ABCMdb

ABCC1 p.Arg723Gln

ClinVar:	c.2168G>A , p.Arg723Gln ? , Uncertain significance
Predicted by SNAP2:	A: D (91%), C: D (91%), D: D (95%), E: D (95%), F: D (95%), G: D (95%), H: D (95%), I: D (95%), K: D (59%), L: D (95%), M: D (91%), N: D (95%), P: D (95%), Q: D (59%), S: D (95%), T: D (95%), V: D (91%), W: D (95%), Y: D (95%),
Predicted by PROVEAN:	A: D, C: D, D: D, E: N, F: D, G: D, H: D, I: D, K: N, L: D, M: D, N: N, P: D, Q: N, S: D, T: D, V: D, W: D, Y: D,

[switch to compact view]
Comments [show]

None has been submitted yet.

Publications
[hide] Linkage disequilibrium and haplotype architecture ... Ann Hum Genet. 2004 Nov;68(Pt 6):563-73. Wang H, Hao B, Zhou K, Chen X, Wu S, Zhou G, Zhu Y, He F
Linkage disequilibrium and haplotype architecture for two ABC transporter genes (ABCC1 and ABCG2) in Chinese population: implications for pharmacogenomic association studies.
Ann Hum Genet. 2004 Nov;68(Pt 6):563-73., [PMID:15598215]

Abstract [show]
Information about linkage disequilibrium (LD) patterns and haplotype structures for candidate genes is instructive for the design and analysis of genetic association studies for complex diseases and drug response. ABCC1 and ABCG2 are genes coding for two multidrug resistance (MDR) associated transporters; they are also related to some pathophysiological traits. To pinpoint the LD profiles of these MDR genes in Chinese, we systemically screened 27 unrelated individuals for single nucleotide polymorphisms (SNPs) in the coding and regulatory regions of these genes, and thereby characterized their haplotype structures. Despite marked variations in haplotype diversity, LD pattern and intragenic recombination intensity between the two genes, both loci could be partitioned into several LD blocks, in which a modest number of haplotypes accounted for a high fraction of the sampled chromosomes. We concluded that each locus has its own genomic LD profile, but that they still share a common segmental LD architecture with low haplotype diversity. Our data will benefit genetic association studies of complex traits and drug response possibly related to these genes.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
57 SNP Nucleotide sequence Minor allele dbSNP ID effect position (major/minor) frequency (%) ABCC1 1 5`FR/-1862 gacccG/Aggcca 44.4 2 5`FR/-1830 atcctA/Gtctac 1.9 3 5`FR/-1680 gaggaG/Aaaaag 1.9 4 5`FR/-471 cggatA/Gctgtc 7.4 5 E2/218 caaaaC/Tcaaaa 3.7 Thr73Ile 6 I2/-26 gttgtG/Aggggg 1.9 rs8187842 7 I3/-66 ctgggT/Cgacaa 37.0 rs4148337 8 I7/+54 ccactC/Actgtg 9.3 rs903880 9 I7/+64 ggcctC/Gaatcc 48.1 rs246232 10 E8/816 cagccG/Agtgaa 1.9 wobble 11 E8/825 aaggtT/Cgtgta 38.9 rs246221 wobble 12 E9/1062 gtgaaT/Cgacac 35.2 rs35587 wobble 13 I9/+8 aggggA/Gcgctg 37.0 rs35588 14 I12/-37 cactcA/Ggggca 20.4 rs35604 15 E13/1684 tggccT/Ctgtgc 20.4 rs35605 wobble 16 I13/+105 ccggtC/Tgggct 20.4 rs35606 17 I14/+105 ccagcC/Tgcttg 1.9 18 I15/+627 gctgtA/Gtttta 25.8 rs35628 19 I15/+669 aatctG/Ttagaa 7.4* rs4148353 20 I15/-967 ctttcT/Ggctgt 37.0 rs152029 21 E16/2007 atcccC/Tgaagg 3.7 rs2301666 wobble 22 E17/2168 tctccG/Aagaaa 5.6 rs4148356 Arg723Gln 23 I18/-30 gcactG/Cacgtg 16.7 rs2074087 24 I22/+62 aattaT/Ctccct 27.8 rs3887893 25 I22/-43 gtcagC/Ttccct 3.7 26 E27/3915 gaggaC/Tctgga 1.9 wobble 27 E28/4002 aagtcG/Atccct 11.1 rs2239330 wobble 28 I28/-35 tcagcA/Gtgaca 27.8 rs212087 29 I30/+30 gcacaG/Atggcc 29.6 rs212088 30 3`UTR/+801 accccC/Gactcc 33.3 rs129081 noncoding 31 3`UTR/+866 tactgT/Atccca 14.8 rs212090 noncoding 32 3`FR/+1513 gttctT/Ctaagg 27.8 ABCG2 1 5`UTR/-407 cgcagC/Tgcctc 1.9 2 5`UTR/-376 ggggaG/Acgctc 1.9 3 E2/34 tcccaG/Atgtca 20.4 rs2231137 Val12Met 4 I2/+36 ttttaA/Gtttac 25.9 rs4148152 5 I3/+10 gtataA/Ggagag 20.4 rs2231138 6 E5/421 acttaC/Agttct 22.2 rs2231142 Gln141Lys 7 E7/805 acgggC/Tctgct 3.7 Pro269Ser 8 I9/-126 agccaT/Gtgagt 7.4 9 I11/+20 gttctA/Gggaac 31.5 rs2231153 10 I12/+49 cctatG/Tggtga 16.7 rs2231156 11 I13/+40 tgtttT/Ctttcc 24.1 rs2231157 12 I13/-21 tgactC/Tttagt 29.6 rs2231162 13 I14/-46 ttcttG/Aaaatt 48.1 rs2725267 SNPs in specific regions, i.e. 5`flanking region (5`FR), 5`untranslated region (5`UTR), intron (I), exon (E), 3`UTR, and 3`FR, are presented as region/+(-): for 5`FR and 5`UTR, n nucleotides upstream (-) from the translation initiation site; for 3`UTR and 3`FR, n nt downstream (+) from the third base of stop codon; for coding regions, n corresponds to positions of their cDNA with the first base of start codon set to 1; and for introns, n nt upstream (-) from 3` site or downstream (+) from 5` site of introns. Login to comment

[hide] Role of pharmacogenetics of ATP-binding cassette t... Pharmacol Ther. 2006 Nov;112(2):457-73. Cascorbi I
Role of pharmacogenetics of ATP-binding cassette transporters in the pharmacokinetics of drugs.
Pharmacol Ther. 2006 Nov;112(2):457-73., [PMID:16766035]

Abstract [show]
Interindividual differences of drug response are an important cause of treatment failures and adverse drug reactions. The identification of polymorphisms explaining distinct phenotypes of drug metabolizing enzymes contributed in part to the understanding of individual variations of drug plasma levels. However, bioavailability also depends on a major extent from the expression and activity of drug transport across biomembranes. In particular efflux transporters of the ATP-binding cassette (ABC) family such as ABCB1 (P-glycoprotein, P-gp), the ABCC (multidrug resistance-related protein, MRP) family and ABCG2 (breast cancer resistance protein, BCRP) have been identified as major determinants of chemoresistance in tumor cells. They are expressed in the apical membranes of many barrier tissue such as the intestine, liver, blood-brain barrier, kidney, placenta, testis and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics and clinical outcome of a variety of drugs. This review focuses on the functional significance of single nucleotide polymorphisms (SNP) of ABCB1, ABCC1, ABCC2, and ABCG2 in in vitro systems, in vivo tissues and drug disposition, as well as on the clinical outcome of major indications.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
830 A thorough investigation on the functional significance of 10 non-synonymous SNP, leading to amino acid changes C43S, T73I, S92F, T117; R230Q, R633Q, R723Q, A989T, C1047S. Login to comment
852 Table 5 Frequency of ABCC1 genetic variants in different populations, position on DNA, putative effect, and frequencies (according to Le Saux et al., 2000; Ito et al., 2001; Moriya et al., 2002; Conrad et al., 2002; Oselin et al., 2003b; Wang et al., 2004) Position/ Nucleotide Aminoacid or effect Orientals Caucasians Function 128G>C C43S 0.01 - elevateda 218C>T T73I 0.00-0.04 - 257C>T S92F 0.00 0.00 decreaseda 350C>T T117M - 0.02 (decreased)a 689G>A R230N 0.00 0.00 (decreased)a 816G>A synonymous - 0.04 825T>C synonymous - 0.30 1057G>A V353M 0.00 0.005 elevateda 1299G>T R433S - 0.01 elevated Vmax of doxorubicin, decreased transport of LTC4 a,b 1684T>C synonymous - 0.80 1898G>A R633Q - 0.01 (decreased)a 2012G>T G671V - 0.03 doxorubicine-induced cardiomyopathyc 2168G>A R723Q 0.01-0.07 - decreaseda 2965G>A A989T 0.00 0.005 (decreased)a 3140G>C C1047S 0.00 0.00 3173G>A R1058Q 0.01 - 4002G>A synonymous - 0.28 4535C>T S1512L - 0.03 decreaseda a Letourneau et al. (2005). Login to comment

[hide] Pharmacogenomics of MRP transporters (ABCC1-5) and... Drug Metab Rev. 2008;40(2):317-54. Gradhand U, Kim RB
Pharmacogenomics of MRP transporters (ABCC1-5) and BCRP (ABCG2).
Drug Metab Rev. 2008;40(2):317-54., [PMID:18464048]

Abstract [show]
Elucidation of the key mechanisms that confer interindividual differences in drug response remains an important focus of drug disposition and clinical pharmacology research. We now know both environmental and host genetic factors contribute to the apparent variability in drug efficacy or in some cases, toxicity. In addition to the widely studied and recognized genes involved in the metabolism of drugs in clinical use today, we now recognize that membrane-bound proteins, broadly referred to as transporters, may be equally as important to the disposition of a substrate drug, and that genetic variation in drug transporter genes may be a major contributor of the apparent intersubject variation in drug response, both in terms of attained plasma and tissue drug level at target sites of action. Of particular relevance to drug disposition are members of the ATP Binding Cassette (ABC) superfamily of efflux transporters. In this review a comprehensive assessment and annotation of recent findings in relation to genetic variation in the Multidrug Resistance Proteins 1-5 (ABCC1-5) and Breast Cancer Resistance Protein (ABCG2) are described, with particular emphasis on the impact of such transporter genetic variation to drug disposition or efficacy.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
71 Letourneau et al. (2005) studied the influence of 10 non-synonymous variations (Thr73Ile, Ser92Phe, Thr117Met, Arg230Gln, Arg633Gln, Arg723Gln, Ala989Thr, Cys1047Ser, Arg1056Gln, and Ser1512Leu) on MRP1 expression using membrane vesicles isolated from transfected cells and assesed transport activity for 3 known MRP1 substrates (LTC4, estradiol-17-β-glucuronide, and methotrexate). Login to comment
81 MRP1 (ABCC1) NH2 NBD NBD in out Membrane Cys43Ser Ser92Phe Thr117Met Arg230Gln Val353Met Arg633Gln Gly671Val Arg723Gln Arg433Ser Ala989Thr Cys1047Ser Val1146Ile Arg1058Gln Thr1401Met Ser1512Leu Thr73Ile COOH NBD NBD COOH NBD COOH NBD NBD Table1MRP1(ABCC1)singlenucleotidepolymorphisms.Location,allelefrequencyandfunctionaleffects. Positionin codingsequence Aminoacid exchangeLocation Allelefrequency EffectNCBIIDReferenceAfCaJpothers 128G>CCys43SerExon2--1[1]-Decreaseinvincristineresistance[2]rs41395947 Disruptedplasmamembranetraffickingin transfectedcells[2] 218C>TThr73IleExon2--1[1]3.7Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] rs41494447 257C>TSer92PheExon30a 0a 0a 0Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] 350C>TThr117MetExon3-100[5]--Noinfluenceonexpressionandtransportin membranevesicles[4] 689G>AArg230GlnExon70a 0a 0a 0Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4] 1057G>AVal353MetExon90a 0.5a 0a -- 1299G>TArg433SerExon10-1.4[6]--Changesintransportandresistance[7] 1898G>AArg633GlnExon13-[8]--Noinfluenceonexpressionandtransportin membranevesicles[4] 2012G>TGly671ValExon16-2.8[6]--Noinfluenceonexpressionandtransportin membranevesicles[6] Associatedwithanthracycline-induced cardiotoxicity[9] 2168G>AArg723GlnExon17--7.3[1]5.6Chinese[3]Noinfluenceonexpressionandtransportin membranevesicles[4]noinfluenceonmRNA expressioninenterocytes(n=1)[10] rs4148356 2965G>AAla989ThrExon220a 0.5a 0a -Noinfluenceonexpressionandtransportin membranevesicles(non-significantreduction inE17βGtransport)[4] 323 3140G>CCys1047SerExon234.5a 0a 0a -Noinfluenceonexpressionandtransportin membranevesicles[4] rs13337489 3173G>AArg1058GlnExon23--1[1]-Noinfluenceonexpressionandtransportin membranevesicles[4] rs41410450 3436G>AVal1146IleExon24-----rs28706727 4102C>TThr1401MetExon29-----rs8057331 4535C>TSer1512LeuExon31-[5]--Noinfluenceonexpressionandtransportin membranevesicles[4] ReferencewithoutfrequencymeansthatSNPwasdetectedbutnofrequencydetermined. Login to comment

[hide] Pharmacogenetics of ATP-binding cassette transport... Methods Mol Biol. 2010;596:95-121. Cascorbi I, Haenisch S
Pharmacogenetics of ATP-binding cassette transporters and clinical implications.
Methods Mol Biol. 2010;596:95-121., [PMID:19949922]

Abstract [show]
Drug resistance is a severe limitation of chemotherapy of various malignancies. In particular efflux transporters of the ATP-binding cassette family such as ABCB1 (P-glycoprotein), the ABCC (multidrug resistance-associated protein) family, and ABCG2 (breast cancer resistance protein) have been identified as major determinants of chemoresistance in tumor cells. Bioavailability depends not only on the activity of drug metabolizing enzymes but also to a major extent on the activity of drug transport across biomembranes. They are expressed in the apical membranes of many barrier tissues such as the intestine, liver, blood-brain barrier, kidney, placenta, testis, and in lymphocytes, thus contributing to plasma, liquor, but also intracellular drug disposition. Since expression and function exhibit a broad variability, it was hypothesized that hereditary variances in the genes of membrane transporters could explain at least in part interindividual differences of pharmacokinetics of a variety of anticancer drugs and many others contributing to the clinical outcome of certain leukemias and further malignancies.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
134 A thorough investigation on the functional significance of ten nonsynonymous SNPs, leading to amino acid changes C43S, T73I, S92F, T117; R230Q, R633Q, R723Q, A989T, C1047S. Login to comment
155 ABCC2 (Multidrug Resistance-Associated Protein 2) Table 6.5 Frequency of ABCC1 genetic variants in different populations, position on DNA, putative effect, and frequencies (according to (33, 77-80, 136)) Position Amino acid or effect Orientals Caucasians Function c.128G>C C43S 0.01 - Elevateda c. 218C>T T73I 0.00-0.04 - c. 257C>T S92F 0.00 0.00 Decreaseda c. 350C>T T117M - 0.02 (Decreased)a c. 689G>A R230N 0.00 0.00 (Decreased)a c. 816G>A Synonymous - 0.04 c. 825T>C Synonymous - 0.30 c. 1057G>A V353M 0.00 0.005 Elevateda c. 1299G>T R433S - 0.01 Elevated vmax of doxorubicin, decreased transport of LTC4 a,b c. 1684T>C Synonymous - 0.80 c. 1898G>A R633Q - 0.01 (Decreased)a c. 2012G>T G671V - 0.03 Doxorubicine-induced cardiomyopathyc c. 2168G>A R723Q 0.01-0.07 - Decreaseda c. 2965G>A A989T 0.00 0.005 (Decreased)a c. 3140G>C C1047S 0.00 0.00 c. 3173G>A R1058Q 0.01 - c. 4002G>A Synonymous - 0.28 c. 4535C>T S1512L - 0.03 Decreaseda References: a [81], b [77], c [84] an inducible expression of ABCC2, which contributes also to the phenomenon of drug resistance. Login to comment

[hide] Pharmacogenetics of membrane transporters: an upda... Mol Biotechnol. 2010 Feb;44(2):152-67. Sissung TM, Baum CE, Kirkland CT, Gao R, Gardner ER, Figg WD
Pharmacogenetics of membrane transporters: an update on current approaches.
Mol Biotechnol. 2010 Feb;44(2):152-67., [PMID:19950006]

Abstract [show]
This review provides an overview of the pharmacogenetics of membrane transporters including selected ABC transporters (ABCB1, ABCC1, ABCC2, and ABCG2) and OATPs (OATP1B1 and OATP1B3). Membrane transporters are heavily involved in drug clearance and alters drug disposition by actively transporting substrate drugs between organs and tissues. As such, polymorphisms in the genes encoding these proteins may have significant effects on the absorption, distribution, metabolism and excretion of compounds, and may alter pharmacodynamics of many agents. This review discusses the techniques used to identify substrates and inhibitors of these proteins and subsequently to assess the effect of genetic mutation on transport, both in vitro and in vivo. A comprehensive list of substrates for the major drug transporters is included. Finally, studies linking transporter genotype with clinical outcomes are discussed.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
67 Those studied include C43S, T73I, S92F, T117M, R230Q, V353M, R433S, R633Q, G671V, R723Q, A989T, C1047S, R1058Q, A1337T, and S1512L. Login to comment

[hide] Polymorphism of the ABC transporter genes, MDR1, M... Pharmacogenetics. 2001 Mar;11(2):175-84. Ito S, Ieiri I, Tanabe M, Suzuki A, Higuchi S, Otsubo K
Polymorphism of the ABC transporter genes, MDR1, MRP1 and MRP2/cMOAT, in healthy Japanese subjects.
Pharmacogenetics. 2001 Mar;11(2):175-84., [PMID:11266082]

Abstract [show]

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
32 Four of the 16 mutations were associated with an amino acid substitution; G to C transversion at position 128 (G128C, Cys to Ser at codon 43) in exon 2, C to T at 218 (C218T, Thr to Ile at 73) in exon 2, G to A at 2168 (G2168A, Arg to Gln at 723) in exon 17 and G to A at 3173 (G3173A, Arg to Gln at 1058) in exon 23 (position numbering from Grant et al., 1997) (Fig. 2). Login to comment
63 In the MRP1 gene, we identi®ed four missense mutations, G128C (Cys43Ser), C218T (Thr73Ile), G2168A (Arg723Gln) and G3173A (Arg1058Gln). Login to comment
67 Frequencies of mutations in the MRP1 gene in a Japanese population (n 48) Primer pair Location Nucleic acid Nucleotide sequence Amino acid Genotype Allele frequency substitutiona substitution Wild-type Mutation w/w w/m m/m w m MR12/1 Exon 2 G128C gccttGttttt gccttCttttt Cys43Ser 47 1 0 0.990 0.010 MR12/1 Exon 2 C218T caaaaCcaaaa caaaaTcaaaa Thr73Ile 47 1 0 0.990 0.010 MR18/1 Exon 8 T825C aaggtTgtgta aaggtCgtgta Val275Val 18 24 6 0.625 0.375 MR19/1 Exon 9 T1062C gtgaaTgacac gtgaaCgacac Asn354Asn 17 28 3 0.646 0.354 MR113/1 Exon 13 T1684C tggccTtgtgc tggccCtgtgc Leu562Leu 31 15 2 0.802 0.198 MR116/1 Exon 16 C2007T atcccCgaagg atcccTgaagg Pro669Pro 40 8 0 0.917 0.083 MR117/1 Exon 17 G2168A tctccGagaaa tctccAagaaa Arg723Gln 41 7 0 0.927 0.073 MR120/1 Exon 20 C2665T gcggtCcaggg gcggtTcaggg Pro889Pro 47 1 0 0.990 0.010 MR120/1 Exon 20 T2694C gagaaTggcat gagaaCggcat Asn898Asn 47 1 0 0.990 0.010 MR123/1 Exon 23 G3173A cctgcGgtcac cctgcAgtcac Arg1058Gln 47 1 0 0.990 0.010 MR128/1 Exon 28 G4002A aagtcGtccct aagtcAtccct Ser1334Ser 36 9 3 0.844 0.156 MR131/1 Exon 31 C4524T gagtaCggcgc gagtaTggcgc Tyr1508Tyr 47 1 0 0.990 0.010 MR19/1 Intron 9 A12188G aggggAcgctg aggggGcgctg ± 17 28 3 0.646 0.354 MR112/1 Intron 11 C1474À48T atgggCtgatc atgggTtgatc ± 44 3 1 0.948 0.052 MR119/1 Intron 18 C2461À30G gcactCacgtg gcactGacgtg ± 27 14 7 0.708 0.292 MR119/1 Intron 18 T2461À38C acacaTgtgca acacaCgtgca ± 41 7 0 0.927 0.073 The positions of the identi®ed polymorphisms correspond to positions of the MRP1 gene (Grant et al., 1997; EMBL/GenBank accession no. Login to comment

