ABCMdb

ABCC7 p.Asp614Gly

II (maturation defect) <a href="https://www.ncbi.nlm.nih.gov/pubmed/26823392">Veit et al.</a>
admin on 2016-08-19 15:16:22

Publications

PMID: 16442101 [PubMed] Frelet A et al: "Insight in eukaryotic ABC transporter function by mutation analysis."

No. Sentence Comment

295 I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R and L633P resulted in aberrant processing. Login to comment
297 L619S resulted in an inactive channel whereas D614G and I618T display a partial activity as chloride channels [161]. Login to comment

PMID: 11462247 [PubMed] Castellani C et al: "Analysis of the entire coding region of the cystic fibrosis transmembrane regulator gene in idiopathic pancreatitis."

No. Sentence Comment

7 Six possibly CF-related mutations were detected: L997F and 3878delG were found in two of the subjects already carrying another mutation, S1235R and L997F in one patient carrying the 5T, and L997F and D614G in the two patients with borderline sweat chloride. Login to comment
73 Six possibly CF-related mutations were detected: L997F and 3878delG (the latter described here for the first time) were found in two of the subjects already carrying another mutation, S1235R and L997F in one patient carrying the 5T allele, and L997F and D614G in two of the three patients with borderline sweat chloride. Login to comment
77 Sex (m/f) Age (yr) Pancreatitis CFTR Testing for 18 mutations Newly found mutations after DGGE PolyT Splice Variant Sweat Cl- (mEq/l) Nasal Potential Difference CF-compatible anamnestical and clinical features Sputum culture FEV1 (%) 1 m 17 ICP F508del L997F 7/9 23.5 n.a. - neg. 141 2 m 33 ICP F508del 7/9 n.a. n.a. - n.a. n.a. 3 m 45 ICP 2789+5G→A 7/7 59.5 n.a. - neg. 71 4 f 52 ICP F508del 7/9 28.5 basal and activated: negative - neg. 107 5 m 18 IRAP R1162X 7/7 n.a. n.a. sinusitis n.a. n.a. 6 m 45 ICP F508del 7/9 55.5 basal negative diabetes 7 m 50 ICP F508del 7/9 n.a. n.a. - n.a. n.a. 8 m 14 IAP 3849+10KbC→T 3878delG* 7/7 n.a. n.a. - n.a. n.a. 9 m 27 ICP - S1235R L997F 5/7 24.5 basal and activated: negative - neg. n.a. 10 m 32 IRAP - 5/7 n.a. n.a. - n.a. n.a. 11 f 24 ICP - 5/7 57.5 basal and activated: negative - neg. n.a. 12 f 7 IRAP - 5/7 9.5 basal negative - n.a. n.a. 13 m 28 ICP - L997F 7/9 49.5 n.a. chronic cough n.a. n.a. 14 f 27 IRAP - D614G 7/7 56 n.a. chronic cough, sinusitis neg. 117 n.a. : not available * : novel mutation DISCUSSION There is general agreement that a diagnosis of CF can be formulated in presence of one or more consistent phenotypic features (including pancreatitis) plus the evidence of CFTR dysfunction as documented by elevated sweat chloride concentrations, or identification of two CF-causing mutations, or the in vivo demonstration of abnormal ion transport across the nasal epithelium (Rosenstein et al, 1998). Login to comment
105 As for the other mutations found in phase 2, 3878delG had not been described previously, D614G had been found in exon 13 of a CF patient from Italian origin, and S1235R in exon 19 in two out of 34 unrelated Belgian CF chromosomes (Cystic Fibrosis Genetic Analysis Consortium, http://www.genet.sickkids.on.ca./cftr). Login to comment

PMID: 12865275 [PubMed] Ahmed N et al: "Molecular consequences of cystic fibrosis transmembrane regulator (CFTR) gene mutations in the exocrine pancreas."

No. Sentence Comment

309 Table 2 Genotype classification according to the functional consequences of CFTR gene mutations Pancreatic status Class I Class II Class III Class IV Class V PS F1 , 875+1G→C(2) F, F (1) F, G551D (1) F, R117H (11) F,3849+10kbC→T (5) F, G85E2 (1) F, R347H (3) F,3272-26A→G (4) F, S1251N (2) F,A445E (3) F, D614G (1) F,P574H (2) F, R347P (1) F,3120G>A (1) R117H,R117H (1) F, 5T (8) F, L1335P (1) F,2789+5G→A (1) F,P67L (1) F,R347P/R347H (1) F,V232D(2) R334W, R334W(1) PS→PI F,3659delC (1) F,F (15) F,G551D (1) F, I1234V (1) F,2184insA (1) F,R560T (1) PI F, G542X (27) F,F (365) F, G551D (28) F, 621+1G→T (13) F, R560T (7) F,R553X (7) F, N1303K (9) F, R1162X (6) F,L1077P (2) F, 3659delC (5) F, I48T (1) F, 1717-1G→A (5) F,A559T (1) F, W1282X (5) F, G85E2 (2) F, 711+1G→T (5) G551D,G551D(1) F,2184delA(4) F,H199R (1) W1282X,W1282X (4) F,I1072T(1) F,Y1092X (3) F,S549 (R75Q) (1) F,556delA (3) F, Q493X (3) F,4016InsT (3) F, 3120+1G→A (2) F, G551D/R553X (2) F,Q814X(2) F,1154insTC (2) F,441delA (1) F, 4326delTC (1) F,Q552X(1) F,3007delG (1) F,2184insA (1) F, 4010del4 (1) F,3905insT (1) F,1078delT(1) F,E1104X (1) F,3876delA (1) F,4374+1G→T (1) F,E585X (1) F, E60X (1) CFTR, cystic fibrosis transmembrane regulator; PI, pancreatic insufficiency; PS, pancreatic sufficiency. Login to comment

PMID: 15084222 [PubMed] D'Apice MR et al: "Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy."

No. Sentence Comment

89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

PMID: 15333598 [PubMed] Grangeia A et al: "Characterization of cystic fibrosis conductance transmembrane regulator gene mutations and IVS8 poly(T) variants in Portuguese patients with congenital absence of the vas deferens."

