ABCMdb

ABCC2 p.Arg768Trp

None has been submitted yet.

Publications

PMID: 16766035 [PubMed] Cascorbi I et al: "Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs."

No. Sentence Comment

882 0.01 Exon 2 56 C>T P19L 0.01 Exon 3 234 A>G synonymous 0.01 Exon 3 299 G>A R100Q 0.01 Exon 7 842 G>A S281N 0.01 Exon 10 1249 G>A V417I 0.12 (0.21) Exon 10 1457 C>T T486I 0.03 Exon 18 2302 C>T R768W 0.01 (0.00) Exon 18 2366 C>T S789F 0.01 (0.00) slightly elevated activity, lower expressionb Exon 20 2647 G>A D883N 0.01 Exon 21 2882 A>G K961R 0.01 Exon 22 2934 G>A synonymous 0.05 Exon 22 3039 C>T synonymous 0.01 Exon 22 3057 G>T Q1019H 0.01 Exon 24 3321 G>T synonymous 0.01 Exon 25 3521 G>A R1174H 0.01 Exon 25 3563 T>A V1188E 0.01 Exon 26 3732 C>T N1244K 0.01 Exon 28 3972 C>T synonymous 0.21 (0.34) Exon 29 4100 C>G S1367C 0.01 Exon 30 4290 G>T synonymous 0.01 Exon 31 4348 G>A A1450T 0.01 (0.00) decreased activity, lower expressionb Exon 31 4488 C>T synonymous 0.01 Exon 32 4544 G>A C1515Y 0.01 a Haenisch et al. (in press). Login to comment

PMID: 17373578 [PubMed] Yoshioka S et al: "The identification of two germ-line mutations in the human breast cancer resistance protein gene that result in the expression of a low/non-functional protein."

No. Sentence Comment

156 R768W MRP2, which has the amino acid substitution in Signature C of the first ATP binding site of the protein, confers high serum bilirubin concentrations in the affected patients (28), and the mutant protein is not completely glycosylated (29). Login to comment

PMID: 18464048 [PubMed] Gradhand U et al: "Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2)."

No. Sentence Comment

101 Several molecular defects in MRP2 have been suggested to result in DJS including those which produce deficient protein maturation (Hashimoto et al., 2002; Keitel et al., 2003), proteasomal degradation (Keitel, 2003), impaired membrane sorting (Hashimoto et al., 2002; Mor-Cohen et al., 2001), loss in transport activity (Mor-Cohen et al., 2001), Figure 2 Predicted membrance topology of MRP2 (ABCC2) based on hydrophobicity analysis. Locations of the non-synonymous polymorphisms are indicated with arrows. See Table 2 for allele frequencies and description of funtional consequences. NH2 COOH NBD NBD in out Membrane Pro19Leu Phe39Tyr Arg100* Arg100Gln Ser281Asn Ser325* Asp333Gly Arg353His Arg412Gly Val417Ile Lys430Arg Thr486Ile Gly676Arg Trp709Arg Asn718Ser Ser789Phe Arg768Trp Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* Phe981Leu Gln1019His Arg1066* Arg1150His Arg1100Cys Arg1100His Ile1137Phe Ile1173Phe Val1188Glu Arg1174His Arg1181Leu Asn1244Lys Thr1273Ala Pro1291Leu Lys1299Gln Arg1310* Ser1367Cys Gln1382Arg Arg1392del Met1393del Ala1450Thr Thr1476Met Cys1515Tyr MRP2 (ABCC2) NBD NBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* NBD NBDNBD Asp833Asn Glu893Gln Leu927Arg Lys961Arg Tyr967* 325 Table2MRP2(ABCC2)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Amino acidexchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 56C>TPro19LeuExon2--1[1]b -- 116T>APhe39TyrExon2--0[2]--rs927344 298C>TArg100*Exon3--[3]-DJS[3] 299G>AArg100GlnExon3--1[1]b -- 842G>ASer281AsnExon7-0[4]1[1]b -- 974C>GSer325*Exon8---Malayan[5]DJS[5] 998A>GAsp333GlyExon8--0[2]--rs17222674 1058G>AArg353HisExon9--0[2]--rs7080681 1271A>GArg412GlyExon10-[6]0[2]-DJS;Decreaseinmethotrexateelimination[6] 1249G>AVal417IleExon10-22[7]13[9]-lowermRNAand(protein)expressioninpreterm placenta[11] rs2273697 26[8]16[4]noeffectonRNAandproteinininduodenum[12] 19[10]noeffectonproteininliver[8] noeffectonconjugatedbilirubinlevelinserum[13] changesinlocalizationinneuroepithelialtumors[14] possibleassociationwithtenofovir-inducedrenal proximaltubulopathy[15] 1289A>GLys430ArgExon10-4[16]0[2]-- 1457C>TThr486IleExon10-0[4]3[1]b -- 2026G>CGly676Arg--0[2]-DJS[17] 2125T>CTrp709Arg--0[2]-DJS[17] 2153A>GAsn718SerExon17-0[4]0[2]--rs3740072 2302C>TArg768TrpExon18-0[18]1[9]-DJS;deficientmaturationandimpairedsorting[19] 2366C>TSer789PheExon18-0[18]1[9]-lowerexpressionandmembranelocalization[20] noeffectonconjugatedbilirubinlevelinserum[13]/ heterozygous 2647G>AAsp883AsnExon20--1[1]b -- 2677G>CGlu893GlnExon20--0[2]--rs3740071 2780T>GLeu927ArgExon21-1[10]0[2]-- (Continued) Table2(Continued) Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 2882A>GLys961ArgExon21--1[1]b --- 2901C>ATyr967*Exon22--0[2]--rs17222547 2943C>GPhe981LeuExon22-2[21]0[2]-Noinfluenceonpravastatinkinetics[21] 3057G>TGln1019HisExon22--1[1]b -- 3196C>TArg1066*Exon23-[22]0[2]-DJS;truncatedprotein[22][23] 3298C>TArg1100CysExon24-1[10]0[2]-- 3299G>AArg1100HisExon24-1[10]0[2]-- 3449G>AArg1150HisExon25--0[2]Israeli[24]DJS;impairedtransportactivityintransfectedcells althoughnormalexpressionandlocalization[24] 3517A>TIle1173PheExon25--0[2]Israeli[24]DJS;impairedproteinmaturationandproteasomal degradation[25] lowexpression,mislocation,andimpairedtransport activityintransfectedcells[24] 3521G>AArg1174HisExon25-0[4]1[1]b -- 3542G>TArg1181LeuExon25-0[4]0[2]--rs8187692 3563T>AVal1188GluExon25-7[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4],rs17222723 4[16]associatedwithanthracycline-induced cardiotoxicity[26] 6[8] 3732C>TAsn1244LysExon26--0[1]b -- 0[2] 3817A>GThr1273AlaExon27--0[2]--rs8187699 3872C>TPro1291LeuExon28--0[2]--rs17216317 3897A>CLys1299GlnExon28--0[2]--rs4148400 3928C>TArg1310*Exon28--0[2]-DJS[17,27] 4100C>GSer1367CysExon29--1[1]b -- 4145A>GGln1382ArgExon29--[28]-DJS;noeffectonmaturationorsorting,impaired substrate-inducedATPhydrolysis[19] 4175-80delArg1392delExon30--0[2]-DJS;deficientMRP2maturationandimpaired sortingtoapicalmembraneintransfectedcells[29] 327 4348G>AAla11450ThrExon31-0[18]1[9]-lowerexperssionandmembracelocalizationin transfectedcells[20] 4461C>TThr1476MetExon31-[30]1[2]-- 4544G>ACys1515TyrExon32-9[4]1[1]b -noeffectonnelfinaviraccumulationinPBMC[4]rs8187710 5[10]associatedwithanthracycline-induced cardiotoxicity[26] 4[16] 6[8] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment

PMID: 18673259 [PubMed] Nakamura T et al: "Pharmacogenetics of intestinal absorption."

No. Sentence Comment

34 Arg768Trp induced by 2302C>T resulted in deficient maturation and impaired sorting, whereas Glu1382Arg induced by 4145A>G caused deficient transport [40]. Login to comment
36 Hirouchi and colleagues evaluated the cellular location and function of ABCC2 Val417Ile (1249G>A), Arg768Trp (2302C>T), Ser789Phe (2366C>T), and Ala1450Thr (4348G>A) variants in LLC-PK1 cells, finding that Ser789Phe and Ala1450Thr mutations caused less expression and mislocation [51]. Login to comment

PMID: 19949922 [PubMed] Cascorbi I et al: "Pharmacogenetics of ATP-binding cassette transporters and clinical implications."