[hide] Identification of 779 genetic variations in eight ... J Hum Genet. 2002;47(4):147-71. Saito S, Iida A, Sekine A, Miura Y, Ogawa C, Kawauchi S, Higuchi S, Nakamura Y
Identification of 779 genetic variations in eight genes encoding members of the ATP-binding cassette, subfamily C (ABCC/MRP/CFTR.
J Hum Genet. 2002;47(4):147-71., [PMID:12166651]

Abstract [show]
We screened DNAs from 48 Japanese individuals for single-nucleotide polymorphisms (SNPs) in eight genes encoding the ATP-binding cassette, subfamily C (ABCC/ MRP/CFTR), by direct sequencing of their entire genomic regions, except repetitive sequence elements. This approach identified 688 SNPs and 91 insertion/deletion polymorphisms among the eight genes. Of the 688 SNPs, 81 were identified in the ABCC1 gene, 41 in ABCC2, 30 in ABCC3, 230 in ABCC4, 76 in ABCC5, 58 in CFTR, 102 in ABCC8. and 70 in ABCC9. Six SNPs were located in the 5' flanking regions, 617 in introns, 46 in exons, and 19 in the 3' flanking regions. These variants should contribute to studies that investigate possible correlations of genotypes with disease-susceptibility phenotypes and responsiveness or adverse effects to drugs.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
59 Among the six novel nonsynonymous polymor- Fig.1a-h.Continued Fig. 1a-h. Continued phisms, three SNPs (Cys171Gly and Glu757Lys in ABCC4, and Val560Met in ABCC8) present in the transmembrane domain and one SNP (Arg723Gln in ABCC1) in the nucleotide-binding domain may influence the function of the gene products and could have phenotypic consequences. Login to comment
72 A longer Fig. 1a-h. Continued Fig. 1a-h. Continued Fig. 1a-h. Continued Table 2a. Summary of genetic variations detected in the ABCC1 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -1661 A/G 2 Intron 2 601 G/A rs215109 3 Intron 2 635 T/C 4 Intron 2 4769 G/del 5 Intron 2 4834 G/A rs1472532 6 Intron 2 10069 T/C 7 Intron 2 11782 A/G rs215096 8 Intron 2 (11965-11984) (T)18-20 9 Intron 4 4302 T/G 10 Intron 4 4394 A/C 11 Intron 4 4524 T/C 12 Intron 5 409 G/A rs1967120 13 Intron 5 1759 C/G rs185005 14 Intron 5 1768 T/C rs246215 15 Intron 6 9045 G/A 16 Intron 7 208 G/A rs2062541 17 Intron 7 (3059-3071) (A)11-13 18 Intron 8 54 C/Ab rs903880 19 Intron 8 (886-889) GAAA/del 20 Intron 8 2420 C/T rs246230 21 Exon 9 16 T/C(Val275Val)c rs246221 22 Exon 10 22 T/C(Asn354Asn) rs35587 23 Intron 10 8 A/G rs35588 2a. Continued No. Location Positiona Genetic variation NCBI SNP ID 24 Intron 10 1940 C/G rs35591 25 Intron 10 1953 T/C rs35592 26 Intron 11 198 C/A 27 Intron 11 784 C/G 28 Intron 12 122 C/G 29 Intron 12 (3138-3148) (A)10-12 30 Intron 12 3197 G/A rs35595 31 Intron 12 3227 C/Tc 32 Intron 13 2060 T/C 33 Intron 13 (2061-2062) C/ins 34 Intron 13 7882 G/A rs35597 35 Intron 13 11776 G/A 36 Intron 13 11824 A/G rs35604 37 Exon 14 7 T/C(Leu562Leu)c rs35605 38 Intron 14 105 C/T rs35606 39 Intron 14 179 A/T 40 Intron 14 321 T/C rs35607 41 Intron 15 2754 G/C rs35620 42 Intron 15 3022 C/T rs35621 43 Intron 15 3980 C/T rs35625 44 Intron 16 219 G/T 45 Intron 16 310 C/T 46 Intron 16 357 G/T rs35626 47 Intron 16 513 G/A rs35627 48 Intron 16 848 A/G rs35628 49 Intron 16 890 G/T 50 Intron 16 1184 C/T rs35629 51 Exon 17 19 C/T(Pro669Pro) rs2301666 52 Intron 17 1171 G/A 53 Intron 17 1332 A/G 54 Exon 18 53 G/A(Arg723Gln) 55 Intron 19 293 T/C rs2074086 56 Intron 19 (3369-3374) (CA)2-3 57 Intron 19 3383 G/C rs207487 58 Intron 20 2730 C/T 59 Intron 20 2789 G/C 60 Intron 20 2919 C/T 61 Intron 20 3024 C/T 62 Intron 20 8716 G/A rs2239996 63 Intron 20 9718 A/C 64 Intron 20 9733 G/C 65 Intron 20 (9895-9896) AT/del 66 Intron 20 9952 G/A 67 Intron 20 11120 A/G 68 Intron 20 11147 G/A 69 Intron 20 (11629-11631) CTT/del 70 Intron 20 11864 C/T 71 Intron 21 3860 G/del 72 Intron 22 878 G/A 73 Intron 22 (4428-4445) (GGGGCT)3-4 74 Intron 23 62 T/C 75 Intron 24 3171 C/T 76 Intron 24 (3349-3368) (T)19-22 77 Intron 24 3369 T/C 78 Intron 24 3584 A/G 79 Intron 24 5322 T/G rs2238475 80 Exon 25 60 G/A(Pro1150Pro) 81 Intron 27 4539 G/A 82 Intron 28 179 G/A rs212011 83 Intron 28 1354 G/A rs212082 84 Intron 28 2150 G/A rs212083 85 Exon 29 36 G/A(Ser1334Ser)c rs2239330 86 Intron 29 1920 G/A rs212087 87 Intron 30 (1708-1714) (T)6-7 88 Intron 31 18 G/Ab rs212088 89 Exon 32 652 C/T(3ЈUTR) 90 Exon 32 910 C/G(3ЈUTR) rs129081 2b. Summary of genetic variations detected in the ABCC2 gene No. Location Positiona Genetic variation NCBI SNP ID 1 Exon 1 77 C/T(5ЈUTR) rs717620 2 Intron 1 413 A/C rs2756103 3 Intron 2 192 T/G 4 Intron 2 1020 G/C 5 Intron 2 3639 C/A 6 Intron 2 3930 A/G 7 Intron 2 3989 C/T 8 Intron 2 4078 T/C rs2145852 9 Intron 2 4171 C/T rs2756107 10 Intron 2 4257 G/A rs2145853 11 Intron 2 4436 C/G rs2180990 12 Intron 2 5227 A/G 13 Intron 2 5373 A/G 14 Intron 2 5538 G/T 15 Intron 3 772 A/T rs2073336 16 Intron 3 1145 C/T rs2804400 17 Intron 7 1658 G/T rs2756109 18 Exon 10 40 G/A(Val417Ile) rs2273697 19 Intron 11 1672 T/A 20 Intron 12 148 A/G rs2073337 21 Intron 13 180 G/C 22 Intron 13 1497 T/C rs2756114 23 Intron 15 169 T/C 24 Intron 15 949 A/G 25 Intron 15 984 A/C 26 Intron 16 4059 C/G 27 Intron 19 10899 G/A 28 Exon 22 51 G/A(Ser978Ser) 29 Intron 23 56 C/T 30 Intron 23 432 G/A 31 Intron 23 734 G/A 32 Intron 23 801 T/G 33 Intron 26 154 T/C 34 Intron 27 124 C/G 35 Exon 28 52 A/C(Lys1299Gln) 36 Exon 28 84 C/T(Tyr1309Tyr) 37 Exon 28 129 C/T(Ile1324Ile) 38 Intron 29 154 A/G 39 Intron 30 91 T/C 40 Intron 31 170 A/G 41 3ЈFlanking 371 C/T rs12826 ABCC2, ATP-binding cassette, subfamily C, member2 Table 2a. Continued No. Location Positiona Genetic variation NCBI SNP ID 91 Exon 32 975 T/A(3ЈUTR) rs212090 92 3ЈFlanking 158 G/A 93 3ЈFlanking (187-199) (T)11-13 94 3ЈFlanking 378 T/C rs212091 95 3ЈFlanking 2227 G/A ABCC1, ATP-binding cassette, subfamily C, member1; NCBI, National Center for Biotechnology Information; SNP, single-nucleotide polymorphism; UTR, untranslated region; del, deletion; ins, insertion a For SNPs in the 5Ј flanking region, intron region, or 3Ј flanking region, nucleotide positions are counted from the first intronic nucleotide at the exon/intron junction (for SNPs in the exon region, nucleotide positions are counted from the first exonic nucleotide at the exon/intron junction) b SNPs previously reported by Conrad et al. (2001) c SNPs previously reported by Ito et al. (2001) 2c. Summary of genetic variations detected in the ABCC3 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -1064 C/T 2 5ЈFlanking -(827-820) (C)7-8 3 Intron 1 1226 T/G 4 Intron 1 (1389-1399) (A)10-12 5 Intron 1 2070 C/T 6 Intron 1 4378 A/G rs1548529 7 Intron 1 4477 G/A 8 Intron 1 6189 T/C 9 Intron 2 268 G/A 10 Intron 2 376 G/C 11 Intron 2 446 C/T 12 Intron 3 166 G/A rs2301836 13 Intron 5 206 G/A rs739923 14 Intron 6 432 G/C rs733393 15 Intron 6 546 G/A rs733392 16 Intron 7 1132 C/G rs1978153 17 Intron 7 1537 C/T rs2301837 18 Intron 8 2323 C/G 19 Intron 12 85 C/del 20 Intron 14 257 T/C rs879459 21 Intron 18 303 G/A rs2240801 22 Intron 19 1581 C/T 23 Intron 20 29 C/T rs2072365 24 Intron 20 53 G/A rs2072366 25 Exon 22 180 C/T(Gly1013Gly) 26 Intron 23 1053 G/A rs2240802 27 Intron 24 84 C/T rs967935 28 Exon 27 135 C/T(His1314His) rs2277624 29 Intron 28 412 T/C rs872793 30 Intron 30 1979 C/G 31 Intron 30 2340 A/G 32 Exon 31 34 A/G(Glu1503Glu) rs1051640 33 3ЈFlanking (555-558) AAGA/del 34 3ЈFlanking 1455 G/A 35 3ЈFlanking (1650-1659) (A)9-11 ABCC3, ATP-binding cassette, subfamily C, member3 Table 2d. Summary of genetic variations detected in the ABCC4 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -644 C/T 2 5ЈFlanking -527 C/G rs869951 3 Exon 1 67 C/T(5ЈUTR) 4 Intron 1 (864-865) CT/del 5 Intron 1 21255 A/G 6 Intron 1 21503 T/C 7 Intron 1 21900 C/G 8 Intron 1 22005 C/T 9 Intron 1 (22256-22264) (T)8-9 10 Intron 1 27784 C/G 11 Intron 1 27821 A/T 12 Intron 1 27837 A/G 13 Intron 1 27880 C/T 14 Intron 1 40310 A/T 15 Intron 1 40372 G/A 16 Intron 1 40413 G/A 17 Intron 1 40958 A/G 18 Intron 1 50060 G/A 19 Intron 2 181 G/T 20 Intron 2 254 G/A 21 Intron 2 290 T/C 22 Intron 2 543 T/C 23 Intron 3 557 G/A 24 Intron 3 718 G/A 25 Intron 3 801 G/A 26 Intron 3 1022 T/C 2d. Continued No. Location Positiona Genetic variation NCBI SNP ID 27 Intron 3 1471 A/G 28 Intron 3 1490 G/A 29 Intron 3 (1833-1834) G/ins 30 Intron 3 1870 G/A 31 Intron 3 1927 G/A 32 Intron 3 1970 A/T 33 Intron 3 2039 T/C 34 Intron 3 (2067-2068) CTTT/ins 35 Intron 3 3563 G/A 36 Intron 3 3696 C/G 37 Intron 3 4093 T/C 38 Intron 3 4097 T/del 39 Intron 3 9724 A/G 40 Intron 3 9988 G/A 41 Intron 3 10952 A/G 42 Intron 3 11125 A/G 43 Intron 3 11244 C/del 44 Intron 3 11916 A/del 45 Intron 3 12047 A/G 46 Exon 4 205 T/G(Cys171Gly) 47 Intron 4 (412-414) GTT/del 48 Intron 4 -(9757-9756) T/ins 49 Intron 4 -6373 C/G 50 Intron 4 -6267 T/C 51 Intron 4 -6097 T/C 52 Intron 4 -6057 C/T 53 Intron 4 -5295 A/G 54 Intron 4 -803 C/T 55 Intron 4 -745 C/T rs1678400 56 Intron 4 -736 C/T 57 Intron 4 -728 C/T 58 Intron 4 -624 A/C 59 Intron 4 -470 C/T 60 Intron 4 -411 G/A 61 Intron 4 -323 C/T 62 Intron 4 -246 A/G 63 Intron 4 -199 C/T 64 Intron 4 -108 C/T rs899497 65 Intron 5 50 C/T rs899496 66 Intron 5 73 C/T 67 Intron 5 403 G/A 68 Intron 5 537 T/A rs943288 69 Intron 5 559 G/A rs873706 70 Intron 5 749 G/A rs873705 71 Intron 5 750 C/T rs899495 72 Intron 5 937 G/C 73 Intron 5 949 A/C rs2389203 74 Intron 5 965 G/C rs1678403 75 Exon 6 48 C/T(Ile223Ile) rs899494 76 Intron 6 150 C/T 77 Intron 6 158 C/T rs2389204 78 Intron 6 (380-381) AT/ins 79 Intron 6 1400 T/G rs2274410 80 Intron 6 1474 G/A rs2274409 81 Intron 7 80 G/A rs2274408 82 Intron 7 894 A/T 83 Exon 8 1 G/T(Lys302Asn) rs2274407 84 Exon 8 40 G/A(Arg317Arg) rs2274406 85 Exon 8 58 G/A(Ser323Ser) rs2274405 86 Intron 8 82 C/G 87 Intron 8 100 C/T 88 Intron 8 5212 A/T 89 Intron 8 5444 T/G 90 Intron 8 8969 A/G 91 Intron 8 9106 T/C 92 Intron 8 9189 G/A rs1751021 93 Intron 8 9412 G/A 94 Intron 9 70 T/C rs2274403 95 Intron 9 116 A/G 96 Intron 9 1384 T/C 2d. Continued No. Location Positiona Genetic variation NCBI SNP ID 97 Intron 9 1428 A/G rs1751015 98 Intron 9 1459 A/G 99 Intron 9 1485 C/A rs1751014 100 Intron 9 1632 C/A 101 Intron 9 3630 G/del 102 Intron 9 3830 C/T 103 Intron 9 3940 C/T 104 Intron 9 4023 G/A rs1678374 105 Intron 10 1411 A/G rs1557069 106 Intron 10 1504 G/A 107 Intron 11 171 C/A rs2148529 108 Intron 11 1233 T/C rs1564351 109 Intron 11 1293 G/A rs1751008 110 Intron 11 1817 G/C 111 Intron 11 3261 C/T rs1887163 112 Intron 11 3322 C/A rs1887162 113 Intron 11 3342 T/C 114 Intron 11 3377 T/C 115 Intron 11 (3610-3625) (A)15-17 116 Intron 11 3737 A/G 117 Intron 11 6953 C/A 118 Intron 13 91 G/A rs1751005 119 Intron 13 118 C/T rs2296653 120 Intron 13 280 G/A rs1678405 121 Intron 13 349 T/G rs1073500 122 Intron 13 373 A/G rs2009772 123 Intron 13 386 G/A rs2478461 124 Intron 13 442 G/C 125 Intron 13 459 T/C 126 Intron 13 633 G/A 127 Intron 13 645 G/T 128 Intron 13 3092 C/T rs1751003 129 Intron 13 3306 A/C 130 Intron 13 6722 G/A rs1729786 131 Intron 14 252 A/G 132 Intron 15 124 C/T 133 Intron 15 219 G/A rs1729770 134 Intron 15 1016 A/G rs1038138 135 Intron 15 1552 C/T 136 Intron 16 107 T/C rs1729764 137 Intron 16 157 G/A 138 Intron 17 329 T/C 139 Exon 18 56 G/A(Glu757Lys) 140 Intron 19 5440 T/C rs1729788 141 Intron 19 7202 T/del 142 Intron 19 7445 T/C 143 Intron 19 8337 T/C rs1471481 144 Intron 19 9018 A/G 145 Intron 19 9127 G/T rs899498 146 Intron 19 10304 C/A rs1479390 147 Intron 19 11388 A/G 148 Intron 19 11646 T/del 149 Intron 19 13517 A/T 150 Intron 19 19989 A/T rs997777 151 Intron 19 21033 G/A 152 Intron 19 21095 A/T 153 Intron 19 21582 G/A rs2619313 154 Intron 19 21634 C/T 155 Intron 19 21715 C/T 156 Intron 19 23090 G/A 157 Intron 19 24297 A/G 158 Intron 19 25947 C/A 159 Intron 19 30193 A/C 160 Intron 19 33424 A/G rs1189428 161 Intron 19 33474 T/C rs1189429 162 Intron 19 34901 T/G rs1564353 163 Intron 19 34916 G/T rs1564354 164 Intron 19 35277 T/C rs1564355 165 Intron 19 36938 C/G 166 Intron 19 37322 C/T 2d. Continued No. Location Positiona Genetic variation NCBI SNP ID 167 Intron 19 (38361-38362) T/ins 168 Intron 19 38746 T/C 169 Intron 19 41603 T/C rs1678342 170 Intron 19 42343 C/T 171 Intron 19 44733 A/del 172 Intron 19 45056 T/G rs1678394 173 Intron 20 (405-419) (T)13-15 174 Intron 20 (637-648) (A)12-13 175 Intron 20 842 T/del 176 Intron 20 843 T/C 177 Intron 20 1347 T/del 178 Intron 20 1614 A/G rs1729748 179 Intron 20 2222 G/A rs1678395 180 Intron 20 4115 G/A rs1628382 181 Intron 20 9851 T/G rs1678363 182 Intron 20 10233 C/T rs1729775 183 Intron 20 12141 T/G rs1630807 184 Intron 20 12153 G/C rs1751059 185 Intron 20 (14553-14567) (A)13-15 186 Intron 20 15487 C/T 187 Intron 20 15698 G/C rs1678354 188 Intron 20 15951 C/A rs1729761 189 Intron 20 16152 T/C rs1729760 190 Intron 20 16161 T/C 191 Intron 20 16185 A/G rs1729759 192 Intron 20 30891 C/T 193 Intron 20 30984 C/T rs1189434 194 Intron 20 31180 G/A 195 Intron 20 31283 A/del 196 Intron 20 31526 A/G rs1189435 197 Intron 20 32572 A/C rs1189437 198 Intron 21 404 C/T rs1189438 199 Intron 21 428 G/A rs1189439 200 Intron 21 2016 C/T rs1751052 201 Intron 21 3703 G/A rs1678362 202 