ABCMdb

PMID: 12395335

Hashimoto K, Uchiumi T, Konno T, Ebihara T, Nakamura T, Wada M, Sakisaka S, Maniwa F, Amachi T, Ueda K, Kuwano M
Trafficking and functional defects by mutations of the ATP-binding domains in MRP2 in patients with Dubin-Johnson syndrome.
Hepatology. 2002 Nov;36(5):1236-45., [PubMed]

Sentences

No. Mutations Sentence Comment

1 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg We investigated the consequences of 2 missense mutations, R768W and Q1382R, of nucleotide-binding domains (NBDs) of the multidrug resistance protein 2 (MRP2; ABCC2) that were previously identified in patients with DJS. Login to comment 2 ABCC2 p.Gln1382Arg Pulse chase analysis revealed that the precursor form of the wild-type and Q1382R MRP2 were converted to the mature form, which is resistant to endoglycosidase H (Endo H) in about 60 minutes. Login to comment 3 ABCC2 p.Arg768Trp However, the precursor form of the R768W MRP2, which is sensitive to endoglycosidase H, was degraded within 120 minutes and did not mature to the fully glycosylated form. Login to comment 4 ABCC2 p.Arg768Trp Proteasome inhibitors inhibited the degradation of the precursor form of the R768W MRP2. Login to comment 5 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg Unlike the R768W MRP2, the Q1382R MRP2 was mainly localized on the apical membrane in the wild-type form. Login to comment 6 ABCC2 p.Gln1382Arg ABCC2 p.Gln1382Arg However, efflux of glutathione monochlorobimane (GS-MCLB) and ATP-dependent leukotriene C4 (LTC4) uptake into plasma membrane vesicles from cells expressing the Q1382R MRP2 were markedly reduced, suggesting that the Q1382R MRP2 on the apical membrane was nonfunctional. Login to comment 7 ABCC2 p.Gln1382Arg Vanadate-induced nucleotide trapping with 8-azido-[␣-32P]ATP in the wild-type MRP2 was stimulated by estradiol glucuronide (E217betaG) in a concentration-dependent manner but that in the Q1382R MRP2 was not. Login to comment 8 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg In conclusion, the R768W mutation causes deficient maturation and impaired sorting, and the Q1382R mutation does not affect maturation or sorting but impairs the substrate-induced ATP hydrolysis. Login to comment 28 ABCC2 p.Arg768Trp ABCC2 p.Arg768Trp ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg ABCC2 p.Gln1382Arg ABCC2 p.Gln1382Arg ABCC2 p.Lys677Arg ABCC2 p.Lys677Arg ABCC2 p.Lys677Arg The mutants R768W, Q1382R, and K677R were generated from pBS-MRP2.20 To generate these mutant MRPs, site-directed mutagenesis was carried out using a PCR-based method.21 The following primers were used to generate specific mutations: for R768W, the 5Ј-oligonucleotides MRP2-2,302 (5Ј-CAGAAGCAGCGGAT- CAGC; corresponding to the native MRP2 sequence) and R768W-MRP2 (5Ј- CAGAAGCAGTGGAT- CAGCCTG); for Q1382R, the 5Ј-oligonucleotides MRP2-4,555 (5Ј-CATCCCCCAGGACCCCATC; corresponding to the native MRP2 sequence) and Q1382R- MRP2 (5Ј- CATCCCCCGGGACCCCATC); and, for K677R, the 5Ј-oligonucleotides MRP2-2,030 (5Ј- GGCTCTGGGAAATCCTCCTTG; corresponding to the native MRP2 sequence) and K677R-MRP2 (5Ј- GGCTCTGGGAGATCCTCCTTG). Login to comment 39 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg ABCC2 p.Lys677Arg In brief, 20, 20, 200, and 200 ␮g total protein from LLC-PK1 cells expressing the wild-type, Q1382R, K677R, and R768W MRP2 were treated with 1,000 units of each enzyme for 1 hour at 37°C, respectively. Login to comment 42 ABCC2 p.Arg768Trp Biopsy specimens of a DJS patient (mutation R768W) and noncancerous regions of hepatoma patients were fixed in 10% formaldehyde, processed, and