 18 mutations in the sequence of the MRP2/ABCC2 gene have been reported in DJS, including nonsense mutations, deletions, splicing junction mutations, and missense mutations (Table 1). Login to comment

[hide] Single nucleotide polymorphisms in ABCC2 and ABCB1... Cancer Lett. 2006 Mar 8;234(1):40-50. Epub 2005 Dec 27. Wada M
Single nucleotide polymorphisms in ABCC2 and ABCB1 genes and their clinical impact in physiology and drug response.
Cancer Lett. 2006 Mar 8;234(1):40-50. Epub 2005 Dec 27., [PMID:16377077]

Abstract [show]
Among the ABC proteins, some members including ABCB1, ABCC1, ABCC2 and ABCG2 are believed to contribute to multidrug resistance of cancer chemotherapy. In addition, the broad substrate-specificity and apical localization of the ABCB1 and ABCC2 in mucosal epithelium of intestine and hepatocyte give them a protective role against xenobiotics. The inter-individual variations in activity and expression levels of ABCB1 and ABCC2, thus, might affect on drug response and response to toxic substrates. In this review, I focus on (1) physiological and toxicological relevance of ABCB1 and ABCC2, and on (2) genetic variations of ABCB1 and ABCC2 genes and their association with biochemical function, expression level and tumor incidence.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
41 In Japan, the expected number of Table 1 Summary of mutations identified in Dubin-Johnson syndrome (DJS) Mutation Exon IVS Amino acid alteration Reference 298COT 3 R100X a,b 1815C 2TOA 13 Exon13 skip [38] 1967C 2TOC 15 Exon15 skip [62] 2026GOC 16 G676R [92] 2302COT 18 R768W [49,91]c 2439C 2TOC 18 Exon18 skip [38]a,c 3196COT 23 R1066X [47] 3449GOA 25 R1150H [52] 3517AOT 25 I1173F [52] 3928COT 28 R1310X [50] 4145AOG 29 Q1382R [38] 4175- 4180del 30 RM1392-1393del [48] a Adachi and Wada, unpublished data. b Houkibara and Wada, unpublished data. Login to comment
58 Mor-Cohen analyzed in vitro two novel missense mutations identified in exon 25 in DJS [52] (Tables 1 Table 2 Naturally occurring base-change in ABCC2 gene accompanied by amino acid substitution Location (exon) Nucleic acid substitution Amino acid substitution Domain Pathogenetic consequence (biochemical defect) Frequency (%) Jews Japanese Reference 7 842GOA S281N Linker Unkown 2.4 Not reported [52] 10 1249GOA V417I MSD2 Unkown 22.7 10.9 [42,43,52]a 16 2026GOC G676R NBD1 DJSb Not reported Not reported [92] 18 2302COT R768W NBD1 DJS (protein maturation) Not reported 0.4? Login to comment
68 ABCC2 (R768W), being mutated in the C motif of NBD1, was localized in the cytoplasm with an ER-like distribution [53]. Login to comment
72 MG132, an inhibitor of the cytosolic proteasome, blocked the degradation of the precursor form of ABCC2 (R768W), suggesting that ABCC2 (R768W) is degraded by the proteasome pathway, which is involved in the degradation of newly synthesized, misfolded and unassembled proteins in the ER [54]. Login to comment
75 These results suggested that, unlike the R768W mutation, the Q1382R mutation does not affect either the maturation process or the subcellular localization of ABCC2. Login to comment

[hide] Apical/basolateral surface expression of drug tran... Pharm Res. 2005 Oct;22(10):1559-77. Epub 2005 Sep 22. Ito K, Suzuki H, Horie T, Sugiyama Y
Apical/basolateral surface expression of drug transporters and its role in vectorial drug transport.
Pharm Res. 2005 Oct;22(10):1559-77. Epub 2005 Sep 22., [PMID:16180115]

Abstract [show]
It is well known that transporter proteins play a key role in governing drug absorption, distribution, and elimination in the body, and, accordingly, they are now considered as causes of drug-drug interactions and interindividual differences in pharmacokinetic profiles. Polarized tissues directly involved in drug disposition (intestine, kidney, and liver) and restricted distribution to naive sanctuaries (blood-tissue barriers) asymmetrically express a variety of drug transporters on the apical and basolateral sides, resulting in vectorial drug transport. For example, the organic anion transporting polypeptide (OATP) family on the sinusoidal (basolateral) membrane and multidrug resistance-associated protein 2 (MRP2/ABCC2) on the apical bile canalicular membrane of hepatocytes take up and excrete organic anionic compounds from blood to bile. Such vectorial transcellular transport is fundamentally attributable to the asymmetrical distribution of transporter molecules in polarized cells. Besides the apical/basolateral sorting direction, distribution of the transporter protein between the membrane surface (active site) and the intracellular fraction (inactive site) is of practical importance for the quantitative evaluation of drug transport processes. The most characterized drug transporter associated with this issue is MRP2 on the hepatocyte canalicular (apical) membrane, and it is linked to a genetic disease. Dubin-Johnson syndrome is sometimes caused by impaired canalicular surface expression of MRP2 by a single amino acid substitution. Moreover, single nucleotide polymorphisms in OATP-C/SLC21A6 (SLCO1B1) also affect membrane surface expression, and actually lead to the altered pharmacokinetic profile of pravastatin in healthy subjects. In this review article, the asymmetrical transporter distribution and altered surface expression in polarized tissues are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
236 At least three of the other mutations (R768W, I1173F, and deletion 1392Y1394) are related to sorting problems from the ER to Golgi, as these mutant MRP2 accumulated within the ER in core-glycosylated forms. Login to comment

[hide] Dual hereditary jaundice: simultaneous occurrence ... Gastroenterology. 2005 Jul;129(1):315-20. Cebecauerova D, Jirasek T, Budisova L, Mandys V, Volf V, Novotna Z, Subhanova I, Hrebicek M, Elleder M, Jirsa M
Dual hereditary jaundice: simultaneous occurrence of mutations causing Gilbert's and Dubin-Johnson syndrome.
Gastroenterology. 2005 Jul;129(1):315-20., [PMID:16012956]