No. Sentence Comment

92 The frequency of the other mutations was: four of 62 (6.5%) for R334W, two of 62 (3.2%) for R117H, P205S and G576A, and one of 62 (1.6%) for D614G, V562I, R668C, 2789-5G ! Login to comment
104 Of the 22 NOAZ patients with conserved spermatogenesis and normal renal development, there were seven (31.8%) Table I. CFTR mutations and IVS8-5T variants found in 77 Portuguese azoospermic patients Syndromes Mutations n CFTR mutations IVS8 poly(T) variants Two mutations One mutation CBAVD F508del/R117H 1 1 - 7/9 F508del/D614G 1 1 - 7/9 R334W/R334W 1 1 - 7/7 R334W/V562I 1 1 - 5/7 R117H/P205S 1 1 - 7/7 2789 þ 5G ! Login to comment

PMID: 17413420 [PubMed] Grangeia A et al: "Molecular characterization of the cystic fibrosis transmembrane conductance regulator gene in congenital absence of the vas deferens."

No. Sentence Comment

93 DeltaF508 was the second most common mutation, representing 21 (23.3%) of total alleles, followed by R334W (6, Table 1 CFTR gene mutations and polymorphisms in patients with congenital absence of the vas deferens Mutation Location Nucleotide alteration Effect Method 1 CFTRdele2,3 Exons 2-3 Deletion of exons 2 and 3 Frameshift QFM-PCR 2 R117H Exon 4 G¡A at 482 AA substitution 31 mutation panel 3 P205S Exon 6a C¡T at 745 AA substitution DGGE/dHPLC 4 L206W Exon 6a T¡G at 749 AA substitution DGGE/dHPLC 5 R258G Exon 6b A¡G at 904 AA substitution DGGE/dHPLC 6 R334W Exon 7 C¡T at 1132 AA substitution 31 mutation panel 7 T5 allele Intron 8 Deletion of 2T at 1342-12 to -6 Aberrant splicing DGGE/DNA sequencing 8 P439S Exon 9 C¡T at 1447 AA substitution DGGE/dHPLC 9 D443Ya Exon 9 G¡T at 1459 AA substitution DGGE/dHPLC 10 I507del Exon 10 Deletion of 3 bp at 1648-1653 AA deletion 31 mutation panel 11 DeltaF508 Exon 10 Deletion of 3 bp at 1652-1655 AA deletion 31 mutation panel 12 G542X Exon 11 G¡T at 1756 Truncation 31 mutation panel 13 V562I Exon 12 G¡A at 1816 AA substitution DGGE/dHPLC 14 G576Aa Exon 12 G¡C at 1859 Aberrant splicing DGGE/dHPLC 15 D614G Exon 13 A¡G at 1973 AA substitution DGGE/dHPLC 16 R688Ca Exon 13 C¡T at 2134 AA substitution DGGE/dHPLC 17 V754M Exon 13 G¡A at 2392 AA substitution DGGE/dHPLC 18 E831X Exon 14a G¡T at 2623 Truncation DGGE/dHPLC 19 3272-26AϾG Intron 17a A¡G at 3272-26 Aberrant splicing DGGE/dHPLC 20 2789ϩ5G¡A Intron 14b G¡A at 2789ϩ5 Aberrant splicing 31 mutation panel 21 V1108L Exon 17b G¡C at 3454 AA substitution DGGE/dHPLC 22 L1227S Exon 19 T¡C at 3812 AA substitution DGGE/dHPLC 23 S1235R Exon 19 T¡G at 3837 AA substitution DGGE/dHPLC 24 P1290S Exon 20 C¡T at 4000 AA substitution DGGE/dHPLC 25 N1303K Exon 21 C¡G at 4041 AA substitution 31 mutation panel 26 E1401K Exon 23 G¡A at 4333 AA substitution DGGE/dHPLC Polymorphisms 1 TG repeats Intron 8 9-13 copies at 1342-12 to -35 Sequence variation DGGE/DNA sequencing 2 M470V Exon 10 A or G at 1540 Sequence variation DNA sequencing 3 125G/C Exon 1 G¡C at 125 Sequence variation DGGE/dHPLC 4 1001ϩ11T/C Intron 6b C¡4T at 1001ϩ11 Sequence variation DGGE/dHPLC 5 1716G/A Exon 10 G¡A at 1716 Sequence variation DGGE/dHPLC 6 1899-136T/G Intron 12 T¡G at 1899-136 Sequence variation DGGE/dHPLC 7 T854T Exon 14a T¡G at 2694 Sequence variation DGGE/dHPLC 8 3601-65C/A Intron 18 C¡A at 3601-65 Sequence variation DGGE/dHPLC 9 4521G/A Exon 24 G¡A at 4521 Sequence variation DGGE/dHPLC QFM-PCR, semiquantitative fluorescent multiplex polymerase chain reaction; bp, base pair; DGGE, denaturing gradient gel electrophoresis; dHPLC, denaturing high-performance liquid chromatography. Login to comment
97 The allelic frequency of the other mutations was 4.4% for R117H, G576A, and R668C, 3.3% for S1235R and 3272-26A¡G, and 2.2% for P205S, L206W, D443Y, G542X, D614G, and N1301K, whereas the remaining 12 mutations were present in single patients (Table 3). Login to comment
101 The missense M470V polymorphism was evaluated in all 45 pa- tientswithCAVD(Table2).TheallelicfrequencyoftheM470variant Table 2 CFTR genotypes identified in patients with congenital absence of the vas deferens CFTR mutation genotypes [(TG)mTn] genotype M470V Patients N % DeltaF508 (TG)10T9 (TG)12T5 M V 11 24.4 DeltaF508 (TG)10T9 (TG)11T5 M M 1 2.2 DeltaF508 R117H (TG)10T9 (TG)10T7 M M 2 4.4 G542X (TG)10T9 (TG)12T5 M V 2a 4.4 DeltaF508 R334W (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 D443Y-G576A-R668C (TG)10T9 (TG)10T7 M M 1 2.2 DeltaF508 D614G (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 E831X (TG)10T9 (TG)11T7 M V 1 2.2 DeltaF508 L1227S (TG)10T9 (TG)11T7 M M 1 2.2 DeltaF508 E1401K (TG)10T9 (TG)11T7 M V 1 2.2 I507del D614G (TG)11T7 (TG)10T7 M V 1 2.2 N1303K L206W (TG)10T9 (TG)9T9 M M 1 2.2 R117H P205S (TG)11T7 (TG)10T7 M V 1 2.2 R117H R334W (TG)10T7 (TG)11T7 M V 1 2.2 R334W P439S (TG)11T7 (TG)11T7 M V 1 2.2 R334W R334Wb (TG)11T7 (TG)11T7 V V 1 2.2 R334W V562I (TG)11T7 (TG)11T5 V M 1 2.2 D443Y-G576A-R668C 3272-26A¡G (TG)10T7 (TG)10T7 M M 1 2.2 G576A-R668C V754Mb (TG)10T7 (TG)11T7 M M 1 2.2 S1235R S1235Rb (TG)13T5 (TG)13T5 M M 1 2.2 2789ϩ5G¡A S1235Rb (TG)10T7 (TG)13T5 M M 1 2.2 3272-26A¡G P1290S (TG)11T7 (TG)10T7 M V 1 2.2 P205S (TG)11T7 (TG)12T5 V V 1 2.2 G576A-R668C b (TG)10T7 (TG)11T5 M M 1 2.2 V1108L b (TG)11T7 (TG)11T5 V M 1 2.2 N1303K (TG)10T9 (TG)12T5 M V 1 2.2 3272-26A¡G b (TG)10T7 (TG)12T5 M V 1 2.2 CFTRdele2,3 b (TG)11T7 (TG)13T5 V M 1 2.2 b (TG)11T5 (TG)12T5 M V 1 2.2 b (TG)13T5 (TG)12T5 M V 1 2.2 DeltaF508 - (TG)10T9 (TG)11T7 M V 1a 2.2 L206W -b (TG)9T9 (TG)11T7 M V 1 2.2 R258G -b (TG)11T7 (TG)11T7 V V 1 2.2 a CUAVD. Login to comment
110 Large Table 3 Allelic frequencies of CFTR mutations in patients with congenital absence of the vas deferens CBAVD CUAVD Total Patients 42 3 45 Alleles 84 6 90 Mutations N % N % N % 1 T5 allele 26a 31 2 33.3 28 31.1 2 DeltaF508 20 23.8 1 16.7 21 23.3 3 R334W 6a 7.1 0 0 6 6.7 4 R117H 4 4.8 0 0 4 4.4 5 G576A 4b 4.8 0 0 4 4.4 6 R688C 4b 4.8 0 0 4 4.4 7 S1235R 3a 3.6 0 0 3 3.3 8 3272-26A¡G 3 3.6 0 0 3 3.3 9 P205S 2 2.4 0 0 2 2.2 10 L206W 2 2.4 0 0 2 2.2 11 D443Y 2b 2.4 0 0 2 2.2 13 D614G 2 2.4 0 0 2 2.2 14 N1303K 2 2.4 0 0 2 2.2 12 G542X 0 0 2 33.3 2 2.2 15 R258G 1 1.2 0 0 1 1.1 16 P439S 1 1.2 0 0 1 1.1 17 I507del 1 1.2 0 0 1 1.1 18 V562I 1 1.2 0 0 1 1.1 19 V754M 1 1.2 0 0 1 1.1 20 E831X 1 1.2 0 0 1 1.1 21 2789ϩ5G¡A 1 1.2 0 0 1 1.1 22 V1108L 1 1.2 0 0 1 1.1 23 L1227S 1 1.2 0 0 1 1.1 24 P1290S 1 1.2 0 0 1 1.1 25 E1401K 1 1.2 0 0 1 1.1 26 CFTRdele2,3 1 1.2 0 0 1 1.1 CBAVD, congenital bilateral absence of the vas deferens; CUAVD, congenital unilateral absence of the vas deferens. Login to comment