No. Sentence Comment

190 0.01* (0.00) c. 56 C>T P19L 0.01* c. 234 A>G Synonymous 0.01* c. 299 G>A R100Q 0.01* c. 842 G>A S281N 0.01* c. 1249 G>A V417I 0.13 (0.21) c. 1446 C>G (0.01) c. 1457 C>T T486I 0.03* (0.00) c. 2302 C>T R768W 0.01 (0.00) c. 2366 C>T S789F 0.01 (0.00) c. 2647 G>A D883N 0.01* c. 2882 A>G K961R 0.01* c. 2934 G>A Synonymous 0.05* c. 3039 C>T Synonymous 0.01* c. 3057 G>T Q1019H 0.01* c. 3321 G>T Synonymous 0.01* c. 3521 G>A R1174H 0.01* c. 3542 G>T (0.001) c. 3561 G>A (0.00) c. 3563 T>A V1188E 0.01* (0.05) c. 3732 C>T N1244K 0.01* c. 3972 C>T Synonymous 0.22* (0.34) c. 4100 C>G S1367C 0.01* c. 4290 G>T Synonymous 0.01* c. 4348 G>A A1450T 0.01 (0.00) c. 4488 C>T Synonymous 0.01* c. 4544 G>A C1515Y 0.01* (0.04) association to cholestatic or mixed type hepatitis whereas -24T carriers exhibited more often hepatocellular-type hepatitis after intake of drugs or herbal remedies (96). Login to comment

PMID: 11266082 [PubMed] Ito S et al: "Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects."

No. Sentence Comment

37 Four were associated with an amino acid substitution; G to A transversion at position 1249 (G1249A, Val to Ile at codon 417) in exon 10, C to T at 2302 (C2302T, Arg to Trp at 768) and C to T at 2366 (C2366T, Ser to Phe at 789) in exon 18, and G to A at 4348 (G4348A, Ala to Thr at 1450) in exon 31 (position numbering: Taniguchi et al., 1996; Toh et al., 1999) (Fig. 3). Login to comment

PMID: 14965249 [PubMed] Haimeur A et al: "The MRP-related and BCRP/ABCG2 multidrug resistance proteins: biology, substrate specificity and regulation."

No. Sentence Comment

373 These include Arg768Trp and Gln1382Arg which have been recently characterized in vitro [275]. Login to comment
376 Inhibitors of MRP2 have been described but few, if any, are known to be highly specific for this transporter alone. studies showed that the maturation and apical localization of the NBD1 MRP2-Arg768Trp mutant was deficient while substrate-induced ATP hydrolysis was impaired in the NBD2 MRP2-Gln1382Arg mutant. Login to comment

PMID: 16006996 [PubMed] Conseil G et al: "Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters."

No. Sentence Comment

157 For example, homozygous DJS mutations Arg768Trp (C2302T) and Gln1382Arg (A4145G) are located in NBD1 and NBD2, respectively, and in vitro studies have shown that both mutations have substantial phenotypic consequences [40]. Login to comment
158 Thus, the Arg768Trp mutation impairs maturation and sorting of MRP2 to the apical membrane, whereas the Gln1382Arg mutation decreases organic anion (LTC4) transport and substrate-induced ATP hydrolysis [45]. Login to comment

PMID: 16442101 [PubMed] Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."

No. Sentence Comment

326 Baculovirus-mediated expression in Sf21 insect cells.. Membrane vesicle transport [146] HsMRP2 R768W impaired maturation and sorting to the apical membrane SDM. Login to comment
494 The missense mutation C1302T results in an amino acid exchange, R768W, which causes a deficient maturation of the protein leading to a diminished glycosylation, impaired sorting to the apical membrane and degradation via the proteasome pathway. Login to comment

PMID: 18220559 [PubMed] Yu XQ et al: "Multidrug resistance associated proteins as determining factors of pharmacokinetics and pharmacodynamics of drugs."

No. Sentence Comment

405 Important Single Nucleotide Polymorphisms (SNPs) of MRP Genes MRP Chromosomal location Amino acid variation Nucleotide variation Location References Cys43Ser Thr73Ile G128C C218T Exon2 Exon2 [239] Arg433Ser G1299T Exon10 [258] Gly671Val G2012T Exon16 [259] Arg723Gln G2168A Exon17 [239] MRP1 16p13.11-p13.12 Arg1058Gln G3173A Exon23 [239] C-24T Promoter [100, 239] Val417Ile G1249A Exon10 [100, 238, 239] Gly676Arg G2026C Exon16 [237] Try709Arg T2125C Exon17 [236] Arg768Trp Ser789Phe C2302T C2366T Exon18 Exon18 [100, 238, 239] I1173F R1150H A3517T G3449A Exon25 Exon25 [240] Ile1324Ile C3972T Exon28 [100, 239] MRP2 10q23-24 Ala1450Thr G4348A Exon31 [100, 238, 239] (Table 2) contd…. Login to comment

PMID: 16086317 [PubMed] Miksch S et al: "Molecular genetics of pseudoxanthoma elasticum: type and frequency of mutations in ABCC6."

No. Sentence Comment

290 R760W in ABCC6 aligns with R768W in ABCC2, and R765Q in ABCC6 is comparable with R560T in ABCC7. Login to comment

PMID: 12357145 [PubMed] Lotsch J et al: "Does the A118G polymorphism at the mu-opioid receptor gene protect against morphine-6-glucuronide toxicity?"

No. Sentence Comment

106 33 T/T T/T MDR1 2 A61G Asn21Asp 11.2 20.6 9 A/G A/G Forward: 5Ј-AGG AGC AAA GAA GAA GAA CTT TTT TAA ACT GAT C-3Ј 9.3 17.6 8 Reverse: 5Ј-GAT TCC AAA GGC TAG CTT GC-3Ј 5 T307C Phe103Leu 0.6 1.2 9 T/T T/T Forward: 5Ј-GTG GTT GCA CAC AGT CAG CA-3Ј Reverse: 5Ј-GGA GGA TGT CTA ATT ACC TGG TCA-3Ј 11 G1199A Ser400Asn 5.5 11.1 9 G/G G/G Forward: 5Ј-CAG CTA TTC GAA GAG TGG GC-3Ј 6.5 12.9 8 Reverse: 5Ј-CCG TGA GAA AAA AAC TTC AAG G-3Ј 21 G2677T Ala893Ser 41.6 49.2 9 T/T T/T Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј 63.9 43.4 8 Reverse: 5Ј-GTT TGA CTC ACC TTC CCA G-3Ј 21 G2677A Ala893Thr 0.9 2 9 NA NA Forward: 5Ј-TGC AGG CTA TAG GTT CCA GG-3Ј Reverse: 5Ј-TTT AGT TTG ACT CAC CTT CCC G-3Ј 26 A3320C Gln1107Pro 0.2 0.4 9 A/A A/A 26 C3396T Ala1132Ala 0.3 0.5 8 C/C C/C Forward: 5Ј-ATC TGT GAA CTC TTG TTT TCA GC-3Ј 26 C3435T Ile1145Ile 50.3 47.7 8 T/T T/T Reverse: 5Ј-TCG ATG AAG GCA TGT ATG TTG-3Ј 53.9 50.5 9 - - MRP2 10 G1249A Val417Ile 12.5 20.8 34 G/G G/G Forward: 5Ј-GGG TCC TAA TTT CAA TCC TTA-3Ј Reverse: 5Ј-TAT TCT TCT GGG TGA CTT TTT-3Ј 18 C2302T Arg768Trp 1 2.1 34 C/C C/C Forward: 5Ј-GGA GTA GTG CTT AAT ATG AAT-3Ј 18 C2366T Ser789Phe 1 2.1 34 C/C C/C Reverse: 5Ј-CCC ACC CCA CCT TTA TAT CTT-3Ј 28 C3972T Ile132Ile 21.9 35.4 34 C/T C/T Forward: 5Ј-TGC TAC CCT TCT CCT GTT CTA-3Ј Reverse: 5Ј-ATC CAG GCC TTC CTT CAC TCC-3Ј 31 G4348A Ala1450Thr 1 2.1 34 G/G G/G Forward: 5Ј-AGG AGC TAA CAC ATG GTT GCT-3Ј Reverse: 5Ј-GGG TTA AGC CAT CCG TGT CAA-3Ј † Sequence is not translated. Login to comment

PMID: 16648557 [PubMed] Mutoh K et al: "A T3587G germ-line mutation of the MDR1 gene encodes a nonfunctional P-glycoprotein."

No. Sentence Comment

190 R768W MRP2, which has an amino acid substitution in signature C of the first ATP-binding site of the protein, is associated with relatively high serum bilirubin concentrations in affected patients (38) and this mutant protein is not properly glycosylated (36). Login to comment

PMID: 16788565 [PubMed] Haenisch S et al: "Influence of polymorphisms of ABCB1 and ABCC2 on mRNA and protein expression in normal and cancerous kidney cortex."