Intron 21 3898 G/C rs1751050 203 Intron 21 3902 C/T rs1624638 204 Intron 21 4204 A/T 205 Intron 21 4336 T/C rs943290 206 Intron 21 4471 C/T rs943289 207 Intron 21 4527 A/G rs1729755 208 Intron 21 7071 C/A rs1751042 209 Exon 22 26 A/G(Leu904Leu) rs1678339 210 Intron 22 1026 A/C 211 Exon 23 38 C/T(Phe948Phe) rs1189466 212 Intron 23 377 A/G 213 Intron 23 395 G/A rs1189465 214 Intron 23 602 G/A rs1189464 215 Intron 24 99 A/G rs2274401 216 Intron 24 1096 G/A rs1189462 217 Intron 25 128 G/A rs1189461 218 Intron 25 4122 C/G/T 219 Intron 25 4422 G/C rs1189457 220 Intron 25 4936 A/C rs1678365 221 Intron 25 5251 A/G rs1751036 222 Intron 25 5428 G/A rs1678409 223 Intron 25 6418 C/A 224 Intron 25 8764 T/C rs1751035 225 Intron 25 (8765-8775) (T)5-11 226 Exon 26 138 A/G(Lys1116Lys) rs1751034 227 Intron 26 67 G/C 228 Intron 26 100 T/G rs1751033 229 Intron 26 (101-109) (T)8-9 230 Intron 26 362 G/A rs931110 231 Intron 26 463 T/C rs922522 232 Intron 26 591 T/C rs931111 233 Intron 26 7716 G/A rs1189444 234 Intron 26 7816 G/A rs1189445 235 Intron 26 7845 A/G rs1189446 236 Intron 26 9266 A/G rs1189449 2d. Continued No. Location Positiona Genetic variation NCBI SNP ID 237 Intron 27 7469 G/A rs1151471 238 Intron 28 391 T/del 239 Intron 29 2569 C/T 240 Intron 29 7820 C/T 241 Intron 30 6269 A/G 242 Intron 30 6320 C/T 243 Intron 30 6474 A/G 244 Intron 30 6519 C/T 245 Intron 30 6574 C/T 246 Intron 30 6680 A/G 247 Intron 30 -704 A/C 248 Intron 30 -228 A/G 249 Intron 30 -(14-5) (T)9-10 250 Exon 31 146 G/T(3ЈUTR) 251 3ЈFlanking 173 A/G 252 3ЈFlanking (430-440) (A)10-11 253 3ЈFlanking 556 G/A 254 3ЈFlanking 741 T/C rs1059751 255 3ЈFlanking 1144 T/C 256 3ЈFlanking 1426 A/T 257 3ЈFlanking 1454 C/T rs1059762 ABCC4, ATP-binding cassette, subfamily C, member4 Table 2e. Summary of genetic variations detected in the ABCC5 gene No. Location Positiona Genetic variation NCBI SNP ID 1 Intron 1 628 G/C 2 Intron 1 1834 C/T 3 Intron 1 3055 A/del 4 Intron 2 -20280 T/C 5 Intron 2 -20260 A/T 6 Intron 2 -19204 C/T 7 Intron 2 -19043 G/A 8 Intron 2 -18824 A/G 9 Intron 2 -18807 G/A 10 Intron 2 -(18735-18734) A/ins 11 Intron 2 -16898 C/T rs2292997 12 Intron 2 -15903 G/A 13 Intron 2 -15901 C/T 14 Intron 2 -15847 G/A 15 Intron 2 -15605 C/T 16 Intron 2 -13571 G/A 17 Intron 2 -13402 G/T 18 Intron 2 -13325 G/C 19 Intron 2 -7293 C/T 20 Intron 5 374 C/T 21 Intron 5 1490 T/C rs939338 22 Intron 5 (2212-2213) CT/del 23 Intron 5 3283 C/T 24 Intron 5 3469 C/T 25 Intron 5 4411 G/C rs939337 26 Intron 5 4630 C/T rs2313212 27 Intron 7 28 G/A rs2293001 28 Intron 7 443 C/T 29 Intron 7 458 T/G 30 Exon 9 38 C/T(Ala395Ala) rs2271938 31 Intron 9 176 A/G 32 Intron 9 214 G/T 33 Intron 10 703 T/C 34 Intron 10 3580 A/G 35 Intron 10 3655 G/A 36 Intron 10 3854 T/C 37 Intron 10 5040 C/T 38 Intron 10 5062 C/T rs869335 39 Intron 10 5316 C/T 40 Intron 11 213 A/G rs869417 2e. Continued No. Location Positiona Genetic variation NCBI SNP ID 41 Exon 12 21 T/C(Cys594Cys) rs939336 42 Intron 12 234 G/A 43 Intron 12 300 A/G 44 Intron 12 318 A/G 45 Intron 12 1545 C/T 46 Intron 13 20 T/C 47 Intron 14 13 C/T rs2271937 48 Intron 14 76 C/T rs1879257 49 Intron 14 278 A/G 50 Intron 15 117 A/C rs2292999 51 Intron 16 (1654-1663) (T)9-10 52 Intron 16 1664 A/T 53 Intron 17 20 T/G 54 Intron 18 232 C/T 55 Intron 19 249 G/A 56 Intron 20 846 G/A 57 Intron 20 1154 A/del 58 Intron 22 (1424-1425) AT/ins 59 Intron 22 1799 T/C rs2280392 60 Intron 23 50 C/G rs1016752 61 Intron 23 1279 G/A rs2292998 62 Intron 24 132 A/G 63 Intron 24 -874 A/G 64 Intron 24 -630 G/A 65 Intron 24 -102 G/C 66 Exon 25 120 C/T(Leu1208Leu) 67 Intron 26 263 C/T 68 Intron 26 -3717 G/A rs2037379 69 Intron 26 -3257 T/C 70 Intron 27 873 G/A 71 Intron 29 (2733-2734) TGTCCAAAGGAAGGACACG/ins 72 Intron 29 2959 A/G 73 Intron 29 4020 G/A 74 Exon 30 684 G/A(3ЈUTR) 75 Exon 30 947 C/T(3ЈUTR) 76 Exon 30 (1145-1160) (TC)6-8(3ЈUTR) 77 Exon 30 1345 A/G(3ЈUTR) rs562 78 3ЈFlanking 4 A/C 79 3ЈFlanking 1729 C/T rs2313217 80 3ЈFlanking 1911 C/T rs1533684 81 3ЈFlanking 1958 A/G rs1000002 82 3ЈFlanking 2008 C/del 83 3ЈFlanking 2052 A/G 84 3ЈFlanking 2238 G/A rs1533683 85 3ЈFlanking 2845 A/G rs1533682 ABCC5, ATP-binding cassette, subfamily C, member5 Table 2f. Summary of genetic variations detected in the CFTR gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -834 T/G 2 5ЈFlanking -729 T/del 3 Exon 1 125 G/C(5ЈUTR) rs1800501 4 Intron 1 6200 G/A rs2283054 5 Intron 1 7538 C/A 6 Intron 1 9203 T/C rs885993 7 Intron 1 13519 T/C rs2237721 8 Intron 1 14110 T/del 9 Intron 1 14293 C/del 10 Intron 1 14316 C/G 11 Intron 1 14433 G/A 12 Intron 1 14824 G/C 13 Intron 1 23401 C/G 14 Intron 3 879 C/A 2f. Continued No. Location Positiona Genetic variation NCBI SNP ID 15 Intron 3 922 G/C 16 Intron 3 933 C/T 17 Intron 3 2632 A/C rs980574 18 Intron 3 13704 A/del 19 Intron 3 13758 A/G 20 Intron 3 21578 G/A rs1429566 21 Intron 4 240 T/del 22 Intron 4 376 A/G 23 Intron 4 586 T/C 24 Intron 4 1089 G/A rs957461 25 Intron 4 1101 T/A rs213942 26 Intron 4 1615 C/T 27 Intron 4 1946 T/C 28 Intron 6 783 A/G 29 Intron 6 (1104-1131) (GATT)6-7 30 Intron 7 (731-732) T/ins 31 Intron 7 1434 T/C 32 Intron 7 1481 A/G rs213935 33 Intron 8 752 A/G rs2237725 34 Intron 8 1109 G/A 35 Intron 8 1312 T/del 36 Intron 9 (6499-6520) (TG)11-12 b 37 Intron 10 395 G/A rs1820871 38 Intron 10 2119 T/G 39 Intron 10 2406 G/A rs213946 40 Exon 11 16 G/A(Val470Met)c rs213950 41 Intron 11 3867 A/del 42 Intron 11 11844 A/del 43 Intron 11 12144 T/C rs2082056 44 Intron 11 20975 G/A 45 Intron 11 21152 A/G rs213955 46 Intron 11 21297 G/A rs213956 47 Intron 11 27057 G/A 48 Intron 11 27131 T/del 49 Intron 12 1280 G/A rs213963 50 Intron 12 1449 A/G rs213964 51 Intron 12 1650 T/A rs213965 52 Intron 13 152 T/A 53 Intron 13 287 T/C 54 Intron 14 1826 A/G rs117243 55 Intron 15 (85-86) AT/del 56 Intron 15 106 T/A 57 Intron 15 3267 T/G rs213976 58 Intron 15 3333 T/G rs213977 59 Intron 15 3341 A/C 60 Intron 15 5556 A/T rs2246450 61 Intron 15 5919 C/A rs2106155 62 Intron 15 6282 A/T rs2213958 63 Intron 17 2479 A/C rs2299445 64 Intron 18 -81 A/del 65 Intron 19 751 A/G 66 Intron 19 820 T/C 67 Intron 20 1011 G/T rs213980 68 Intron 21 1532 T/del 69 Intron 21 1607 C/T rs2237726 70 Intron 21 4244 G/A rs213985 71 Intron 21 11260 T/C 72 Intron 22 (130-131) AT/del 73 Intron 23 1837 A/del 74 Intron 24 (7100-7112) (T)12-14 75 Intron 25 237 C/T 76 Exon 27 115 C/T(Arg1453Trp) 77 Exon 27 334 T/del(3ЈUTR) CFTR, Cystic fibrosis transmembrane conductance regulator b SNP previously reported by Chu et al. (1993) c SNP previously reported by Cuppens et al. (1998) 2g. Summary of genetic variations detected in the ABCC8 gene No. Location Positiona Genetic variation NCBI SNP ID 1 5ЈFlanking -1099 T/C 2 5ЈFlanking -(424-422) CAC/del 3 Intron 1 382 G/C rs985136 4 Intron 1 1212 A/G 5 Exon 2 59 T/C(Pro69Pro)b rs1048099 6 Intron 2 1003 C/A rs2283253 7 Intron 2 1253 C/T rs2283254 8 Intron 2 1382 T/C rs2283255 9 Intron 2 2371 T/A 10 Intron 3 1957 C/T 11 Intron 3 (2088-2089) CCA/ins 12 Intron 3 2204 G/A rs2283257 13 Intron 3 2286 A/G 14 Intron 3 2312 C/G 15 Intron 3 2356 A/G 16 Intron 3 2359 A/C 17 Intron 3 2370 G/A 18 Intron 3 2382 A/G 19 Intron 3 4910 G/A 20 Intron 3 4969 A/G 21 Intron 3 5003 C/G 22 Intron 3 5019 A/C 23 Intron 4 14 C/Tb rs2301703 24 Intron 4 187 G/A rs2301704 25 Intron 4 204 G/C 26 Intron 4 254 G/A 27 Intron 4 357 G/C 28 Intron 5 92 G/A rs2074317 29 Intron 5 801 C/T rs886289 30 Intron 5 802 A/G rs886290 31 Intron 6 87 A/G rs886291 32 Intron 6 4205 G/A rs2237975 33 Intron 6 5519 A/C rs2237976 34 Intron 6 5575 G/C rs2237977 35 Intron 6 6587 C/T rs2073585 36 Intron 6 6747 C/T rs2073586 37 Intron 7 348 A/C rs2057661 38 Intron 8 28 G/A rs1800850 39 Intron 8 4015 T/G rs886292 40 Intron 9 191 A/G rs2073587 41 Intron 10 1963 T/G rs2283261 42 Intron 10 2047 T/C rs886293 43 Intron 10 2724 A/G rs2237979 44 Intron 10 2938 G/C rs2237980 45 Intron 10 3094 T/del 46 Intron 10 3368 A/G rs2237981 47 Intron 10 8897 C/T 48 Intron 11 308 G/A 49 Intron 11 1171 G/A rs2074308 50 Exon 12 7 G/A(Val560Met) 51 Exon 12 15 C/T(His562His) rs1799857 52 Intron 12 356 G/T 53 Intron 12 934 G/T 54 Intron 12 1370 C/G rs2283262 55 Exon 14 25 G/A(Lys649Lys) rs1799858 56 Intron 15 412 C/T 57 Intron 15 688 A/G 58 Intron 15 709 C/Tc rs1799854 59 Intron 16 4464 G/A rs2237988 60 Intron 16 4574 T/C 61 Intron 16 5011 C/T rs2299638 62 Intron 16 6138 A/T rs929235 63 Intron 16 7608 C/G rs2299641 64 Intron 16 7730 G/A rs2299642 65 Intron 16 7818 C/G rs916828 66 Intron 16 8369 T/C rs2237991 67 Intron 16 9708 T/G rs2074315 68 Intron 17 651 A/G rs2234773 69 Intron 17 692 A/G 70 Intron 17 1541 C/T 2g. Continued No. Location Positiona Genetic variation NCBI SNP ID 71 Intron 18 580 C/T 72 Intron 18 658 C/Tb 73 Intron 18 660 T/Cb 74 Intron 19 93 T/C 75 Intron 19 123 T/C 76 Intron 19 219 C/T 77 Intron 19 845 C/T rs2074309 78 Intron 20 338 A/G rs2355017 79 Exon 21 10 C/T(Leu829Leu) 80 Intron 21 192 C/del 81 Intron 23 17 A/G rs2106865 82 Intron 23 67 C/T 83 Intron 23 581 T/C rs1319447 84 Intron 26 268 G/C rs2077654 85 Intron 26 308 C/T rs2077655 86 Intron 26 348 A/G rs2077144 87 Intron 26 613 A/G rs739688 88 Intron 26 807 G/A 89 Intron 26 834 G/C rs2073583 90 Intron 28 (118-121) AAAA/del 91 Intron 28 1348 G/A rs2067043 92 Intron 29 1253 G/T 93 Intron 29 1589 A/G 94 Intron 29 2322 G/A rs2074310 95 Intron 29 2348 T/C rs2074311 96 Intron 29 2418 C/T rs2074312 97 Intron 29 2494 C/A 98 Intron 29 2735 C/T 99 Intron 30 386 C/T 100 Exon 31 66 G/A(Arg1273Arg)c rs1799859 101 Exon 33 117 T/G(Ser1369Ala) rs757110 102 Intron 33 93 G/T 103 Intron 33 358 C/T 104 Intron 33 446 T/C rs757111 105 Intron 33 959 T/Cd rs759689 106 Intron 38 54 G/C 107 Intron 38 466 C/del 108 Intron 38 529 A/G ABCC8, ATP-binding cassette, subfamily C, member8 b SNPs previously reported by Nestorowicz et al. (1998) c SNPs previously reported by Inoue et al. (1996) d SNP previously reported by Goksel et al. (1998) Table 2h. Summary of genetic variations detected in the ABCC9 gene No. Location Positiona Genetic variation NCBI SNP ID 1 Intron 2 -321 T/C rs870134 2 Intron 2 -266 A/G rs870135 3 Intron 3 38 C/A 4 Intron 3 305 T/A rs2176394 5 Intron 3 320 A/G 6 Intron 3 631 G/C 7 Intron 3 8644 A/G 8 Intron 4 757 A/C 9 Intron 4 1022 A/C 10 Intron 5 -1217 A/G 11 Intron 5 -1208 A/G rs1344569 12 Intron 5 -180 A/G rs1517276 13 Intron 6 (100-106) (T)8-9 14 Intron 6 1347 A/del 15 Intron 6 1618 G/A rs2418021 16 Intron 6 1835 C/Tb 17 Intron 7 407 T/G 18 Intron 7 423 C/T 19 Intron 8 743 A/T 20 Intron 8 850 T/G 2h. Continued No. Location Positiona Genetic variation NCBI SNP ID 21 Intron 8 1360 C/T rs1421602 22 Intron 9 585 A/T 23 Intron 9 1394 G/C 24 Intron 11 1035 A/G rs704217 25 Intron 12 908 T/C rs704215 26 Intron 12 1113 T/C rs1914361 27 Intron 12 1167 G/A rs2292771 28 Intron 12 1195 A/G rs2292772 29 Intron 12 2123 G/A 30 Intron 12 2622 G/A rs704212 31 Intron 12 (2653-2656) TAAC/del 32 Intron 12 2756 G/A rs2032775 33 Intron 13 (3043-3044) CTCTTT/ins or CT/ins 34 Intron 13 4877 A/C rs1283802 35 Intron 13 4887 A/G rs1356368 36 Intron 14 85 T/A 37 Intron 14 275 T/C 38 Intron 14 453 T/C 39 Intron 14 3709 G/A 40 Intron 14 3813 C/T 41 Intron 14 4000 A/del 42 Intron 14 5522 T/A rs1492138 43 Intron 14 5535 T/G rs704205 44 Intron 16 1466 A/C 45 Intron 16 5357 T/G 46 Intron 16 7395 A/G rs697252 47 Intron 16 7407 C/T rs768314 48 Intron 17 970 A/T rs704194 49 Intron 17 (1358-1368) (T)10-11 50 Intron 18 119 C/T rs704193 51 Intron 18 773 T/C rs704192 52 Intron 18 865 A/G rs704191 53 Intron 20 98 G/A 54 Intron 20 173 C/T rs704189 55 Intron 22 28 A/C rs2307024 56 Intron 22 194 G/del 57 Intron 22 1370 C/T 58 Intron 22 1487 C/G 59 Intron 22 3148 T/G rs1283822 60 Intron 23 (455-462) AATTAGAA/del 61 Intron 23 1221 A/G rs829080 62 Intron 23 1976 C/A rs829079 63 Intron 24 (460-465) TTTAAAA/TTTTAA 64 Intron 24 595 A/G rs2307025 65 Intron 26 -150 T/G rs1643235 66 Intron 27 1628 C/T rs704179 67 Intron 27 1770 C/G rs704178 68 Intron 27 1976 A/T rs704177 69 Intron 28 -926 G/A rs2112080 70 Intron 29 667 T/C rs1283811 71 Intron 29 1072 A/C rs1283810 72 Intron 29 2692 T/del 73 Intron 29 2959 T/C rs1873638 74 Intron 29 5464 G/A 75 Intron 29 -1830 A/T 76 Intron 31 102 G/A rs2638441 77 Intron 33 877 A/G 78 Intron 33 1069 T/C rs2216525 79 Intron 36 (1270-1281) (T)11-12 80 Intron 37 533 C/G rs829060 81 3ЈFlanking 197 T/G ABCC9, ATP-binding cassette, subfamily C, member9 b SNP previously reported by Iwasa et al. (2001) 3. Login to comment
75 Novel SNPs detected in exons in seven ABCC genes Region Gene Location Position SNP 5ЈUTR ABCC4 Exon 1 67 C/T Coding Nonsynonymous ABCC1 Exon 18 53 G/A(Arg723Gln) ABCC2 Exon 28 52 A/C(Lys1299Gln) ABCC4 Exon 4 205 T/G(Cys171Gly) Exon 18 56 G/A(Glu757Lys) CFTR Exon 27 115 C/T(Arg1453Trp) ABCC8 Exon 12 7 G/A(Val560Met) Synonymous ABCC1 Exon 25 60 G/A(Pro1150Pro) ABCC2 Exon 22 51 G/A(Ser978Ser) Exon 28 84 C/T(Tyr1309Tyr) Exon 28 129 C/T(Ile1324Ile) ABCC3 Exon 22 180 C/T(Gly1013Gly) ABCC5 Exon 25 120 C/T(Leu1208Leu) ABCC8 Exon 21 10 C/T(Leu829Leu) 3ЈUTR ABCC1 Exon 32 652 C/T ABCC4 Exon 31 146 G/T ABCC5 Exon 30 684 G/A Exon 30 947 C/T 7. Login to comment