PMID: 20059485 [PubMed] Dorfman R et al: "Do common in silico tools predict the clinical consequences of amino-acid substitutions in the CFTR gene?"

No. Sentence Comment

64 Mutations in the CFTR gene grouped by clinical category Cystic fibrosis CFTR-related disease No disease T338I D614G L320V V920L L90S M470V H199R S1251N I203M G550R P111A I148T Q1291H R560K L1388Q L183I R170H I1027T S549R D443Y P499A L1414S T908N R668C S549N A455E E1401K Q151K G27E I1234L Y563N R347P C866R S1118C P1290S R75Q A559T V520F P841R M469V E1401G P67L G85E S50Y E1409K R933G G458V G178R Y1032C R248T I980K G85V V392G L973P L137H T351S R334W I444S V938G R792G R560T R555G L1339F D1305E P574H V1240G T1053I D58G G551D L1335P I918M F994C S945L L558S F1337V R810G D1152H G1247R P574S R766M D579G W1098R H949R F200I R352Q L1077P K1351E M244K L206W M1101K D1154G L375F N1303K R1066C E528D D110Y R347H R1070Q A800G P1021S S549K A1364V V392A damaging` (is supposed to affect protein function or structure) and 'probably damaging` (high confidence of affecting protein function or structure). Login to comment

PMID: 20100616 [PubMed] Havasi V et al: "Association of cystic fibrosis genetic modifiers with congenital bilateral absence of the vas deferens."

No. Sentence Comment

68 Portuguese CFTR alleles Spanish CFTR alleles Turkish CFTR alleles 5T 22 F508del 11 5T 20 F508del 14 5T 9 D1152H 14 R334W 5 D443Ya 3 D110H 3 R117H 3 G576Aa 3 F508del 2 S1235R 3 R668Ca 3 3041-11del7 2 N1303K 2 G542X 2 1767del6 2 P205S 2 R117H 2 2789þ5G>A 2 D614G 2 V232D 2 CFTRdele2(ins186) 2 G542X 1 L997F 1 3120þ1G>A 1 L206W 1 H609R 1 G1130A 1 V562I 1 N1303H 1 M952I 1 I507del 1 L206W 1 365insT 1 3272-26A>G 1 3272-26A/G 1 E585X 1 2789þ5G>A 1 L15P 1 2752-15C>G 1 G576Aa 1 R347H 1 R334Q 1 R668Ca 1 2689insG 1 R347H 1 CFTRdele2,3 1 R1070W 1 E831X 1 L1227S 1 I 1027T 1 R1070W 1 E831X 1 3272-26A>G 1 L997F 1 I853F 1 A349V 1 6T 1 Note: CFTR ¼ cystic fibrosis transmembrane conductance regulator. Login to comment

PMID: 20932301 [PubMed] Green DM et al: "Mutations that permit residual CFTR function delay acquisition of multiple respiratory pathogens in CF patients."