No. Sentence Comment

139 The earlier described ABCC2 SNPs, namely 2302C4T (Arg768Trp), 2366C4T (Ser789Phe) and 4348G4A (Ala1450Thr),43 could not be found in our Caucasian volunteers (data not shown). Login to comment

PMID: 10355502 [PubMed] Kamisako T et al: "Molecular aspects of organic compound transport across the plasma membrane of hepatocytes."

No. Sentence Comment

72 Studies carried out using antibodies raised against the C-terminal of MRP2 failed to demonstrate the presence of MRP2 in the canalicular membrane of a patient with Dubin-Johnson syndrome, suggesting that the lack of MRP2 is the cause of this syndrome.46 Recently, various gene abnormalities have been reported in a patient with Dubin-Johnson syndrome: a R768W, R1066X and splicing abnormality (1669del147) each in a homozygote, and a compound heterozygote with R768W and 2272del168.50,51 Bile acid transport In the early 1980s, potential-dependent transport in the canalicular membrane was reported to be involved in bile acid excretion from hepatocytes into bile.52 However,the physiological membrane potential (-35--40 mV) in hepatocytes is not high enough to create a concentration gradient between blood and bile (100-1000-fold difference required). Login to comment

PMID: 21996082 [PubMed] Shuker N et al: "ATP-binding cassette transporters as pharmacogenetic biomarkers for kidney transplantation."

No. Sentence Comment

870 Several other ABCC2 SNPs such as 2302CNT (Arg768Trp), 2366CNT (Ser789Phe; both in exon 18), and the 4348GNA (Ala1450Th; in exon 31) were not found in this population whereas their allele frequency in an Asian population was about 1% [8,48,49]. Login to comment

PMID: 22330094 [PubMed] Sekine S et al: "Sustained intrahepatic glutathione depletion causes proteasomal degradation of multidrug resistance-associated protein 2 in rat liver."

No. Sentence Comment

19 Certain DJS mutations (e.g., missence mutations R768W and I1173F; deletion mutation R1392, M1393) have been reported to cause defects in canalicular sorting and rapid proteasomal degradation of the hMRP2 protein [2-4]. Login to comment

PMID: 22565165 [PubMed] Grover S et al: "Genetic association analysis of transporters identifies ABCC2 loci for seizure control in women with epilepsy on first-line antiepileptic drugs."

No. Sentence Comment

89 - 24C > T 50 UTR k Promoter activity [haplotype containing (- 1549A)-(- 24T)] [33] k mRNA expression [29] m Expression and activity [35] m Expression [haplotype containing (- 24C)-1249A- 3972C] [36] k Expression [haplotype containing (- 24C)- 1249G- 3972T, (-24T)-1249G- 3972C or (-24T)-1249G- 3972T] [36] k Clearance of mycophenolic acid [35] k Clearance of methotrexate [37] k Clearance of irinotecan (ABCC2*2 containing the wild-type C allele) [29] 0.137 5 rs4919395 chr10:101542963 c.33 + 329G > A Intron 1 0.384 6 rs2756104 chr10:101544026 c.34 - 339C > T Intron 1 0.392 7 rs927344 chr10:101544447 c.116T > A Exon 2 (Phe39Tyr) 0.000 8 rs4148385 chr10:101548177 c.207+ 3639C > A Intron 2 0.382 9 rs2180990 chr10:101548974 c.208 - 3017C > G Intron 2 0.392 10 rs35191126 chr10:101549533:34 c.208 - 2458_208 - 2457G > delG Intron 2 0.384 11 rs4148389 chr10:101549911 c.208 - 2080A > G Intron 2 0.396 12 rs2804400 chr10:101553259 c.334 - 49C > T Intron 3 0.394 13 rs2756109 chr10:101558746 c.868 - 218T > G Intron 7 0.364 14 rs7080681 chr10:101560169 c.1058G > A Exon 9 (Arg353His) 0.000 15 rs2273697 chr10:101563815 c.1249G > A Exon 10 (Val417Ile) m mRNA expression [38] m Expression [haplotype containing (- 24C)-1249A- 3972C] [36] k Expression [haplotype containing (- 24C)- 1249G- 3972T, (-24T)-1249G- 3972C or (-24T)-1249G- 3972T] [36] k Clearance of irinotecan (ABCC*2 containing G allele) [34] 0.271 16 rs113646094 chr10:101564012 c.1446C > G Exon 10 (Thr482Thr) m mRNA expression [39] 0.002 17 rs2073337 chr10:101567426 c.1668 + 148A > G Intron 12 0.388 18 rs2756114 chr10:101569483 c.1816 - 408T > C Intron 13 0.393 19 rs3740074 chr10:101571528 c.1967+ 169T > C Intron 15 0.368 20 rs4148394 chr10:101572343 c.1968 - 432A > C Intron 15 0.206 21 rs3740072 chr10:101577123 c.2153A > G Exon 17 (Asn718Ser) 0.000 22 rs56199535 chr10:101578577 c.2302C > T Exon 18 (Arg768Trp) 0.000 23 rs56220353 chr10:101578641 c.2366C > G/T Exon 18 (Ser789Cys/Phe) k Activity, k expression and impaired membrane localization [40] 0.000 24 rs2002042 chr10:101587931 c.2621 - 2133C > T Intron 19 0.204 25 rs11442349 chr10:101589215:16 c.2621 - 849_2621 - 848T > delT Intron 19 0.375 26 rs3740071 chr10:101590120 c.2677C > G Exon 20 (Gln893Glu) 0.000 27 rs7898096 chr10:101593385 c.3259 -752G > A Intron 23 0.000 28 rs17216345 chr10:101594274 c.3396T > C Exon 24 (Ile1132Ile) 0.027 29 rs72558200 chr10:101595882 c.3449 G > A Exon 25 (Arg1150His) 0.000 30 rs72558201 chr10:101595950 c.3517 A > T Exon 25 (Ile1173Phe) 0.000 31 rs8187692 chr10:101595975 c.3542G > T Exon 25 (Leu1181Arg) 0.000 32 rs17222723 chr10:101595996 c.3563T > A Exon 25 (Val1188Glu) m Expression [41] 0.016 ABCC2 polymorphism and response to AEDs Grover et al. 451 or liver functioning. Login to comment

PMID: 21691255 [PubMed] Megaraj V et al: "Functional analysis of nonsynonymous single nucleotide polymorphisms of multidrug resistance-associated protein 2 (ABCC2)."

No. Sentence Comment

183 Expression of S789F (located in NBD1) was decreased to 59% of that of WT MRP2; a nearby but different mutation in NBD1 (R768W) of MRP2 was shown to be localized in the cytoplasm with an endoplasmic reticulum-like distribution [50]. Login to comment

PMID: 21044052 [PubMed] Pacifico L et al: "Mutational analysis of ABCC2 gene in two siblings with neonatal-onset Dubin Johnson syndrome."

No. Sentence Comment

27 Mutation analysis showed that both siblings were compound heterozygous for missense mutation on exon 18: p.R768W (c.2302 C>T) and nonsense mutation on exon 23 p.R1066X (c.3196 C>T). Login to comment
28 The study of allelic segregation in Letter to the Editor R100X R393W IVS6_IVS7del L441M IVS13 +2 T>A IVS15 +2 T>C G676R IVS18 +2 T>C R768W * 2748_2883del * R1066X * 3399_3400del L1173F 3615_3843del* Y1275X * R1310X Q1382R R1392_M1393del S325X W709R T1273A IVS8 +4 A>G 1256_1272delins CT 4292_4293delR1150H E1352Q * Exon 1 32 Fig. 1. Login to comment
37 In particular, the missense mutation (p.R768W) has been identified in homozygosis as well as in compound heterozygosis in different populations (Japanese, Caucasian) (4, 11-15), suggesting that this is a common allele in the DJS patients. Login to comment
42 The missense mutation R768W found in our patients is indeed located in the Walker C motif of the first ABC domain. Login to comment
43 Immunochemical data by Hashimoto et al. (16) in a DJS patient with the R768W mutation have shown that MRP2 protein could not be expressed in the canalicular membrane of hepatocytes of such patient Pulse chase analysis revealed that the precursor form of the wild-type MRP2 were converted to the mature form, which is resistant to endoglycosidase H in about 60 min while the precursor form of the R768W MRP2, which is sensitive to endoglycosidase H, was rapidly degraded within 120 min and did not mature to the fully glycosylated form (16). Login to comment
44 Thus the mutation R768W MRP2 appears to block the maturation process of MRP2 protein during membrane sorting, plausibly from endoplasmic reticulum to the Golgi apparatus. Login to comment
47 In this case our patients will result functionally hemyzygotes for R768W mutation. Login to comment
51 In that vein, it may be of interest that Toh et al. found higher bilirubin levels in patients with R768W mutation compared to those with other mutations, and they also suggested that this mutation might cause more severe disruption of the transporter activity (4). Login to comment
101 Materna V, Lage H. Homozygous mutation Arg768Trp in the ABC-transporter encoding gene MRP2/cMOAT/ABCC2 causes Dubin-Johnson syndrome in a Caucasian patient. Login to comment

PMID: 20082599 [PubMed] Jemnitz K et al: "ABCC2/Abcc2: a multispecific transporter with dominant excretory functions."