Abstract [show]
BACKGROUND & AIMS: Dubin-Johnson syndrome is recessively inherited, conjugated hyperbilirubinemia induced by mutations in the ABCC2/MRP2 gene encoding the canalicular transporter for conjugated bilirubin. Gilbert's syndrome is recessively inherited, unconjugated hyperbilirubinemia caused by decreased conjugation rate of bilirubin associated mostly with homozygous A(TA) 7 TAA variant of the TATAA-box in the UGT1A1 gene promoter. Our aim was to establish the molecular diagnosis in a 3-year-old male with atypical, intermittent, predominantly unconjugated, hyperbilirubinemia. METHODS: 99m Tc-HIDA cholescintigraphy was used for imaging the biliary tree. Expression of ABCC2/MRP2 protein in hepatocytes was investigated immunohistochemically. UGT1A1 and ABCC2/MRP2 genes were sequenced from genomic DNA, and the mutations were verified by fragment analysis, sequencing the cloned exons, and restriction fragment length polymorphism. RESULTS: Cholescintigraphy revealed delayed visualization of the gallbladder. A brown granular lipopigment differing from melanin-like pigment reported in Dubin-Johnson syndrome was present in hepatocytes, but, otherwise, liver histology was normal. ABCC2/MRP2 protein was not detected on the canalicular membrane of hepatocytes, and 2 novel mutations were found in the ABCC2/MRP2 gene: a heterozygous in-frame insertion-deletion mutation 1256insCT/delAAACAGTGAACCTGATG in exon 10 inherited from the father and a heterozygous deletion 4292delCA in exon 30 inherited from the mother. In addition, the patient was homozygous for -3279T>G and A(TA) 7 TAA mutations in the UGT1A1 gene promoter. CONCLUSIONS: Our patient represents a case of digenic mixed hyperbilirubinemia-a distinct type of constitutive jaundice resulting from coinherited defects in ABCC2/MRP2 and UGT1A1 genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 2302CϾT 18 R768W Wada M et al, Hum Mol Genet 1998;7:203-207. Login to comment

[hide] A mutation in the drug transporter gene ABCC2 asso... Pharmacogenet Genomics. 2005 May;15(5):277-85. Hulot JS, Villard E, Maguy A, Morel V, Mir L, Tostivint I, William-Faltaos D, Fernandez C, Hatem S, Deray G, Komajda M, Leblond V, Lechat P
A mutation in the drug transporter gene ABCC2 associated with impaired methotrexate elimination.
Pharmacogenet Genomics. 2005 May;15(5):277-85., [PMID:15864128]

Abstract [show]
Human multidrug resistance protein 2 (MRP2, encoded by ABCC2) is involved in active efflux of anionic drugs such as methotrexate. MRP2 is expressed on the luminal side of hepatocytes and renal proximal tubular cells, indicating an important role in drug elimination. We postulated that loss-of-function mutations in ABCC2, which are involved in the Dubin-Johnson syndrome, may be associated with impaired methotrexate elimination and an increased risk of toxicity. We studied the biological phenotype and ABCC2 coding sequence in a patient receiving a high-dose methotrexate infusion for large B-cell lymphoma and who had an unusual pharmacokinetic profile, mainly characterized by a three-fold reduction in the methotrexate elimination rate. This resulted in severe methotrexate over-dosing and reversible nephrotoxicity. An inversion of the urinary coproporphyrin isomer I/III ratio (a specific biological marker of the Dubin-Johnson syndrome) was observed in this patient. Genetic analysis of ABCC2 identified a heterozygous mutation replacing a highly conserved arginine by glycine in the cytoplasmic part of the second membrane-spanning domain (position 412 of MRP2), a region associated with substrate affinity. This genetic variant was not found in a control population. Functional analysis in transiently transfected Chinese hamster ovary cells revealed a loss of transport activity of the G412 MRP2 mutant protein. An ABCC2 mutation altering MRP2-mediated methotrexate transport and resulting in impaired drug elimination and subsequent renal toxicity was identified. Candidates for methotrexate therapy should be considered for MRP2 functional testing.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
60 Mutations (R412G and a positive control mutation R768W) were inserted into the wild-type pcDNA3.1/ MRP2 by using the QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, California, USA). Login to comment

[hide] Mutational analysis of the MRP2 gene and long-term... J Gastroenterol. 2005 Apr;40(4):366-70. Machida I, Wakusawa S, Sanae F, Hayashi H, Kusakabe A, Ninomiya H, Yano M, Yoshioka K
Mutational analysis of the MRP2 gene and long-term follow-up of Dubin-Johnson syndrome in Japan.
J Gastroenterol. 2005 Apr;40(4):366-70., [PMID:15870973]

Abstract [show]
BACKGROUND: Recent studies have indicated that dysfunction or loss of the multidrug resistance protein 2 (MRP2) is the molecular basis of Dubin-Johnson syndrome (DJS). To clarify the genetic basis of the disease and the long-term stability of serum bilirubin levels, we conducted a mutational analysis of the MRP2 gene and followed up serum bilirubin levels in Japanese DJS patients 30 years after they were originally diagnosed, based on traditional criteria. METHODS: Patients were interviewed by telephone, and blood tests, including a genetic analysis of MRP2, were performed on the patients and family members who gave informed consent. RESULTS: Over the 30 years, hyperbilirubinemia remained unchanged in four of the five patients studied, while it worsened in 1 patient whose DJS was complicated by chronic hepatitis C. From an MRP2 gene mutational analysis, six mutations, including the novel mutation 1177C>T, were found. Three patients of a consanguineous family were homozygotes for three mutations (298C>T, 1967+2T>C, and 2439+2T>C). Two patients were compound heterozygotes (1177C>T/2302C>T and 1967+2T>C/2026G>C). A familial study showed no difference in serum bilirubin levels between mutant/wild heterozygotes and wild/wild homozygotes. CONCLUSIONS: The hyperbilirubinemia of four Japanese patients with DJS, one of whom had a novel mutation, 1177C>T, of the MRP2 gene, had not worsened with aging.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
66 298CϾT Gly100Stop 14 1177CϾT Arg393Trp Novel 1967ϩ2TϾC 1901del67 (exon 15 skipping) 12 2026GϾC Gly676Arg 6 2302CϾT Arg768Trp 13 2439ϩ2TϾC 2272del168 (exon 18 skipping) 8 a b immunohistochemical analysis, the mechanism by which this mutation impairs the canalicular transport of conjugated bilirubin remains unclear. Login to comment

[hide] The ABC transporters MDR1 and MRP2: multiple funct... Drug Metab Rev. 2004 Oct;36(3-4):669-701. Hoffmann U, Kroemer HK
The ABC transporters MDR1 and MRP2: multiple functions in disposition of xenobiotics and drug resistance.
Drug Metab Rev. 2004 Oct;36(3-4):669-701., [PMID:15554242]

Abstract [show]
ATP-binding cassette (ABC) transporters comprise one of the largest membrane bound protein families. They are involved in transport of numerous compounds. These proteins transport substrates against a concentration gradient with ATP hydrolysis as a driving force across the membrane. Mammalian ABC proteins have important physiological, pharmacological and toxicological functions including the transport of lipids, bile salts, drugs, toxic and environmental agents. The efflux pumps serve both as natural defense mechanisms and influence the bioavailability and disposition of drugs. In general terms, the transporters remove xenobiotics from the cellular environment. For example, in cancer cells, over expression of these molecules may confer to multidrug resistance against cytostatic drugs. In addition, based on diverse structural characteristics and a broad substrate specifity, ABC transport proteins alter the intracellular concentration of a variety of therapeutically used compounds and toxicologically relevant agents. We review the function of the human multidrug resistance protein MDR1, (P-glycoprotein, ABCB1) and the multidrug resistance protein MRP2 (ABCC2). We focus on four topics namely 1) structure and physiological functions of these transporters, 2) substrates e.g., drugs, xenotoxins, and environmental toxicants including their conjugates, 3) drug-drug interactions, and the role of chemosensitizers which may be able to reverse drug resistance, and 4) pharmacologically and toxicologically relevant genetic polymorphisms in transport proteins and their clinical implications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
290 This base alteration results in an amino acid exchange Arg768Trp (Materna and Lage, 2003; Tsujii et al., 1999; Wada et al., 1998). Login to comment