No. Sentence Comment

74 For Pa, the hazard ratio Table 1 Classification of CFTR alleles Category Mutation Specific mutations Class I Defective Protein Synthesis (nonsense, frameshift, aberrant splicing) 1078delT, 1154 insTC, 1525-2A > G, 1717-1G > A, 1898+1G > A, 2184delA, 2184 insA, 3007delG, 3120+1G > A, 3659delC, 3876delA, 3905insT, 394delTT, 4010del4, 4016insT, 4326delTC, 4374+1G > T, 441delA, 556delA, 621+1G > T, 621-1G > T, 711+1G > T, 875+1G > C, E1104X, E585X, E60X, E822X, G542X, G551D/R553X, Q493X, Q552X, Q814X, R1066C, R1162X, R553X, V520F, W1282X, Y1092X Class II Abnormal Processing and Trafficking A559T, D979A, ΔF508, ΔI507, G480C, G85E, N1303K, S549I, S549N, S549R Class III Defective Channel Regulation/Gating G1244E, G1349D, G551D, G551S, G85E, H199R, I1072T, I48T, L1077P, R560T, S1255P, S549 (R75Q) Class IV Decreased Channel Conductance A800G, D1152H, D1154G, D614G, delM1140, E822K, G314E, G576A, G622D, G85E, H620Q, I1139V, I1234V, L1335P, M1137V, P67L, R117C, R117P, R117H, R334W, R347H, R347P, R347P/ R347H, R792G, S1251N, V232D Class V Reduced Synthesis and/or Trafficking 2789+5G > A, 3120G > A, 3272-26A > G, 3849+10kbC > T, 5T variant, 621+3A > G, 711+3A > G, A445E, A455E, IVS8 poly T, P574H was increased 3 fold for those with 'Minimal` function when compared to those with 'Residual` function. Login to comment

PMID: 9736778 [PubMed] Vankeerberghen A et al: "Characterization of 19 disease-associated missense mutations in the regulatory domain of the cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

1 Nine of these (I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R and L633P) resulted in aberrant processing. Login to comment
61 Some of the mutants, however, presented an abnormal maturation pattern, as can be seen for L610S and D614G CFTR (Fig. 2). Login to comment
66 The mutations that gave rise to a protein that was not able to proceed to the 190 kDa form (I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R and L633P; Table 2) are therefore class two mutations (17), where the disease phenotype is caused by the absence of sufficient CFTR protein at the cell surface. Login to comment
68 Primers used for mutagenesis Primer Sequence I601F (a1933t) 5'-CTA ACA AAA CTA GGT TTT TGG TCA CTT C-3' L610S (t1961c) 5'-CTA AAA TGG AAC ATT CAA AGA AAG CTG-3' A613T (g1969a) 5'-CAT TTA AAG AAA ACT GAC AAA ATA TTA-3' D614G (a1973g) 5'-CAT TTA AAG AAA GCT GGC AAA ATA TTA A-3' I618T (t1985c) 5'-GAC AAA ATA TTA ACT TTG CAT GAA GG-3' L619S (t1988c) 5'-GAC AAA ATA TTA ATT TCG CAT GAA GGT-3' H620P (a1991c) 5'-CAA AAT ATT AAT TTT GCC TGA AGG TAG C-3' H620Q (t1992g) 5'-AAT ATT AAT TTT GCA GGA AGG TAG CAG-3' G622D (g1997a) 5'-TTG CAT GAA GAT AGC AGC TAT TTT TAT G-3' G628R (g2014c) 5'-GCA GCT ATT TTT ATC GGA CAT TTT C-3' L633P (t2030c) 5'-CAT TTT CAG AAC CCC AAA ATC TAC AGC-3' D648V (a2075t) 5'-CTC ATG GGA TGT GTT TCT TTC GAC C-3' T665S (a2125t) 5'-CAA TCC TAA CTG AGT CCT TAC ACC G-3' F693L (t2209c) 5'-CAG ACT GGA GAG CTT GGG GAA AAA AG-3' R766M (g2429t) 5'-GCA CGA AGG ATG CAG TCT GTC CTG-3' R792G (c2506g) 5'-CAG CAT CCA CAG GAA AAG TGT CAC TG-3' A800G (c2531g) 5'-CTG GCC CCT CAG GGA AAC TTG ACT G-3' I807M (a2553g) 5'-CTG AAC TGG ATA TGT ATT CAA GAA GG-3' E822K (g2596a) 5'-GGC TTG GAA ATA AGT AAA GAA ATT AAC G-3' E826K (g2608a) 5'-GAA GAA ATT AAC AAA GAA GAC TTA AAG-3' Selection primer BstBI 5'-CTC TGG GGT CCG GAA TGA CCG AC-3' Two primers were used for each mutagenesis reaction. Login to comment
77 Mutations detected in patients (I601F, L610S, A613T, D614G, I618T, L619S, H620P, H620Q, D622G, G628R, L633P, T665S, F693L, K698R, V754M, R766M, R792G, A800G, I807M, E822K and E826K) are indicated in bold and underlined, the PKA phosphorylation sites by an arrow and the two acidic domains are boxed. Login to comment
87 Maturation pattern of RD mutations and their associated phenotype found in patients with the indicated genotype (when the mutation is associated with CF, only the pancreas status is given) Mutation A-form B-form C-form Clinical data Genotype Phenotype Reference I601F + + - I601F/G542X PS M. Schwarz, personal communication L610S + + - Unknown Unknown A613T + + - Unknown Unknown D614G + + - D614G/unknown PI 14 I618T + + - I618T/dF508 PS G.R. Cutting, personal communication L619S + + - L619S/unknown PI B. Tümmler, personal communication H620P + + - H620P/R1158X PS M. Schwarz, personal communication H620Q + + + H620Q/dF508 PI T. Dörk, personal communication G622D + + + G622D/unknown Oligospermia J. Zielenski, personal communication G628R + + - Unknown Unknown L633P + + - L633P/3659delC M. Schwarz, personal communication D648V + + + D648V/3849+10kb C/T PI C. Ferec, personal communication T665S + + + Unknown Unknown F693L + + + F693L/W1282X Healthy C. Ferec; CF Genetic Analysis Consortium R766M + + + R766M/R792G CBAVD D. Glavac, personal communication R792G + + + R766M/R792G CBAVD D. Glavac, personal communication A800G + + + A800G/unknown CBAVD 34 I807M + + + I807M/unknown CBAVD Our observation E822K + + + E822K/unknown PI 35 E826K + + + E826K/unknown Thoracic sarcoidosis C. Bombieri, personal communication +, the protein matures up to that form; -, the protein does not reach the respective maturation step. Login to comment
99 Pulse chase and immunoprecipitation of CFTR from COS1 cells transiently expressing wild-type, L610S, D614G or I807M CFTR. Login to comment
109 Nine mutations caused aberrant processing: I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R and L633P. Login to comment

PMID: 9822639 [PubMed] Pasyk EA et al: "A conserved region of the R domain of cystic fibrosis transmembrane conductance regulator is important in processing and function."