embedded in paraffin. Login to comment 56 ABCC2 p.Gln1382Arg Plasma membrane vesicles were prepared from HEK293 cells expressing the wild-type and Q1382R MRP2 according to the method of Cornwell et al.30 with some modifications as described previously.22 ATP-dependent uptake of [3H] LTC4 into the inside-out membrane vesicles was measured by a rapid filtration technique22,30 with some modifications. Login to comment 60 ABCC2 p.Gln1382Arg Vanadate trapping of 8-azido-ATP and subsequent photoaffinity labeling were performed as described previously.31 Membrane proteins (2 ␮g) from the stable transfectants of wild-type MRP2, Q1382R MRP2, and empty vector in HEK293 cells were suspended with the assay solution including 1 mmol/L vanadate and estradiol glucuronide (E217betaG) at each concentration. Login to comment 63 ABCC2 p.Arg768Trp ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg We recently identified a missense mutation 2,302 (C3T) R768W in NBD1 in 3 DJS families and another missense mutation 4,145 (A3G) Q1382R in NBD2 in one DJS family (Fig. 1).12,13 Paraffin-embedded liver sections from a patient with R768W mutation were examined for the presence of the MRP2 and P-glycoprotein using monoclonal antibodies. Login to comment 65 ABCC2 p.Arg768Trp In the liver from a DJS patient, we observed positive staining for P-glycoprotein on the canalicular membrane of hepatocytes, but no staining for MRP2, indicating that the R768W MRP2 protein was not ex- Fig. 1. Login to comment 66 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg Location of the DJS-associated mutations, R768W and Q1382R, in a MRP2. Login to comment 69 ABCC2 p.Lys677Arg The Walker A lysine mutation K677R is also shown. Login to comment 72 ABCC2 p.Arg768Trp Noncancerous region in the normal liver (A and B) and the liver of the DJS patient (R768W) (C and D) was stained with a monoclonal antibody against P-glycoprotein (C219) (A and C) and MRP2 (M2III-6) (B and D). Login to comment 76 ABCC2 p.Arg768Trp These results suggested that R768W mutation in NBD1 impaired the expression or proper sorting of MRP2 to the apical membrane and caused impaired secretion of anionic conjugates. Login to comment 77 ABCC2 p.Gln1382Arg We were unable to examine whether the Q1382R MRP2 was expressed in the canalicular membrane of hepatocytes because no bioptic sample was available. Login to comment 79 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg To investigate the effect of these DJS-associated mutations on the processing, localization, and function of MRP2, we introduced the 2 DJS-associated mutations, 2,302 (C3T) R768W and 4,145 (A3G) Q1382R into the MRP2 cDNA. Login to comment 80 ABCC2 p.Lys677Arg Another artificial mutation, 2,030 (A3G) K677R, was also introduced into the Walker A motif of NBD1. Login to comment 81 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg ABCC2 p.Lys677Arg LLC-PK1 and HEK293 cell lines that stably express the wild-type MRP2 or each mutant MRP2 (R768W, Q1382R, and K677R) were established. Login to comment 83 ABCC2 p.Gln1382Arg The antibody M2I-4 detected a 190 to 210 kd diffused band, probably mature and glycosylated protein (designated as M) of the wild-type and Q1382R MRP2 (Fig. 3A). Login to comment 84 ABCC2 p.Gln1382Arg The antibody M2III-6, raised against the C-terminal region, recognized the wild-type MRP2 efficiently but the Q1382R MRP2 only weakly (Fig. 3B). Login to comment 85 ABCC2 p.Gln1382Arg The Q1382R mutation changed the epitope to reduce the reactivity to the antibody, although it did not affect the maturation process. Login to comment 86 ABCC2 