[hide] Polymorphisms of MRP1 (ABCC1) and related ATP-depe... Pharmacogenet Genomics. 2005 Aug;15(8):523-33. Conseil G, Deeley RG, Cole SP
Polymorphisms of MRP1 (ABCC1) and related ATP-dependent drug transporters.
Pharmacogenet Genomics. 2005 Aug;15(8):523-33., [PMID:16006996]

Abstract [show]
Genetic variations in drug metabolizing enzymes and targets are established determinants of adverse drug reactions and interactions, but less is known about the role of genetic polymorphisms in membrane transport proteins. MRP1 (ABCC1) is one of 13 polytopic membrane proteins that comprise the 'C' subfamily of the ATP-binding cassette (ABC) superfamily of transport proteins. MRP1 and related ABCC family members, including MRP2, 3, 4 and 5 (ABCC2, 3, 4 and 5), each have a distinctive pattern of tissue expression and substrate specificity. Together, these five transporters play important roles in the disposition and elimination of drugs and other organic anions, and in maintenance of blood-tissue barriers, as confirmed by enhanced chemosensitivity of respective knockout mice. Moreover, Mrp2 (Abcc2) deficient animals display mild conjugated hyperbilirubinemia, corresponding to a human condition known as Dubin-Johnson syndrome (DJS). Naturally occurring mutations in MRP/ABCC-related drug transporters have been reported, some of which are non-synonymous single nucleotide polymorphisms. The consequences of the resulting amino acid changes can sometimes be predicted from in vitro site-directed mutagenesis studies or from knowledge of mutations of analogous (conserved) residues in ABCC proteins that cause DJS, Pseudoxanthoma elasticum (ABCC6), cystic fibrosis (CFTR/ABCC7) or persistent hyperinsulinemic hypoglycemia of infancy (SUR1/ABCC8). Continual updating of databases of sequence variants and haplotype analysis, together with in vitro biochemical validation assays and pharmacological studies in knockout animals, should make it possible to determine how genetic variation in the MRP-related transporters contributes to the range of responses to drugs and chemicals observed in different human populations.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
148 Fig. 3 Exon 1 2 3 MSDMSD NBD1 MSD NBD2 C4535T(S1512L) G3173A (R1058Q) G3140C (C1047S) G2965A (A989T) G2168A (R723Q) G2012T(G671V) G1898A (R633Q) G1299T(R433S) G1057A (V353M) G689A (R230Q) C350T(T117M) C257T(S92F) C218T(T73I) C128C (C43S) (TM1-5) (TM6-11) (TM12-17) 4 5 6 7 8 9101112 1314 151617 1819 20 21 22 23 242526272829 30 31 Location of non-synonymous SNPs in the coding regions of the genes in the MRP1/ABCC1 gene. Login to comment

[hide] Functional characterization of non-synonymous sing... Pharmacogenet Genomics. 2005 Sep;15(9):647-57. Letourneau IJ, Deeley RG, Cole SP
Functional characterization of non-synonymous single nucleotide polymorphisms in the gene encoding human multidrug resistance protein 1 (MRP1/ABCC1).
Pharmacogenet Genomics. 2005 Sep;15(9):647-57., [PMID:16041243]

Abstract [show]
The 190-kDa ATP-binding cassette (ABC) multidrug resistance protein 1 (MRP1) encoded by the MRP1/ABCC1 gene mediates the active cellular efflux of glucuronide, glutathione and sulfate conjugates. It can also confer resistance to a diverse spectrum of chemotherapeutic agents and transport a variety of toxicants. In the present study, we examined 10 MRP1/ABCC1 missense genetic variants [non-synonymous single nucleotide polymorphisms (SNPs)] to determine whether or not they affect expression or function of the transporter. Variants 218C>T (Thr73Ile), 257C>T (Ser92Phe), 350C>T (Thr117Met), 689G>A (Arg230Gln), 1898G>A (Arg633Gln), 2168G>A (Arg723Gln), 2965G>A (Ala989Thr), 3140G>C (Cys1047Ser), 3173G>A (Arg1058Gln) and 4535C>T (Ser1512Leu) were recreated using site-directed mutagenesis and transfected into human embryonic kidney cells. Immunoblotting experiments showed that all mutant proteins were expressed at levels comparable to wild-type MRP1. Vesicular transport assays revealed that the Ala989Thr mutation caused a significant decrease in estradiol 17beta-glucuronide transport due to a decrease in apparent affinity (Km) for this organic anion. The transport properties of the other mutants were comparable to wild-type MRP1. When the MRP1/ABCC1 non-synonymous SNPs were evaluated by the SIFT algorithm using subsets of homologs and orthologs of MRP1/ABCC1, Arg230Gln, Val353Met, Arg433Ser, Gly671Val and Arg1058 mutations were predicted to be deleterious, whereas the PolyPhen algorithm predicted Ser92Phe and Gly671Val to be potentially damaging. Thus most predictions of these algorithms were not in accordance with our experimental results. In conclusion, our data suggest that none of the MRP1/ABCC1 variants studied are likely by themselves to have major deleterious effects in healthy individuals, and the SIFT and PolyPhen algorithms appear to be poor predictors of the phenotypic consequences of these MRP1 mutations at least in vitro.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 Variants 218C > T (Thr73Ile), 257C > T (Ser92Phe), 350C > T (Thr117Met), 689G > A (Arg230Gln), 1898G > A (Arg633Gln), 2168G > A (Arg723Gln), 2965G > A (Ala989Thr), 3140G > C (Cys1047Ser), 3173G > A (Arg1058Gln) and 4535C > T (Ser1512Leu) were recreated using site-directed mutagenesis and transfected into human embryonic kidney cells. Login to comment
28 Of these mutations, the Fig. 1 128G >C (C43S) 128G >T(T73I) 689G >A (R230Q)1057G >A (V353M) 1299G >T(R433S) 1898G >A (R633Q) 2012G >T(G671V) 2168G >A (R723Q) 3173G >A (R1058Q) 4535C >T(S1512L) 3140G >C (C1047S) 2965G >A (A989T) 350C >T(T117M) 257C >T(S92F) 313029282726252423222120181716151413121110987654321 19 MSD1 MSD1 MSD2 MSD3 MSD2 NBD1 MSD3 NBD2 TM 1 2 3 4 5 6 7 8 Val353Met Ala989Thr Cys1047Ser Arg1058Gln NBD2NBD1 Ser1512Leu Arg633Gln Arg433Ser Arg723Gln Thr73lle Thr117Met Arg230Gln Cys43Ser Ser92Phe Gly671Val 9 10 11 12 13 14 15 16 17 (a) (b) Location of reported non-synonymous single nucleotide polymorphisms (SNPs) in MRP1/ABCC1. Login to comment
46 The template for generating Table 1 Frequencies of non-synonymous single nucleotide polymorphisms in MRP1/ABCC1 Variant Amino acid substitution Allelic frequency Population References 128G > C Cys43Ser 0% (0/26) Japanese [16] 1% (1/96) Japanese [17] 218C > T Thr73Ile 0% (0/26) Japanese [16] 1% (1/96) Japanese [17] 3.7% (2/54) Chinese [37] 257C > T Ser92Phe 0% (0/220) Caucasian www.pharmGKB.org 0.5% (1/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 350C > T Thr117Met 1.6% (1/64) Caucasian [28] 689G > A Arg230Gln 0% (0/220) Caucasian www.pharmGKB.org 0.5% (1/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 1057G > A Val353Met 0.5% (1/220) Caucasian www.pharmGKB.org 0% (0/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 1299G > T Arg433Ser 1.4% (1/72) Caucasian [20] 0% (0/110) Caucasian [19] 1898G > A Arg633Gln 0.8% (2/234) Caucasian [29] 2012G > T Gly671Val 2.8% (2/72) Caucasian [20] 2.6% (6/234) Caucasian [29] 2168G > A Arg723Gln 3.8% (1/26) Japanese [16] 1% (1/96) Japanese [30] 7.3% (7/96) Japanese [17] 5.6% (3/54) Chinese [37] 2965G > A Ala989Thr 0.5% (1/220) Caucasian www.pharmGKB.org 0% (0/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 3140G > C Cys1047Ser 0% (0/220) Caucasian www.pharmGKB.org 4.5% (9/200) African-American 0% (0/60) Japanese 0% (0/14) Pacific-Islander 3173G > A Arg1058Gln 0% (0./26) Japanese [16] 1% (1/96) Japanese [17] 4535C > T Ser1512Leu 3.1% (2/24) Caucasian [28] Characterization of MRP1/ABCC1 variants in vitro Le´tourneau et al. 649 the Arg633Gln and Arg723Gln mutants was created by subcloning a HindIII fragment (1329 bp) encoding amino acids 517-959 into pGEM-3z [20]. Login to comment
50 Mutagenesis was performed according to the manufacturer`s instructions with the following sense primers (substituted nucleotides for amino acid mutation are underlined, introduced or disrupted restriction sites are italicized and other silent substitutions are in lower case letters) as follows: Thr73Ile (50 -G ATG ACA CCT CTC AAC AAA ATC AAAACTGCCTTGGG-30 ); Ser92Phe (50 -GG GCA GAC CTG TTC TAC TTT TTC TGG GAA AG-30 ) (EarI); Thr117Met (50 -CTC TTG GGC ATC ACC ATG CTG CTT GCT ACC-30 ); Arg230Gln (50 -GG TTG ATT GTA CAG GGC TAC CGC C-30 ) (BsrGI); Arg633Gln (50 -GAC AGC ATC GAG CGA CAG CCT GTG AAA GAC GGC GG-30 ) (Eam1105I); Arg723Gln (50 -CAG AAT GAC TCT CTC CAA GAA AAt ATC CTT TTT GGA TGT CAG C-30 ) (PleI); Ala989Thr (50 -C ATG TGT AAC CAC GTG TCC ACG CTG GCT TCC-30 ) (PmlI); Cys1047Ser (50 - GCT TCC CGC TCT CTG CAT GTG GAC CTG C-30 ) (PmlI); Arg1058Gln (50 -CTG CTG CAC AGC ATC CTC CAG TCA CCC ATG AGC-30 ) (BstEII); and Ser1512Leu (50 -CAG GAG TAC GGA GCC CCA TTG GAC CTt CTG CAG CAG-30 ) (NarI). Login to comment
51 Following mutagenesis, the desired fragment was subcloned back into pcDNA3.1(-) MRP1k as a XbaI/BamHI fragment (865 bp) for the Thr73Ile, Ser92Phe, Thr117Met and Arg230Gln mutants; a Bsu36I/Esp3I fragment (721 bp) for the Arg633Gln and Arg723Gln mutants; a Esp3I/EcoRI fragment (1313 bp) for the Ala989Thr, Cys1047Ser, Arg1058Gln mutants; and a EcoRI/KpnI fragment (778 bp) for the Ser1512Leu mutant. Login to comment
83 Expression levels of MRP1 mutants To investigate the effect of the amino acid substitutions resulting from the non-synonymous SNPs on MRP1 protein expression and function, MRP1 expression vectors containing the mutations responsible for the substitutions (Thr73Ile, Ser92Phe, Thr117Met, Arg230Gln, Arg633Gln, Arg723Gln, Thr989Ala, Cys1047Ser, Arg1058Gln, Ser1512Leu) were generated by site-directed mutagenesis and transfected into HEK293T cells. Login to comment
87 The mutants were considered in four groups based on their location in the transporter: (a) MSD1/CL3 mutants Thr73Ile, Ser92Phe, Thr117Met and Arg230Gln; (b) NBD1 mutants Arg633Gln and Arg723Gln; (c) MSD3 mutants Ala989Thr, Cys1047Ser and Arg1058Gln; and (d) COOH-terminus mutant Ser1512Leu. Login to comment
96 However, the three SNPs located in or close to the NBDs (Arg633Gln, Arg723Gln and Ser1512Leu) caused a consistent decrease (approximately 25%) in [3 H]E217bG (Fig. 3b) and [3 H]MTX uptake when activity levels were normalized for variation in expression level (Fig. 3c). Login to comment
97 The Arg723Gln and Ser1512Leu mutations had a similar effect on [3 H]LTC4 uptake, whereas the Arg633Gln mutation did not (Fig. 3a). Login to comment
123 Previous mutagenesis and inhibition studies have Fig. 3 Cys43Ser Thr73lle Ser92Phe Thr117Met Arg230Gln Arg433Ser Arg633Gln Gly671Val Arg723Gln Ala989Thr Cys1047Ser Arg1058Gln Ser1512Leu Cys43Ser Thr73lle Ser92Phe Thr117Met Arg230Gln Arg433Ser Arg633Gln Gly671Val Arg723Gln Ala989Thr Cys1047Ser Arg1058Gln Ser1512Leu Thr73lle Ser92Phe Thr117Met Arg230Gln Arg633Gln Arg723Gln Ala989Thr Cys1047Ser Arg1058Gln Ser1512Leu LTC4 % WT-MRP1 uptake 0 25 50 75 100 125 E217βG % WT-MRP1 uptake 0 25 50 75 100 125 150 MTX % WT-MRP1 uptake 0 25 50 75 100 125 (b) (c) (a) ATP-dependent vesicular transport of organic anions by mutant MRP1 proteins. Login to comment
157 It is interesting to note that, in some cases, the human MRP1 polymorphic residue is found in the sequence of an MRP1 ortholog or other ABCC homolog (e.g. Thr117Met, Arg230Gln, Arg723Gln and Arg1058Gln). Login to comment
158 This observation may be construed as being Table 2 Conservation of the amino acids substituted by non-synonymous SNP of human MRP1/ABCC1a Protein Speciesb C43S T73I S92F T117Mc R230Q V353M R433S R633Qc G671V R723Q A989T C1047S R1058Q S1512L MRP1 Human C T S T R V R R G R A C R S Monkey C T S M R V R R G Q A C R S Dog C T S M R V R R G R A R R S Cow C A S M Q V R R G R A R R S Rat C A S M Q V R W G R A R R S Mouse C T S M H V R R G R A R R S MRP2 Human L A V T K A K R G K A I R E Monkey L A V T K A K R G K A I R E Dog L A V T K A K R G K A I Q Q Rat L A A T K V K R G K A A R E Mouse L A A T K V K V G K A T R E Rabbit L A V T K V K R G K A I R E MRP3 Human C L S M Y I R K G Q A V R A Rat C L S M L L R K G Q A L R V MRP4 Human - - - - I F K R G R Y T K Y MRP5 Human - - - - V T R S G R T R R S MRP6 Human P A A M R I R S G V A L R A CFTR Human - - - - R Y K A G K L I Q Q SUR1 Human V L L A T V Q R G E L R L E SUR2 Human V L H T Q V Q R G E I N L P Pgp Human - - - - - E K S G A G R R Q YCF1 Saccharomyces cervisiae A I L V T V K L G K S Y R G Mrp1 Caenorhabditis elegans T L D F L I R T G R G L R K Mrp2 Caenorhabditis elegans T F D I L I K T G R G I R K AtMRP2 Arabidopsis thaliana Q L R W L M S P G R R K R E AtMRP1 Arabidopsis thaliana H T A V L M S P G R R K R E a Aligned using Clustal W (http://pbil.univ-lyon1.fr/). Login to comment

[hide] Nucleotide sequence analyses of the MRP1 gene in f... BMC Genomics. 2006 May 10;7:111. Wang Z, Sew PH, Ambrose H, Ryan S, Chong SS, Lee EJ, Lee CG
Nucleotide sequence analyses of the MRP1 gene in four populations suggest negative selection on its coding region.
BMC Genomics. 2006 May 10;7:111., [PMID:16684361]

Abstract [show]
BACKGROUND: The MRP1 gene encodes the 190 kDa multidrug resistance-associated protein 1 (MRP1/ABCC1) and effluxes diverse drugs and xenobiotics. Sequence variations within this gene might account for differences in drug response in different individuals. To facilitate association studies of this gene with diseases and/or drug response, exons and flanking introns of MRP1 were screened for polymorphisms in 142 DNA samples from four different populations. RESULTS: Seventy-one polymorphisms, including 60 biallelic single nucleotide polymorphisms (SNPs), ten insertions/deletions (indel) and one short tandem repeat (STR) were identified. Thirty-four of these polymorphisms have not been previously reported. Interestingly, the STR polymorphism at the 5' untranslated region (5'UTR) occurs at high but different frequencies in the different populations. Frequencies of common polymorphisms in our populations were comparable to those of similar populations in HAPMAP or Perlegen. Nucleotide diversity indices indicated that the coding region of MRP1 may have undergone negative selection or recent population expansion. SNPs E10/1299 G>T (R433S) and E16/2012 G>T (G671V) which occur at low frequency in only one or two of four populations examined were predicted to be functionally deleterious and hence are likely to be under negative selection. CONCLUSION: Through in silico approaches, we identified two rare SNPs that are potentially negatively selected. These SNPs may be useful for studies associating this gene with rare events including adverse drug reactions.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
129 2000 SNPe13* E17/2168 G>A R723Q 0.36 benign -1.12171 0 2.86 0 0 Moriya et al . Login to comment

[hide] Association between single nucleotide polymorphism... Anticancer Res. 2006 May-Jun;26(3B):2227-32. Obata H, Yahata T, Quan J, Sekine M, Tanaka K
Association between single nucleotide polymorphisms of drug resistance-associated genes and response to chemotherapy in advanced ovarian cancer.
Anticancer Res. 2006 May-Jun;26(3B):2227-32., [PMID:16821592]

Abstract [show]
BACKGROUND: Single nucleotide polymorphisms (SNPs) may show clinicopathological importance as prognostic markers. This study examined the association of SNPs and the expression of drug resistance-associated markers with response to chemotherapy in advanced ovarian cancer (stages III and IV) patients. MATERIALS AND METHODS: SNPs were analyzed for MDR1, MRP1, MRP2 and LRP in 60 advanced ovarian cancer patients. The protein expression of each factor was analyzed by immunohistochemistry in all patients. RESULTS: As a result of examining the relevance of SNP genotypes to the response to chemotherapy, a significant relevance (p=0.01) was observed regarding MRP1 exon-17 SNP (G2168A) involving amino acid substitution. No significant relationship was observed between protein expression and the response to chemotherapy or disease-free survival time. CONCLUSION: Analysis of drug resistance gene polymorphism appears to be an indicator of the response to chemotherapy in advanced ovarian cancer.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
84 Gene Nucleic acid Amino acid Allele frequencies Allele frequencies location change substitution (major alleles) (major alleles) in this study in other subject* MDR1 Promotor 1 T/C - 0.908 - Promotor 2 A-41aG - 0.883 0.927 exon-12 T1236C Gly412Gly 0.633 0.615 exon-26 G/A IIe1144IIe 0.500 - exon-28 A/G - 0.742 - MRP1 exon-8 T825C Val275Val 0.600 0.625 exon-9 T1062C Asn354Asn 0.567 0.646 exon-13 T1684C Leu562Leu 0.750 0.802 exon-16 C2007T Pro669Pro 0.950 0.917 exon-17 G2168A Arg723Gln 0.917 0.927 exon-28 G4002A Ser1334Ser 0.883 0.844 MRP2 Promotor C-24T - 0.867 - exon-10 G1249A Val417IIe 0.925 0.875 exon-28 C3972T IIe1324IIe 0.758 0.781 *Ito S. et al. Login to comment
130 On the basis of these reports, the significant correlation with the response to chemotherapy found in this study seems to suggest the possibility that exon-17 G2168A (Arg723Gln) polymorphism is relevant to the change in the function of MRP1, although the precise mechanism requires further examination. Login to comment