No. Sentence Comment

87 Interestingly, two missense mutations, R768W and Q1382R, of the nucleotide-binding domains (NBDs) behaved differently. Login to comment
89 However, the precursor form of the R768W remained sensitive to Endo H and was degraded within 120 minutes (Hashimoto et al., 2002). Login to comment

PMID: 18334920 [PubMed] Haenisch S et al: "Influence of genetic polymorphisms on intestinal expression and rifampicin-type induction of ABCC2 and on bioavailability of talinolol."

No. Sentence Comment

38 Genotyping The ABCC2 SNPs -24C > T (rs717620), c.1249G > A (V417I, rs2273697), c.2302C > T (Arg768Trp), c.2366C > T (Ser789Phe), c.3972C > T (I1324I, rs3740066), c.4348G > A (Ala1450Thr) were genotyped using PCR-restriction fragment length polymorphism (RFLP) analysis. Login to comment

PMID: 17517077 [PubMed] Hayashi H et al: "Genetic background of Japanese patients with adult-onset storage diseases in the liver."

No. Sentence Comment

76 Fifty years after the first identification of lysosomes,1,2 three Table 3 Results of mutation analysis for patients with Dubin-Johnson syndrome Patient Age (years)/Sex MRP2 Mutation 1 Mutation 2 1 21/male 298C > T (R100X) 298C > T (R100X) 2 26/male 1177C > T (R393W) 2302C > T (R768W) 3 23/female 1967 + 2T > C (1901del67: exon 15 skipping) 1967 + 2T > C (1901del67: exon 15 skipping) 4 25/male 1967 + 2T > C (1901del67: exon 15 skipping) 2026G > C (G676R) 5 28/female 2125T > C (W709R) 2125T > C (W709R) 6 28/male 2439 + 2T > C (2272del168: exon 18 skipping) 2439 + 2T > C (2272del168: exon 18 skipping) adult-onset storage disorders of the liver were found to be secondary lysosomal diseases with the genetic defects outside of lysosomes. Login to comment

PMID: 17502832 [PubMed] Choi JH et al: "MRP2 haplotypes confer differential susceptibility to toxic liver injury."

No. Sentence Comment

93 The pGL3 plasmids containing WT or mutant MRP2 promoters were Table 3 Oligonucleotide primers used in the genotyping and functional molecular studies Primer name Nucleotide sequence Primers for SNaPshot or SNaPIT PCR primers c.334-49C > T Sense 50 -CAT GGG TCC TGG AAA GGT T-30 Antisense 50 -CCC CAT GGT ACC TCC TCA T-30 c.1249G > A (p.V417I) Sense 50 -TTT GTC CAT GGG TCC TAA TTT-30 Antisense 50 -ATG AAG TTG GTC ACA TCC ATG-30 c.1457C > T (p.T486I) Sense 50 -ATG GTG CTT GTA ATC CCA ATT-30 Antisense 50 -TTG CCC AAA CTC CCA TTA-30 c.2620 + 3A > G Sense 50 -AAA AAA GGA GAG TTT GCT AAG AAT C-30 Antisense 50 -ATA CTG AGC AGT TCA GGA ATT AGA TAT T-30 c.2934G > A (p.S978S) Sense 50 -AGT TCT ACT AAT ATT GAG GTG GGG A-30 Antisense 50 -AAT AAA AGC CAC AGA ATT CAT CA-30 c.3972C > T (p.I1324I) Sense 50 -TAC CGA CCT GAG CTG GAT C-30 Antisense 50 -CAT CCA GGC CTT CCT TCA-30 c.4147 - 35G > A Sense 50 -GTA GCC ACT CCG AGC CTT AG-30 Antisense 50 -GGA ATC AGA CCT GGA TGA AAA-30 c.4508 + 12G > A Sense 50 -CCC ACA GGC TGC ACA CCA T-30 Antisense 50 -TGT TAC TGT TGA GCA AGG GTT A-30 Genotyping primers c.334 - 49C > T 50 -TCT GAA GAA TAC TGC CAC TAA CCG A-30 c.1249G > A (p.V417I) 50 -GAC ATC AGG TTC ACT GTT TCT CCA A-30 c.1457C > T (p.T486I) 50 -GGG TGA CTT TTT CTT TAC CTG AAT G-30 c.2620 + 3A > G 50 -CTA TCT TGT CCC AAT CCT TCT TAC A-30 c.2934G > A (p.S978S) 50 -ACC TAC AAG CAA TAG GAT TGT TTT C-30 c.3972C > T (p.I1324I) 50 -CTC CAC CTA CCT TCT CCA TGC TAC C-30 c.4147 - 35G > A 50 -GAA CTC CGA GGT CCT TTT CTG GCA T-30 c.4508 + 12G > A 50 -AAG CCA TCC GTG TCA AGC CCT GTC C-30 Primers for the DNA sequencing of MRP2 promoter regions g. - 1774delG Sense 50 -GAT TCT CCA CCC TCT CTT TT-30 Antisense 50 -CAT TCA GTG TGG GAG AAA AT-30 g. - 1549G > A Sense 50 -CCC ACT TTT TAA TTT GTT AGT GTA-30 Antisense 50 -CTG GGA CTA CAG GCA CAT-30 g. - 24C > T and g. - 23G > A Sense 50 -TAG GCT CAC ACT GGA TAA GC-30 Antisense 50 -TGC ACA TCT AAC ATT TCT GG-30 Mutagenic primers - 24C-T 50 -CAA TCA TAT TAA TAG AAG AGT CTT CGT TCC AGA CGC AGT CCA GGA A-30 c.1249G > A (p.V417I) 50 -GGA AGG AGT ACA CCA TTG GAG AAA CAG TGA ACC TGA TGT C-30 c.2302C > T (p.R768W) 50 -AAA TCT TAG TGG GGG TCA GAA GCA GTG GAT CAG CCT GGC CAG-30 c.2934G > A (p.S978S) 50 -CTA CAA GCA ATA GGA TTG TTT TCA ATA TTC TTC ATC ATC-30 c.3972C > T (p.I1324I) 50 -GAG GGA TCA CTT GTG ACA TTG GTA GCA TGG AGA AGG TAG G-30 Primers for MRP2 promoter cloning First round PCR ( - 2314 to + 348) Sense 50 -AGA TTC ATG ACT TCC TGG CTC CTT-30 Antisense 50 -ACA ACA ATT CTC CTT CCT CAC ACG-30 Second round PCR ( - 2229 to -1) Sense (KpnI site) 50 -CGG GGT ACC TTG ATG AAC ATT TAG ATT CT-30 Antisense (NheI site) 50 -CTA GCT AGC GAT TCC TGG ACT GCG TCT GG-30 RT-PCR primers for exon 4 splicing Sense (exon 3) 50 -CGT GTA TAA ATC CAG GAC CAA GAG A-30 Antisense (exon 5) 50 -GGA GAT GAA GAA CAG GCA GGA GTA G-30 PCR, polymerase chain reaction; RT-PCR, reverse transcription-polymerase chain reaction. Login to comment
141 The p.R768W mutation, which was known to cause the DJS by misfolding and premature degradation of MRP2 protein [14], was used as a positive control of MRP2 dysfunction. Login to comment
142 None of the common coding region variants, p.V417I, c.2934G > A, or c.3972C > T, induced identifiable defects in protein expression, whereas p.R768W evoked a definite decrease (Fig. 2a). Login to comment
143 Consistent with protein expression levels, MRP2-mediated CF efflux was decreased only in p.R768W, and none of the common variants in the coding regions showed significant changes in transport activity (Fig. 2b). Login to comment
149 Fig. 2 30 kDa 0 20 40 60 80 100 120 Transportactivity(%) 140 WT 190 kDa MRP2 Neomycin phosphotransferase II (a) (b) WT p.V417I c.2934G > A (Ser978) c.3972C > T (Ile1324) p.R768W Mock (c) 500 400 300 200 100 CC CT TT MRP2 exon 4 β-actin (1) (2) (3) (4) (5) (6) bp 300 p.V417I c.2934G > A (Ser978) c.3972C > T (Ile1324) p.R768W Functional studies of intragenic variations. Login to comment
152 p.R768W was used as a positive control bearing defective protein expression. Login to comment

PMID: 16847695 [PubMed] Nies AT et al: "The apical conjugate efflux pump ABCC2 (MRP2)."