p.Arg768Trp ABCC2 p.Lys677Arg On the other hand, the R768W and K677R MRP2 were detected as 175-kd weak bands (designated as P) by both antibodies (Fig. 3A and B). Login to comment 87 ABCC2 p.Arg768Trp ABCC2 p.Lys677Arg These results suggested that the R768W and K677R MRP2 did not mature properly and that their expression levels were low. Login to comment 92 ABCC2 p.Arg768Trp ABCC2 p.Lys677Arg The deglycosylated form of MRP2 was also produced from the 175-kd K677R and R768W MRP2 (band P) by the treatment with Endo H, indicating that they did not contain complex oligosaccharides and might be located in the endoplasmic reticulum (ER) or the cis-Golgi complex. Login to comment 95 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg ABCC2 p.Lys677Arg LLC-PK1 cells stably expressing the wild-type human MRP2 and the mutant MRP (Q1382R, R768W, or K677R) were solubilized and analyzed by Western blot analysis with monoclonal antibodies M2I-4 (A) and M2III-6 (B). Login to comment 98 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg ABCC2 p.Lys677Arg The cell lysates from LLC-PK1 cells expressing the wild-type and Q1382R MRP2 (20 ␮g) or from cells expressing the R768W and K677R MRP2 (200 ␮g) were treated with Endo H or PNGaseF and analyzed by Western blot analysis with monoclonal antibodies M2I-4. Login to comment 100 ABCC2 p.Gln1382Arg wild-type and Q1382R MRP2 (band M) were resistant to Endo H, suggesting that they did not contain high mannose oligosaccharides but complex oligosaccharides and reached the trans-Golgi complex. Login to comment 102 ABCC2 p.Arg768Trp Because Western blot analyses suggested that the DJS-associated R768W mutation caused deficient MRP2 maturation, we examined the effect of DJS mutations on the biosynthesis and maturation by pulse-chase experiments. Login to comment 104 ABCC2 p.Gln1382Arg The 175-kd form (band P) of the wild-type and Q1382R MRP2 were converted to the 190-kd form (band M) time dependently, and the conversion was almost completed in 60 minutes. Login to comment 106 ABCC2 p.Arg768Trp ABCC2 p.Lys677Arg In contrast, the 175-kd form (band P) of R768W and K677R MRP2 was scarcely converted to the 190-kd form (band M) and was degraded with a half-life of approximately 60 minutes. Login to comment 109 ABCC2 p.Arg768Trp Only about 10% of the precursor forms of R768W MRP2 were degraded during incubation for 60 minutes in the presence of MG132, an inhibitor of proteasomal degradation, whereas about 40% of the proteins were degraded in the absence of inhibitors (Fig. 5A and B). Login to comment 114 ABCC2 p.Arg768Trp ABCC2 p.Lys677Arg Consistent with our previous report,20 the wild-type MRP2 predominantly localized to the cell surface, especially to the apical membrane (Fig. 6A), but the R768W and K677R MRP2 localized in the cytoplasm, with ER-like distribution (Fig. 6A), consistent with the immature glycosylation of these mutants. Login to comment 115 ABCC2 p.Gln1382Arg On the other hand, the Q1382R MRP2 protein, which is modified with complex oligosaccharides, predominantly localized to the cell surface, especially to the apical membrane, with a distribution similar to that of the wild-type MRP2 (Fig. 6B). Login to comment 116 ABCC2 p.Gln1382Arg Q1382R Mutation Impairs Transport of GS-MCLB. Login to comment 117 ABCC2 p.Gln1382Arg Because Q1382R caused no apparent deficiency in the protein maturation process or apical sorting pro- Fig. 4. Login to comment 123 ABCC2 p.Arg768Trp Effect of proteasome inhibitors on the degradation of the precursor form of the R768W MRP2. Login to comment 124 ABCC2 p.Arg768Trp (A) Proteins in LLC-PK1 