[hide] High plasma pravastatin concentrations are associa... Pharmacogenetics. 2004 Jul;14(7):429-40. Niemi M, Schaeffeler E, Lang T, Fromm MF, Neuvonen M, Kyrklund C, Backman JT, Kerb R, Schwab M, Neuvonen PJ, Eichelbaum M, Kivisto KT
High plasma pravastatin concentrations are associated with single nucleotide polymorphisms and haplotypes of organic anion transporting polypeptide-C (OATP-C, SLCO1B1).
Pharmacogenetics. 2004 Jul;14(7):429-40., [PMID:15226675]

Abstract [show]
This study aimed to characterize possible relationships between polymorphisms in the drug transporter genes organic anion transporting polypeptide-C (OATP-C, SLCO1B1), OATP-B (SLCO2B1), multidrug resistance-associated protein 2 (MRP2, ABCC2) and multidrug resistance transporter (MDR1, ABCB1) and the pharmacokinetics of pravastatin. We studied 41 healthy Caucasian volunteers who had previously participated in pharmacokinetic studies with pravastatin. Six volunteers had a very high pravastatin AUC value and were defined as outliers according to statistical criteria. The OATP-C gene was sequenced completely in all subjects, and they were also genotyped for selected single nucleotide polymorphisms (SNP) in the OATP-B, MDR1 and MRP2 genes. Of the six outliers, five were heterozygous for the OATP-C 521T>C (Val174Ala) SNP (allele frequency 42%) and three were heterozygous for a new SNP in the promoter region of OATP-C (-11187G>A, allele frequency 25%). Among the remaining 35 subjects, two were homozygous and six were heterozygous carriers of the 521T>C SNP (allele frequency 14%, P = 0.0384 versus outliers) and three were heterozygous carriers of the -11187G>A SNP (allele frequency 4%, P = 0.0380 versus outliers). In subjects with the -11187GA or 521TC genotype, the mean pravastatin AUC0-12 was 98% (P = 0.0061) or 106% (P = 0.0034) higher, respectively, compared to subjects with the reference genotype. These results were substantiated by haplotype analysis. In heterozygous carriers of *15B (containing the 388A>G and 521T>C variants), the mean pravastatin AUC0-12 was 93% (P = 0.024) higher compared to non-carriers and, in heterozygous carriers of *17 (containing the -11187G>A, 388A>G and 521T>C variants), it was 130% (P = 0.0053) higher compared to non-carriers. No significant associations were found between OATP-B, MRP2 or MDR1 polymorphisms and the pharmacokinetics of pravastatin. These results suggest that haplotypes are more informative in predicting the OATP-C phenotype than single SNPs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
145 ymous SNPs in exon 18, 2302C.T (Arg768 Trp) which is associated with the Dubin-Johnson syndrome [5,50] and 2366C.T (Ser789 Phe) with suggested functional significance [51], were not found in any of the subjects. Login to comment

[hide] Characterization of the cellular localization, exp... Pharm Res. 2004 May;21(5):742-8. Hirouchi M, Suzuki H, Itoda M, Ozawa S, Sawada J, Ieiri I, Ohtsubo K, Sugiyama Y
Characterization of the cellular localization, expression level, and function of SNP variants of MRP2/ABCC2.
Pharm Res. 2004 May;21(5):742-8., [PMID:15180328]

Abstract [show]
PURPOSE: The presence of single nucleotide polymorphisms (SNPs) has been reported for multidrug resistance-associated protein 2 (MRP2/ABCC2). The purpose of the current study was to characterize the localization, expression level, and function of MRP2 variants. METHODS: The expression and cellular localization of the wild-type and three kinds of reported SNP variants of MRP2 molecules were analyzed in LLC-PK1 cells after infection with the recombinant Tet-off adenoviruses. Their function was determined by using the isolated membrane vesicles from the infected LLC-PK1 cells. RESULTS: The transport activity for E217betaG, LTC4, and DNP-SG, normalized by the expression level of MRP2, was similar between the wild-type, V417I, and A1450T MRP2s. The transport activity of S789F MRP2 was slightly higher than that of wild-type MRP2. However, the expression level of S789F and A1450T MRP2 proteins was significantly lower compared with the wild-type and V417I MRP2. In addition, although the wild-type and V417I MRP2 were exclusively localized in the apical membrane, S789F and A1450T MRP2 were located in the apical membrane and also in the intracellular compartment. CONCLUSIONS: These results suggest that the most frequently observed V417I substitution may not affect the in vivo function of MRP2, whereas the much less frequently observed S789F and A1450T may be associated with the reduced in vivo function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 Only one respective heterozygote subject was observed out of 48 volunteers for C2302T (exon 18, Arg768Trp), C2366T (exon 18, Ser789Phe), and G4348A (exon 31, Ala1450Thr) (19), and their allele frequency was calculated to be 1%. Login to comment
27 Among these three kinds of less frequently observed SNPs, C2302T (exon 18, Arg768Trp) has been identified as the mutation responsible for DJS (21). Login to comment
43 We have generated the following four kinds of missense mutations reported previously: Val417Ile, Arg768Trp, Ser789Phe, and Ala1450Thr. Login to comment
87 R768W MRP2 showed no staining, presumably due to rapid degradation as previously reported (18). Login to comment
92 As a positive control to determine the localization of MRP2, we also determined the localization of R768W MRP2, which has been reported to be responsible for the sideration of the DJS (18). Login to comment
93 In our experimental system, R768W MRP2 was located in the intracellular compartment of LLC-PK1 cells, which is consistent with the previous report (18). Login to comment
151 Indeed, both R768W MRP2 mutant and MRP2 mutant, which lacks R1392 and M1393 found in DJS patients, were core glycosylated and localized predominantly within the endoplasmic reticulum (17,18). Login to comment

[hide] Homozygous mutation Arg768Trp in the ABC-transport... J Hum Genet. 2003;48(9):484-6. Epub 2003 Aug 27. Materna V, Lage H
Homozygous mutation Arg768Trp in the ABC-transporter encoding gene MRP2/cMOAT/ABCC2 causes Dubin-Johnson syndrome in a Caucasian patient.
J Hum Genet. 2003;48(9):484-6. Epub 2003 Aug 27., [PMID:12942343]