No. Sentence Comment

7 One of these mutants, L619S, exhibits no detectable function, whereas the other two, D614G and I618T, exhibit partial activity as chloride channels. Login to comment
41 The two other mutants, D614G and I618T, exhibited partial function in two-electrode voltage clamp experiments and could be studied at the single channel level, wherein it was revealed that they exhibited altered rates of channel opening. Login to comment
130 Single Channel Analysis Reveals Defects in Channel Opening by CFTR D614G and I618T-We know from the previous whole cell studies that the L619S mutation causes severe dysfunction of the CFTR channel activity because, despite expression of this mutant protein at the cell surface (Fig. 3), cyclic AMP-activated chloride currents were not detected (Fig. 4). Login to comment

PMID: 20799350 [PubMed] Kelly L et al: "Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains."

No. Sentence Comment

50 Disease-associated nsSNPs at Three Structural Hotspots in Human ABC Transporter NBDs Gene Disease Position ARA motif ABCB11 BRIC2 A570T ABCD1 X-ALD A616V CFTR CF A559T ABCC6 PXE R765Q ABCC8 HHF1 R841G ABCC8 HHF1 R1493Q ABCC8 HHF1 R1493W ABCD1 X-ALD R617C ABCD1 X-ALD R617G ABCD1 X-ALD R617H CFTR CF R560K CFTR CF R560S CFTR CF R560T ABCA1 HDLD1 A1046D ABCB4 ICP A546D C-loop 1 motif ABCC8 HHF1 D1471H ABCC8 HHF1 D1471N CFTR CBAVD G544V ABCC8 HHF1 G1478R C-loop2 motif ABCA4 STGD1 H2128R ABCC8 HHF1 K889T ABCD1 X-ALD R660P ABCD1 X-ALD R660W ABCA1 HDLD2 M1091T ABCA4 STGD1 E2131K ABCA12 LI2 E1539K ABCA4 STGD1 and CORD3 E1122K CFTR CF L610S ABCC8 HHF1 L1543P ABCA1 Colorectal cancer sample; somatic mutation A2109T ABCC9 CMD1O A1513T ABCD1 X-ALD H667D CFTR CF A613T ABCA1 HDLD2 D1099Y ABCD1 X-ALD T668I CFTR CF D614G ABCA4 STGD1 R2139W ABCA4 STGD1 R1129C ABCA4 ARMD2, STGD1, and FFM R1129L Disease abbreviations are as follows: BRIC2, benign recurrent intrahepatic cholestasis type 2; X-ALD, X-linked adrenoleukodystrophy; CF, cystic fibrosis; PXE, Pseudoxanthoma elasticum; HHF1, familial hyperinsulinemic hypoglycemia-1; HDLD1, high density lipoprotein deficiency type 1; ICP, intrahepatic cholestasis of pregnancy; CBAVD, congenital bilateral absence of the vas deferens; STGD1, Stargardt disease type 1; HDLD2, high density lipoprotein deficiency type 2; LI2, ichthyosis lamellar type 2; CORD3, cone-rod dystrophy type 3; CMD1O, cardiomyopathy dilated type 1O; ARMD2, age-related macular degeneration type 2; FFM, fundus flavimaculatus. Login to comment

PMID: 22020151 [PubMed] Amato F et al: "Extensive molecular analysis of patients bearing CFTR-related disorders."

No. Sentence Comment

69 Allele Frequency and CFTR Mutations in Patients Bearing CFTR-RDs Mutation (traditional name) HGVS nomenclature15 CBAVD (118 alleles)* RP (42 alleles)* DB (38 alleles)* Total (198 alleles)* TG12-T5-470V 34 (28.8) 2 (4.8) 10 (26.3) 46 (23.2) F508del c.1521_1523del 19 (16.1) 7 (16.7) 4 (10.5) 30 (15.2) 3195del6 c.3063_3069del 9 (7.6) 0 0 9 (4.5) N1303K c.3909CϾG 3 (2.5) 1 (2.4) 4 (10.5) 8 (4.0) G542X c.1624GϾT 4 (3.4) 1 (2.4) 1 (2.6) 6 (3.0) D1152H c.3454GϾC 1 (0.8) 2 (4.8) 2 (5.3) 5 (2.5) G85E c.254GϾA 2 (1.7) 3 (7.1) 0 5 (2.5) 1525-1delG c.1394de 3 (2.5) 1 (2.4) 0 4 (3.0) 4016insT c.3885insT 2 (1.7) 1 (2.4) 0 3 (1.5) 2789ϩ5GϾA c.2657ϩ5GϾA 0 3 (7.1) 0 3 (1.5) Q1476X c.4426CϾT 3 (2.5) 0 0 3 (1.5) 2183AAϾG c.2051_2052delinsG 1 (0.8) 1 (2.4) 0 2 (1.0) R553X c.1657CϾT 1 (0.8) 1 (2.4) 0 2 (1.0) L568F c.1704GϾT 2 (1.7) 0 0 2 (1.0) R1158X c.3472CϾT 2 (1.7) 0 0 2 (1.0) V920M c.2758GϾA 1 (0.8) 0 1 (2.6) 2 (1.0) 711ϩ1GϾT c.579ϩ1GϾT 0 1 (2.4) 0 1 (0.5) D614G c.1841AϾG 1 (0.8) 0 0 1 (0.5) 2184insA c.2052del 0 1 (2.4) 0 1 (0.5) 621ϩ1GϾT c.489ϩ1GϾT 1 (0.8) 0 0 1 (0.5) R1438W c.4312CϾT 0 1 (2.4) 0 1 (0.5) E193X c.577GϾT 0 1 (2.4) 0 1 (0.5) G1244E c.3731GϾA 1 (0.8) 0 0 1 (0.5) K68E c.202AϾG 1 (0.8) 0 0 1 (0.5) R347P c.1040GϾC 1 (0.8) 0 0 1 (0.5) 621ϩ3AϾG c.489ϩ3AϾG 1 (0.8) 0 0 1 (0.5) L997F c.2991GϾC 0 1 (2.4) 0 1 (0.5) F508C c.1523TϾG 1 (0.8) 0 0 1 (0.5) Total 94 (79.7) 28 (66.7) 22 (57.9) 144 (72.7) Undetected 24 (20.3) 14 (33.3) 16 (42.1) 54 (27.3) *Data are given as number (percentage). Login to comment
144 This detection rate is higher than that reported for other patients affected by CBAVD,20 RP,21-24 or DB.25-28 Most previous studies tested restricted mutation panels for first-level analysis, whereas we used sequencing analysis, and 11 mutations identified in our study (3195del6, Q1476X, L568F, V920M, 1525-1delG, D614G, R1438W, E193X, K68E, 621ϩ3AϾG, and L997F), present in approximately 13% of chromosomes of CFTR-RD patients, are not included in most mutation panels. Login to comment