[hide] Genetic variations and haplotype structures of the... Drug Metab Pharmacokinet. 2007 Feb 25;22(1):48-60. Fukushima-Uesaka H, Saito Y, Tohkin M, Maekawa K, Hasegawa R, Kawamoto M, Kamatani N, Suzuki K, Yanagawa T, Kajio H, Kuzuya N, Yasuda K, Sawada J
Genetic variations and haplotype structures of the ABC transporter gene ABCC1 in a Japanese population.
Drug Metab Pharmacokinet. 2007 Feb 25;22(1):48-60., 2007-02-25 [PMID:17329911]

Abstract [show]
Multidrug resistance-related protein 1 (MRP1), an ATP-binding cassette transporter encoded by the ABCC1 gene, is expressed in many tissues, and functions as an efflux transporter for glutathione-, glucuronate- and sulfate-conjugates as well as unconjugated substrates. In this study, the 31 exons and their flanking introns of ABCC1 were comprehensively screened for genetic variations in 153 Japanese subjects to elucidate the linkage disequilibrium (LD) profiles and haplotype structures of ABCC1 that is necessary for pharmacogenetic studies of the substrate drugs. Eighty-six genetic variations including 31 novel ones were found: 1 in the 5'-flanking region, 1 in the 5'-untranslated region (UTR), 20 in the coding exons (9 synonymous and 11 nonsynonymous variations), 4 in the 3'-UTR, and 60 in the introns. Of these, eight novel nonsynonymous variations, 726G>T (Trp242Cys), 1199T>C (Ile400Thr), 1967G>C (Ser656Thr), 2530G>A (Gly844Ser), 3490G>A (Val1164Ile), 3550G>A (Glu1184Lys), 3901C>T (Arg1301Cys), and 4502A>G (Asp1501Gly), were detected with an allele frequency of 0.003. Based on the LD profiles, the analyzed regions of the gene were divided into five LD blocks (Blocks -1 and 1 to 4). The multiallelic repeat polymorphism in the 5'-UTR was defined as Block -1. For Blocks 1, 2, 3 and 4, 32, 23, 23 and 13 haplotypes were inferred, and 9, 7, 7 and 6 haplotypes commonly found on > or = 10 chromosomes accounted for > or = 91% of the inferred haplotypes in each block. Haplotype-tagging single nucleotide polymorphisms for each block were identified to capture the common haplotypes. This study would provide fundamental and useful information for the pharmacogenetic studies of MRP1-dependently effluxed drugs in Japanese.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
26 In Caucasian populations, 1299GÀT (Arg433Ser), 1898GÀA (Arg633Gln), 2012GÀT (Gly671Val), and 4535CÀT (Ser1512Leu) have been reported.79) In addition, Arg433Ser decreases the transport activity for LTC4 and estrone sulfate, but not for estradiol 17b-glucuronide, in vitro.10) Ito et al. found 16 genetic polymorphisms, including 4 nonsynonymous and 8 synonymous ones, in 48 Japanese subjects.11) An in vitro functional study showed that one of the non-synonymous variations, 2168GÀA (Arg723Gln), leads to reduced transport activity for LTC4, estradiol 17b-glucuronide and methotrexate.12) However, no haplotype analysis has been reported for the Japanese population. Login to comment
69 We also detected three known nonsynonymous variations, 218CÀT (Thr73Ile), 2168GÀA (Arg723Gln), and 3173GÀA (Arg1058Gln) at frequencies of 0.007, 0.065 and 0.003, respectively. These frequencies were similar to those found in the earlier reports for Japanese11) and Chinese.21) One of the variations, Arg723Gln, leads to reduced transport activities for LTC4, estradiol 17b-glucuronide and methotrexate.12) We did not detect three previously reported variations: 2012GÀT (Gly671Val; found with approximately 0.03 frequency in Caucasians), 3140GÀC (Cys1047Ser; 0.05 in African-Americans), and 4535CÀT (Ser1512Leu; 0.03 in Caucasians).8,9,12) These SNPs might be ethnic- specic. Login to comment
115 The *2 to *4 haplotypes were dened by the nonsynonymous variations, 2168GÀA (Arg723Gln) (*2), 1967GÀC (Ser656Thr) (*3), and 2530GÀA (Gly844Ser) (*4). Login to comment
118 To distinguish these 7 haplotypes, the 6 htSNPs, IVS1285GÀA, 1684CÀT (Leu562Leu), IVS13 { 105CÀT, 2007CÀT (Pro669Pro), IVS16{181CÀT, and 2168GÀA (Arg723Gln), can be used. Login to comment

[hide] Multidrug resistance associated proteins as determ... Curr Drug Metab. 2007 Dec;8(8):787-802. Yu XQ, Xue CC, Wang G, Zhou SF
Multidrug resistance associated proteins as determining factors of pharmacokinetics and pharmacodynamics of drugs.
Curr Drug Metab. 2007 Dec;8(8):787-802., [PMID:18220559]

Abstract [show]
The multidrug resistance associated proteins (MRP1, MRP2, MRP3, MRP4, MRP5, MRP6, MRP7, MRP8 and MRP9) belong to the ATP-binding cassette superfamily (ABCC family) of transporters. They are expressed differentially in the liver, kidney, intestine, brain and other tissues. These transporters are localized to the apical and/or basolateral membrane of the hepatocytes, enterocytes, renal proximal tubule cells and endothelial cells of the blood-brain barrier. Several MRPs (mainly MRP1-3) are associated with tumor resistance which is often caused by an increased efflux and decreased intracellular accumulation of natural product anticancer drugs and other anticancer agents. MRPs transport a structurally diverse array of important endogenous substances and xenobiotics and their metabolites (in particular conjugates) with different substrate specificity and transport kinetics. Most MRPs are subject to induction and inhibition by a variety of compounds. Several nuclear receptors, including pregnane X receptor (PXR), liver X receptor (LXR), and farnesoid receptor (FXR) participate in the regulation of MRPs. MRPs play an important role in the absorption, distribution and elimination of various drugs in the body and thus may affect their efficacy and toxicity and cause drug-drug interactions. MRPs located in the blood-brain barrier can restrict the penetration of compounds into the central nervous system. Mutation of MRP2 causes Dubin-Johnson syndrome, while mutations in MRP6 are responsible for pseudoxanthoma elasticum. More recently, mutations in mouse Mrp6/Abcc6 gene is associated with dystrophic cardiac calcification (DCC), a disease characterized by hydroxyapatite deposition in necrotic myocytes. A single nucleotide polymorphism, 538G>A in the MRP8/ABCC11 gene, is responsible for determination of earwax type. A better understanding of the function and regulating mechanism of MRPs can help minimize and avoid drug toxicity, unfavourable drug-drug interactions, and to overcome drug resistance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
405 Important Single Nucleotide Polymorphisms (SNPs) of MRP Genes MRP Chromosomal location Amino acid variation Nucleotide variation Location References Cys43Ser Thr73Ile G128C C218T Exon2 Exon2 [239] Arg433Ser G1299T Exon10 [258] Gly671Val G2012T Exon16 [259] Arg723Gln G2168A Exon17 [239] MRP1 16p13.11-p13.12 Arg1058Gln G3173A Exon23 [239] C-24T Promoter [100, 239] Val417Ile G1249A Exon10 [100, 238, 239] Gly676Arg G2026C Exon16 [237] Try709Arg T2125C Exon17 [236] Arg768Trp Ser789Phe C2302T C2366T Exon18 Exon18 [100, 238, 239] I1173F R1150H A3517T G3449A Exon25 Exon25 [240] Ile1324Ile C3972T Exon28 [100, 239] MRP2 10q23-24 Ala1450Thr G4348A Exon31 [100, 238, 239] (Table 2) contd…. Login to comment

[hide] Characterization and analyses of multidrug resista... Pharmacogenet Genomics. 2009 Mar;19(3):206-16. Yin JY, Huang Q, Yang Y, Zhang JT, Zhong MZ, Zhou HH, Liu ZQ
Characterization and analyses of multidrug resistance-associated protein 1 (MRP1/ABCC1) polymorphisms in Chinese population.
Pharmacogenet Genomics. 2009 Mar;19(3):206-16., [PMID:19214144]

Abstract [show]
OBJECTIVE: To explore the distribution frequencies of four common single nucleotide polymorphisms (SNPs) of MRP1/ABCC1 in a mainland Chinese population and investigate whether these SNPs affect the expression and function of the MRP1/ABCC1. METHODS: The genotype of 208 healthy volunteers was determined using PCR-restriction fragment length polymorphism. The four candidated SNPs were recreated by site-directed mutagenesis and tested for their effect on MRP1/ABCC1 expression and multidrug resistance function in stable transfected HEK293 and CHO-K1 cell lines. Real-time PCR, western blot and confocal microscopy were used to determine the mRNA, protein expression, and protein trafficking. At last, the effect of mutations on MRP1/ABCC1-mediate drug resistance was determined using methyl thiazolyl tetrazolium assay. RESULTS: The allelic frequencies of Cys43Ser (128G>C), Thr73Ile (218C>T), Arg723Gln (2168G>A), and Arg1058Gln (3173G>A) in mainland Chinese were 0.5, 1.4, 5.8, and 0.5%, respectively. None of these mutations had any effect on MRP1/ABCC1 expression and trafficking, but that Arg723Gln mutation significantly reduced MRP1/ABCC1-mediated resistance to daunorubicin, doxorubicin, etoposide, vinblastine, and vincristine. The Cys43Ser mutation did not affect all tested drug resistance. In contrast, the Thr73Ile mutation reduced resistance to methotrexate and etoposide, whereas the Arg1058Gln mutation increased the response of two anthracycline drugs and etoposide in HEK293 and CHO-K1 cells as well as vinblastine and methotrexate in CHO-K1 cells. CONCLUSION: The allelic frequency of the Arg723Gln mutation is relatively higher than other SNPs in mainland Chinese population and therefore this mutation significantly reduces MRP1/ABCC1 activity in multidrug resistance.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 Results The allelic frequencies of Cys43Ser (128G > C), Thr73Ile (218C > T), Arg723Gln (2168G > A), and Arg1058Gln (3173G > A) in mainland Chinese were 0.5, 1.4, 5.8, and 0.5%, respectively. Login to comment
6 None of these mutations had any effect on MRP1/ABCC1 expression and trafficking, but that Arg723Gln mutation significantly reduced MRP1/ ABCC1-mediated resistance to daunorubicin, doxorubicin, etoposide, vinblastine, and vincristine. Login to comment
9 Conclusion The allelic frequency of the Arg723Gln mutation is relatively higher than other SNPs in mainland Chinese population and therefore this mutation significantly reduces MRP1/ABCC1 activity in multidrug resistance. Pharmacogenetics and Genomics 19:206-216 c 2009 Wolters Kluwer Health | Lippincott Williams & Wilkins. Login to comment
23 The four most common nonsynonymous SNPs in the Asian population are Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations [15,17]. Login to comment
24 While Cys43Ser (128G > C) is located in the first transmembrane (TM), Thr73Ile (218C > T), Arg723Gln (2168G > A) and Arg1058Gln (3173G > A) are located in the first intracellular loop, the first NBD, and the seventh intracellular loop, respectively (Fig. 1a). Login to comment
35 Fig. 1 COOH L0 NBD1 NBD2 NH2 KCFQNTVLVWVPCFYLWACFPFYF TM1(a) CL1 Thr73Ile …AWIQNDSLRENILFGC… NBD1 Arg723Gln * * * * …DLLHSILRSPMSFF… CL7 Arg1058Gln PFYFLYLSRHDRGYIQMTPLNKTK Cys43Ser Cys43Ser Thr73Ile Arg723Gln Arg1058Gln 1 Human Monkey Bovine Dog Mouse Rat Chicken 2 3 4 5 6 7 (b) Location and conservation of the amino acid residues with polymorphisms in multidrug-resistance-associated protein 1 (MRP1/ABCC1). Login to comment
36 (a) Location of Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln in the schematic model of MRP1/ABCC1. Login to comment
51 Site-directed mutagenesis For site mutagenesis, cassettes containing various domains of MRP1/ABCC1 cDNA were first released from the full-length cDNA by double digestion (Not I/BamH I for Cys43Ser and Thr73Ile mutation; EcoN I/BsmB I for Arg723Gln mutation; and BsmB I/EcoR I for Arg1058Gln mutation), cloned into pGEM-T Easy (Promega), followed by site-directed mutagenesis using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, California, USA) with the following primers (the substituted nucleotides are italicized): 50 -TCGTGTGGGTGCCTTGTTTTTACCTCTGGGC-30 (Cys43Ser); 50 -GATGACACCTCTCAACAAAACCAAA ACTGCCTTGGGATTTT-30 (Thr73lle); 50 -GGATTC AGAATGATTCTCTCCAAGAAAACATCCTTTTTGGA TG-30 (Arg723Gln); 50 -GCACAGCATCCTGCGGTCAC CCATGAGCT-30 (Arg1058Gln). Login to comment
62 The real-time PCR was carried Table 1 Primers and PCR condition for determining polymorphisms Polymorphisms Oligonucleotide primers Annealing temperature (1C) Restriction enzyme Cys43Ser (128G > C) F: GGTCCTCGTGTGGGTGCCAT 57.5 Nla III R: TAGAAGAAGGAACTTAGGGTCAACT Thr73Ile (218C > T) F: TCAGATGACACCTCTCAACAGAA 56.7 Hinf I R: CCAGTTTTCACCTCCCACATTAT Arg723Gln (2168G > A) F: GCCTGGATTCAGAATGATTCTCTTC 52.0 Taq I R: TACTGACCTTCTCGCCAATCTCTGT Arg1058Gln (3173G > A) F: TCTGCATTGTGGAGTTTT 53.0 Pst I R: GACGAAGAAGTAGATGAGGC F, forward; R, reverse. Login to comment
92 It is interesting to note that the Arg723Gln mutation is located between the Walker A and Walker B motives in NBD1, which is important for the ATPase activity of MRP1/ABCC1 to provide energy for substrate transport. Login to comment
94 The distribution of polymorphisms in Chinese population In the 208 volunteers, genotyping of the Arg723Gln mutation identified 185 GG homozygotes, 22 GA Characterization of ABCC polymorphisms Yin et al. 209 heterozygotes, and one AA homozygote. Login to comment
95 The frequencies of A and G alleles for the Arg723Gln mutation were 5.8 and 94.%, respectively. Login to comment
101 The genotyping and allelic frequencies of SNPs for Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations are shown in Table 2. Login to comment
102 The distribution of these SNPs in different populations and their comparison are summarized in Table 3. mRNA and protein expression levels of MRP1/ABCC1 mutants To determine whether these SNPs affect MRP1/ABCC1 expression, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations were recreated in MRP1/ABCC1 cDNA by site-directed mutagenesis and transiently transfected into HEK293 and CHO-K1 cells. Login to comment
107 Subcellular localization of wild-type and mutant MRP1/ABCC1 To further determine whether Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations influence the trafficking of MRP1/ABCC1 to the cell surface, we detected the subcellular localization of wild-type and mutant MRP1/ABCC1 in transiently transfected HEK293 and CHO-K1 cells through the process of immunostaining. Login to comment
108 As shown in Fig. 3, strong plasma membrane staining was observed with all cells that are transfected with either wild-type or mutant MRP1/ABCC1, but not in the Table 3 Comparison of distributive frequencies of MRP1/ABCC1 Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln polymorphisms in different ethnic populations Allelic frequency (n) SNPs (nucleic acid substitution) m w Population References NCBI SNP ID Cys43Ser (128G > C) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41395947 0 (0/26) 1 (26/26) Japanese [14] 0.005 (2/416) 0.995 (414/416) Chinese This study Thr73Ile (218C > T) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41494447 0 (0/26) 1 (26/26) Japanese [14] 0.037 (2/54) 0.963 (52/54) Chinese [17] 0.014 (1/72) 0.986 (71/72) Chinese [15] 0.029 (2/70) 0.971 (68/70) Malay [15] 0 (0/70) 1 (70/70) Indian [15] 0(0/72) 1 (72/72) Caucasian [15] 0.014 (6/416) 0.986 (410/416) Chinese This study Arg723Gln (2168G > A) 0.073 (7/96) 0.927 (89/96) Japanese [16] rs4148356 0.038 (1/26) 0.962 (25/26) Japanese [14] 0.056(3/54) 0.944 (51/54) Chinese [17] 0 (0/72) 1 (72/72) Chinese [15] 0.029 (2/70) 0.971 (68/70) Malay [15] 0 (0/70) 1 (70/70) Indian [15] 0 (0/72) 1 (72/72) Caucasian [15] 0.058 (24/416) 0.942 (392/416) Chinese* This study Arg1058Gln (3173G > A) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41410450 0 (0/26) 1 (26/26) Japanese [14] 0.005 (2/416) 0.995 (414/416) Chinese This study m, mutant; MRP1/ABCC1, multidrug-resistance-associated protein 1; SNP, single nucleotide polymorphism; w, wild-type. Login to comment
110 Table 2 Genotyping and allelic frequencies of MRP1/ABCC1 polymorphisms SNPs (nucleic acid substitution) Allele Allelic frequency (n) Genotype Genotype frequency (n) Cys43Ser (128G > C) G 0.995 (414) GG 0.990 (206) C 0.005 (2) GC 0.010 (2) CC 0 (0) Thr73lle (218C > T) C 0.986 (410) CC 0.971 (202) T 0.014 (6) CT 0.029 (6) TT 0 (0) Arg723Gln (2168G > A) G 0.942 (392) GG 0.889 (185) A 0.058 (24) GA 0.106 (22) AA 0.005 (1) Arg1058Gln (3173G > A) G 0.995 (414) GG 0.990 (206) A 0.005 (2) GA 0.010 (2) AA 0 (0) MRP1/ABCC1, multidrug-resistance-associated protein 1; SNP, single nucleotide polymorphism. Login to comment
112 HEK293 and CHO-K1 cells were transiently transfected with vector control or wild-type, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 followed by preparation of RNAs for quantitative real-time reverse-transcribed PCR analysis of MRP1/ABCC1 R. level (relative level) (a), or preparation of cell lysates for western blot analysis of MRP1/ABCC1 protein level (b). Login to comment
116 Fig. 3 Vector Wild-type Cys43Ser Thr73lle Arg723Gln Arg1058Gln Vector MRP1/ ABCC1 P1 MRP1/ ABCC1 P1(a) MergeMerge Wild-type Cys43Ser Thr73lle Arg723Gln Arg1058Gln (b) Effect of mutations on subcellular localization of multidrug resistance-associated protein 1 (MRP1/ABCC1). Login to comment
117 HEK293 (a) and CHO-K1 (b) cells were transiently transfected with vector control or wild-type, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1, followed by fixation and immunostaining of MRP1/ABCC1 using MRPr1 antibody and fluorescein isothiocyanate-conjugated secondary antibody. Login to comment
126 HEK293 cells stably transfected with vector, wild-type, or Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 were exposed to cisplatin, paclitaxel, etoposide, daunorubicin, doxorubicin, methotrexate, vinblastine, and vincristine at various concentrations for 72 h at 371C followed by methyl thiazolyl tetrazolium assay and determination of half maximal inhibitory concentration (IC50). Login to comment
133 In HEK293 cells, Arg723Gln confers lower resistance to all drugs compared with wild-types. Login to comment
134 In CHO-K1 cells, Arg723Gln also significantly decreased resistance to all drugs except cisplatin, paclitaxel, and methotrexate when compared with wild-type MRP1/ABCC1. Login to comment
136 CHO-K1 cells stably transfected with vector, wild-type, or Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 were exposed to cisplatin, paclitaxel, etoposide, daunorubicin, doxorubicin, methotrexate, vinblastine, and vincristine at various concentrations for 72 h at 371C followed by methyl thiazolyl tetrazolium assay and determination of half maximal inhibitory concentration (IC50). Login to comment
142 Discussion In this study, we identified the allelic frequencies of Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln in a mainland Chinese population. Login to comment
144 However, the study discovered that Arg723Gln could diminish the resistance activity of MRP1/ABCC1 to daunorubicin, doxorubicin, etoposide, vinblastine, and vincristine. Login to comment
147 This study shows for the first time the frequencies of nonsynonymous mutations, Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln, in a large sample of healthy volunteers from mainland China. Login to comment
151 However, we found 22 heterozygotes and one homozygote in the 208 volunteers for Arg723Gln. Login to comment
154 However, the frequencies of the Arg723Gln A allele and the Thr73Ile Tallele in the Chinese population were higher than the Caucasians (P < 0.05) of whom these alleles have not been found. Login to comment
155 In contrast, Arg723Gln has the highest frequency in Asian populations. Login to comment
161 Table 4 Resistance factors of transfected HEK293 cells to chemotherapeutic agents Resistance factorsa Drugs WT MRP1/ABCC1 Cys43Ser (128G > C) Thr73lle (218C > T) Arg723Gln (2168G > A) Arg1058Gln (3173G > A) Cisplatin 0.95 ± 0.24 0.95 ± 0.14 0.83 ± 0.18 0.76 ± 0.20 1.10 ± 0.10 Paclitaxel 1.14 ± 0.09 0.99 ± 0.16 0.99 ± 0.21 1.10 ± 0.22 1.04 ± 0.16 Daunorubicin 17.82 ± 3.15 17.27 ± 2.37 19.73 ± 1.98 9.09 ± 1.68 8.73 ± 2.62 Doxorubicin 14.38 ± 0.75 15.13 ± 0.91 14.63 ± 1.52 3.63 ± 1.20 2.38 ± 1.03 Etoposide 12.65 ± 2.09 11.51 ± 1.92 13.08 ± 1.84 4.41 ± 0.67 6.65 ± 1.05 Methotrexate 10.80 ± 1.33 10.50 ± 1.58 6.70 ± 0.95 6.20 ± 0.90 10.70 ± 1.26 Vinblastine 5.44 ± 1.36 5.72 ± 1.60 5.64 ± 1.04 2.80 ± 1.26 5.44 ± 1.62 Vincristine 11.35 ± 3.11 11.17 ± 2.91 8.89 ± 2.40 3.76 ± 1.15 11.18 ± 2.82 IC50, half maximal inhibitory concentration; MRP1/ABCC1, multidrug resistance-associated protein 1; WT, wild-type. Login to comment
163 Table 5 Resistance factors of transfected CHO-K1 cells to chemotherapeutic agents Resistance factorsa Drugs WT MRP1/ABCC1 Cys43Ser (128G > C) Thr73lle (218C > T) Arg723Gln (2168G > A) Arg1058Gln (3173G > A) Cisplatin 0.94 ± 0.05 0.98 ± 0.12 0.89 ± 0.04 0.99 ± 0.09 0.89 ± 1.10 Paclitaxel 0.94 ± 0.11 0.88 ± 0.10 0.96 ± 0.05 1.00 ± 0.07 0.96 ± 0.06 Daunorubicin 12.97 ± 2.76 13.09 ± 2.68 13.07 ± 2.81 2.96 ± 0.58 4.81 ± 1.01 Doxorubicin 15.44 ± 1.37 15.84 ± 0.91 15.44 ± 1.95 6.46 ± 0.90 7.22 ± 0.86 Etoposide 16.57 ± 1.91 16.44 ± 1.95 4.84 ± 0.51 3.56 ± 0.36 4.77 ± 0.56 Methotrexate 3.78 ± 1.07 3.70 ± 1.01 3.60 ± 1.39 3.75 ± 1.08 1.67 ± 0.53 Vinblastine 10.35 ± 1.61 10.32 ± 1.70 10.27 ± 1.66 5.73 ± 0.87 8.50 ± 1.32 Vincristine 6.93 ± 1.13 6.78 ± 1.18 6.79 ± 1.04 2.27 ± 0.34 6.85 ± 1.14 IC50, half maximal inhibitory concentration; MRP1/ABCC1, multidrug resistance-associated protein 1; WT, wild-type. Login to comment
165 214 The four SNPs (Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln) studied here are located in various domains of human MRP1/ABCC1. Login to comment
166 Although the location of SNPs in protein has not always been an accurate predictor of phenotypic change in the expression or function of the protein [18,19], the location of Arg723Gln in the NBD1 suggests that this mutation likely would affect the function of the protein by affecting the ATPase activity of MRP1/ABCC1. Login to comment
167 Indeed, we found that Arg723Gln mutation decreased the resistance of the cell to nearly all drugs tested in HEK293 and CHO-K1 cells (see also, discussion in the last paragraph). Login to comment
168 Interestingly, Arg723Gln is also the most commonly found nonsynonymous SNP of the four SNPs in Chinese and other Asian populations. Login to comment

