ABCMdb

ABCC7 p.Arg334Leu

None has been submitted yet.

Publications

PMID: 10562541 [PubMed] Tector M et al: "An unstable transmembrane segment in the cystic fibrosis transmembrane conductance regulator."

No. Sentence Comment

80 (C) Translation and translocation into microsomes of constructs containing wild-type or doubly mutated, R334L and K335I, Tm6 were analysed by immunoprecipitation with anti-myc antibody (lanes 1, 2, 5 and 6) or a non-relevant control antibody (NRA) (lanes 3 and 7) from TX-100 extracts of the isolated microsomes. Login to comment
95 Arginine 334 was changed to leucine and lysine 335 to isoleucine, generating construct Tm5-6(RK-LI)-Inv (Figure 3A). Login to comment
203 These mutations enabled the production of proteins containing leucine in place of arginine 334 and isoleucine in place of lysine 335 in Tm6 of CFTR. Login to comment

PMID: 12679372 [PubMed] Gong X et al: "Molecular determinants and role of an anion binding site in the external mouth of the CFTR chloride channel pore."

No. Sentence Comment

53 Block of wild-type, R334C-, R334E-, R334H-, R334K-, R334L- and R334Q-CFTR by 100 mM and 1 mM intracellular Au(CN)2 _ are compared in Fig. 4B. Login to comment
106 However, SCN_ permeability was significantly increased in one mutant, R334L (Fig. 9B). Login to comment
117 Mean of data from 3-5 patches. B, relative SCN_ permeability, estimated from the reversal potential with 150 mM NaSCN in the extracellular solution, was unaltered in most mutants but significantly increased (**P < 0.001) in R334L. Login to comment
148 The fact that tight Au(CN)2 _ binding and strong Au(CN)2 _ -anion interactions are separable by mutagenesis is also evident in R334H and R334L (Fig. 5). Login to comment

PMID: 15084222 [PubMed] D'Apice MR et al: "Molecular analysis using DHPLC of cystic fibrosis: increase of the mutation detection rate among the affected population in Central Italy."

No. Sentence Comment

89 Table 1: Primers and DHPLC (oven temperature, gradient) analysis conditions for 6b and 9 exons of the CFTR gene exon Primer 5' → 3' Amplicon length Oven temp (°C) % B buffer start/end 6b F - CAGAGATCAGAGAGCTGGG 323 56 55/63 R - GAGGTGGAAGTCTACCATGA 9 F - GGGATTTGGGGAATTATTTG 279 55 54/62 R - TCTCCAAAAATACCTTCCAG Table 2: CF mutations identified in cohort of 290 patients from the Central Italy Mutation Nucleotide change Exon/intron N % Method delF508 1652delCTT 10 328 56.36 INNO-LiPA, DHPLC N1303K 4041 C to G 21 51 8.76 INNO-LiPA, DHPLC G542X 1756 G to T 11 42 7.21 INNO-LiPA, DHPLC W1282X 3978 G to A 20 15 2.60 INNO-LiPA, DHPLC S549R 1779 T to G 11 8 1.37 DHPLC 621+1G-T 621+1 G to T Intron 4 7 1.20 INNO-LiPA, DHPLC 1717-1G-A 1717-1 G to A Intron 10 5 0.86 INNO-LiPA, DHPLC G85E 386 G to A 3 4 0.69 INNO-LiPA, DHPLC R553X 1789 C to T 11 4 0.69 INNO-LiPA, DHPLC H139R 548 A to G 6a 3 0.51 DHPLC R347P 1172 G to C 7 3 0.51 INNO-LiPA, DHPLC L1065P 3326 T to C 17b 3 0.51 DHPLC L1077P 3362 T to C 17b 3 0.51 DHPLC S4X 143 C to A 1 2 0.34 DHPLC D110H 460 G to C 4 2 0.34 DHPLC R334W 1132 C to T 7 2 0.34 INNO-LiPA, DHPLC M348K 1175 T to A 7 2 0.34 DHPLC 1259insA 1259 ins A 8 2 0.34 DHPLC S549N 1778 G to A 11 2 0.34 DHPLC L558S 1805 T to C 11 2 0.34 DHPLC 2183+AA-G 2183 A to G and 2184 del A 13 2 0.34 INNO-LiPA, DHPLC 2789+5G-A 2789+5 G to A Intron 14b 2 0.34 INNO-LiPA, DHPLC R1066C 3328 C to T 17b 2 0.34 DHPLC 3667ins4 3667insTCAA 19 2 0.34 DHPLC S42F 257 C to T 2 2 0.34 DHPLC R117L 482 G to T 4 1 0.17 DHPLC H199R 728 A to G 6a 1 0.17 DHPLC R334L 1133 G to T 7 1 0.17 DHPLC T338I 1145 C to T 7 1 0.17 DHPLC G551D 1784 G to A 11 1 0.17 INNO-LiPA, DHPLC Q552X 1786 C to T 11 1 0.17 INNO-LiPA, DHPLC D614G 1973 A to G 13 1 0.17 DHPLC A1006E 3149 C to A 17a 1 0.17 DHPLC 4016insT 4016 ins T 21 1 0.17 DHPLC 4040delA 4040 del A 21 1 0.17 DHPLC 4167del7 4167 delCTAAGCC 22 1 0.17 DHPLC Detected 511 88.10 Unknown 69 11.90 Total 580 100.00 N = number of CF chromosomes; % = frequency. Login to comment