No. Sentence Comment

139 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment
140 Although all sequence variants associated with Dubin-Johnson syndrome result in the absence of a Table 3 Nucleotide sequence variants in the human ABCC2 gene (NM_000392) leading to amino acid changes in the ABCC2/MRP2 protein (NP_000383) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references Exon 2 c.56 C>Te p.P19L Probably damaging T: 0.007 [63] Exon 2 c.116 T>A p.F39Y Benign A: 0.010 rs927344 A: 0.008 rs17222603 Exon 3 c.298 C>T p.R100Xf DJS [154] Exon 3 c.299 G>Ae p.R100Q Possibly damaging A: 0.007 [63] Exon 7 c.736 A>C p.M246L Benign C: 0.002 rs8187667 C: 0.002 rs17222744 Exon 7 c.842 G>A p.S281N Benign A: 0.0060.056 [117] Exon 8 c.998 A>G p.D333G Possibly damaging G: 0.002 rs8187668 G: 0.004 rs17222674 Exon 9 c.1058 G>A p.R353H Benign A: 0.009 rs7080681 A: 0.014 rs17216205 Exon 9 c.1177 C>T p.R393W DJS Probably damaging [104, 112] Exon 10 c.1234 A>G p.R412G Probably damaging Deficient methotrexate transport function [56] Exon 10 c.1249 G>A p.V417I Benign None apparent [50] A: 0.163 rs2273697, [146] A: 0.158 rs17216184 A: 0.125 [62] A: 0.1830.312 [117] Exon 10 c.1457 C>T p.T486I Benign T: 0.002 rs8187670 T: 0.002 rs17222589 Exon 11 c.1483 A>G p.K495E Possibly damaging G: 0.002 rs8187672 G: 0.002 rs17222561 Exon 13 c.1686 T>G p.F562L Benign G: 0.002 rs8187673 G: 0.002 rs17216233 Exon 16 c.2009 T>C p.I670T Benign rs8187676 C: 0.006 rs17222632 Exon 16 c.2026 G>C p.G676R DJS Probably damaging [181] Exon 17 c.2125 T>C p.W709R DJS Probably damaging [111] Exon 17 c.2153 A>G p.N718S Possibly damaging rs3740072 Exon 17 c.2215 C>T p.L739F Probably damaging T: 0.006 [51] Exon 18 c.2302 C>T p.R768W DJS Probably damaging Deficient maturation and impaired sorting [47] T: 0.010 [62] [168, 180] Exon 18 c.2366 C>T p.S789F Probably damaging Reduced protein levels [50] T: 0.010 [62] Exon 19 c.2546 T>G p.L849R Benign G: 0.002 rs8187689 G: 0.006 rs17222617 Exon 20 c.2647 G>Ae p.D883N Benign A: 0.007 [63] Exon 20 c.2677 G>C p.E893Q Benign rs3740071 Exon 21 c.2882 A>Ge p.K961R Benign G: 0.007 [63] Exon 22 c.2901 C>A p.Y967Xf A: 0.002 rs8187683 A: 0.002 rs17222547 Exon 22 c.2944 A>G p.I982V Benign G: 0.002 rs8187684 G: 0.002 rs17222554 Exon 22 c.3057 G>Te p.Q1019H Benign T: 0.007 [63] Exon 23 c.3107 T>C p.I1036T Possibly damaging C: 0.002 rs8187685 C: 0.004 rs17216149 Exon 23 c.3188 A>G p.N1063S Benign G: 0.002 rs8187686 G: 0.002 rs17222540 Exon 23 c.3196 C>T p.R1066Xf DJS No ABCC2 protein in liver [134] Exon 25 c.3449 G>A p.R1150H DJS Probably damaging Deficient transport function A: 00.009 [117] Exon 25 c.3517 A>T p.I1173F DJS Probably damaging Deficient maturation and impaired sorting, deficient transport function T: 00.029 [117] [80, 117] Exon 25 c.3521 G>Ae p.R1174H Probably damaging A: 0.007 [63] Exon 25 c.3542 G>T p.R1181L Possibly damaging T: 0.039 rs8187692 T: 0.034 rs17222702 Exon 25 c.3563 T>A p.V1188E Benign A: 0.059 rs8187694 A: 0.059 rs17222723 Exon 26 c.3732 T>Ge p.N1244K Possibly damaging G: 0.014 [63] Exon 27 c.3817 A>G p.T1273A Benign G: 0.002 rs8187699 G: 0.004 rs17222582 Exon 27 c.3825 C>G p.Y1275Xf DJS No ABCC2 protein in liver [104] Exon 28 c.3872 C>T p.P1291L Possibly damaging T: 0.012 rs8187700 T: 0.010 rs17216317 Exon 28 c.3895 A>C p.K1299Q Benign rs4148400, [146] Exon 28 c.3928 C>T p.R1310Xf DJS [166] Exon 29 c.4100 C>Ge p.S1367C Possibly damaging G: 0.007 [63] Exon 29 c.4145 A>G p.Q1382R DJS Probably Deficient [47, 168] Table 3 (continued) Location Nucleotide changea Deduced effect on proteina Causing Dubin-Johnson syndromeb Predicted effect by PolyPhen databasec Experimentally proven functional consequence Average frequency of indicated nucleotide exchange in population NCBI SNP IDd and/or references functionally active ABCC2 protein from the canalicular membrane, their effects on the synthesis and function of the ABCC2 protein differ. Login to comment

PMID: 16952291 [PubMed] Corpechot C et al: "Identification of a novel 974C-->G nonsense mutation of the MRP2/ABCC2 gene in a patient with Dubin-Johnson syndrome and analysis of the effects of rifampicin and ursodeoxycholic acid on serum bilirubin and bile acids."

No. Sentence Comment

78 Mutations in the MRP2/ABCC2 Gene Associated with DJS Nucleotide Mutation Exon Predicted Effect Reference 298C→T 3 R100X 27 974C→G 8 S325X This article IVS8 + 4A→G Intron 8 Aberrant splicing 28 1177C→T 9 R393W 29 1256insCT/ delAAACAG TGAACCT- GATG 10 Frameshift 30 1271A→G 10 R412G 31 1815 + 2T→A 13 Skipped exon 32, 33 1967 + 2T→C 15 Skipped exon 34, 35 2026G→C 16 G676R 35 2125T→C 17 W709R 36 2302C→T 18 R768W 32, 37, 38 2439 + 2T→C 18 Skipped exon 32, 35, 37 3196C→T 23 R1066X 39, 40 3449G→A 25 R1150H 41 3517A→T 25 I1173F 41 3928C→T 28 R1310X 27, 33 4145A→G 29 Q1382R 37 4175delGGATGA 30 R1392 + M1393 deletion 40 4292delCA 30 Frameshift 30 DISCUSSION Identification of a Novel Nonsense Mutation of the MRP2/ABCC2 Gene Up to now, 18 mutations in the sequence of the MRP2/ABCC2 gene have been reported in DJS, including nonsense mutations, deletions, splicing junction mutations, and missense mutations (Table 1). Login to comment

PMID: 16377077 [PubMed] Wada M et al: "Single nucleotide polymorphisms in ABCC2 and ABCB1 genes and their clinical impact in physiology and drug response."

No. Sentence Comment

41 In Japan, the expected number of Table 1 Summary of mutations identified in Dubin-Johnson syndrome (DJS) Mutation Exon IVS Amino acid alteration Reference 298COT 3 R100X a,b 1815C 2TOA 13 Exon13 skip [38] 1967C 2TOC 15 Exon15 skip [62] 2026GOC 16 G676R [92] 2302COT 18 R768W [49,91]c 2439C 2TOC 18 Exon18 skip [38]a,c 3196COT 23 R1066X [47] 3449GOA 25 R1150H [52] 3517AOT 25 I1173F [52] 3928COT 28 R1310X [50] 4145AOG 29 Q1382R [38] 4175- 4180del 30 RM1392-1393del [48] a Adachi and Wada, unpublished data. b Houkibara and Wada, unpublished data. Login to comment
58 Mor-Cohen analyzed in vitro two novel missense mutations identified in exon 25 in DJS [52] (Tables 1 Table 2 Naturally occurring base-change in ABCC2 gene accompanied by amino acid substitution Location (exon) Nucleic acid substitution Amino acid substitution Domain Pathogenetic consequence (biochemical defect) Frequency (%) Jews Japanese Reference 7 842GOA S281N Linker Unkown 2.4 Not reported [52] 10 1249GOA V417I MSD2 Unkown 22.7 10.9 [42,43,52]a 16 2026GOC G676R NBD1 DJSb Not reported Not reported [92] 18 2302COT R768W NBD1 DJS (protein maturation) Not reported 0.4? Login to comment
68 ABCC2 (R768W), being mutated in the C motif of NBD1, was localized in the cytoplasm with an ER-like distribution [53]. Login to comment
72 MG132, an inhibitor of the cytosolic proteasome, blocked the degradation of the precursor form of ABCC2 (R768W), suggesting that ABCC2 (R768W) is degraded by the proteasome pathway, which is involved in the degradation of newly synthesized, misfolded and unassembled proteins in the ER [54]. Login to comment
75 These results suggested that, unlike the R768W mutation, the Q1382R mutation does not affect either the maturation process or the subcellular localization of ABCC2. Login to comment

PMID: 16180115 [PubMed] Ito K et al: "Apical/basolateral surface expression of drug transporters and its role in vectorial drug transport."