PMID: 19318035 [PubMed] Seia M et al: "Borderline sweat test: Utility and limits of genetic analysis for the diagnosis of cystic fibrosis."

No. Sentence Comment

59 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported. Login to comment
57 In order to evaluate the relationship between the presence of CFTR mutation and sweat chloride concentration, we focused our attention on the 91 individuals (11.8%) in whom borderline sweat chloride values (31-59 mEq/l) were recorded (mean sweat electrolyte value was 40.0 mEq/l): 25 refused to be referred to the local Table 2 Demographic and clinical features of subjects with positive DNA analysis Patient Initials Gender Age at test years/ months Sweat chloride mEq/l Clinical indication DNA results IRT Right arm Left arm 1 CA M 49y5m 34 34 CBAVD G542X/5T-TG12 ND 2 SA M 45y2m 45 43 Pancreatitis F508del/R117H-7T ND 3 PD F 43y7m 33 38 Recurrent bronchitis F508del/5T-TG12 ND 4 CA M 36y1m 31 29 CBAVD R117H-7T/R117C-7T ND 5 SC M 36y1m 33 40 Pneumonia F508del/D1152H ND 6 MG M 25Y5m 41 45 CBAVD Q552X/D1152H NEG 7 SG M 18y5m 49 54 Pancreatitis 4016insT/dupl.prom.-3 ND 8 LS F 10y4m 41 38 Pancreatitis D1152H/L997F NEG 9 CM M 8y3m 30 31 Pneumonia F1052V/A120T NEG 10 PT M 7y3m 41 39 Positive screening F508del/Y1032C POS 11 ME F 7y1m 44 44 Positive screening 2789+5GNA/5T-TG12 POS 12 PM F 6y4m 35 36 Positive screening 2183AANG/5T-TG12 POS 13 BM F 6y3m 36 39 Positive screening F508del/5T-TG12 POS 14 CD M 5y8m 40 41 Chronic bronchitis 5T-TG12/5T-TG12 NEG 15 CG F 4y5m 33 37 Recurrent bronchitis R553X/L997F POS 16 CS F 3y8m 53 58 Family history G542X/D614G POS 17 VA M 4y2m 49 43 Pneumonia E831X/5T-TG12 ND 18 SC M 3y4m 39 39 Positive screening R352Q/G213E POS 19 CC F 2y3m 31 31 Positive screening F508del/5T-TG12 POS 20 CA F 2y5m 51 52 Recurrent bronchitis E831X/5T-TG12 ND 21 MR F 3y+7m 29 31 Family history G542X/5T-TG12 POS 22 CM F 2y3m 60 58 Pneumonia T338I/L997F POS 23 LM F 2y1m 50 52 Positive screening F508del/E1473X POS 24 CGE F 0y8m 46 47 Positive screening E92K/5T-TG13 POS 25 NF M 0y7m 32 30 Positive screening F508del/P5L POS 26 RG M 0y7m 45 40 Positive screening N1303K/P5L POS 27 PE M 47y4m 60 58 Nasal polyposis R1066H/UN ND 28 LS M 39y9m 39 38 Azoospermy N1303K/UN ND 29 TM M 38y4m 40 45 Azoospermy N1303K/UN ND 30 DF M 34y2m 52 58 Bronchiectasis 3849+10 kbCNT/UN ND 31 TV F 30y5m 35 34 Recurrent bronchitis L997F/UN ND 32 FA F 18y7m 53 49 Family history Del es.2/UN NEG 33 DG M 17y8m 43 47 Recurrent bronchitis 5T-TG12/UN NEG 34 LN F 13y7m 54 53 Nasal poliposis, malnutrition R74W-V855I/UN NEG 35 FKT M 15y4m 54 53 Chronic bronchitis R352Q/UN NEG 36 BM M 10y9m 48 51 Chronic bronchitis T1263I/UN NEG 37 SV F 11y1m 60 58 Chronic bronchitis R347H/UN NEG 38 CV F 10y10m 38 39 Recurrent bronchitis 5T-TG12/UN NEG 39 BF F 9y10m 37 38 Chronic bronchitis L997F/UN NEG 40 CA M 8y2m 33 32 Pneumonia F508del/UN NEG 41 RX F 8y7m 29 31 Chronic bronchitis V920L/UN NEG 42 MG F 4y3m 51 51 Positive screening F508del/UN POS Sweat chloride concentration and mutations/variants detected are also reported. Login to comment

PMID: 12454843 [PubMed] Durno C et al: "Genotype and phenotype correlations in patients with cystic fibrosis and pancreatitis."