PMID: 17673962 [PubMed] Zhou JJ et al: "Direct and indirect effects of mutations at the outer mouth of the cystic fibrosis transmembrane conductance regulator chloride channel pore."

No. Sentence Comment

85 Figure 3 shows the blocking effects of internally applied Pt(NO2)4 2À in six different channel mutants (R334C, R334E, R334H, R334K, R334L, R334Q) under conditions of both low (Fig. 3a) and high (Fig. 3b) extracellular ClÀ concentration. Login to comment
91 With elevated extracellular ClÀ , the Kd(0) was significantly increased only in R334C and R334E; not significantly altered in R334K, R334L and R334Q; and significantly decreased in R334H (Fig. 5b). Login to comment
106 Comparison of the mean Kd estimated for suramin (at 0 mV) shows that R334C, R334E, R334K, R334L and R334Q were all associated with weakened suramin block, with only R334H failing to significantly affect suramin block (Fig. 7). Login to comment
129 Mean of data from three to eight patches. Fitted lines are to equation 1 as described in Figure 1 for wild type and R334Q and with the following parameters for other channel variants: R334C 4 mM external ClÀ , Kd(0) = 1362 lM, zd = À0.295; R334C 154 mM external ClÀ , Kd(0) = 836 lM, zd = À0.219; R334E 4 mM external ClÀ , Kd(0) = 759 lM, zd = À0.376; R334E 154 mM external ClÀ , Kd(0) = 564 lM, zd = À0.173; R334H 4 mM external ClÀ , Kd(0) = 140 lM, zd = À0.166; R334H 154 mM external ClÀ , Kd(0) = 119 lM, zd = À0.149; R334K 4 mM external ClÀ , Kd(0) = 143 lM, zd = À0.314; R334K 154 mM external ClÀ , Kd(0) = 317 lM, zd = À0.374; R334L 4 mM external ClÀ , Kd(0) = 176 lM, zd = À0.258; R334L 154 mM external ClÀ , Kd(0) = 284 lM, zd = À0.366 extracellular Pt(NO2)4 2À by normalizing current amplitude at the hyperpolarized extreme of the voltage range studied, -80 mV (Fig. 10b). Login to comment
159 These plots represent mean data from four to seven patches. Fitted lines are to equation 1 with the following parameters: wild type, Kd(0) = 2.51 lM, zd = À0.042; R334C, Kd(0) = 18.5 lM, zd = À0.056; R334E, Kd(0) = 25.0 lM, zd = À0.107; R334H, Kd(0) = 3.10 lM, zd = À0.085; R334K, Kd(0) = 6.31 lM, zd = À0.232; R334L, Kd(0) = 4.08 lM, zd = À0.061; R334Q, Kd(0) = 6.64 lM, zd = À0.239 with our previous suggestion that intracellular Au(CN)2 À blocks the channel by interacting directly with R334, several reasons prompt us to suggest that Pt(NO2)4 2À does not interact directly with the arginine side chain at this position. Login to comment
228 ), R334E (5), R334H (j), R334K (), R334L (h), R334Q (u); c wild type (d), K95Q (m), R303Q (Å). Login to comment