No. Sentence Comment

236 At least three of the other mutations (R768W, I1173F, and deletion 1392Y1394) are related to sorting problems from the ER to Golgi, as these mutant MRP2 accumulated within the ER in core-glycosylated forms. Login to comment

PMID: 16012956 [PubMed] Cebecauerova D et al: "Dual hereditary jaundice: simultaneous occurrence of mutations causing Gilbert's and Dubin-Johnson syndrome."

No. Sentence Comment

57 2302CϾT 18 R768W Wada M et al, Hum Mol Genet 1998;7:203-207. Login to comment

PMID: 15864128 [PubMed] Hulot JS et al: "A mutation in the drug transporter gene ABCC2 associated with impaired methotrexate elimination."

No. Sentence Comment

60 Mutations (R412G and a positive control mutation R768W) were inserted into the wild-type pcDNA3.1/ MRP2 by using the QuickChange site-directed mutagenesis kit (Stratagene, La Jolla, California, USA). Login to comment

PMID: 15870973 [PubMed] Machida I et al: "Mutational analysis of the MRP2 gene and long-term follow-up of Dubin-Johnson syndrome in Japan."

No. Sentence Comment

66 298CϾT Gly100Stop 14 1177CϾT Arg393Trp Novel 1967ϩ2TϾC 1901del67 (exon 15 skipping) 12 2026GϾC Gly676Arg 6 2302CϾT Arg768Trp 13 2439ϩ2TϾC 2272del168 (exon 18 skipping) 8 a b immunohistochemical analysis, the mechanism by which this mutation impairs the canalicular transport of conjugated bilirubin remains unclear. Login to comment

PMID: 15554242 [PubMed] Hoffmann U et al: "The ABC transporters MDR1 and MRP2: multiple functions in disposition of xenobiotics and drug resistance."

No. Sentence Comment

290 This base alteration results in an amino acid exchange Arg768Trp (Materna and Lage, 2003; Tsujii et al., 1999; Wada et al., 1998). Login to comment

PMID: 15226675 [PubMed] Niemi M et al: "High plasma pravastatin concentrations are associated with single nucleotide polymorphisms and haplotypes of organic anion transporting polypeptide-C (OATP-C, SLCO1B1)."

No. Sentence Comment

145 ymous SNPs in exon 18, 2302C.T (Arg768 Trp) which is associated with the Dubin-Johnson syndrome [5,50] and 2366C.T (Ser789 Phe) with suggested functional significance [51], were not found in any of the subjects. Login to comment

PMID: 15180328 [PubMed] Hirouchi M et al: "Characterization of the cellular localization, expression level, and function of SNP variants of MRP2/ABCC2."

No. Sentence Comment

26 Only one respective heterozygote subject was observed out of 48 volunteers for C2302T (exon 18, Arg768Trp), C2366T (exon 18, Ser789Phe), and G4348A (exon 31, Ala1450Thr) (19), and their allele frequency was calculated to be 1%. Login to comment
27 Among these three kinds of less frequently observed SNPs, C2302T (exon 18, Arg768Trp) has been identified as the mutation responsible for DJS (21). Login to comment
43 We have generated the following four kinds of missense mutations reported previously: Val417Ile, Arg768Trp, Ser789Phe, and Ala1450Thr. Login to comment
87 R768W MRP2 showed no staining, presumably due to rapid degradation as previously reported (18). Login to comment
92 As a positive control to determine the localization of MRP2, we also determined the localization of R768W MRP2, which has been reported to be responsible for the sideration of the DJS (18). Login to comment
93 In our experimental system, R768W MRP2 was located in the intracellular compartment of LLC-PK1 cells, which is consistent with the previous report (18). Login to comment
151 Indeed, both R768W MRP2 mutant and MRP2 mutant, which lacks R1392 and M1393 found in DJS patients, were core glycosylated and localized predominantly within the endoplasmic reticulum (17,18). Login to comment

PMID: 12942343 [PubMed] Materna V et al: "Homozygous mutation Arg768Trp in the ABC-transporter encoding gene MRP2/cMOAT/ABCC2 causes Dubin-Johnson syndrome in a Caucasian patient."

No. Sentence Comment

0 SHORT COMMUNICATION Homozygous mutation Arg768 Trp in the ABC-transporter encoding gene MRP2/cMOAT/ABCC2 causes Dubin-Johnson syndrome in a Caucasian patient Received: 15 May 2003 / Accepted: 1 July 2003 / Published online: 27 August 2003 Ó The Japan Society of Human Genetics and Springer-Verlag 2003 Abstract Dubin-Johnson syndrome (DJS) is an autosomal recessive disorder characterized by conjugated hyperbilirubinemia and caused by mutations of the ATP-binding cassette (ABC) transporter encoding gene MRP2/cMOAT/ABCC2. Login to comment
3 This DJS-causing alteration results in an amino acid exchange Arg768Trp. Login to comment
27 The only alteration found was the missense mutation C2302T causing an amino acid exchange Arg768Trp indicating to be the molecular basis for DJS in this Turkish patient. Login to comment
33 It was reported that the amino acid exchange Arg768Trp causes a deficient maturation of the ABCC2 protein leading to a diminished glycosylation, impaired sorting to the apical membrane, and degradation via the proteasome pathway (Hashimoto et al. 2002). Login to comment
34 These results support our findings that the missense mutation Arg768Trp alone is responsible for the defect in transporting bilirubin conjugates, leading to hyperbilirubinemia in the context of DJS in the examined patient. Login to comment
48 Conclusions The homozygous missense mutation C2302T causing the amino acid exchange Arg768Trp is the molecular reason for DJS in a female Caucasian patient examined. Login to comment

PMID: 12406647 [PubMed] Suzuki H et al: "Single nucleotide polymorphisms in multidrug resistance associated protein 2 (MRP2/ABCC2): its impact on drug disposition."

No. Sentence Comment

137 Arg768Trp), C2366T (exon 18, Ser789Phe) and Although Harris et al. Login to comment

PMID: 12395335 [PubMed] Hashimoto K et al: "Trafficking and functional defects by mutations of the ATP-binding domains in MRP2 in patients with Dubin-Johnson syndrome."