Abstract [show]
Dubin-Johnson syndrome (DJS) is an autosomal recessive disorder characterized by conjugated hyperbilirubinemia and caused by mutations of the ATP-binding cassette (ABC) transporter encoding gene MRP2/cMOAT/ABCC2. Previous studies reported on mutations in DJS patients and polymorphisms in healthy human individuals. The genomic DNA sequence of a female Caucasian DJS patient was analyzed by DNA sequencing and revealed the identification of a homozygous missense mutation C2302T. This DJS-causing alteration results in an amino acid exchange Arg768Trp.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
0 SHORT COMMUNICATION Homozygous mutation Arg768 Trp in the ABC-transporter encoding gene MRP2/cMOAT/ABCC2 causes Dubin-Johnson syndrome in a Caucasian patient Received: 15 May 2003 / Accepted: 1 July 2003 / Published online: 27 August 2003 Ó The Japan Society of Human Genetics and Springer-Verlag 2003 Abstract Dubin-Johnson syndrome (DJS) is an autosomal recessive disorder characterized by conjugated hyperbilirubinemia and caused by mutations of the ATP-binding cassette (ABC) transporter encoding gene MRP2/cMOAT/ABCC2. Login to comment
3 This DJS-causing alteration results in an amino acid exchange Arg768Trp. Login to comment
27 The only alteration found was the missense mutation C2302T causing an amino acid exchange Arg768Trp indicating to be the molecular basis for DJS in this Turkish patient. Login to comment
33 It was reported that the amino acid exchange Arg768Trp causes a deficient maturation of the ABCC2 protein leading to a diminished glycosylation, impaired sorting to the apical membrane, and degradation via the proteasome pathway (Hashimoto et al. 2002). Login to comment
34 These results support our findings that the missense mutation Arg768Trp alone is responsible for the defect in transporting bilirubin conjugates, leading to hyperbilirubinemia in the context of DJS in the examined patient. Login to comment
48 Conclusions The homozygous missense mutation C2302T causing the amino acid exchange Arg768Trp is the molecular reason for DJS in a female Caucasian patient examined. Login to comment

[hide] Single nucleotide polymorphisms in multidrug resis... Adv Drug Deliv Rev. 2002 Nov 18;54(10):1311-31. Suzuki H, Sugiyama Y
Single nucleotide polymorphisms in multidrug resistance associated protein 2 (MRP2/ABCC2): its impact on drug disposition.
Adv Drug Deliv Rev. 2002 Nov 18;54(10):1311-31., [PMID:12406647]

Abstract [show]
Multidrug resistance associated protein 2 (MRP2/ABCC2), expressed on the bile canalicular membrane, plays an important role in the biliary excretion of various kinds of substrates. In addition, MRP2 is also expressed on the apical membrane of epithelial cells such as enterocytes. It is possible that the inter-individual difference in the function of MRP2 affects the drug disposition. In the present article, we will summarize the physiological and pharmacological role of MRP2, particularly focusing on the factors affecting its transport function such as single nucleotide polymorphisms and/or the induction/down regulation of this transporter. Mutations found in patients suffering from the Dubin-Johnson syndrome, along with the amino acid residues which are involved in supporting the transport activity of MRP2, are also summarized.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
137 Arg768Trp), C2366T (exon 18, Ser789Phe) and Although Harris et al. Login to comment

[hide] Trafficking and functional defects by mutations of... Hepatology. 2002 Nov;36(5):1236-45. Hashimoto K, Uchiumi T, Konno T, Ebihara T, Nakamura T, Wada M, Sakisaka S, Maniwa F, Amachi T, Ueda K, Kuwano M
Trafficking and functional defects by mutations of the ATP-binding domains in MRP2 in patients with Dubin-Johnson syndrome.
Hepatology. 2002 Nov;36(5):1236-45., [PMID:12395335]