cells expressing the wild-type and R768W MRP2 were pulse labeled with [35S]methionine and [35S]cysteine for 20 minutes then chased for 60 minutes in the absence or presence of MG132. Login to comment 125 ABCC2 p.Arg768Trp (B) The relative intensity of the band of the R768W MRP2 was measured (0 minutes as 100%). Login to comment 131 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg ABCC2 p.Lys677Arg In stable HEK293 transfectants, as in stable LLC-PK1 transfectants (Fig. 3A), the Q1382R mutation did not affect the expression and maturation of MRP2, whereas the R768W and K677R MRP2 did not mature properly, and their expression levels were low (Fig. 7A). Login to comment 133 ABCC2 p.Arg768Trp ABCC2 p.Lys677Arg GS-MCLB efflux from HEK293 cells expressing the R768W and K677R MRP2 was as low as that from control cells, consistent with their low expression of these proteins on the plasma membrane. Login to comment 134 ABCC2 p.Gln1382Arg ABCC2 p.Gln1382Arg Interestingly, the GS-MCLB efflux from HEK293 cells expressing the Q1382R MRP2 was even lower than that from control cells, although the Q1382R MRP2 localized on the apical membrane as the wild-type MRP2 (Fig. 7B). Login to comment 136 ABCC2 p.Gln1382Arg However, no decrease of fluorescence of intracellular GS-MCLB was observed in cells expressing the Q1382R MRP2 compared with the level in control cells (Fig. 7C). Login to comment 138 ABCC2 p.Gln1382Arg Taken together, these results suggest that Q1382R MRP2 localized on the apical membrane did not efflux GS-MCLB. Login to comment 139 ABCC2 p.Gln1382Arg Q1382R Mutation Impairs ATP-Dependent LTC4 Uptake Into Plasma Membrane Vesicles. Login to comment 140 ABCC2 p.Gln1382Arg Because GS-MCLB efflux could be affected by the velocity of conjugation in each transfectant, we also measured ATP-dependent LTC4 uptake into plasma membrane vesicles to examine transporter activity of the wild-type and Q1382R MRP2. Login to comment 141 ABCC2 p.Gln1382Arg Similar expression of MRP2 proteins was detected by Western blotting in plasma membrane vesicles from transfectants expressing wild-type and Q1382R MRP2 (Fig. 8A). Login to comment 144 ABCC2 p.Gln1382Arg Although the ATP-dependent uptake into membrane vesicles prepared from transfectants expressing the Q1382R MRP2 was also observed, it was as low as that into vesicles from the cells transfected by the empty vector, probably because of the activity of an endogenous ATP-dependent transport system. Login to comment 145 ABCC2 p.Gln1382Arg These results suggest that Q1382R MRP2 is deficient in ATP-dependent transport of LTC4. Login to comment 146 ABCC2 p.Gln1382Arg Q1382R Mutation Impairs Substrate Stimulation of Vanadate-Induced Nucleotide Trapping. Login to comment 147 ABCC2 p.Gln1382Arg It has been reported that MRP1 traps nucleotides and can be specifically photoaffinity labeled when crude membrane containing MRP1 is incubated with 8-azido-[␣-32P]ATP in the presence of excess vanadate.33,34 We examined whether human MRP2 also shows vanadate-induced nucleotide trapping (Fig. 9A) and, if so, whether the Q1382R mutation affects it (Fig. 9B). Login to comment 149 ABCC2 p.Gln1382Arg Crude membrane from HEK293 stable transfectants, which express similar levels of the wild-type and the Q1382R MRP2 (data not shown), was used for this experiment. Login to comment 152 ABCC2 p.Arg768Trp ABCC2 p.Lys677Arg (A) LLC-PK1 cells expressing the wild-type, R768W, and K677R MRP2 were stained with the MRP2 antibody M2III-6. Login to comment 153 ABCC2 p.Gln1382Arg (B) LLC-PK1 cells expressing the wild-type and Q1382R MRP2 were stained with