No. Sentence Comment

1 We investigated the consequences of 2 missense mutations, R768W and Q1382R, of nucleotide-binding domains (NBDs) of the multidrug resistance protein 2 (MRP2; ABCC2) that were previously identified in patients with DJS. Login to comment
3 However, the precursor form of the R768W MRP2, which is sensitive to endoglycosidase H, was degraded within 120 minutes and did not mature to the fully glycosylated form. Login to comment
4 Proteasome inhibitors inhibited the degradation of the precursor form of the R768W MRP2. Login to comment
5 Unlike the R768W MRP2, the Q1382R MRP2 was mainly localized on the apical membrane in the wild-type form. Login to comment
8 In conclusion, the R768W mutation causes deficient maturation and impaired sorting, and the Q1382R mutation does not affect maturation or sorting but impairs the substrate-induced ATP hydrolysis. Login to comment
28 The mutants R768W, Q1382R, and K677R were generated from pBS-MRP2.20 To generate these mutant MRPs, site-directed mutagenesis was carried out using a PCR-based method.21 The following primers were used to generate specific mutations: for R768W, the 5Ј-oligonucleotides MRP2-2,302 (5Ј-CAGAAGCAGCGGAT- CAGC; corresponding to the native MRP2 sequence) and R768W-MRP2 (5Ј- CAGAAGCAGTGGAT- CAGCCTG); for Q1382R, the 5Ј-oligonucleotides MRP2-4,555 (5Ј-CATCCCCCAGGACCCCATC; corresponding to the native MRP2 sequence) and Q1382R- MRP2 (5Ј- CATCCCCCGGGACCCCATC); and, for K677R, the 5Ј-oligonucleotides MRP2-2,030 (5Ј- GGCTCTGGGAAATCCTCCTTG; corresponding to the native MRP2 sequence) and K677R-MRP2 (5Ј- GGCTCTGGGAGATCCTCCTTG). Login to comment
39 In brief, 20, 20, 200, and 200 ␮g total protein from LLC-PK1 cells expressing the wild-type, Q1382R, K677R, and R768W MRP2 were treated with 1,000 units of each enzyme for 1 hour at 37°C, respectively. Login to comment
42 Biopsy specimens of a DJS patient (mutation R768W) and noncancerous regions of hepatoma patients were fixed in 10% formaldehyde, processed, and embedded in paraffin. Login to comment
63 We recently identified a missense mutation 2,302 (C3T) R768W in NBD1 in 3 DJS families and another missense mutation 4,145 (A3G) Q1382R in NBD2 in one DJS family (Fig. 1).12,13 Paraffin-embedded liver sections from a patient with R768W mutation were examined for the presence of the MRP2 and P-glycoprotein using monoclonal antibodies. Login to comment
65 In the liver from a DJS patient, we observed positive staining for P-glycoprotein on the canalicular membrane of hepatocytes, but no staining for MRP2, indicating that the R768W MRP2 protein was not ex- Fig. 1. Login to comment
66 Location of the DJS-associated mutations, R768W and Q1382R, in a MRP2. Login to comment
72 Noncancerous region in the normal liver (A and B) and the liver of the DJS patient (R768W) (C and D) was stained with a monoclonal antibody against P-glycoprotein (C219) (A and C) and MRP2 (M2III-6) (B and D). Login to comment
76 These results suggested that R768W mutation in NBD1 impaired the expression or proper sorting of MRP2 to the apical membrane and caused impaired secretion of anionic conjugates. Login to comment
79 To investigate the effect of these DJS-associated mutations on the processing, localization, and function of MRP2, we introduced the 2 DJS-associated mutations, 2,302 (C3T) R768W and 4,145 (A3G) Q1382R into the MRP2 cDNA. Login to comment
81 LLC-PK1 and HEK293 cell lines that stably express the wild-type MRP2 or each mutant MRP2 (R768W, Q1382R, and K677R) were established. Login to comment
86 On the other hand, the R768W and K677R MRP2 were detected as 175-kd weak bands (designated as P) by both antibodies (Fig. 3A and B). Login to comment
87 These results suggested that the R768W and K677R MRP2 did not mature properly and that their expression levels were low. Login to comment
92 The deglycosylated form of MRP2 was also produced from the 175-kd K677R and R768W MRP2 (band P) by the treatment with Endo H, indicating that they did not contain complex oligosaccharides and might be located in the endoplasmic reticulum (ER) or the cis-Golgi complex. Login to comment
95 LLC-PK1 cells stably expressing the wild-type human MRP2 and the mutant MRP (Q1382R, R768W, or K677R) were solubilized and analyzed by Western blot analysis with monoclonal antibodies M2I-4 (A) and M2III-6 (B). Login to comment
98 The cell lysates from LLC-PK1 cells expressing the wild-type and Q1382R MRP2 (20 ␮g) or from cells expressing the R768W and K677R MRP2 (200 ␮g) were treated with Endo H or PNGaseF and analyzed by Western blot analysis with monoclonal antibodies M2I-4. Login to comment
102 Because Western blot analyses suggested that the DJS-associated R768W mutation caused deficient MRP2 maturation, we examined the effect of DJS mutations on the biosynthesis and maturation by pulse-chase experiments. Login to comment
106 In contrast, the 175-kd form (band P) of R768W and K677R MRP2 was scarcely converted to the 190-kd form (band M) and was degraded with a half-life of approximately 60 minutes. Login to comment
109 Only about 10% of the precursor forms of R768W MRP2 were degraded during incubation for 60 minutes in the presence of MG132, an inhibitor of proteasomal degradation, whereas about 40% of the proteins were degraded in the absence of inhibitors (Fig. 5A and B). Login to comment
114 Consistent with our previous report,20 the wild-type MRP2 predominantly localized to the cell surface, especially to the apical membrane (Fig. 6A), but the R768W and K677R MRP2 localized in the cytoplasm, with ER-like distribution (Fig. 6A), consistent with the immature glycosylation of these mutants. Login to comment
123 Effect of proteasome inhibitors on the degradation of the precursor form of the R768W MRP2. Login to comment
124 (A) Proteins in LLC-PK1 cells expressing the wild-type and R768W MRP2 were pulse labeled with [35S]methionine and [35S]cysteine for 20 minutes then chased for 60 minutes in the absence or presence of MG132. Login to comment
125 (B) The relative intensity of the band of the R768W MRP2 was measured (0 minutes as 100%). Login to comment
131 In stable HEK293 transfectants, as in stable LLC-PK1 transfectants (Fig. 3A), the Q1382R mutation did not affect the expression and maturation of MRP2, whereas the R768W and K677R MRP2 did not mature properly, and their expression levels were low (Fig. 7A). Login to comment
133 GS-MCLB efflux from HEK293 cells expressing the R768W and K677R MRP2 was as low as that from control cells, consistent with their low expression of these proteins on the plasma membrane. Login to comment
152 (A) LLC-PK1 cells expressing the wild-type, R768W, and K677R MRP2 were stained with the MRP2 antibody M2III-6. Login to comment
163 The symbols shown are as follows: wild type (F), empty vector (Œ), R768W (ϫ), K677R (ϩ), Q1382R (I). Login to comment
173 Discussion We previously reported 2 missense mutations, 2,302 (C3T) R768W and 4,145 (A3G) Q1382R, and 2 splice donor site mutations, 2,439 ϩ 2 (T3C) and 1,815 ϩ 2 (T3A), in the MRP2 gene in patients with DJS.12,13 In the present study, we examined the molecular consequences and biochemical basis for the defect caused by the missense mutations, R768W and Q1382R, in NBDs. Login to comment
174 The missense mutation R768W, located in the Walker C motif in NBD1, caused deficient maturation and impaired sorting like other reported DJS mutations. Login to comment
176 We introduced 2 DJS-associated MRP2 mutations, R768W and Q1382R, and an artificial mutation, K677R, to the Walker A motif (Fig. 1). Login to comment
178 A confocal microscopic analysis revealed that MRP2 with the missense mutation R768W, in the signature C motif of NBD1, and K677R, in the Walker A motif of NBD1, were localized in the cytoplasm with an ER-like distribution, whereas the wild-type MRP2 was predominantly localized on the apical membrane (Fig. 6A). Login to comment
179 These results are consistent with the immunochemical data showing that there was no apparent expression of MRP2 protein in the canalicular membrane of hepatocytes in a DJS patient with the R768W mutation (Fig. 2). Login to comment
180 R768W and K677R transfectants produced precursor forms of MRP2 protein that were sensitive to Endo H (Fig. 3C) and rapidly degraded with a half-life of less than 60 minutes (Fig. 4). Login to comment
183 MG132, an inhibitor for the cytosolic proteasome, blocked the degradation of the precursor form of R768W MRP2 (Fig. 5), whereas lysosomal inhibitors, chloroquine or NH4Cl, did not block the degradation (data not shown). Login to comment
184 These results suggest that the R768W MRP2 is degraded by the proteasome pathway, which is involved in the degradation of newly synthesized, misfolded, and unassembled proteins in the ER.36 It has also been reported that a 1 amino acid (F508) deletion of the cystic fibrosis transmembrane conductance regulator (CFTR), which is the major mutation in cystic fibrosis patients and causes misfolding of CFTR,37 is degraded by the protea- Fig. 9. Login to comment
192 The missense mutation R768W, in the signature C motif of NBD1, probably causes misfolding of MRP2 and is thus degraded by the proteasome pathway before exiting from the ER. Login to comment
194 These results suggested that, unlike the R768W mutation, the Q1382R mutation does not affect either the maturation process or the subcellular localization of MRP2. Login to comment
208 In conclusion, introduction of a DJS mutation R768W as well as the Walker A lysine mutation K677R resulted in abortive maturation and sorting of MRP2, whereas another DJS mutation, Q1382R, did not affect maturation or sorting but impaired the substrate-induced ATP hydrolysis. Login to comment

PMID: 12130697 [PubMed] Gerk PM et al: "Regulation of expression of the multidrug resistance-associated protein 2 (MRP2) and its role in drug disposition."