PMID: 19236881 [PubMed] Enquist K et al: "Membrane-integration characteristics of two ABC transporters, CFTR and P-glycoprotein."

No. Sentence Comment

113 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ΔM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
116 One mutation, TM6CFTR (R334L), increased the insertion efficiency from 55% to 85%, as expected for a charged-to-hydrophobic replacement. Login to comment
109 For CFTR, we chose mutations located in TM1CFTR (F87L, G91R), TM3CFTR (P205S, L206W), TM4CFTR (C225R), TM5CFTR (DF311, G314E), TM6CFTR (R334L/W, I336K/R/D, I340N/S, L346P, R347L/H), TM8CFTR (S909I, S912L), TM9CFTR (I1005R, A1006E), TM10CFTR (Y1032N), and TM12CFTR (M1137R, ƊM1140, M1140K), or close to the TM region of TM1CFTR (R74W, L102R/P), TMF2CFTR (R117P/L, L137P), and TM11CFTR (M1101K/R). Login to comment
112 One mutation, TM6CFTR (R334L), increased the insertion efficiency from 55% to 85%, as expected for a charged-to-hydrophobic replacement. Login to comment

PMID: 9272157 [PubMed] Dork T et al: "Distinct spectrum of CFTR gene mutations in congenital absence of vas deferens."