Abstract [show]
Dubin-Johnson syndrome (DJS) is a hereditary disease characterized by hyperbilirubinemia. We investigated the consequences of 2 missense mutations, R768W and Q1382R, of nucleotide-binding domains (NBDs) of the multidrug resistance protein 2 (MRP2; ABCC2) that were previously identified in patients with DJS. Pulse chase analysis revealed that the precursor form of the wild-type and Q1382R MRP2 were converted to the mature form, which is resistant to endoglycosidase H (Endo H) in about 60 minutes. However, the precursor form of the R768W MRP2, which is sensitive to endoglycosidase H, was degraded within 120 minutes and did not mature to the fully glycosylated form. Proteasome inhibitors inhibited the degradation of the precursor form of the R768W MRP2. Unlike the R768W MRP2, the Q1382R MRP2 was mainly localized on the apical membrane in the wild-type form. However, efflux of glutathione monochlorobimane (GS-MCLB) and ATP-dependent leukotriene C(4) (LTC(4)) uptake into plasma membrane vesicles from cells expressing the Q1382R MRP2 were markedly reduced, suggesting that the Q1382R MRP2 on the apical membrane was nonfunctional. Vanadate-induced nucleotide trapping with 8-azido-[alpha-32P]ATP in the wild-type MRP2 was stimulated by estradiol glucuronide (E(2)17betaG) in a concentration-dependent manner but that in the Q1382R MRP2 was not. In conclusion, the R768W mutation causes deficient maturation and impaired sorting, and the Q1382R mutation does not affect maturation or sorting but impairs the substrate-induced ATP hydrolysis.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 We investigated the consequences of 2 missense mutations, R768W and Q1382R, of nucleotide-binding domains (NBDs) of the multidrug resistance protein 2 (MRP2; ABCC2) that were previously identified in patients with DJS. Login to comment
3 However, the precursor form of the R768W MRP2, which is sensitive to endoglycosidase H, was degraded within 120 minutes and did not mature to the fully glycosylated form. Login to comment
4 Proteasome inhibitors inhibited the degradation of the precursor form of the R768W MRP2. Login to comment
5 Unlike the R768W MRP2, the Q1382R MRP2 was mainly localized on the apical membrane in the wild-type form. Login to comment
8 In conclusion, the R768W mutation causes deficient maturation and impaired sorting, and the Q1382R mutation does not affect maturation or sorting but impairs the substrate-induced ATP hydrolysis. Login to comment
28 The mutants R768W, Q1382R, and K677R were generated from pBS-MRP2.20 To generate these mutant MRPs, site-directed mutagenesis was carried out using a PCR-based method.21 The following primers were used to generate specific mutations: for R768W, the 5Ј-oligonucleotides MRP2-2,302 (5Ј-CAGAAGCAGCGGAT- CAGC; corresponding to the native MRP2 sequence) and R768W-MRP2 (5Ј- CAGAAGCAGTGGAT- CAGCCTG); for Q1382R, the 5Ј-oligonucleotides MRP2-4,555 (5Ј-CATCCCCCAGGACCCCATC; corresponding to the native MRP2 sequence) and Q1382R- MRP2 (5Ј- CATCCCCCGGGACCCCATC); and, for K677R, the 5Ј-oligonucleotides MRP2-2,030 (5Ј- GGCTCTGGGAAATCCTCCTTG; corresponding to the native MRP2 sequence) and K677R-MRP2 (5Ј- GGCTCTGGGAGATCCTCCTTG). Login to comment
39 In brief, 20, 20, 200, and 200 ␮g total protein from LLC-PK1 cells expressing the wild-type, Q1382R, K677R, and R768W MRP2 were treated with 1,000 units of each enzyme for 1 hour at 37°C, respectively. Login to comment
42 Biopsy specimens of a DJS patient (mutation R768W) and noncancerous regions of hepatoma patients were fixed in 10% formaldehyde, processed, and embedded in paraffin. Login to comment
63 We recently identified a missense mutation 2,302 (C3T) R768W in NBD1 in 3 DJS families and another missense mutation 4,145 (A3G) Q1382R in NBD2 in one DJS family (Fig. 1).12,13 Paraffin-embedded liver sections from a patient with R768W mutation were examined for the presence of the MRP2 and P-glycoprotein using monoclonal antibodies. Login to comment
65 In the liver from a DJS patient, we observed positive staining for P-glycoprotein on the canalicular membrane of hepatocytes, but no staining for MRP2, indicating that the R768W MRP2 protein was not ex- Fig. 1. Login to comment
66 Location of the DJS-associated mutations, R768W and Q1382R, in a MRP2. Login to comment
72 Noncancerous region in the normal liver (A and B) and the liver of the DJS patient (R768W) (C and D) was stained with a monoclonal antibody against P-glycoprotein (C219) (A and C) and MRP2 (M2III-6) (B and D). Login to comment
76 These results suggested that R768W mutation in NBD1 impaired the expression or proper sorting of MRP2 to the apical membrane and caused impaired secretion of anionic conjugates. Login to comment
79 To investigate the effect of these DJS-associated mutations on the processing, localization, and function of MRP2, we introduced the 2 DJS-associated mutations, 2,302 (C3T) R768W and 4,145 (A3G) Q1382R into the MRP2 cDNA. Login to comment
81 LLC-PK1 and HEK293 cell lines that stably express the wild-type MRP2 or each mutant MRP2 (R768W, Q1382R, and K677R) were established. Login to comment
86 On the other hand, the R768W and K677R MRP2 were detected as 175-kd weak bands (designated as P) by both antibodies (Fig. 3A and B). Login to comment
87 These results suggested that the R768W and K677R MRP2 did not mature properly and that their expression levels were low. Login to comment
92 The deglycosylated form of MRP2 was also produced from the 175-kd K677R and R768W MRP2 (band P) by the treatment with Endo H, indicating that they did not contain complex oligosaccharides and might be located in the endoplasmic reticulum (ER) or the cis-Golgi complex. Login to comment
95 LLC-PK1 cells stably expressing the wild-type human MRP2 and the mutant MRP (Q1382R, R768W, or K677R) were solubilized and analyzed by Western blot analysis with monoclonal antibodies M2I-4 (A) and M2III-6 (B). Login to comment
98 The cell lysates from LLC-PK1 cells expressing the wild-type and Q1382R MRP2 (20 ␮g) or from cells expressing the R768W and K677R MRP2 (200 ␮g) were treated with Endo H or PNGaseF and analyzed by Western blot analysis with monoclonal antibodies M2I-4. Login to comment
102 Because Western blot analyses suggested that the DJS-associated R768W mutation caused deficient MRP2 maturation, we examined the effect of DJS mutations on the biosynthesis and maturation by pulse-chase experiments. Login to comment
106 In contrast, the 175-kd form (band P) of R768W and K677R MRP2 was scarcely converted to the 190-kd form (band M) and was degraded with a half-life of approximately 60 minutes. Login to comment
109 Only about 10% of the precursor forms of R768W MRP2 were degraded during incubation for 60 minutes in the presence of MG132, an inhibitor of proteasomal degradation, whereas about 40% of the proteins were degraded in the absence of inhibitors (Fig. 5A and B). Login to comment
114 Consistent with our previous report,20 the wild-type MRP2 predominantly localized to the cell surface, especially to the apical membrane (Fig. 6A), but the R768W and K677R MRP2 localized in the cytoplasm, with ER-like distribution (Fig. 6A), consistent with the immature glycosylation of these mutants. Login to comment
123 Effect of proteasome inhibitors on the degradation of the precursor form of the R768W MRP2. Login to comment
124 (A) Proteins in LLC-PK1 cells expressing the wild-type and R768W MRP2 were pulse labeled with [35S]methionine and [35S]cysteine for 20 minutes then chased for 60 minutes in the absence or presence of MG132. Login to comment
125 (B) The relative intensity of the band of the R768W MRP2 was measured (0 minutes as 100%). Login to comment
131 In stable HEK293 transfectants, as in stable LLC-PK1 transfectants (Fig. 3A), the Q1382R mutation did not affect the expression and maturation of MRP2, whereas the R768W and K677R MRP2 did not mature properly, and their expression levels were low (Fig. 7A). Login to comment
133 GS-MCLB efflux from HEK293 cells expressing the R768W and K677R MRP2 was as low as that from control cells, consistent with their low expression of these proteins on the plasma membrane. Login to comment
152 (A) LLC-PK1 cells expressing the wild-type, R768W, and K677R MRP2 were stained with the MRP2 antibody M2III-6. Login to comment
163 The symbols shown are as follows: wild type (F), empty vector (Œ), R768W (ϫ), K677R (ϩ), Q1382R (I). Login to comment
173 Discussion We previously reported 2 missense mutations, 2,302 (C3T) R768W and 4,145 (A3G) Q1382R, and 2 splice donor site mutations, 2,439 ϩ 2 (T3C) and 1,815 ϩ 2 (T3A), in the MRP2 gene in patients with DJS.12,13 In the present study, we examined the molecular consequences and biochemical basis for the defect caused by the missense mutations, R768W and Q1382R, in NBDs. Login to comment
174 The missense mutation R768W, located in the Walker C motif in NBD1, caused deficient maturation and impaired sorting like other reported DJS mutations. Login to comment
176 We introduced 2 DJS-associated MRP2 mutations, R768W and Q1382R, and an artificial mutation, K677R, to the Walker A motif (Fig. 1). Login to comment
178 A confocal microscopic analysis revealed that MRP2 with the missense mutation R768W, in the signature C motif of NBD1, and K677R, in the Walker A motif of NBD1, were localized in the cytoplasm with an ER-like distribution, whereas the wild-type MRP2 was predominantly localized on the apical membrane (Fig. 6A). Login to comment
179 These results are consistent with the immunochemical data showing that there was no apparent expression of MRP2 protein in the canalicular membrane of hepatocytes in a DJS patient with the R768W mutation (Fig. 2). Login to comment
180 R768W and K677R transfectants produced precursor forms of MRP2 protein that were sensitive to Endo H (Fig. 3C) and rapidly degraded with a half-life of less than 60 minutes (Fig. 4). Login to comment
183 MG132, an inhibitor for the cytosolic proteasome, blocked the degradation of the precursor form of R768W MRP2 (Fig. 5), whereas lysosomal inhibitors, chloroquine or NH4Cl, did not block the degradation (data not shown). Login to comment
184 These results suggest that the R768W MRP2 is degraded by the proteasome pathway, which is involved in the degradation of newly synthesized, misfolded, and unassembled proteins in the ER.36 It has also been reported that a 1 amino acid (F508) deletion of the cystic fibrosis transmembrane conductance regulator (CFTR), which is the major mutation in cystic fibrosis patients and causes misfolding of CFTR,37 is degraded by the protea- Fig. 9. Login to comment
192 The missense mutation R768W, in the signature C motif of NBD1, probably causes misfolding of MRP2 and is thus degraded by the proteasome pathway before exiting from the ER. Login to comment
194 These results suggested that, unlike the R768W mutation, the Q1382R mutation does not affect either the maturation process or the subcellular localization of MRP2. Login to comment
208 In conclusion, introduction of a DJS mutation R768W as well as the Walker A lysine mutation K677R resulted in abortive maturation and sorting of MRP2, whereas another DJS mutation, Q1382R, did not affect maturation or sorting but impaired the substrate-induced ATP hydrolysis. Login to comment