No. Sentence Comment

53 Site-directed mutagenesis studies substi- TABLE 1 Mutations in human MRP2 Mutation Location Translation Domain Phenotype Reference -24(C-T) Promoter 5Ј-UTR Not reported (Ito et al., 2001e) 1249(G-A)/wt Exon 10 V4171 MSD2 Not reported (Ito et al., 2001e) 1815ϩ2(T-A)/1815ϩ2(T-A) Exon 13 147-bp deletion MSD2 DJS (Wada et al., 1998; Toh et al., 1999) 2002del67/2002del67 Exon 16 Premature termination codon NBD1 DJS (Konig et al., 1999a) 2302(C-T)/2302(C-T) Exon 18 R768W/R768W NBD1 DJS (Wada et al., 1998; Toh et al., 1999; Ito et al., 2001e) 2302(C-T)/2439ϩ2(T-C) Exon 18 R768W/168-bp deletion NBD1 DJS (Toh et al., 1999) 2302(C-T)/wt Exon 18 R768W/wt NBD1 Increased UCP1 (Toh et al., 1999) 2366(C-T)/wt Exon 18 S789F/wt NBD1 Not reported (Ito et al., 2001e) 2439ϩ2(T-C)/2439ϩ2(T-C) Exon 18 168-bp deletion/168-bp deletion NBD1 DJS (Wada et al., 1998; Toh et al., 1999) 2439ϩ2(T-C)/4145(A-G) Exon 18/29 168-bp deletion/Q1328R NBD1/2 DJS (Toh et al., 1999) 2439ϩ2(T-C)/wt Exon 18 168-bp deletion/wt NBD1 Increased UCP1 (Toh et al., 1999) 3196(C-T)/3196(C-T) Exon 23 Premature termination codon MSD3 DJS (Paulusma et al., 1997; Tsujii et al., 1999) 3449(G-A)/3449(G-A) Exon 25 R1150H/R1150H MSD3 DJS (Mor-Cohen et al., 2001) 3517(A-T)/3517(A-T) Exon 25 I1173F/I1173F MSD3 DJS (Mor-Cohen et al., 2001) 3972(C-T)/wt Exon 28 I1324I/wt near NBD2 None (Ito et al., 2001e) 4175del6 Exon 30 Loss of R1392 and M1393 NBD2 DJS (Tsujii et al., 1999) 4348(G-A)/wt Exon 31 A1450T/wt NBD2 Not reported (Ito et al., 2001e) UTR, untranslated region; wt, wild type; bp, base pair; UCP1, urinary coproporphyrin fraction 1. tuting the cationic amino acid Arg586 and Arg1096 in rat Mrp2 with neutral amino acids (R586L, R586I, R1096L, and R1096M) or a cationic amino acid (R1096K) led to acquisition of taurocholate transport and retention of glucuronide and glutathione conjugate transport by Mrp2 (Ito et al., 2001d). Login to comment

PMID: 11901087 [PubMed] Itoda M et al: "Polymorphisms in the ABCC2 (cMOAT/MRP2) gene found in 72 established cell lines derived from Japanese individuals: an association between single nucleotide polymorphisms in the 5'-untranslated region and exon 28."

No. Sentence Comment

57 Location Substitution Genotype 72 Cell Linesa (48 Subjects)b Nucleotide Amino Acid w/w w/m m/m 5Ј-Flanking t-751a 71 1 0 5Ј-Flanking c-717t 71 1 0 5Ј-UTR c-24t 52 (31) 14 (16) 6 (1) 5Ј-UTR g-23a 70 2 0 Exon 2 c56t P19L 71 1 0 Exon 3 a234g L78L 71 1 0 Exon 3 g299a R100Q 71 1 0 Exon 7 g842a S281N 71 1 0 Exon 10 g1249a V417I 59 (37) 9 (10) 4 (1) Exon 10 c1457t T486I 69 2 1 Exon 18 c2302t R768W 72 (47) 0 (1) 0 (0) Exon 18 c2366t S789F 71 (47) 1 (1) 0 (0) Exon 20 g2647a D883N 71 1 0 Exon 21 a2882g K961R 71 1 0 Exon 22 g2934a S978S 66 5 1 Exon 22 c3039t T1013T 71 0 1 Exon 22 g3057t Q1019H 71 1 0 Exon 24 g3321t L1107L 71 1 0 Exon 25 g3521a R1174H 71 1 0 Exon 25 t3563a V1188E 71 1 0 Exon 26 t3732g N1244K 71 0 1 Exon 28 c3972t I1324I 49 (29) 14 (17) 9 (2) Exon 29 c4100g S1367C 71 1 0 Exon 30 g4290t V1430V 71 1 0 Exon 31 g4348a A1450T 72 (47) 0 (1) 0 (0) Exon 31 c4488t H1496H 71 1 0 Exon 32 g4544a C1515Y 71 1 0 UTR, untranslated region. Login to comment

PMID: 10053008 [PubMed] Toh S et al: "Genomic structure of the canalicular multispecific organic anion-transporter gene (MRP2/cMOAT) and mutations in the ATP-binding-cassette region in Dubin-Johnson syndrome."

No. Sentence Comment

25 We previously had isolated the human MRP2/cMOAT gene as the candidate transporter for the glucuronide- Table 1 Mutations in MRP2/cMOAT and Serum Total- and Direct-Bilirubin and Urinary Coproporphyrine Isomer I Fractions, in Patients with DJS and in Their Families PEDIGREE AND PATIENT/ FAMILY MEMBER ALTERATION IN cMAOT EXON PUTATIVE CONSEQUENCE CONCENTRATION [NORMAL RANGE]a T-bilirubin [.3-1.0] (mg/dl) D-bilirubin [.1-.6] (mg/dl) Urinary Coproporphyrin I Fraction [!27]b (%) 1: DJ1 2302(CrT)/2302(CrT) 18 R768W/R768W 5.0 3.8 NT 2: DJ2 2302(CrT)/wild type 18 R768W/wild type NT NT 42.1 DJ3 2439ϩ2(TrC)/wild type 18 Splice donor/wild type NT NT 43.5 DJ4 2302(CrT)/2439ϩ2(TrC) 18 R768W/splice donor 1.3 .8 94.5 DJ5 2302(CrT)/2439ϩ2(TrC) 18 R768W/splice donor 1.3 .8 93.6 DJ6 Wild type/wild type ) Wild type/wild type NT NT NT 3: DJ7 1815ϩ2(TrA)/1815ϩ2(TrA) 13 Splice donor/splice donor 5.2 3.8 NT 4: DJ8 2302(CrT)/2302(CrT) 18 R768W/R768W 4.8 3.2 NT 5: DJ9 2439ϩ2(TrC)/4145(ArG) 18/29 Splice donor/Q1382R 2.5 1.6 80.0 6: DJ10 2439ϩ2(TrC)/2439ϩ2(TrC) 18 Splice donor/splice donor 2.1 1.6 85.7 DJ11 2439ϩ2(TrC)/wild type 18 Splice donor/wild type .9 .4 48.0 DJ12 2439ϩ2(TrC)/wild type 18 Splice donor/wild type .5 .2 36.9 a NT ϭ not tested. Login to comment
76 This alteration was accompanied by an amino acid substitution, R768W, in the active transporter-family signature (Higgins 1992) (fig. 1). Login to comment
99 The first mutation, identified in DJ8 in the present study, is 2302(CrT) and is associated with the amino acid change Arg768 rTrp (R768W) in the highly conserved domain, the Walker C motif. Login to comment
123 This mutation is accompanied by an amino acid substitution, R768W, in the Walker C motif, which is a highly conserved domain among the ABC-transporter family. Login to comment

PMID: 9878557 [PubMed] Kajihara S et al: "A splice mutation in the human canalicular multispecific organic anion transporter gene causes Dubin-Johnson syndrome."

No. Sentence Comment

61 Wada et al. identified three kinds of mutations in Japanese DJS patients; a missense mutation 2302 (C to T) R768W in the active transport signature, 2272del168, a deletion of 168 nucleotides from 2272 to 2439, 1669del147, a splice mutation that leads to 147b deletion (from nucleotides 1669 to 1815) (8). Login to comment

PMID: 9425227 [PubMed] Wada M et al: "Mutations in the canilicular multispecific organic anion transporter (cMOAT) gene, a novel ABC transporter, in patients with hyperbilirubinemia II/Dubin-Johnson syndrome."

No. Sentence Comment

21 We identified a missense mutation 2302 (C→T) R768W in the active transport family signature (15) present in cDNA of three patients, DJ1, DJ4 and DJ5 (Figs 1 and 2). Login to comment

PMID: 16815813 [PubMed] Choudhuri S et al: "Structure, function, expression, genomic organization, and single nucleotide polymorphisms of human ABCB1 (MDR1), ABCC (MRP), and ABCG2 (BCRP) efflux transporters."

No. Sentence Comment

315 Other SNPs identified with low frequency (~1%) were C2302T (Arg768Trp), C2366T (Ser789Phe), and G4348A (Ala1450Thr), all being missense mutations. Login to comment
331 The two missence mutations were C2302T transition in exon 18, resulting in amino acid replacement Arg768Trp in the active transport family signature motif; and A4145G transition in exon 29, resulting in amino acid substitution Gln1382Arg in the position within the ABC signature motif at the C-terminal end. Login to comment

PMID: 24465238 [PubMed] Yi JH et al: "Genetic Variations of ABCC2 Gene Associated with Adverse Drug Reactions to Valproic Acid in Korean Epileptic Patients."

No. Sentence Comment

35 In addition, the c.2302C &#ff1e; T (exon 18, Arg768Trp) mutation is responsible for Dubin-Johnson syndrome [21, 22]. Login to comment