[hide] MRP1 polymorphisms associated with citalopram resp... J Clin Psychopharmacol. 2010 Apr;30(2):116-25. Lee SH, Lee MS, Lee JH, Kim SW, Kang RH, Choi MJ, Park SJ, Kim SJ, Lee JM, Cole SP, Lee MG
MRP1 polymorphisms associated with citalopram response in patients with major depression.
J Clin Psychopharmacol. 2010 Apr;30(2):116-25., [PMID:20520284]

Abstract [show]
Multidrug resistance protein 1 (MRP1, ABCC1) transports antidepressive agents in the endothelial cells of the blood-brain barrier. Therefore, polymorphisms in the MRP1 gene may affect the treatment response of antidepressants. This study was aimed to identify the association between genetic variations in MRP1/ABCC1 and the therapeutic response to the antidepressant citalopram. One hundred and twenty-three patients who had been treated with citalopram monotherapy to control their major depressive disorder were recruited, and genotype data from 64 patients who had completed their 8-week follow-up were evaluated together with those from 100 controls. Nine MRP1 single nucleotide polymorphisms (SNPs) showing more than 5% allele frequency in the Korean population were analyzed. The c.4002G>A, a synonymous SNP in exon 28, showed a strong association with the remission state at 8 weeks (P = 0.005, odds ratio [OR], 4.7, 95% confidence interval [CI], 1.5 approximately 14.7). The c.4002G>A forms a linkage disequilibrium block with 3 other SNPs including c.5462T>A in the 3' untranslated region. Accordingly, the haplotype showed a significant association with the remission state (P = 0.014). Subsequent molecular studies also supported the association between these MRP1 polymorphisms and the citalopram response. Thus, kinetic studies using MRP1-enriched membrane vesicles revealed that citalopram is a substrate of MRP1 (Km = 1.99 microM, Vmax = 137 pmol/min per milligram protein). In addition, individuals with c.4002G>A or c.5462T>A polymorphisms showed higher MRP1 mRNA levels in peripheral blood cells. These results suggest that MRP1 polymorphisms may be a predictive marker of citalopram treatment in major depression.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
68 Genotype and Allele Analysis of SNPs in Control and Patients SNP (rs#) Position Control vs Patients Remitted vs Nonremitted Genotype Genotype Allele CTL PT W2 P R NR W2 P R NR W2 P g.-1989A9G AA 17 18 3.13 0.209 10 8 0.03 0.986 A 36 29 0.03 0.872 (rs12929977) AG 56 29 16 13 (0.930) Promoter GG 25 17 9 8 G 34 29 g.-1841G9A GG 21 19 2.93 0.231 11 8 0.28 0.868 G 36 30 0.10 0.753 (rs4148330) GA 58 28 14 14 (0.624) Promoter AA 20 15 8 7 A 30 28 c.1062T9C(N354N) CC 27 20 1.83 0.400 11 9 1.94 0.378 C 40 29 0.65 0.420 (rs35587) CT 39 29 18 11 (0.973) Exon 9 TT 33 15 6 9 T 30 29 c.2168G9A(R723Q) GG 91 53 3.42 *0.142 30 23 1.72 *0.491 G 64 52 0.12 0.732 (rs4148356) GA 7 10 4 6 (0.499) Exon 17 AA 1 1 1 0 A 6 6 IVS18-30G9C GG 53 39 0.90 *0.676 22 17 0.40 *0.897 G 56 45 0.11 0.739 (rs2074087) GC 42 23 12 11 (0.729) Intron 18 CC 4 2 1 1 C 14 13 c.4002G9A(S1334S) GG 78 46 2.26 *0.328 21 25 6.01 *† 0.038 G 52 54 7.89 † 0.005 (rs2239330) GA 19 14 10 4 *† (0.026) Exon 28 AA 2 4 4 0 A 18 4 IVS28-45G9A GG 67 38 0.91 0.633 18 20 3.38 *0.194 G 46 48 3.77 0.052 (rs212087) GA 23 18 10 8 (0.195) Intron 28 AA 9 7 6 1 A 22 10 IVS29-13delT TT 38 21 0.42 0.810 15 6 3.53 0.171 T 44 28 2.73 0.099 (rs4148379) T/d 43 30 14 16 (0.060) Intron 29 d/d 17 11 5 6 d 24 28 c.5462T9A(3`UTR) TT 71 42 0.80 *0.671 20 22 4.14 *0.133 T 51 51 4.45 † 0.035 (rs212090) TA 22 18 11 7 (0.117) Exon 31 AA 7 4 4 0 A 19 7 *Fisher exact test was done; the P values were calculated using the codominant model. Login to comment

[hide] Polymorphisms in the multiple drug resistance prot... Ann Hematol. 2010 Nov;89(11):1133-40. Epub 2010 Jun 8. Buda G, Ricci D, Huang CC, Favis R, Cohen N, Zhuang SH, Harousseau JL, Sonneveld P, Blade J, Orlowski RZ
Polymorphisms in the multiple drug resistance protein 1 and in P-glycoprotein 1 are associated with time to event outcomes in patients with advanced multiple myeloma treated with bortezomib and pegylated liposomal doxorubicin.
Ann Hematol. 2010 Nov;89(11):1133-40. Epub 2010 Jun 8., [PMID:20532504]

Abstract [show]
Single nucleotide polymorphisms (SNPs) in the multiple drug resistance protein 1 (MRP1) and P-glycoprotein 1 (MDR1) genes modulate their ability to mediate drug resistance. We therefore sought to retrospectively evaluate their influence on outcomes in relapsed and/or refractory myeloma patients treated with bortezomib or bortezomib with pegylated liposomal doxorubicin (PLD). The MRP1/R723Q polymorphism was found in five subjects among the 279 patient study population, all of whom received PLD + bortezomib. Its presence was associated with a longer time to progression (TTP; median 330 vs. 129 days; p = 0.0008), progression-free survival (PFS; median 338 vs. 129 days; p = 0.0006), and overall survival (p = 0.0045). MDR1/3435(C > T), which was in Hardy-Weinberg equilibrium, showed a trend of association with PFS (p = 0.0578), response rate (p = 0.0782) and TTP (p = 0.0923) in PLD + bortezomib patients, though no correlation was found in the bortezomib arm. In a recessive genetic model, MDR1/3435 T was significantly associated with a better TTP (p = 0.0405) and PFS (p = 0.0186) in PLD + bortezomib patients. These findings suggest a potential role for MRP1 and MDR1 SNPs in modulating the long-term outcome of relapsed and/or refractory myeloma patients treated with PLD + bortezomib. Moreover, they support prospective studies to determine if such data could be used to tailor therapy to the genetic makeup of individual patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
3 The MRP1/R723Q polymorphism was found in five subjects among the 279 patient study population, all of whom received PLD+ bortezomib. Login to comment
30 Like MDR1, it confers resistance to anthracyclines [19], and because the MRP1 mutation Arg723Gln has an effect on MRP1 expression and trafficking, it significantly reduced MRP1-mediated resistance to a wide spectrum of drugs [20]. Login to comment
33 Specifically, we tested for the presence of the MDR1 polymorphisms 1236C>T, 2677G>W (W=T or A), and 3435C>T and the MRP1 gene R723Q polymorphism. Login to comment
43 Analyses The objectives of the pharmacogenomic analyses were to test whether the MDR1 gene polymorphisms-3435C>T (RefSNP ID rs1045642), 2677G>W (W=T or A; RefSNP ID rs2032582), and 1236C>T (RefSNP ID rs1128503), and the MRP1 gene R723Q polymorphism (RefSNP ID rs4148356), were associated with a different overall response rate (CR+partial response) and response durability (TTP, PFS, and OS). Login to comment
67 Influence of MDR1 and MRP1 SNPs The possible presence of associations between 1236C>T, 2677G>W (W=Tor A), and 3435C>T in MDR1 and R723Q in MRP1 and the response rate of the bortezomib or PLD+ bortezomib groups, as well as response durability measures, were then evaluated. Login to comment
70 In the present study, the MRP1 gene polymorphism R723Q was significantly associated with time to progression (Fig. 1a; p= 0.0008), progression-free survival (Fig. 1b; p=0.0006), and overall survival (Fig. 1c; p=0.0045) in subjects who received PLD+bortezomib. Login to comment
76 Table 2 Summary statistics of the studied genetic markers Marker Frequency minor allele Hardy-Weinberg equilibrium p value n/Genotype frequencies of homozygous wild type n/Genotype frequencies of heterozygous n/Genotype frequencies of homozygous variant Missing data MDR1 1236C>T 0.4355 0.6110 91 (0.3262) 133 (0.4767) 55 (0.1971) 0 MDR1 2677G>W 0.4373 0.7430 87 (0.3118) 140 (0.5018) 52 (0.1864) 0 MDR1 3435C>T 0.4910 0.8145 73 (0.2626) 137 (0.4928) 68 (0.2446) 1 MRP1 R723Q 0.0090 0.8800 274 (0.9821) 5 (0.0179) 0 (0) 0 Patient Prior therapies Paraprotein type and level Cytogenetics 1 1. Login to comment
81 Doxorubicin, melphalan, cyclophosphamide Table 3 Clinical characteristics of patients with the MRP1 R723Q polymorphism a b c Fig. 1 Time to progression (panel a), progression-free survival (panel b), and overall survival (panel c) of patients treated for their relapsed and/or refractory multiple myeloma with PLD+bortezomib is plotted based on the presence of either the A/G or G/G SNP at R723Q in MRP 1 using the Kaplan-Meier method Discussion The introduction of novel agents, and their use in rationally designed combination regimens, has revolutionized the therapy of multiple myeloma and contributed to an increasing overall survival [23, 24]. Login to comment
87 Fig. 2 Progression-free survival of patients treated for their relapsed and/or refractory multiple myeloma with PLD+bortezomib is plotted based on the presence of either the C/C, C/T, or T/T SNP at C3435T in MDR1 using the Kaplan-Meier method Fig. 3 Time to progression of patients treated for their relapsed and/or refractory multiple myeloma with PLD+bortezomib is plotted based on the presence of the five most common MDR1 diplotypes using the Kaplan-Meier method In the present retrospective study, the MRP1 gene polymorphism R723Q was significantly associated with TTP (Fig. 1a), PFS (Fig. 1b), and OS (Fig. 1c) in subjects who received PLD+bortezomib. Login to comment
88 Studies of the MRP1 mutation Arg723Gln have not shown that it impacts on model substrate transport [30], but it does reduce resistance to agents such as daunorubicin and doxorubicin [19], and thus it may exert its effect instead through MRP1 expression and trafficking. Login to comment
90 Since anthracyclines exert their antitumor effects in part through the induction of just such stress [33], it may be differences in the ability of the MRP1 R723Q isoform to play such a role that increased the sensitivity to PLD+bortezomib, though this hypothesis will require laboratory testing. Login to comment
91 Moreover, further studies of the impact of the MRP1 R723Q allele will be needed to confirm our findings, given the few subjects with this genotype that were present in our population. Login to comment

[hide] Structural and functional properties of human mult... Curr Med Chem. 2011;18(3):439-81. He SM, Li R, Kanwar JR, Zhou SF
Structural and functional properties of human multidrug resistance protein 1 (MRP1/ABCC1).
Curr Med Chem. 2011;18(3):439-81., [PMID:21143116]

Abstract [show]
Multidrug ABC transporters such as P-glycoprotein (P-gp/MDR1/ABCB1) and multidrug resistance protein 1 (MRP1/ABCC1) play an important role in the extrusion of drugs from the cell and their overexpression can be a cause of failure of anticancer and antimicrobial chemotherapy. Recently, the mouse P-gp/Abcb1a structure has been determined and this has significantly enhanced our understanding of the structure-activity relationship (SAR) of mammalian ABC transporters. This paper highlights our current knowledge on the structural and functional properties and the SAR of human MRP1/ABCC1. Although the crystal structure of MRP1/ABCC1 has yet to be resolved, the current topological model of MRP1/ABCC1 contains two transmembrane domains (TMD1 and TMD2) each followed by a nucleotide binding domain (NBD) plus a third NH2-terminal TMD0. MRP1/ABCC1 is expressed in the liver, kidney, intestine, brain and other tissues. MRP1/ABCC1 transports a structurally diverse array of important endogenous substances (e.g. leukotrienes and estrogen conjugates) and xenobiotics and their metabolites, including various conjugates, anticancer drugs, heavy metals, organic anions and lipids. Cells that highly express MRP1/ABCC1 confer resistance to a variety of natural product anticancer drugs such as vinca alkaloids (e.g. vincristine), anthracyclines (e.g. etoposide) and epipodophyllotoxins (e.g. doxorubicin and mitoxantrone). MRP1/ABCC1 is associated with tumor resistance which is often caused by an increased efflux and decreased intracellular accumulation of natural product anticancer drugs and other anticancer agents. However, most compounds that efficiently reverse P-gp/ABCB1-mediated multidrug resistance have only low affinity for MRP1/ABCC1 and there are only a few effective and relatively specific MRP1/ABCC1 inhibitors available. A number of site-directed mutagenesis studies, biophysical and photolabeling studies, SAR and QSAR, molecular docking and homology modeling studies have documented the role of multiple residues in determining the substrate specificity and inhibitor selectivity of MRP1/ABCC1. Most of these residues are located in the TMs of TMD1 and TMD2, in particular TMs 4, 6, 7, 8, 10, 11, 14, 16, and 17, or in close proximity to the membrane/cytosol interface of MRP1/ABCC1. The exact transporting mechanism of MRP1/ABCC1 is unclear. MRP1/ABCC1 and other multidrug transporters are front-line mediators of drug resistance in cancers and represent important therapeutic targets in future chemotherapy. The crystal structure of human MRP1/ABCC1 is expected to be resolved in the near future and this will provide an insight into the SAR of MRP1/ABCC1 and allow for rational design of anticancer drugs and potent and selective MRP1/ABCC1 inhibitors.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
816 There are at least 15 naturally occurring mutations identified in MRP1/ABCC1, including Cys43Ser in TM1, Thr73Ile in CL1, Ser92Phe in TM2, Arg230Asn in L0, Val353Met at TM6/TM7 interface, Arg433Ser in TM8, Gly671Val in TM11, Arg723Gln located between the Walker A and Walker B motifs of NBD1, Ala861Thr at NBD1/TM12 interface, Ala989Thr in TM12, Cys1047Ser in TM13, Arg1058Gln in CL7, Val1146Ile in CL7, Thr1337Ala between the Walker A and Walker B motifs of NBD2, and Thr1401Met, and many of them have been found to affect its transport activity [171, 362, 363, 366, 367, 377-384]. Login to comment
820 When Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln were separately transfected in CHO-K1 or HEK293 cells, the cells displayed altered resistance profiles to a panel of anticancer drugs compared to the wild-type [366]. Login to comment
821 In HEK293 cells, Arg723Gln confers lower resistance to all drugs compared with wild-types. Login to comment
822 In CHO-K1 cells, Arg723Gln significantly decreased resistance to all drugs tested except cisplatin, paclitaxel and MTX. Login to comment
828 For example, the frequencies of the Arg723Gln A allele and the Thr73Ile T allele in Chinese population were higher than the Caucasians [366]. Login to comment