[hide] Regulation of expression of the multidrug resistan... J Pharmacol Exp Ther. 2002 Aug;302(2):407-15. Gerk PM, Vore M
Regulation of expression of the multidrug resistance-associated protein 2 (MRP2) and its role in drug disposition.
J Pharmacol Exp Ther. 2002 Aug;302(2):407-15., [PMID:12130697]

Abstract [show]
The multidrug resistance protein 2 (MRP2; ABCC2) is an ATP-binding cassette transporter accepting a diverse range of substrates, including glutathione, glucuronide, and sulfate conjugates of many endo- and xenobiotics. MRP2 generally performs excretory or protective roles, and it is expressed on the apical domain of hepatocytes, enterocytes of the proximal small intestine, and proximal renal tubular cells, as well as in the brain and the placenta. MRP2 is regulated at several levels, including membrane retrieval and reinsertion, translation, and transcription. In addition to transport of conjugates, MRP2 transports cancer chemotherapeutics, uricosurics, antibiotics, leukotrienes, glutathione, toxins, and heavy metals. Several mutagenesis studies have described critical residues for substrate binding and various naturally occurring mutations that eliminate MRP2 expression or function. MRP2 is important clinically as it modulates the pharmacokinetics of many drugs, and its expression and activity are also altered by certain drugs and disease states.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
53 Site-directed mutagenesis studies substi- TABLE 1 Mutations in human MRP2 Mutation Location Translation Domain Phenotype Reference -24(C-T) Promoter 5Ј-UTR Not reported (Ito et al., 2001e) 1249(G-A)/wt Exon 10 V4171 MSD2 Not reported (Ito et al., 2001e) 1815ϩ2(T-A)/1815ϩ2(T-A) Exon 13 147-bp deletion MSD2 DJS (Wada et al., 1998; Toh et al., 1999) 2002del67/2002del67 Exon 16 Premature termination codon NBD1 DJS (Konig et al., 1999a) 2302(C-T)/2302(C-T) Exon 18 R768W/R768W NBD1 DJS (Wada et al., 1998; Toh et al., 1999; Ito et al., 2001e) 2302(C-T)/2439ϩ2(T-C) Exon 18 R768W/168-bp deletion NBD1 DJS (Toh et al., 1999) 2302(C-T)/wt Exon 18 R768W/wt NBD1 Increased UCP1 (Toh et al., 1999) 2366(C-T)/wt Exon 18 S789F/wt NBD1 Not reported (Ito et al., 2001e) 2439ϩ2(T-C)/2439ϩ2(T-C) Exon 18 168-bp deletion/168-bp deletion NBD1 DJS (Wada et al., 1998; Toh et al., 1999) 2439ϩ2(T-C)/4145(A-G) Exon 18/29 168-bp deletion/Q1328R NBD1/2 DJS (Toh et al., 1999) 2439ϩ2(T-C)/wt Exon 18 168-bp deletion/wt NBD1 Increased UCP1 (Toh et al., 1999) 3196(C-T)/3196(C-T) Exon 23 Premature termination codon MSD3 DJS (Paulusma et al., 1997; Tsujii et al., 1999) 3449(G-A)/3449(G-A) Exon 25 R1150H/R1150H MSD3 DJS (Mor-Cohen et al., 2001) 3517(A-T)/3517(A-T) Exon 25 I1173F/I1173F MSD3 DJS (Mor-Cohen et al., 2001) 3972(C-T)/wt Exon 28 I1324I/wt near NBD2 None (Ito et al., 2001e) 4175del6 Exon 30 Loss of R1392 and M1393 NBD2 DJS (Tsujii et al., 1999) 4348(G-A)/wt Exon 31 A1450T/wt NBD2 Not reported (Ito et al., 2001e) UTR, untranslated region; wt, wild type; bp, base pair; UCP1, urinary coproporphyrin fraction 1. tuting the cationic amino acid Arg586 and Arg1096 in rat Mrp2 with neutral amino acids (R586L, R586I, R1096L, and R1096M) or a cationic amino acid (R1096K) led to acquisition of taurocholate transport and retention of glucuronide and glutathione conjugate transport by Mrp2 (Ito et al., 2001d). Login to comment

[hide] Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found... Drug Metab Dispos. 2002 Apr;30(4):363-4. Itoda M, Saito Y, Soyama A, Saeki M, Murayama N, Ishida S, Sai K, Nagano M, Suzuki H, Sugiyama Y, Ozawa S, Sawada Ji J
Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found in 72 established cell lines derived from Japanese individuals: an association between single nucleotide polymorphisms in the 5'-untranslated region and exon 28.
Drug Metab Dispos. 2002 Apr;30(4):363-4., [PMID:11901087]