the MRP2 antibody M2I-4. Login to comment 154 ABCC2 p.Gln1382Arg Vertical sections of LLC-PK1 cells expressing the wild-type and Q1382R MRP2 are shown in the lower panels. Login to comment 158 ABCC2 p.Gln1382Arg The Q1382R MRP2 was weakly photoaffinity labeled (Fig. 4™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™™ Fig. 7. Login to comment 163 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg ABCC2 p.Lys677Arg The symbols shown are as follows: wild type (F), empty vector (Œ), R768W (ϫ), K677R (ϩ), Q1382R (I). Login to comment 166 ABCC2 p.Gln1382Arg LTC4 uptake into plasma membrane vesicles prepared from HEK293 cells expressing the wild-type and Q1382R MRP2. Login to comment 169 ABCC2 p.Gln1382Arg The symbols shown are as follows: wild type (F, E), empty vector (Œ, ‚), Q1382R (I, ᮀ), in the presence of ATP (F, Œ, I) and AMP (E, ‚, ᮀ). Login to comment 173 ABCC2 p.Arg768Trp ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg ABCC2 p.Gln1382Arg Discussion We previously reported 2 missense mutations, 2,302 (C3T) R768W and 4,145 (A3G) Q1382R, and 2 splice donor site mutations, 2,439 ϩ 2 (T3C) and 1,815 ϩ 2 (T3A), in the MRP2 gene in patients with DJS.12,13 In the present study, we examined the molecular consequences and biochemical basis for the defect caused by the missense mutations, R768W and Q1382R, in NBDs. Login to comment 174 ABCC2 p.Arg768Trp The missense mutation R768W, located in the Walker C motif in NBD1, caused deficient maturation and impaired sorting like other reported DJS mutations. Login to comment 175 ABCC2 p.Gln1382Arg Interestingly, the other missense mutation Q1382R, located in NBD2, impaired substrate-induced ATP hydrolysis. Login to comment 176 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg ABCC2 p.Lys677Arg We introduced 2 DJS-associated MRP2 mutations, R768W and Q1382R, and an artificial mutation, K677R, to the Walker A motif (Fig. 1). Login to comment 178 ABCC2 p.Arg768Trp ABCC2 p.Lys677Arg A confocal microscopic analysis revealed that MRP2 with the missense mutation R768W, in the signature C motif of NBD1, and K677R, in the Walker A motif of NBD1, were localized in the cytoplasm with an ER-like distribution, whereas the wild-type MRP2 was predominantly localized on the apical membrane (Fig. 6A). Login to comment 179 ABCC2 p.Arg768Trp These results are consistent with the immunochemical data showing that there was no apparent expression of MRP2 protein in the canalicular membrane of hepatocytes in a DJS patient with the R768W mutation (Fig. 2). Login to comment 180 ABCC2 p.Arg768Trp ABCC2 p.Lys677Arg R768W and K677R transfectants produced precursor forms of MRP2 protein that were sensitive to Endo H (Fig. 3C) and rapidly degraded with a half-life of less than 60 minutes (Fig. 4). Login to comment 183 ABCC2 p.Arg768Trp MG132, an inhibitor for the cytosolic proteasome, blocked the degradation of the precursor form of R768W MRP2 (Fig. 5), whereas lysosomal inhibitors, chloroquine or NH4Cl, did not block the degradation (data not shown). Login to comment 184 ABCC2 p.Arg768Trp These results suggest that the R768W MRP2 is degraded by the proteasome pathway, which is involved in the degradation of newly synthesized, misfolded, and unassembled proteins in the ER.36 It has also been reported that a 1 amino acid (F508) deletion of the cystic fibrosis transmembrane conductance regulator (CFTR), which is the major mutation in cystic fibrosis patients and causes misfolding of CFTR,37 is degraded by the protea- Fig. 9. Login to comment 185 ABCC2 p.Gln1382Arg Vanadate-induced trapping of 8-azido-[␣-32P]ATP in the