[hide] Promoter polymorphism of MRP1 associated with redu... World J Gastroenterol. 2010 Dec 28;16(48):6104-10. Zhao J, Yu BY, Wang DY, Yang JE
Promoter polymorphism of MRP1 associated with reduced survival in hepatocellular carcinoma.
World J Gastroenterol. 2010 Dec 28;16(48):6104-10., 2010-12-28 [PMID:21182225]

Abstract [show]
AIM: to investigate the effect of the G-1666A polymorphism in the multidrug resistance related protein-1 (MRP1) on outcome of hepatocellular carcinoma (HCC). METHODS: a cohort of 162 patients with surgically resected HCC who received no postsurgical treatment until relapse was studied. Genotyping was performed by polymerase chain reaction-restriction fragment length polymorphism analysis. Electrophoretic mobility shift assay (EMSA) was used to evaluate the influence of the G-1666A polymorphism on the binding affinity of the MRP1 promoter with its putative transcription factors. RESULTS: Kaplan-Meier analysis showed that patients with GG homologues had a reduced 4-year disease-free survival compared with those carrying at least one A allele (P = 0.011). Multivariate Cox regression analysis indicated that the -1666GG genotype represented an independent predictor of poorer disease-free survival [hazard ratio (HR) = 3.067, 95% confidence interval (CI): 1.587-5.952, P = 0.001], and this trend became worse in men (HR = 3.154, 95% CI: 1.604-6.201, P = 0.001). A similar association was also observed between 4-year overall survival and the polymorphism in men (HR = 3.342, 95% CI: 1.474-7.576, P = 0.004). Moreover, EMSA suggested that the G allele had a stronger binding affinity to nuclear proteins. CONCLUSION: the MRP1 -1666GG genotype predicted a worse outcome and was an independent predictor of poor survival in patients with HCC from Southeast China.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
45 For example, G2168A (Arg723Gln) can affect patients` sensitivity to chemotherapy in ovarian cancer[11] . Login to comment

[hide] ABCC1 polymorphism Arg723Gln (2168G > A) is associ... Clin Exp Pharmacol Physiol. 2011 Sep;38(9):632-7. doi: 10.1111/j.1440-1681.2011.05571.x. Yin JY, Han LF, Huang Q, Xu XJ, Zhou HH, Liu ZQ
ABCC1 polymorphism Arg723Gln (2168G > A) is associated with lung cancer susceptibility in a Chinese population.
Clin Exp Pharmacol Physiol. 2011 Sep;38(9):632-7. doi: 10.1111/j.1440-1681.2011.05571.x., [PMID:21736601]

Abstract [show]
1. In a previous in vitro study, we showed that the Arg723Gln (2168G > A) polymorphism significantly ABCC1-induced multidrug resistance. The aim of the present study was to further investigate the association of this polymorphism with lung cancer susceptibility and chemotherapy response in a Chinese population. 2. A total of 77 lung cancer patients (54 men, 23 women) and 71 cancer-free controls (49 men, 22 women) were enrolled in the study. Genomic DNA was extracted from peripheral blood and all samples were genotyped using polymerase chain reaction-restriction fragment length polymorphism. 3. Individuals carrying the 723Gln (A) allele have a 3.4-fold increased risk (adjusted odds ratio (OR) 3.42; 95% confidence interval (CI) 1.29-9.06; P = 0.013) of lung cancer compared with wild-type individuals. Further stratified analysis indicated that older individuals (> 50 years) carrying the 723Gln (A) allele have the highest susceptibility to lung cancer (adjusted OR 4.10; 95% CI 1.25-13.48; P = 0.020). However, no substantial association was found between the Arg723Gln (2168G > A) polymorphism and chemotherapy response in Chinese lung cancer patients. 4. In conclusion, the Arg723Gln (2168G > A) polymorphism of ABCC1 appears to be a potential susceptibility marker for lung cancer in the Chinese population, especially in older people.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
1 Please cite this article as an "Accepted Article"; doi: 10.1111/j.1440-1681.2011.05571.x Received Date : 11-May-2011 Revised Date : 03-Jul-2011 Accepted Date : 04-Jul-2011 Article type : Original Article MRP1/ABCC1 polymorphism Arg723Gln (2168G>A) is associated with lung cancer susceptibility in Chinese population. Login to comment
4 Our previous in vitro study showed that the Arg723Gln (2168G>A) polymorphism significantly reduced multidrug resistance-associated protein 1 (MRP1/ABCC1) induced multidrug resistance. Login to comment
12 However, no substantial association was found between the Arg723Gln (2168G>A) polymorphism and chemotherapy response in Chinese lung cancer patients. Login to comment
14 We conclude that the Arg723Gln (2168G>A) polymorphism of MRP1/ABCC1 is a potential susceptibility marker for lung cancer in the Chinese population, especially in older people. Login to comment
24 For example, Cys43Ser (128G>C), which is located in the NH2 proximal region, was found to be important for the maintenance of MRP1/ABCC1-induced drug resistance.6 Another polymorphism, Arg433Ser (1299G>A), has the potential to increase resistance to doxorubicin in transfected Hela cells.7 Our previous investigation also showed that Arg723Gln (2168G>A) could significantly reduce MRP1/ABCC1 induced MDR.8 Furthermore, a number of in vivo studies have provided the clinical data to support the important role of MRP1/ABCC1 polymorphisms in disease susceptibility, drug metabolism and toxicity. Login to comment
26 In this study, we aim to provide information about the clinical role of MRP1/ABCC1 Arg723Gln (2168G>A) in disease susceptibility and drug response. Login to comment
27 We first examined the association between Arg723Gln (2168G>A) and lung cancer susceptibility in a Chinese population, and then determined the relationship between this SNP and chemotherapy response. Login to comment
54 By genotyping for the Arg723Gln (2168G>A) polymorphism, we identified 57 GG homozygotes, 19 GA heterozygotes and 1 AA homozygote in lung cancer population, and 63 GG homozygotes and 8 GA heterozygotes in the control population (Figure 1). Login to comment
58 Association between MRP1/ABCC1 Arg723Gln (2168G>A) and lung cancer risk Because Gln723Gln (AA) homozygotes are rare and only 1 was found in this study, it was combined with the Arg723Gln (GA) heterozygotes as a group for analysis. Login to comment
59 Logistical regression analysis shows that MRP1/ABCC1 Arg723Gln (2168G>A) is significantly associated with risk of lung cancer. Login to comment
63 Arg723Gln (2168G>A) does not increase risk of lung cancer among variant smoking status population, suggesting that there is no interaction between this polymorphism and smoking that contributes to the risk of lung cancer. Login to comment
66 Association between MRP1/ABCC1 Arg723Gln (2168G>A) and chemotherapeutic response Of all 77 patients, 30 (39.0%) were drug responders and 47 (61.0%) were non-responders. Login to comment
69 Therefore, there is no statistically association between MRP1/ABCC1 Arg723Gln (2168G>A) and platinum based lung cancer chemotherapy. Login to comment
70 Discussion In this study, we examined the association between the MRP1/ABCC1 polymorphism Arg723Gln (2168G>A) and lung cancer susceptibility, as well as chemotherapeutic sensitivity, in a Chinese population. Our results suggest that this SNP is a potential susceptibility marker for lung cancer in this Chinese population, especially in older individuals. Login to comment
72 For example, Weiss and collaborators demonstrated that the polymorphisms rs119774 and rs215066 were related to lung function improvement in asthma patients after receiving montelukast and zileuton treatment.15,16 Two other SNPs, rs4148382 and rs212093 were also found contribute to the decline of lung function.17 Additionally, Wang et al. found that rs212090 is associated with an increased risk of developing lung cancer.18 However, to date, all of the SNPs that have been studied are located in non-coding regions of MRP1/ABCC1 and no non-synonymous SNPs have been investigated, as most of the identified non-synonymous SNPs have very low frequencies in the population. Our previous study showed that Arg723Gln (2168G>A) has a relatively high allelic frequency in the Chinese population, and this SNP cause a significantly change in protein function. Login to comment
75 Thus, we believe that MRP1/ABCC1 Arg723Gln (2168G>A) is related with lung cancer susceptibility. Login to comment
79 Although MRP1/ABCC1 is expressed in both normal and cancerous lung tissues, previous investigations observed the changed expression level of MRP1 in lung cancer cells and tissues.21-23 Based on these findings, we speculate that MRP1/ABCC1 Arg723Gln (2168G>A) causes protein dysfunction, and as a result, decreases the capacity for clearing toxins. Login to comment
86 Thus, older individuals carrying the Arg723Gln (2168G>A) polymorphism have the highest susceptibility for developing lung cancer. Login to comment
90 Thus, our result implies that older subjects carrying the Arg723Gln (2168G>A) mutant allele should be made aware of their susceptibility for developing lung cancer. Login to comment
94 Our previous in vitro study showed that Arg723Gln (2168G>A) significantly reduced MRP1/ABCC1 induced MDR, as we detected the association of this SNP with lung cancer chemotherapeutic efficacy.8 However, in the current study, no significant association was detected between MRP1/ABCC1 Arg723Gln (2168G>A) and chemotherapy response. Login to comment
95 This conclusion suggests that MRP1/ABCC1 Arg723Gln (2168G>A) has no contribution to increased drug resistance in the treatment of lung cancer. Login to comment
100 Thus, we speculate that these differences explain why we found that there was no significant contribution of MRP1/ABCC1 Arg723Gln (2168G>A) to drug response in vivo. Login to comment
102 To our knowledge, this study is the first to investigate the role of the MRP1/ABCC1 Arg723Gln polymorphism in drug response in patients. Login to comment

[hide] Xenobiotic, bile acid, and cholesterol transporter... Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26. Klaassen CD, Aleksunes LM
Xenobiotic, bile acid, and cholesterol transporters: function and regulation.
Pharmacol Rev. 2010 Mar;62(1):1-96. Epub 2010 Jan 26., [PMID:20103563]

Abstract [show]
Transporters influence the disposition of chemicals within the body by participating in absorption, distribution, and elimination. Transporters of the solute carrier family (SLC) comprise a variety of proteins, including organic cation transporters (OCT) 1 to 3, organic cation/carnitine transporters (OCTN) 1 to 3, organic anion transporters (OAT) 1 to 7, various organic anion transporting polypeptide isoforms, sodium taurocholate cotransporting polypeptide, apical sodium-dependent bile acid transporter, peptide transporters (PEPT) 1 and 2, concentrative nucleoside transporters (CNT) 1 to 3, equilibrative nucleoside transporter (ENT) 1 to 3, and multidrug and toxin extrusion transporters (MATE) 1 and 2, which mediate the uptake (except MATEs) of organic anions and cations as well as peptides and nucleosides. Efflux transporters of the ATP-binding cassette superfamily, such as ATP-binding cassette transporter A1 (ABCA1), multidrug resistance proteins (MDR) 1 and 2, bile salt export pump, multidrug resistance-associated proteins (MRP) 1 to 9, breast cancer resistance protein, and ATP-binding cassette subfamily G members 5 and 8, are responsible for the unidirectional export of endogenous and exogenous substances. Other efflux transporters [ATPase copper-transporting beta polypeptide (ATP7B) and ATPase class I type 8B member 1 (ATP8B1) as well as organic solute transporters (OST) alpha and beta] also play major roles in the transport of some endogenous chemicals across biological membranes. This review article provides a comprehensive overview of these transporters (both rodent and human) with regard to tissue distribution, subcellular localization, and substrate preferences. Because uptake and efflux transporters are expressed in multiple cell types, the roles of transporters in a variety of tissues, including the liver, kidneys, intestine, brain, heart, placenta, mammary glands, immune cells, and testes are discussed. Attention is also placed upon a variety of regulatory factors that influence transporter expression and function, including transcriptional activation and post-translational modifications as well as subcellular trafficking. Sex differences, ontogeny, and pharmacological and toxicological regulation of transporters are also addressed. Transporters are important transmembrane proteins that mediate the cellular entry and exit of a wide range of substrates throughout the body and thereby play important roles in human physiology, pharmacology, pathology, and toxicology.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
7118 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1↔ Intracellular C218T T73I 1↔ Normal C257T S92F 2↔ Normal C350T T117M 2↔ Normal G689A R230Q ↔ Normal G1057A V353M N.D. N.D. G1299T R433S 2↔ Normal G1898A R633Q 2↔ Normal G2012T G671V ↔ Normal G2168A R723Q 2 Normal G2965A A989T 2↔ Normal G3140C C1047S 1↔ Normal G3173A R1058Q ↔ Normal C4535T S1512L ↔ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ↔ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ↔ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ↔ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ↔ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ↔ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ↔ Normal C4141A R1381S ↔ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2↔ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ↔ Normal G912T K304N ↔ Normal C1067T T356M N.D. N.D. C1208T P403L 2↔ Normal G1460A G487E 2 Normal A1492G K498E ↔ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ↔ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1↔ Normal G3211A V1071I ↔ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ↔, no change in function; N.D. not determined. Login to comment
7115 Nucleotide Change Amino Acid Change In Vitro Function Protein Expression/Localization ABCC1 MRP1 G128C C43S 1࢒ Intracellular C218T T73I 1࢒ Normal C257T S92F 2࢒ Normal C350T T117M 2࢒ Normal G689A R230Q ࢒ Normal G1057A V353M N.D. N.D. G1299T R433S 2࢒ Normal G1898A R633Q 2࢒ Normal G2012T G671V ࢒ Normal G2168A R723Q 2 Normal G2965A A989T 2࢒ Normal G3140C C1047S 1࢒ Normal G3173A R1058Q ࢒ Normal C4535T S1512L ࢒ Normal ABCC2 MRP2 C-24T N.D. N.D. G1058A R353H N.D. N.D. G1249A V417I ࢒ Normal C2366T S789F 12 Intracellular T2780G L927R N.D. N.D. C3298T R1100C N.D. N.D. G3299A R1100H N.D. N.D. T3563A V1188E N.D. N.D. G4348A A1450T ࢒ Normal/Intracellular G4544A C1515Y N.D. N.D. ABCC3 MRP3 G32A G11D ࢒ Normal C202T H68Y N.D. N.D. G296A R99Q N.D. Normal C1037T S346F 2 Normal C1537A Q513K N.D. N.D. T1643A L548Q N.D. N.D. G1820A S607N 2 Normal C2221T Gln741STOP N.D. N.D. G2293C V765L ࢒ Normal G2395A V799M N.D. N.D. C2758T P920S 1 Normal G2768A R923Q 1 Normal C3657A S1219R N.D. N.D. C3856G R1286G ࢒ Normal G3890A R1297H N.D. N.D. C4042T R1348C 1 Normal A4094G Q1365R ࢒ Normal C4141A R1381S ࢒ Intracellular C4217T T1406M N.D. N.D. G4267A G1423R N.D. N.D. ABCC4 MRP4 C52A L18I N.D. N.D. C232G P78A 2࢒ Normal T551C M184T N.D. N.D. G559T G187W 2 Reduced A877G K293E ࢒ Normal G912T K304N ࢒ Normal C1067T T356M N.D. N.D. C1208T P403L 2࢒ Normal G1460A G487E 2 Normal A1492G K498E ࢒ Normal A1875G I625M N.D. N.D. C2000T P667L N.D. N.D. A2230G M744V ࢒ Normal G2269A E757K N.D. Intracellular G2459T R820I N.D. N.D. G2560T V854F N.D. N.D. G2698T V900L N.D. N.D. G2867C C956S 1࢒ Normal G3211A V1071I ࢒ Normal C3425T T1142M N.D. N.D. G3659A R1220Q N.D. N.D. A3941G Q1314R N.D. N.D. 2, reduced function; 1, increased function; ࢒, no change in function; N.D. not determined. Login to comment

[hide] Genetic association analysis of transporters ident... Pharmacogenet Genomics. 2012 Jun;22(6):447-65. Grover S, Gourie-Devi M, Bala K, Sharma S, Kukreti R
Genetic association analysis of transporters identifies ABCC2 loci for seizure control in women with epilepsy on first-line antiepileptic drugs.
Pharmacogenet Genomics. 2012 Jun;22(6):447-65., [PMID:22565165]

Abstract [show]
OBJECTIVE: The ATP-binding cassette (ABC) superfamily of transporters is known to efflux antiepileptic drugs (AEDs) primarily in the brain, gastrointestinal tract, liver, and kidneys. In addition, they are also known to be involved in estrogen disposition and may modulate seizure susceptibility and drug response. The objective of the present study was to investigate the role of genetic variants from ABC transporters in seizure control in epilepsy patients treated with monotherapy of first-line AEDs for 12 months. METHODS: On the basis of gene coverage and functional significance, a total of 98 single nucleotide polymorphisms from ABCB1, ABCC1, and ABCC2 were genotyped in 400 patients from North India. Of these, 216 patients were eligible for therapeutic assessment. Genetic variants were compared between the 'no-seizures' and the 'recurrent-seizures' groups. Bonferroni corrections for multiple comparisons and adjustment for covariates were performed before assessment of associations. RESULTS: Functionally relevant promoter polymorphisms from ABCC2: c.-1549G>A and c.-1019A>G either considered alone or in haplotype and diplotype combinations were observed for a significant association with seizure control in women (odds ratio>3.5, P<10, power>95%). Further, low protein-expressing CGT and TGT (c.-24C>T, c.1249G>A, c.3972C>T) haplotypes were always observed to be present in combination with the AG (c.-1549G>A, c.-1019A>G) haplotype that was over-represented in women with 'no seizures'. CONCLUSION: The distribution of the associated variants supports the involvement of ABCC2 in controlling seizures in women possibly by lowering of its expression. The biological basis of this finding could be an altered interaction of ABCC2 with AEDs and estrogens. These results necessitate replication in a larger pool of patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
87 - 330-21247T > C Intron 1 0.005 6 rs4148731 chr7:87239329 c.-330 - 8935C > T Intron 1 0.000 7 rs9282564 chr7:87229440 c.61A > G Exon 3 (Asn21Asp) 0.000 8 rs9282565 chr7:87214875 c.239C > A Exon 5 (Ala80Glu) 0.000 9 rs28381826 chr7:87214531 c.286 + 297G > A Intron 5 0.000 10 rs1989830 chr7:87205663 c.287 - 6124C > T Intron 5 0.135 11 rs2520464 chr7:87201086 c.287 - 1547A > G Intron 5 0.409 12 rs2235023 chr7:87190452 c.827+ 127G > A Intron 9 0.000 13 rs10276036 chr7:87180198 c.1000 - 44C > T Intron 10 0.401 14 rs2229109 chr7:87179809 c.1199G > A Exon 12 (Ser400Asn) 0.000 15 rs1128503 chr7:87179601 c.1236T > C Exon 13 (Gly412Gly) 0.390 16 rs2235036 chr7:87175271 c.1795G > A Exon 16 (Ala599Thr) 0.000 17 rs2235039 chr7:87165854 c.2401G > A Exon 21 (Val801Met) 0.000 18 rs2235040 chr7:87165750 c.2481 + 24G > A Intron 21 0.155 19 rs2032581 chr7:87160810 c.2485A > G Exon 22 (Ile829Val) 0.000 20 rs2032582 chr7:87160618 c.2677T/A > G Exon 22 (Ser/Thr893Ala) 0.318 21 rs7779562 chr7:87144816 c.3085 -72G > C Intron 25 0.043 22 rs2707944 chr7:87144641 c.3188C > G Exon 26 (Ala1063Gly) 0.000 23 rs2229107 chr7:87138659 c.3421A > T Exon 27 (Thr1141Ser) 0.000 24 rs1045642 chr7:87138645 c.3435T > C Exon 27 (Ile1145Ile) m Expression and activity [28] m mRNA expression [29] Altered substrate specificity [30] 0.375 25 rs2235048 chr7:87138511 c.3489 + 80C > T Intron 27 0.381 26 rs17064 chr7:87133470 c.3932A > T 30 UTR 0.000 ABCC1 1 rs504348 chr16:16043174 rs50438C > G Near gene region k Promoter activity [31] 0.135 2 rs215106 chr16:16047542 c.48 + 3886A > G Intron 1 0.210 3 rs215049 chr16:16070768 c.48 + 27112G > C Intron 1 0.245 4 rs246220 chr16:16082128 c.49 - 19545C > G Intron 1 0.118 5 rs119774 chr16:16086833 c.49 - 14840G > A Intron 1 0.089 6 rs246217 chr16:16090354 c.49 - 11319C > A Intron 1 0.118 7 rs2014800 chr16:16099966 c.49 - 1707C > T Intron 1 0.398 8 rs41494447 chr16:16101842 c.218C > T Exon 2 (Thr73Ile) 0.000 9 rs4781712 chr16:16103232 c.226 - 401A > G Intron 2 0.355 10 rs246240 chr16:16119024 c.616 -7942A > G Intron 5 0.114 11 rs924135 chr16:16123459 c.616 - 3507A > T Intron 5 0.412 12 rs903880 chr16:16130514 c.809 + 54C > A Intron 7 0.147 13 rs8187852 chr16:16139709 c.1057G > A Exon 9 (Met353Val) 0.000 14 rs35587 chr16:16139714 c.1062T > C Exon 9 (Asn354Asn) 0.182 15 rs35592 chr16:16141823 c.1219 - 176T > C Intron 9 0.172 16 rs60782127 chr16:16142079 c.1299G > T Exon 10 (Arg433Ser) k Transport of leukotriene C4 and estrone sulfate [32] 0.008 17 rs3765129 chr16:16149901 c.1474 - 48C > T Intron 11 0.032 18 rs35597 chr16:16158034 c.1678 - 3979G > A Intron 12 0.320 19 rs35621 chr16:16168608 c.1913 - 1575C > T Intron 14 0.103 20 rs45511401 chr16:16173232 c.2012G > T Exon 16 (Gly671Val) 0.024 21 rs4148356 chr16:16177275 c.2168G > A Exon 17 (Arg723Gln) 0.000 22 rs3851713 chr16:16184873 c.2644 + 428A > T Intron 19 0.340 23 rs2239995 chr16:16192565 c.2645 - 3919G > A Intron 19 0.324 24 rs11864374 chr16:16201885 c.2871 + 1155G > A Intron 21 0.338 25 rs35529209 chr16:16205325 c.2965G > A Exon 22 (Thr989Ala) k Transport of estradiol 17b-glucuronide [32] 0.000 26 rs3887893 chr16:16205501 c.3079 + 62G > A Intron 22 0.448 27 rs13337489 chr16:16208683 c.3140G > C Exon 23 (Ser1047Cys) 0.000 28 rs2299670 chr16:16220858 c.3819 + 1090A > G Intron 26 0.399 29 rs8057331 chr16:16230411 c.4202C > T Exon 29 (Thr1401Met) 0.000 30 rs212090 chr16:16236004 c.5462T > A 30 UTR 0.357 31 rs212093 chr16:16237754 rs212093G > A Near gene region 0.429 32 rs4148382 chr16:16238494 rs4148382G > A Near gene region 0.034 ABCC2 1 g.-1774G > delG chr10:101535688 g.-1774G > delG Near gene region k Promoter activity [33] 0.000 2 rs1885301 chr10:101541053 c.-1549G > A Near gene region k Promoter activity [haplotype containing (- 1549A)-(- 24T)] [33] k Clearance of irinotecan (ABCC2*2 containing the G allele) [34] 0.379 450 Pharmacogenetics and Genomics 2012, Vol 22 No 6 Table 2 (continued) N dbSNP ida Positionb Allelesc Gene location (effect) Function MAF 3 rs2804402 chr10:101541583 c. Login to comment