Abstract [show]
We found nucleotide variability in the 5'-upstream region and exonic sequences of a gene-encoding canalicular multispecific organic anion transporter/multidrug resistance-associated protein 2 (cMOAT/MRP2) by polymerase chain reaction-based sequencing using genomic DNA from 72 established cell lines derived from 72 Japanese individuals. Four single nucleotide polymorphisms (SNPs) were found in the 5'-untranslational region and 21 in the exonic regions. Of them, 14 were nonsynonymous SNPs. One deletion of seven consecutive adenines resulting in a frameshift variant was also found. Four SNPs, c-24t, g1249a (V417I), c2366t (S789F), and c3972t (I1324I), were the same as those recently reported. A strong association was found between c-24t (5'-untranslated region) and c3972t (exon 28), with the promoter activity of the former worth being compared.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 Location Substitution Genotype 72 Cell Linesa (48 Subjects)b Nucleotide Amino Acid w/w w/m m/m 5Ј-Flanking t-751a 71 1 0 5Ј-Flanking c-717t 71 1 0 5Ј-UTR c-24t 52 (31) 14 (16) 6 (1) 5Ј-UTR g-23a 70 2 0 Exon 2 c56t P19L 71 1 0 Exon 3 a234g L78L 71 1 0 Exon 3 g299a R100Q 71 1 0 Exon 7 g842a S281N 71 1 0 Exon 10 g1249a V417I 59 (37) 9 (10) 4 (1) Exon 10 c1457t T486I 69 2 1 Exon 18 c2302t R768W 72 (47) 0 (1) 0 (0) Exon 18 c2366t S789F 71 (47) 1 (1) 0 (0) Exon 20 g2647a D883N 71 1 0 Exon 21 a2882g K961R 71 1 0 Exon 22 g2934a S978S 66 5 1 Exon 22 c3039t T1013T 71 0 1 Exon 22 g3057t Q1019H 71 1 0 Exon 24 g3321t L1107L 71 1 0 Exon 25 g3521a R1174H 71 1 0 Exon 25 t3563a V1188E 71 1 0 Exon 26 t3732g N1244K 71 0 1 Exon 28 c3972t I1324I 49 (29) 14 (17) 9 (2) Exon 29 c4100g S1367C 71 1 0 Exon 30 g4290t V1430V 71 1 0 Exon 31 g4348a A1450T 72 (47) 0 (1) 0 (0) Exon 31 c4488t H1496H 71 1 0 Exon 32 g4544a C1515Y 71 1 0 UTR, untranslated region. Login to comment

[hide] Genomic structure of the canalicular multispecific... Am J Hum Genet. 1999 Mar;64(3):739-46. Toh S, Wada M, Uchiumi T, Inokuchi A, Makino Y, Horie Y, Adachi Y, Sakisaka S, Kuwano M
Genomic structure of the canalicular multispecific organic anion-transporter gene (MRP2/cMOAT) and mutations in the ATP-binding-cassette region in Dubin-Johnson syndrome.
Am J Hum Genet. 1999 Mar;64(3):739-46., [PMID:10053008]

Abstract [show]
Dubin-Johnson syndrome (DJS) is an autosomal recessive disease characterized by conjugated hyperbilirubinemia. Previous studies of the defects in the human canalicular multispecific organic anion transporter gene (MRP2/cMOAT) in patients with DJS have suggested that the gene defects are responsible for DJS. In this study, we determined the exon/intron structure of the human MRP2/cMOAT gene and further characterized mutations in patients with DJS. The human MRP2/cMOAT gene contains 32 exons, and it has a structure that is highly conserved with that of another ATP-binding-cassette gene, that for a multidrug resistance-associated protein. We then identified three mutations, including two novel ones. All mutations identified to date are in the cytoplasmic domain, which includes the two ATP-binding cassettes and the linker region, or adjacent putative transmembrane domain. Our results confirm that MRP2/cMOAT is the gene responsible for DJS. The finding that mutations are concentrated in the first ATP-binding-cassette domain strongly suggests that a disruption of this region is a critical route to loss of function.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
25 We previously had isolated the human MRP2/cMOAT gene as the candidate transporter for the glucuronide- Table 1 Mutations in MRP2/cMOAT and Serum Total- and Direct-Bilirubin and Urinary Coproporphyrine Isomer I Fractions, in Patients with DJS and in Their Families PEDIGREE AND PATIENT/ FAMILY MEMBER ALTERATION IN cMAOT EXON PUTATIVE CONSEQUENCE CONCENTRATION [NORMAL RANGE]a T-bilirubin [.3-1.0] (mg/dl) D-bilirubin [.1-.6] (mg/dl) Urinary Coproporphyrin I Fraction [!27]b (%) 1: DJ1 2302(CrT)/2302(CrT) 18 R768W/R768W 5.0 3.8 NT 2: DJ2 2302(CrT)/wild type 18 R768W/wild type NT NT 42.1 DJ3 2439ϩ2(TrC)/wild type 18 Splice donor/wild type NT NT 43.5 DJ4 2302(CrT)/2439ϩ2(TrC) 18 R768W/splice donor 1.3 .8 94.5 DJ5 2302(CrT)/2439ϩ2(TrC) 18 R768W/splice donor 1.3 .8 93.6 DJ6 Wild type/wild type ) Wild type/wild type NT NT NT 3: DJ7 1815ϩ2(TrA)/1815ϩ2(TrA) 13 Splice donor/splice donor 5.2 3.8 NT 4: DJ8 2302(CrT)/2302(CrT) 18 R768W/R768W 4.8 3.2 NT 5: DJ9 2439ϩ2(TrC)/4145(ArG) 18/29 Splice donor/Q1382R 2.5 1.6 80.0 6: DJ10 2439ϩ2(TrC)/2439ϩ2(TrC) 18 Splice donor/splice donor 2.1 1.6 85.7 DJ11 2439ϩ2(TrC)/wild type 18 Splice donor/wild type .9 .4 48.0 DJ12 2439ϩ2(TrC)/wild type 18 Splice donor/wild type .5 .2 36.9 a NT ϭ not tested. Login to comment
76 This alteration was accompanied by an amino acid substitution, R768W, in the active transporter-family signature (Higgins 1992) (fig. 1). Login to comment
99 The first mutation, identified in DJ8 in the present study, is 2302(CrT) and is associated with the amino acid change Arg768 rTrp (R768W) in the highly conserved domain, the Walker C motif. Login to comment
123 This mutation is accompanied by an amino acid substitution, R768W, in the Walker C motif, which is a highly conserved domain among the ABC-transporter family. Login to comment

[hide] A splice mutation in the human canalicular multisp... Biochem Biophys Res Commun. 1998 Dec 18;253(2):454-7. Kajihara S, Hisatomi A, Mizuta T, Hara T, Ozaki I, Wada I, Yamamoto K
A splice mutation in the human canalicular multispecific organic anion transporter gene causes Dubin-Johnson syndrome.
Biochem Biophys Res Commun. 1998 Dec 18;253(2):454-7., [PMID:9878557]

