ABCMdb

PMID: 10453741

Wagner JA, Vassilakis A, Yee K, Li M, Hurlock G, Krouse ME, Moss RB, Wine JJ
Two novel mutations in a cystic fibrosis patient of Chinese origin.
Hum Genet. 1999 Jun;104(6):511-5., [PubMed]

Sentences

No. Mutations Sentence Comment

5 ABCC7 p.Gly970Asp In exon 16, mutation 3041G→A causes the missense change G970D. Login to comment 6 ABCC7 p.Gly970Asp Functional analysis using an isotopic flux assay indicated that the G970D mutation retains partial function; western blotting indicated that the protein is glycosylated. Login to comment 32 ABCC7 p.Gly970Asp Functional analysis G970D was evaluated by introducing the change into human CFTR cDNA using the Stratagene (La Jolla, Calif.) Login to comment 62 ABCC7 p.Gly970Asp Exon 16 was heterozygous for 3041G→A, which converts the codon GGT to GAT and causes the missense 512 Table 1 Primer sequences used to amplify specific CFTR exons Exon Name Base Sequence (5'-3') pair 1 SO-006 204 TTGAGCGGCAGGCACCCAG SO-007 ACACGCCCTAATCTTTCGTG 2 SO-093 178 AGTGAATATCTCTTCCTCCTC SO-094 TTTCTCTTCAACTAAACAATGT 4 SO-016 369 TGTGTTGAAATTCTCAGGGT SO-017 CAGAATATATGTGCCATGGG 5 SO-087 185 ATTATCTAACTTTCCATTTTT SO-88 ACTCCGCCTTTCTTCCAGTTGTA 14a SO-101 200 ATTCTTTTATTCAGGAGTGC SO-102 CCAAACTATCTTAATTTAACTTTA 14b SO-099 203 GGAGGAATAGGTGAAGATGT SO-100 TGGGAGAAATGAAACAAAGT 15 SO-023 485 GTGCATGCTCTTCTAATGCA SO-024 AAGGCACATGCCTCTGTGCA 16 SO-89 191 TGTGATCCAAACTTAGTATTG SO-90 CTTAACGGTACTTATTTTTACA 17a SO-091 199 CATGTTTTCTTTGATCTTACAG SO-092 TGAGTATCGCACATTCACTG 18 SO-097 188 AGGTTCATTTACGTCTTTTG SO-098 ACTTTGTTACTTGTCTGAATTT 23 SO-108 190 ATTACAAGGGCAATGAGATC SO-087 ATTATCTAACTTTCCATTTTT change G970D (Fig.2). Login to comment 63 ABCC7 p.Gly970Asp ABCC7 p.Gly970Arg G970D is a novel mutation, but G970R was reported previously in a single Belgian patient (Cuppens et al. 1993). Login to comment 65 ABCC7 p.Gly970Asp ABCC7 p.Gly970Asp ABCC7 p.Gly970Asp Physiological analysis of G970D To determine whether partial function of G970D might explain this subject`s spared pancreatic function, we made a G970D construct using site-directed mutagenesis, expressed it in HEK cells and assayed for CFTR function using an iodide efflux assay. Login to comment 67 ABCC7 p.Gly970Asp As shown in Fig.3, efflux from cells transfected with the G970D construct was significantly reduced relative to that seen in cells transfected with WT CFTR, but was significantly elevated in comparison with control cells transfected with vector alone. Login to comment 71 ABCC7 p.Gly970Asp We used a western assay to compare G970D with WT CFTR, the M470V polymorphism, and ∆F508. Login to comment 75 ABCC7 p.Gly970Asp B Chromatogram to illustrate heterozygosity for G/A at position 3041(N) in exon 16, giving rise to G970D. Login to comment 79 ABCC7 p.Gly970Asp ABCC7 p.Gly970Asp Asterisks above the points for G970D indicate a significant difference from WT; asterisks below the points indicate a significant difference from vector (P < 0.05); bars are SEM Fig.4 Western blot analysis of G970D CFTR protein. Login to comment 81 ABCC7 p.Gly970Asp ABCC7 p.Gly970Asp The four lanes represent wild type CFTR and the M470V polymorphism (positive controls), ∆F508 (a negative control showing no processing to fully glycosylated CFTR), and G970D Based on this assay, processing of G970D was affected somewhat relative to WT (Fig.), but not more than the common polymorphism M470V. Login to comment 95 ABCC7 p.Gly970Asp The 8-bp deletion is expected to eliminate all functional CFTR expressed from that chromosome, whereas G970D retains partial function. Login to comment 96 ABCC7 p.Gly970Asp ABCC7 p.Gly970Arg Mutation G970D affects the same codon as the previously reported G970R (Cuppens et al. 1993). Login to comment 97 ABCC7 p.Ser945Leu ABCC7 p.His949Tyr G970 lies within the third cytoplasmic loop of CFTR (residues 933- 990, between TMD 6 and 7), as do the CF-causing mutations, S945L (Claustres et al. 1993) and H949Y (Ghanem et al. 1994). Login to comment 98 ABCC7 p.Ser945Leu ABCC7 p.Gly970Arg ABCC7 p.His949Tyr Seibert et al. (1996) examined all three point mutations in the third cytoplasmic loop and determined that S945L and H949Y are trafficking mutations, while G970R is trafficked normally, but shows significantly reduced function when tested with an iodide efflux assay. Login to comment 99 ABCC7 p.Gly970Arg Single channel recordings indicated that the open probability of G970R was reduced as a result of a significantly reduced mean burst duration. Login to comment 100 ABCC7 p.Gly970Arg ABCC7 p.Gly970Arg To help shed light on the structural basis for reduced function of G970R, Seibert et al. (1996) mutated the glycine at position 970 to arginine, alanine, methionine, glutamic acid or lysine. Login to comment 102 ABCC7 p.Gly970Asp ABCC7 p.Gly970Glu Of interest, they found that the peak efflux for the construct G970E was about half that of WT, which is very similar to our result for the natural mutation G970D. Login to comment 105 ABCC7 p.Gly970Asp ABCC7 p.Gly970Asp Pancreatic sufficiency could presumably arise from the residual Cl-channel function of G970D CFTR, or from a residual ability to regulate chloride/bicarbonate transport (Lee et al. 1999). Login to comment 106 ABCC7 p.Gly970Asp The relatively large efflux observed for G970D (approximately 50% of WT) is probably an overestimate of function. Login to comment 132 ABCC7 p.Tyr569Asp ABCC7 p.Gln98* Hum Mutat 9:136-147 Malone G, Haworth A, Schwarz MJ, Cuppens H, Super M (1998) Detection of five novel mutations of the cystic fibrosis transmembrane regulator (CFTR) gene in Pakistani patients with cystic fibrosis: Y569D, Q98X, 296+12(T>C), 1161delC and 621 + 2 (T>C). Login to comment