No. Sentence Comment

105 CFTR Genotypes Among CF Patients With PS With and Without Pancreatitis Two mutations (n) ⌬F508/R117H (9) ⌬F508/(5T) (6) ⌬F508/3272-26A 3 G (4) ⌬F508/R347H (2) ⌬F508/P574H (2) ⌬F508/875 ϩ 1G Ͼ C (2) ⌬F508/3849 ϩ 10kb C 3 T (1) ⌬F508/A455E (1) ⌬F508/D614G (1) ⌬F508/G85E (1) ⌬F508/R347P (1) ⌬F508/S1251N (1) ⌬F508/⌬F508a (1) ⌬F508/3120G Ͼ A (1) ⌬F508/G551Da (1) G542X/R117H (1) R560T/L206W (1) R117H/R117H (1) R31L/P67L (1) 1461ins4 (AGAT)/G85E (1) G551D/(5T) (1) R1066C/3849 ϩ 10kb C Ͼ T (1) G551D/3849 ϩ 10kb C Ͼ T (1) R334W/R334W (1) R334W/681delC (1) W1282X/3489 ϩ 10kb C Ͼ T (1) One mutation (n) ⌬F508/- (18) L1077P/- (1) W1282X/- (1) M1137V/- (1) G551D/- (1) R347H/- (1) Q30X1/- (1) G1244E/- (1) R117H/- (1) 621 ϩ 2G621 ϩ 1G 3 T/- (1) NOTE. Login to comment

PMID: 7472820 [PubMed] Wilschanski M et al: "Correlation of sweat chloride concentration with classes of the cystic fibrosis transmembrane conductance regulator gene mutations."

No. Sentence Comment

43 Defined mutations (each mutation cited in references 8, 23, and 24; numerals in parentheses indicate number of patients): Nonsense mutations-----class I: Frameshift mutations---class I: Splice site mutations-class I: Missense mutations---class HI: Missense mutations---class IV: Partially defective processing---class V: Alternative spficing-----classV: R1162X (3), Y1092X (3), G542X (21), Q552X (2), Q493X (2), w1282x (2), E1104X (1), R553X (6), E585X (l), (all PI) 3659delC (5), 2184delA (4), 4010de14 (1), 556delA (1), 3002delG (1) 3905insT (1), 4016insT (3), 1154insTC (l), 441delA (1), 2184insA (2), 1078delT (1), 4326delTC (3) (all PI) I717-1G--~A (4), 621+lG--*T (10), 711+IG--~T (3), 875+1G-+C (2), 3120+IG-~A (1) (18 PI, 2 PS) G551D (25), N1303K (7), R560T (8), I148T (1), G85E (3), A559T (1), L1077P (2), T1234V (1), (47 PI, 1 PS) R117H (10), R347H (3), R347P (1), D614G (1), S1251N (2), (all PS) P574H (2), A455E (2), (all PS) 3272-26A-+G (4), 3849+10KbC---~T (2), 3120G-+A (1), (all PS) analysis, we further grouped the patients according to the molecular consequences conferred by the CFTR alleles. Login to comment

PMID: 7573058 [PubMed] Zielenski J et al: "CFTR gene variant for patients with congenital absence of vas deferens."

No. Sentence Comment

22 W1282X Unknown 2 R553X Unknown ............ 20.0 4173delC Unknown1 1 D614G Unknown 1 1716+12T- C Unknown 1 J Unknown Unknown ............ .15 21.4 NOTE.-The known CFTR mutations screened included AF508, G542X, GSS1D, N1303K, R553X, W1282X, AI507, 1717-1G-A, R560T, S549N, 621+1G--T, and R117H. Login to comment

PMID: 11001817 [PubMed] Chen JM et al: "Definition of a "functional R domain" of the cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

30 Second, while I601F, L610S, A613T, D614G, I618T, L619S, H620P, G628R, and L633P resulted in aberrant processing, neither D648V or T665S caused an arrest in protein maturation (8). Login to comment

PMID: 16478680 [PubMed] Castaldo G et al: "Phenotypic discordance in three siblings affected by atypical cystic fibrosis with the F508del/D614G genotype."

No. Sentence Comment

3 The whole scanning of CFTR revealed the rare F508del/D614G genotype. Login to comment
24 The gene sequencing scanning of the whole coding region of the CFTR gene in the three siblings revealed the second mutation, i.e., D614G. Login to comment
25 Thus, the CFTR genotype was F508del/D614G. Login to comment
55 Indeed, the three siblings carried the F508del/D614G genotype. Login to comment
56 D614G [5,6] is a rare mutation, not included in commercial kits or in home-made panels [7]. Login to comment
58 The D614G mutation has been identified in atypical CF patients with idiopathic pancreatitis [5,6]. Login to comment

PMID: 23974870 [PubMed] Sosnay PR et al: "Defining the disease liability of variants in the cystic fibrosis transmembrane conductance regulator gene."

No. Sentence Comment

137 In addition to these ten variants, c.1210-12(7) (legacy name 7T) had already been reported to be non-penetrant48 and was identified as a second variant in numerous fathers, and a twelfth variant, p.Ile1027Thr, was deemed 159 variants ࣙ0.01% frequency in CFTR2 127 variants meet clinical and functional criteria Clinical and functional analysis 13 variants meet neither criteria 14 variants 5 variants 7 variants 6 variants Evidence of non-penetrance No evidence of non-penetrance 19 variants meet clinical or functional criteria 127 variants are CF causing 12 variants are non CF causing 20 variants are indeterminate p.Arg117HisߤC p.Arg75Gln p.Gly576Alaߤ p.Arg668Cys ߤ p.Met470Val C p.IIe1027Thr ߤC p.Val754Met ߤC p.IIe148Thr ߤC p.Arg31Cys C p.Ser1235Arg ߤ p.Leu997Phe ߤ p.Arg1162Leu p.Leu227Arg F p.Gln525* F p.Leu558SerC p.Asp614Gly C c.2657+2_2657+3insA C c.1418delG F c.1210-12(7) ߤ p.Arg1070Gln C p.Asp1270Asn ߤC p.[Gln359Lys; Thr360Lys] p.Gly1069Argߤ p.Asp1152His p.Phe1052Val c.1210-12(5) p.Arg74Trpߤ p.IIe1234Val ߤC p.Arg1070Trp ߤF p.Ser977Phe F p.Asp579Gly C p.Tyr569Asp F Penetrance analysis Figure 4ߒ Assignment of disease liability to the 159 most frequent CFTR variants using three criteria. Login to comment

PMID: 25674778 [PubMed] Baker MW et al: "Improving newborn screening for cystic fibrosis using next-generation sequencing technology: a technical feasibility study."