Abstract [show]
The human Dubin Johnson syndrome (DJS) is a rare autosomal recessive disorder characterized by chronic conjugated hyperbilirubinemia and impaired hepatobiliary transport of non-bile salt organic anions. A highly homologous phenotype exists in the transport deficient (TR-) Wistar rat, which has a defective canalicular multispecific organic anion transporter (cMOAT). This protein mediates adenosine triphosphate-dependent transport of a broad range of endogenous and xenobiotic compounds across the (apical) canalicular membrane of the hepatocyte. The cDNA encoding rat cMOAT has recently been cloned, and this mutation in the TR- rat has been identified. Subsequently the human homologue of rat cMOAT localized in the liver was found to be the cause of DJS. In an individual with DJS, we have identified a single novel nucleotide substitution in the exon-intron junction of the cMOAT gene which generates liver cDNA with a 67bp exon deletion.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
61 Wada et al. identified three kinds of mutations in Japanese DJS patients; a missense mutation 2302 (C to T) R768W in the active transport signature, 2272del168, a deletion of 168 nucleotides from 2272 to 2439, 1669del147, a splice mutation that leads to 147b deletion (from nucleotides 1669 to 1815) (8). Login to comment

[hide] Mutations in the canilicular multispecific organic... Hum Mol Genet. 1998 Feb;7(2):203-7. Wada M, Toh S, Taniguchi K, Nakamura T, Uchiumi T, Kohno K, Yoshida I, Kimura A, Sakisaka S, Adachi Y, Kuwano M
Mutations in the canilicular multispecific organic anion transporter (cMOAT) gene, a novel ABC transporter, in patients with hyperbilirubinemia II/Dubin-Johnson syndrome.
Hum Mol Genet. 1998 Feb;7(2):203-7., [PMID:9425227]

Abstract [show]
Members of the ATP-binding cassette (ABC) transporter superfamily are mutated to cause diseases that include cystic fibrosis, hyperinsulinemia, adrenoleukodystrophy, Stargardt disease and multidrug resistance. We recently isolated a novel human member of ABC transporter superfamily as the candidate transporter for the glucuronide and glutathione-conjugated antitumor agents, and found it highly homologous to the rat cmoat gene. consistent with recent findings of defects in the homologous cmoat gene in two rat models of hyperbilirubinemia (TR- and Eisai), we report two deletions and a missense mutation in the active transport family signature region in the gene in patients with hyperbilirubinemia II/Dubin-Johnson syndrome (DJS; MIM 237500), respectively. These results strongly implicate the cMOAT gene as responsible for the defects in DJS patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
21 We identified a missense mutation 2302 (C→T) R768W in the active transport family signature (15) present in cDNA of three patients, DJ1, DJ4 and DJ5 (Figs 1 and 2). Login to comment

[hide] Structure, function, expression, genomic organizat... Int J Toxicol. 2006 Jul-Aug;25(4):231-59. Choudhuri S, Klaassen CD
Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters.
Int J Toxicol. 2006 Jul-Aug;25(4):231-59., [PMID:16815813]

Abstract [show]
The ATP-binding cassette (ABC) transporters constitute a large family of membrane proteins, which transport a variety of compounds through the membrane against a concentration gradient at the cost of ATP hydrolysis. Substrates of the ABC transporters include lipids, bile acids, xenobiotics, and peptides for antigen presentation. As they transport exogenous and endogenous compounds, they reduce the body load of potentially harmful substances. One by-product of such protective function is that they also eliminate various useful drugs from the body, causing drug resistance. This review is a brief summary of the structure, function, and expression of the important drug resistance-conferring members belonging to three subfamilies of the human ABC family; these are ABCB1 (MDR1/P-glycoprotein of subfamily ABCB), subfamily ABCC (MRPs), and ABCG2 (BCRP of subfamily ABCG), which are expressed in various organs. In the text, the transporter symbol that carries the subfamily name (such as ABCB1, ABCC1, etc.) is used interchangeably with the corresponding original names, such as MDR1P-glycoprotein, MRP1, etc., respectively. Both nomenclatures are maintained in the text because both are still used in the transporter literature. This helps readers relate various names that they encounter in the literature. It now appears that P-glycoprotein, MRP1, MRP2, and BCRP can explain the phenomenon of multidrug resistance in all cell lines analyzed thus far. Also discussed are the gene structure, regulation of expression, and various polymorphisms in these genes. Because genetic polymorphism is thought to underlie interindividual differences, including their response to drugs and other xenobiotics, the importance of polymorphism in these genes is also discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
315 Other SNPs identified with low frequency (~1%) were C2302T (Arg768Trp), C2366T (Ser789Phe), and G4348A (Ala1450Thr), all being missense mutations. Login to comment
331 The two missence mutations were C2302T transition in exon 18, resulting in amino acid replacement Arg768Trp in the active transport family signature motif; and A4145G transition in exon 29, resulting in amino acid substitution Gln1382Arg in the position within the ABC signature motif at the C-terminal end. Login to comment

[hide] Genetic Variations of ABCC2 Gene Associated with A... Genomics Inform. 2013 Dec;11(4):254-62. doi: 10.5808/GI.2013.11.4.254. Epub 2013 Dec 31. Yi JH, Cho YJ, Kim WJ, Lee MG, Lee JH
Genetic Variations of ABCC2 Gene Associated with Adverse Drug Reactions to Valproic Acid in Korean Epileptic Patients.
Genomics Inform. 2013 Dec;11(4):254-62. doi: 10.5808/GI.2013.11.4.254. Epub 2013 Dec 31., [PMID:24465238]

Abstract [show]
The multidrug resistance protein 2 (MRP2, ABCC2) gene may determine individual susceptibility to adverse drug reactions (ADRs) in the central nervous system (CNS) by limiting brain access of antiepileptic drugs, especially valproic acid (VPA). Our objective was to investigate the effect of ABCC2 polymorphisms on ADRs caused by VPA in Korean epileptic patients. We examined the association of ABCC2 single-nucleotide polymorphisms and haplotype frequencies with VPA related to adverse reactions. In addition, the association of the polymorphisms with the risk of VPA related to adverse reactions was estimated by logistic regression analysis. A total of 41 (24.4%) patients had shown VPA-related adverse reactions in CNS, and the most frequent symptom was tremor (78.0%). The patients with CNS ADRs were more likely to have the G allele (79.3% vs. 62.7%, p = 0.0057) and the GG genotype (61.0% vs. 39.7%, p = 0.019) at the g.-1774delG locus. The frequency of the haplotype containing g.-1774Gdel was significantly lower in the patients with CNS ADRs than without CNS ADRs (15.8% vs. 32.3%, p = 0.0039). Lastly, in the multivariate logistic regression analysis, the presence of the GG genotype at the g.-1774delG locus was identified as a stronger risk factor for VPA related to ADRs (odds ratio, 8.53; 95% confidence interval, 1.04 to 70.17). We demonstrated that ABCC2 polymorphisms may influence VPA-related ADRs. The results above suggest the possible usefulness of ABCC2 gene polymorphisms as a marker for predicting response to VPA-related ADRs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
35 In addition, the c.2302C &#ff1e; T (exon 18, Arg768Trp) mutation is responsible for Dubin-Johnson syndrome [21, 22]. Login to comment