No. Sentence Comment

82 The R334L mutation occurs at a position at which another mutation, R334W, has been described in mild to moderate CF and has been found to affect chloride channel conductivity significantly (Gasparini et al. 1991; Sheppard et al. 1993). Login to comment
83 The German CBAVD patient in our study was compound heterozygous for R334L and for the missense mutation I336K in the same exon. Login to comment
86 The V938G substitution was identified in two unrelated patients, one homozygote with unilateral ab- 368 Table 1A Frequency distribution and haplotypes of CFTR mutations in 106 CAVD patients Mutationa Nucleotide changesb Locationc Frequencyd Haplotypee Referencef 174delA deletion of A at 174 exon 1 1 D3 This study E56K G→A at 298 exon 3 1 B3 This study D58N G→A at 304 exon 3 1 C2 This study D110H G→A at 460 exon 4 2 C2 Dean et al. (1990) R117H G→A at 482 exon 4 24 B6 Dean et al. (1990) A120T G→A at 490 exon 4 1 n.p. Chillón et al. (1994) ̃L138 insertion of CTA after 546 exon 4 1 A2 This study L206W T→G at 749 exon 6a 1 B8 Claustres et al. (1993) M265R T→G at 926 exon 6b 1 A2 Schwarz et al. (pers. comm.) R297W C→T at 1021 exon 7 1 C2 This study 1078delT deletion of T at 1078 exon 7 1 C2 Claustres et al. (1992) R334W C→T at 1132 exon 7 1 B1 Gasparini et al. (1991) R334L G→T at 1133 exon 7 1 D3 This study I336K T→A at 1139 exon 7 1 A2 Cuppens et al. (1993) R347H G→A at 1172 exon 7 3 D1 Cremonesi et al. (1992) L375F A→C at 1257 exon 8 1 B3 Jézéquel et al. (1996) ∆F508 deletion of 3 bp between 1652-1655 exon 10 57 B1 Kerem et al. (1989) G542X G→T at 1756 exon 11 2 B1 Kerem et al. (1990) R553X C→T at 1789 exon 11 1 A4 Cutting et al. (1990) L568F G→T at 1836 exon 12 1 B3 This study 2184insA insertion of A at 2184 exon 13 1 D3 Dörk et al. (1994b) 2789+5 G→A G→A at 2789+5 intron 14b 4 D3 Highsmith et al. (1997) R933S A→T at 2931 exon 15 1 n.p. Login to comment
137 Complex alleles are indicated a One CF allele with R75X and 125G→C b One CBAVD allele with R75Q and R933S c One CBAVD allele with 5T and Q1352H d Two CF alleles with F508C and S1251N e One CF allele with 1716G→A and L619S f G576A and R668C were linked on two CBAVD and three CF alleles, whereas two additional CF alleles carried R668C together with the 3849+10kB C→T mutation (Dörk and Stuhrmann 1995) 371 Table 3 CFTR mutation genotypes in 106 males with CAVD Genotype PolyT Frequency Ethnic descent Diagnosis ∆F508/R117H 9/7 21 German, Austrian 20 CBAVD, 1 CUAVD ∆F508/5T 9/5 9 German, Austrian 8 CBAVD, 1 CUAVD ∆F508/F508C 9/7 3 German CBAVD ∆F508/R347H 9/9 2 German CBAVD ∆F508/1716 G→A 9/7 2 German CBAVD ∆F508/3272-26 A→G 9/7 2 German CBAVD ∆F508/E56K 9/7 1 German CBAVD ∆F508/M265R 9/7 1 German-Portuguese CBAVD ∆F508/R334W 9/9 1 German CBAVD ∆F508/T351S 9/9 1 German CBAVD ∆F508/L375F 9/7 1 Volga German CBAVD ∆F508/G576A & R668C 9/7 1 German CBAVD ∆F508/R933S 9/7 1 German CBAVD ∆F508/L997F 9/9 1 German CBAVD ∆F508/Y1032C 9/7 1 German CBAVD ∆F508/D1152H 9/7 1 German CBAVD ∆F508/K1351E 9/7 1 German CBAVD ∆F508/D1377H 9/7 1 Portuguese CBAVD ∆F508/L1388Q 9/7 1 German CBAVD ∆F508/unknown 9/7 4 German 3 CBAVD, 1 CUAVD 5T/5T 5/5 2 German CBAVD 5T/G542X 5/9 2 German, Turkish CBAVD 5T/D58N 5/7 1 Lebanese CBAVD 5T/̃L138 5/7 1 German-Polish CBAVD 5T/1078delT 5/7 1 German CBAVD 5T/R553X 5/7 1 German CBAVD 5T/2184insA 5/7 1 Turkish CBAVD 5T/D979A 5/7 1 Vietnamese CBAVD 5T/D1152H 5/7 1 Turkish CBAVD 5T/3659delC 5/7 1 German CBAVD 5T/S1235R 5/7 1 Greek CBAVD 5T/W1282X 5/7 1 German CBAVD 5T & Q1352H/ R297W & Q1352H 5/7 1 Vietnamese CBAVD 5T/unknown 5/7 1 German CBAVD R117H/L206W 7/9 1 German CBAVD R117H/2789+5 G→A 7/7 1 German CBAVD R117H/unknown 7/7 1 German CBAVD 2789+5 G→A/2789+5 G→A 7/7 1 Lebanese CBAVD 2789+5 G→A/L973F 7/7 1 German CBAVD V938G/V938G 7/7 1 Greek CBAVD V938G/174delA 7/7 1 German CBAVD D110H/D110H 7/7 1 Turkish CBAVD R334L/I336K 7/7 1 German CBAVD R347H/N1303K 9/9 1 German CBAVD L568F/D1152H 7/7 1 Turkish CBAVD 3272-26 A→G/V1153E 7/7 1 German CBAVD R75Q/unknown 7/7 1 German CBAVD A120T/unknown 9/7 1 German CBAVD 1716G→A/unknown 7/7 1 German CBAVD G576A & R668C/unknown 7/7 1 German CBAVD 2752-15 C→G/unknown 7/7 1 Iranian CBAVD Unknown/unknown 17 German, Turkish 7 CBAVD and 1 CUAVD without observed renal agenesis, 9 CBAVD with renal agenesis allele and the R297W mutation on a homozygous Q1352H background may then reduce CFTR function to a disease-causing level. Login to comment
145 Maldigestion 13 25 5T/D58N 184 99 55 - 14 34 5T/̃L138 177 80 53 - 15 33 5T/1078delT 187 87 56 Recurrent bronchitis 16 31 5T/G542X 181 85 79 - 17 31 5T/2184insA n.d. n.d. 60 Borderline pancreatic sufficiency 18 31 5T/D979A n.d. n.d. 55 Recurrent infections, FEVI 76% 19 29 5T/D1152H n.d. n.d. 57 - 20 32 5T/W1282X 180 76 n.d. Recurrent infections, nasal polyposis 21 37 5T/unknown 180 74 n.d. Nasal polyposis 22 28 D110H/D110H 175 80 n.d Asthma bronchiale, obstipation 23 33 R334L/I336K 170 65 n.d. Recurrent infections, nasal polyposis, maldigestion, salt depletion episodes 24 35 N1303K/R347H 167 77 93 - 25 30 V938G/174delA n.d. n.d. 42 - 26 29 V938G/V938G 197 115 n.d. Asthma bronchiale Fig.2 Spectrum of CFTR mutation genotypes in CF patients (left) and in patients with congenital absence of the vas deferens (right). Login to comment