wild-type and Q1382R MRP2. Login to comment 186 ABCC2 p.Gln1382Arg Membrane proteins (2 ␮g) from HEK293 cells expressing the wild type (A), Q1382R MRP2 (B), and mock transfectant (C) were reacted with 10 ␮mol/L 8-azido-[␣-32P]ATP in the absence (lane 1) or presence of 1 mmol/L vanadate (lanes 2-5) and 10 ␮mol/L E217betaG (lane 3), 50 ␮mol/L E217betaG (lane 4), and 100 ␮mol/L E217betaG (lane 5) for 10 minutes at 37°C. Login to comment 190 ABCC2 p.Gln1382Arg The symbols shown are as follows: wild type (F), empty vector (Œ), and Q1382R (I). Login to comment 192 ABCC2 p.Arg768Trp The missense mutation R768W, in the signature C motif of NBD1, probably causes misfolding of MRP2 and is thus degraded by the proteasome pathway before exiting from the ER. Login to comment 193 ABCC2 p.Gln1382Arg ABCC2 p.Gln1382Arg Another missense mutation, 4,145 (A3G) Q1382R, in NBD2 was found in one DJS patient with compound heterozygous mutants.13 The precursor form of the Q1382R MRP2 was rapidly converted to the mature form (Fig. 4), which was resistant to Endo H (Fig. 3C), and sorted to the apical membrane of the LLC-PK1 cells as the wild-type MRP2 (Fig. 6B). Login to comment 194 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg These results suggested that, unlike the R768W mutation, the Q1382R mutation does not affect either the maturation process or the subcellular localization of MRP2. Login to comment 195 ABCC2 p.Gln1382Arg However, efflux of GS-MCLB and ATP-dependent LTC4 uptake into plasma membrane vesicles from HEK293 cells expressing the Q1382R MRP2 were markedly reduced compared with that from cells expressing the wild-type MRP2 (Figs. Login to comment 197 ABCC2 p.Gln1382Arg This indicated that the Q1382R MRP2 localized on the apical membrane was nonfunctional. Login to comment 198 ABCC2 p.Gln1382Arg To assess the functional integrity of the Q1382R MRP2, we examined vanadate-induced nucleotide trapping by using 8-azido-[␣-32P]ATP. Login to comment 200 ABCC2 p.Gln1382Arg Vanadate-induced nucleotide trapping in the wild-type MRP2 was stimulated by E217betaG in a concentration-dependent manner but that in Q1382R MRP2 was not (Fig. 9). Login to comment 203 ABCC2 p.Gln1382Arg These results suggest that 8-azido-[␣-32P]ATP is trapped with vanadate after hydrolysis and that the Q1382R mutation impaired substrate-induced ATP hydrolysis. Login to comment 206 ABCC7 p.Gln1291Arg ABCC7 p.Gln1291Arg This water molecule is the most likely candidate for attacking water during ATP hydrolysis.38 The comparable amino acid substitution, Q1291R, in CFTR was observed in patients with cystic fibrosis.39 It has also been reported that the Q1291R CFTR shows no chloride channel function, although it reaches the plasma membrane as a fully glycosylated mature protein. Login to comment 207 ABCC2 p.Gln1382Arg However, the role of the glutamine in the Q-loop has been controversial because the correspondent glutamine residue in the malK molecule was suggested to be placed too far away from the nucleotide to coordinate Mg2ϩ and the water molecule that attacks the ␥-phosphate bond.40 In the present study, the lack of substrate-induced vanadate trapping in the Q1382R MRP2 may suggest that Q1382 is directly involved in ATP hydrolysis. Login to comment 208 ABCC2 p.Arg768Trp ABCC2 p.Gln1382Arg ABCC2 p.Lys677Arg In conclusion, introduction of a DJS mutation R768W as well as the Walker A lysine mutation K677R resulted in abortive maturation and sorting of MRP2, whereas another DJS mutation, Q1382R, did not affect maturation or sorting but impaired the substrate-induced ATP hydrolysis. Login to comment