No. Sentence Comment

31 Both methods used 5 &#b5;l of isolated DNA for the NGS assay. NGS assay for detection of CFTR mutations/variants CFTR mutations are described using both the international nomenclature of the Human Genome Variation Society Mutations that have varying consequences c.3454G>C (D1152H) c.3154T>G (F1052V) c.3208C>T (R1070W) c.2930C>T (S977F) - c.3808G>A (D1270N) c.3205G>A (G1069R) c.350G>A (R117H) PolyTG/ polyT - c.1736A>G (D579G) c.3209G>A (R1070Q) c.220C>T (R74W) - - Mutations still under evaluation c.2657ߙ+ߙ2_2657ߙ+ߙ3insA (2789ߙ+ߙ2insA) c.680T>G (L227R) c.1705T>G (Y569D) - - c.1841A>G (D614G) c.1673T>C (L558S) - - - c.3700A>G (I1234V) c. Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

54 [1117-8A>G;1727G>C; 2002C>T]) and mutations G1069R (p.Gly1069Arg), D614G (p.Asp614Gly), S42F (p.Ser42Phe) and S912L (p.Ser912Leu) should also be considered as part of this extension, even if not found in CF-PI but studied up to the DEL step because they are found in genotypes with an unknown allele. Login to comment
286 These patients had the following mutations on the other allele: F508del (p.Phe508del) (3 CF-PS and 1 CFTR-RD), W1282X (p.Trp1282*) (2 CF-PS), Q779X (p.Gln779*) (2 CF-PS siblings), D110H (p.Asp110His) (1 CF-PS), D614G (p.Asp614Gly) (1 CF-PS), unknown (1 CBAVD). Login to comment
385 [Gly576Ala;Arg668Cys] D579G c.1736A>G CF-PS varying clinical consequence p.Asp579Gly E585X c.1753G>T CF-PI CF-causing p.Glu585* H609L c.1826A>T CFTR-RD nd p.His609Leu A613T c.1837G>A CF-PS nd p.Ala613Thr D614G c.1841A>G CF-PS unknown significance p.Asp614Gly 2143delT c.2012delT CF-PS CF-causing p.Leu671* 2183AA>G c.2051_2052delAAinsG CF-PI,CF-PS CF-causing p.Lys684SerfsX38 2184insA c.2052_2053insA CF-PI CF-causing p.Gln685ThrfsX4 R709X c.2125C>T CF-PI CF-causing p.Arg709* L732X c.2195T>G CF-PI CF-causing p.Leu732* R764X c.2290C>T CF-PI CF-causing p.Arg764* Q779X c.2335C>T uncertain: CF-PI and/or CF-PS nd p.Gln779* E831X c.2491G>T CF-PS CF-causing p.Glu831* Y849X c.2547C>A CF-PI CF-causing p.Tyr849* ex14b-17bdel c.2620-674_3367+198del9858 CF-PI nd 2789+5G>A c.2657+5G>A CF-PI,CF-PS CF-causing 2790-2A>G c.2658-2A>G CF-PS nd S912L c.2735C>T uncertain: found only with an unknown allele in trans nd p.Ser912Leu S945L c.2834C>T CF-PS CF-causing p.Ser945Leu S977F c.2930C>T CFTR-RD varying clinical consequence p.Ser977Phe L997F c.2991G>C CF-PS,CFTR-RD,CBAVD non CF-causing p.Leu997Phe ex17a-18del c.2988+1173_3468+2111del8600 CF-PI nd P1013L c.3038C>T CFTR-RD nd p.Pro1013Leu Y1032C c.3095A>G CFTR-RD nd p.Tyr1032Cys 3272-26A>G c.3140-26A>G CF-PS CF-causing L1065P c.3194T>C CF-PI,CF-PS CF-causing p.Leu1065Pro L1065R c.3194T>G uncertain: CF-PI and/or CF-PS nd p.Leu1065Arg R1066C c.3196C>T CF-PI CF-causing p.Arg1066Cys R1066H c.3197G>A CF-PI CF-causing p.Arg1066His G1069R c.3205G>A uncertain: found only with an unknown allele in trans varying clinical consequence p.Gly1069Arg Continued on next page of 0.021). Login to comment

PMID: 26014425 [PubMed] Girardet A et al: "The improvement of the best practice guidelines for preimplantation genetic diagnosis of cystic fibrosis: toward an international consensus."

No. Sentence Comment

87 [Gln359Lys; Thr360Lys] L558S c.1673 T4C p.Leu558Ser Y569D c.1705 T4G p.Tyr569Asp D579G c.1736 A4G p.Asp579Gly D614G c.1841 A4G p.Asp614Gly S977F c.2930C4T p.Ser977Phe F1052V c.3154 T4G p.Phe1052Val G1069R c.3205G4A p.Gly1069Arg R1070Q c.3209G4A p.Arg1070Gln D1152H c.3454G4C p.Asp1152His I1234V c.3700 A4G p.Ile1234Val 5T c.1210 - 12[5] Examples of common not CF-causing variantsc R31C c.91C4T p.Arg31Cys R74W c.220C4T p.Arg74Trp R75Q c.224G4A p.Arg75Gln I148T c.443 T4C p.Ile148Thr M470V c.1408 A4G p.Met470Val G576A c.1727G4C p.Gly576Ala R668C c.2002C4T p.Arg668Cys V754M c.2260G4A p.Val754Met L997F c.2991G4C p.Leu997Phe I1027T c.3080 T4C p.Ile1027Thr R1070W c.3208C4T p.Arg1070Trp R1162L c.3485G4T p.Arg1162Leu Table 1 (Continued) HGVS nomenclature Legacy name cDNA nucleotide name Protein name S1235R c.3705 T4G p.Ser1235Arg D1270N c.3808G4A p.Asp1270Asn 7T c.1210-12[7] Abbreviation: HGVS, Human Genome Variation Society. Login to comment

PMID: 26574590 [PubMed] Kharrazi M et al: "Newborn Screening for Cystic Fibrosis in California."

No. Sentence Comment

108 [1210-12[5]];[1210-34TG[11]] (IVS8 (TG)11-5T)f 1 2 c.531delT (663delT) / c.314T.A (I105N)e 1 3 c.1521_1523delCTT (F508del) / c.1841A.G (D614G)e 1 3 c.1521_1523delCTT (F508del) / c.290T.C (V97A)e 1 3 c.1519_1521delATC (I507del) / c. Login to comment