PMID: 15130785 [PubMed] Gong X et al: "Maximization of the rate of chloride conduction in the CFTR channel pore by ion-ion interactions."

No. Sentence Comment

35 Results and discussion Previously we characterized the properties of six different R334 mutants (R334C, R334E, R334H, R334K, R334L, and R334Q) [19]. Login to comment
65 (A) Unitary current-voltage relationships for each of the channel variants shown in Fig. 1: (d) wild type, (r) R334C, (j) R334E, (}) R334H, (s) R334K, () R334L, (.) Login to comment
98 Interestingly, three of these mutations-R334L, R334Q, and R334W-have been identified in cystic fibrosis patients [29]. Login to comment

PMID: 16635477 [PubMed] Lucarelli M et al: "A 96-well formatted method for exon and exon/intron boundary full sequencing of the CFTR gene."

No. Sentence Comment

139 In this work, we found a limited subset of 13 mutations (not included in the PCR/OLA/SCS assay) in 7 CFTR exons, significantly improving the sensitivity of standard assays: D110H, R117C, and H139R (exon 4); R334L, T338I, and A349V (exon 7); S549R(A->C) (exon 11); Y849X (exon 14a); L997F (exon 17a); L1065P, R1066C, and L1077P (exon 17b); and G1244E (exon 20). Login to comment

PMID: 24727426 [PubMed] Wang Y et al: "Understanding how cystic fibrosis mutations disrupt CFTR function: from single molecules to animal models."

No. Sentence Comment

2002 Mutation of R334, including the CF mutations R334L and R334Q, transformed the current-voltage (I-V) relationship of CFTR from linear (or quasi-linear, see Cai et al., 2003) to strongly inwardly rectifying (Smith et al., 2001; Gong and Linsdell, 2003). Login to comment

PMID: 25910067 [PubMed] Lucarelli M et al: "A Genotypic-Oriented View of CFTR Genetics Highlights Specific Mutational Patterns Underlying Clinical Macrocategories of Cystic Fibrosis."

No. Sentence Comment

370 991del5 c.859_863delAACTT CF-PI nd p.Asn287LysfsX19 L320V c.958T>G uncertain: CF-PI and/or CF-PS and/or CFTR-RD nd p.Leu320Val R334W c.1000C>T CF-PI,CF-PS CF-causing p.Arg334Trp R334L c.1001G>T CF-PS nd p.Arg334Leu T338I c.1013C>T CF-PS,CFTR-RD,CBAVD CF-causing p.Thr338Ile R347P c.1040G>C CF-PI,CF-PS CF-causing p.Arg347Pro R347H c.1040G>A CF-PS CF-causing p.Arg347His [M348K;S912X] c. Login to comment