[hide] Two polymorphic variants of ABCC1 selectively alte... Drug Metab Dispos. 2013 Dec;41(12):2187-96. doi: 10.1124/dmd.113.054213. Epub 2013 Sep 30. Conseil G, Cole SP
Two polymorphic variants of ABCC1 selectively alter drug resistance and inhibitor sensitivity of the multidrug and organic anion transporter multidrug resistance protein 1.
Drug Metab Dispos. 2013 Dec;41(12):2187-96. doi: 10.1124/dmd.113.054213. Epub 2013 Sep 30., [PMID:24080162]

Abstract [show]
In this study we compared the in silico predictions of the effect of ABCC1 nonsynonymous single nucleotide polymorphisms (nsSNPs) with experimental data on MRP1 transport function and response to chemotherapeutics and multidrug resistance protein 1 (MRP1) inhibitors. Vectors encoding seven ABCC1 nsSNPs were stably expressed in human embryonic kidney (HEK) cells, and levels and localization of the mutant MRP1 proteins were determined by confocal microscopy and immunoblotting. The function of five of the mutant proteins was determined using cell-based drug and inhibitor sensitivity and efflux assays, and membrane-based organic anion transport assays. Predicted consequences of the mutations were determined by multiple bioinformatic methods. Mutants C43S and S92F were correctly routed to the HEK cell plasma membrane, but the levels were too low to permit functional characterization. In contrast, levels and membrane trafficking of R633Q, G671V, R723Q, A989T, and C1047S were similar to wild-type MRP1. In cell-based assays, all five mutants were equally effective at effluxing calcein, but only two exhibited reduced resistance to etoposide (C1047S) and vincristine (A989T; C1047S). The GSH-dependent inhibitor LY465803 (LY465803 [N-[3-(9-chloro-3-methyl-4-oxo-4H-isoxazolo-[4,3-c]quinolin-5-yl)-cyclohexylmethy l]-benzamide)] was less effective at blocking calcein efflux by A989T, but in a membrane-based assay, organic anion transport by A989T and C1047S was inhibited by MRP1 modulators as well as wild-type MRP1. GSH accumulation assays suggest cellular GSH efflux by A989T and C1047S may be impaired. In conclusion, although six in silico analyses consistently predict deleterious consequences of ABCC1 nsSNPs G671V, changes in drug resistance and inhibitor sensitivity were only observed for A989T and C1047S, which may relate to GSH transport differences.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
5 In contrast, levels and membrane trafficking of R633Q, G671V, R723Q, A989T, and C1047S were similar to wild-type MRP1. Login to comment
41 Two others (R633Q, R723Q) were selected because of their location in NBD1. Login to comment
58 Lysates (10 mg protein per lane) prepared from HEK293 cell lines expressing wild-type (WT) and mutant (R633Q, G671V, R723Q, A989T, C1047S) MRP1 proteins and the untransfected control cell line (HEK) were immunoblotted, and MRP1 was detected with mAb QCRL-1. Login to comment
114 The analyses of the two other nsSNPs located in NBD1, namely, R633Q and R723Q, yield results very similar to one another (low probability of adverse effect), except that Arg633 is considered to be more critical to MRP1 stability by I-mutant Suite (Table 1), probably because Arg633 is more strictly conserved than Arg723 (Supplemental Table 1). Login to comment
125 R723Q = A989T. Login to comment
126 nsSNPs R633Q, G671V, R723Q, A989T, and C1047S Have No Effect on Total on Plasma Membrane MRP1 Levels in HEK293 Cells. Login to comment
127 After we had isolated stably transfected HEK293 cell lines by G418 selection, cell lines expressing R633Q, G671V, R723Q, A989T, and C1047S and wild-type MRP1 were cloned to .90% homogeneity for MRP1 expression. Login to comment
128 Immunoblots of cell lysates showed that the levels of the five mutant proteins were comparable to (R633Q, A989T, C1047S) or somewhat (,50%) higher than (G671V, R723Q) wild-type MRP1, indicating that the mutations do not cause any major misfolding of MRP1 that would result in its degradation (Fig. 1B). Login to comment
132 Confocal fluorescence microscopy experiments showed that the R633Q, G671V, R723Q, A989T, and C1047S mutant proteins in the five clonal HEK cell lines were also routed correctly to the plasma membrane in a manner indistinguishable from wild-type MRP1 (Fig. 2). Login to comment
136 The HEK cell lines expressing R633Q, G671V, R723Q, A989T, and C1047S were tested for their levels of resistance to five xenobiotics for which human MRP1 is known to confer resistance, including the antineoplastic agents vincristine, etoposide (VP-16), doxorubicin, and the heavy metal oxyanions arsenite and antimony tartrate (Cole et al., 1994). Login to comment
141 TABLE 1 Predicted effects of MRP1 nsSNPs examined in this study according to various in silico prediction methods nsSNP SIFT/SIFTBLink Probability Scoresa PolyPhen2 Classificationb (Score) I-Mutant Suite "Stability"c (DDG in kcal mol21 ) Grantham Value Difference (D)d Blosum50e PAM250f (Threshold) (,0.05) (.1.000) (,20.5; .0.5) (.50) (,0) (,0) C43S 0.51/0.08 possibly damaging (0.819) decrease (20.74) 112 21 0 S92F 0.11/0.05 possibly damaging (0.303) neutral (20.05) 155 23 23 NBD1-R633Q 0.66/0.57 benign (0.001) decrease (21.16) 43 1 1 NBD1-G671V 0.00/0.02 probably damaging (1.000) decrease (20.57) 109 24 21 NBD1-R723Q 0.49/0.39 benign(0.002) decrease (20.71) 43 1 1 A989T 0.53/0.12 benign (0.000) decrease (20.73) 58 0 1 C1047S 0.07/0.64 benign (0.001) decrease (20.67) 112 21 0 a SIFT (Sorting Intolerant From Tolerant) was used by manually entering a sequence alignment comprising only human homologs of MRP1, and SIFT-BLink probability scores were obtained using 100 aligned computer-selected sequences (threshold for nontolerated substitution set at ,0.05). Login to comment
153 To determine whether the five nsSNPs, R633Q, G671V, R723Q, A989T, and C1047S, affected the ability of MRP1 to mediate efflux of calcein, HEK293 cells stably expressing wild-type and mutant MRP1 as well as untransfected HEK cells were incubated with several concentrations of the cell permeable acetoxymethyl ester of calcein (calcein-AM) at 37&#b0;C; 3 hours later, the intracellular hydrolyzed calcein that had not been effluxed by MRP1 was measured. Login to comment
167 TABLE 2 Effect of nsSNP mutations on MRP1-mediated resistance to chemotherapeutic agents and metalloids in HEK293 cell lines Cell Line/ nsSNP Relative Resistancea Vincristine Doxorubicin Etoposide Na+ Arsenite K+ Antimony Tartrate Wild-type 12.2 6 0.6 3.9 6 1.6 7.1 6 0.6 1.4; 2.2 5.2; 6.4 R633Q 15.3 6 2.9 3.3 6 1.0 5.1 6 0.9 ND ND G671V 9.3 6 2.8 3.4 6 0.6 7.1 6 0.7 ND ND R723Q 21.3 6 7.2 2.5 6 0.1 6.9 6 0.5 ND ND A989T 4.4 6 1.1b ** 2.5 6 0.6 5.0 6 0.9 1.6; 2.3 3.1; 3.5 C1047S 5.1 6 0.5*** 1.8 6 0.2 4.5 6 0.7* 2.0; 1.8 2.2; 1.7 ND, not determined. Login to comment
189 HEK293 cells stably expressing wild-type (WT-MRP1) and mutant (R633Q, G671V, R723Q, A989T, C1047S) MRP1 were incubated in the presence of increasing concentrations of calcein-AM (0-6mM), and the intracellular calcein remaining in the cells after 3 hours was measured by fluorometry as described in Materials and Methods. Login to comment
227 The second category of mutants examined includes the three nsSNPs located in NBD1 (R633Q, G671V, R723Q), which exhibited little, if any, change in transport levels or sensitivity to MRP1 substrates or inhibitors. Login to comment
251 With respect to the R723Q nsSNP, a conserved positive charge is lost (Supplemental Table 1), and the side chain has been shortened. Login to comment
253 Consequently, in this case, the prediction that R723Q would be a benign substitution by five out of six in silico methods used is consistent with the experimental data reported here in a stable HEK cell line as well as in our earlier study in transiently transfected HEK cells (L&#e9;tourneau et al., 2005). Login to comment
254 However, in contrast with our observations, Yin et al. (2009) reported that HEK cells stably expressing R723Q exhibited varying degrees of reduced resistance to natural product drugs and that the plasma membrane trafficking of the R723Q protein was mildly impaired. Login to comment
256 It is of interest that in a small phase III study of Caucasian patients with advanced multiple myeloma, the presence of the R723Q nsSNP in 5 of 279 patients being treated with bortezomib and pegylated liposomal doxorubicin was associated with a different overall response rate and durability (Buda et al., 2010). Login to comment

[hide] Importance of ABCC1 for cancer therapy and prognos... Drug Metab Rev. 2014 Aug;46(3):325-42. doi: 10.3109/03602532.2014.901348. Epub 2014 Mar 26. Kunicka T, Soucek P
Importance of ABCC1 for cancer therapy and prognosis.
Drug Metab Rev. 2014 Aug;46(3):325-42. doi: 10.3109/03602532.2014.901348. Epub 2014 Mar 26., [PMID:24670052]

Abstract [show]
Multidrug resistance presents one of the most important causes of cancer treatment failure. Numerous in vitro and in vivo data have made it clear that multidrug resistance is frequently caused by enhanced expression of ATP-binding cassette (ABC) transporters. ABC transporters are membrane-bound proteins involved in cellular defense mechanisms, namely, in outward transport of xenobiotics and physiological substrates. Their function thus prevents toxicity as carcinogenesis on one hand but may contribute to the resistance of tumor cells to a number of drugs including chemotherapeutics on the other. Within 48 members of the human ABC superfamily there are several multidrug resistance-associated transporters. Due to the well documented susceptibility of numerous drugs to efflux via ABC transporters it is highly desirable to assess the status of ABC transporters for individualization of treatment by their substrates. The multidrug resistance associated protein 1 (MRP1) encoded by ABCC1 gene is one of the most studied ABC transporters. Despite the fact that its structure and functions have already been explored in detail, there are significant gaps in knowledge which preclude clinical applications. Tissue-specific patterns of expression and broad genetic variability make ABCC1/MRP1 an optimal candidate for use as a marker or member of multi-marker panel for prediction of chemotherapy resistance. The purpose of this review was to summarize investigations about associations of gene and protein expression and genetic variability with prognosis and therapy outcome of major cancers. Major advances in the knowledge have been identified and future research directions are highlighted.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
134 Letourneau et al. (2005) studied the influence of 10 DOI: 10.3109/03602532.2014.901348 ABCC1 and cancer therapy and prognosis non-synonymous SNPs - Cys43Ser (G128C, rs41395947), Thr73Ile (C218T, rs41494447), Ser92Phe (C257T, rs8187844), Thr117Met (C350T, no rs number available), Arg230Gln (G689A, rs8187848), Arg633Gln (G1898A, rs112282109), Arg723Gln (G2168A, rs4148356), Ala989Thr (G2965A, rs35529209), Cys1047Ser (G3140C, rs13337489), Arg1058Gln (G3173A, rs41410450) and Ser1512Leu (C4535T, rs369410659) - on ABCC1 expression using membrane vesicles isolated from transfected cells and assessed transport activity for three known ABCC1 substrates. Login to comment
159 NCBI ID Reference Amino acid exchange Nucleotide exchange Location Function MAFa rs41395947 Cys43Ser G128C Exon 2 Non-synonymous Unknown rs41494447 Thr73Ile C218T Exon 2 Non-synonymous T &#bc; 0.003 rs8187844 Ser92Phe C257T Exon 3 Non-synonymous T &#bc; 0.004 rs8187848 Arg230Gln G689A Exon 7 Non-synonymous A &#bc; 0.009 rs2230669 Pro272Pro G816A Exon 8 Synonymous A &#bc; 0.037 rs246221 Val275Val T825C Exon 8 Synonymous C &#bc; 0.301 rs35592 non-coding T-176C Intron 9 Non-coding C &#bc; 0.257 rs60782127 Arg433Ser G1299T Exon 10 Non-synonymous T &#bc; 0.004 rs35605 Leu562Leu T1684C Exon 13 Synonymous T &#bc; 0.173 rs112282109 Arg633Gln G1898A Exon 14 Non-synonymous A &#bc; 0.004 rs45511401 Gly671Val G2012T Exon 16 Non-synonymous T &#bc; 0.050 rs4148356 Arg723Gln G2168A Exon17 Non-synonymous A &#bc; 0.027 rs35529209 Ala989Thr G2965A Exon 22 Non-synonymous Unknown rs13337489 Cys1047Ser G3140C Exon 23 Non-synonymous C &#bc; 0.000 rs41410450 Arg1058Gln G3173A Exon 23 Non-synonymous Unknown rs2238476 non-coding G-1960A Intron 23 Non-coding T &#bc; 0.062 rs2230671 Ser1334Ser G4002A Exon 28 Synonymous T &#bc; 0.208 rs28364006 Thr1337Ala A4009G Exon 28 Non-synonymous Unknown rs369410659 Ser1512Leu C4535T Exon 31 Non-synonymous Unknown a Minor allele frequencies for Caucasinans in dbSNP based on HapMap-CEU population or 1000 genomes. Login to comment
1169 ABCC1 polymorphism Arg723Gln (2168G4A) is associated with lung cancer susceptibility in a Chinese population. Login to comment

[hide] Non-coding polymorphisms in nucleotide binding dom... PLoS One. 2014 Jul 31;9(7):e101740. doi: 10.1371/journal.pone.0101740. eCollection 2014. Kunicka T, Vaclavikova R, Hlavac V, Vrana D, Pecha V, Raus K, Trnkova M, Kubackova K, Ambrus M, Vodickova L, Vodicka P, Soucek P
Non-coding polymorphisms in nucleotide binding domain 1 in ABCC1 gene associate with transcript level and survival of patients with breast cancer.
PLoS One. 2014 Jul 31;9(7):e101740. doi: 10.1371/journal.pone.0101740. eCollection 2014., [PMID:25078270]

Abstract [show]
OBJECTIVES: ATP-Binding Cassette (ABC) transporters may cause treatment failure by transporting of anticancer drugs outside of the tumor cells. Multidrug resistance-associated protein 1 coded by the ABCC1 gene has recently been suggested as a potential prognostic marker in breast cancer patients. This study aimed to explore tagged haplotype covering nucleotide binding domain 1 of ABCC1 in relation with corresponding transcript levels in tissues and clinical phenotype of breast cancer patients. METHODS: The distribution of twelve ABCC1 polymorphisms was assessed by direct sequencing in peripheral blood DNA (n = 540). RESULTS: Tumors from carriers of the wild type genotype in rs35623 or rs35628 exhibited significantly lower levels of ABCC1 transcript than those from carriers of the minor allele (p = 0.003 and p = 0.004, respectively). The ABCC1 transcript levels significantly increased in the order CT-GT>CC-GT>CC-GG for the predicted rs35626-rs4148351 diplotype. Chemotherapy-treated patients carrying the T allele in rs4148353 had longer disease-free survival than those with the GG genotype (p = 0.043). On the other hand, hormonal therapy-treated patients with the AA genotype in rs35628 had significantly longer disease-free survival than carriers of the G allele (p = 0.012). CONCLUSIONS: Taken together, our study shows that genetic variability in the nucleotide binding domain 1 has a significant impact on the ABCC1 transcript level in the target tissue and may modify survival of breast cancer patients.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
40 Moreover, several ABCC1 SNPs including Arg723Gln (rs4148356) located between the Walker A and B motifs in NBD1 have been shown to affect the resistance to a number of anticancer drugs [20]. Login to comment
80 SNP ID Localization Genotype distribution Missing Type * MAF # genotypes Genotype n % n (%) rs35623 intron 15 GG 422 79.5 9 (1.7) NC T (0.11) GT 100 18.8 TT 9 1.7 rs35625 intron 15 TT 217 40.9 9 (1.7) NC C (0.37) TC 234 44.1 CC 80 15.1 rs11866794 intron 15 GG 415 78.2 9 (1.7) NC C (0.12) GC 108 20.3 CC 8 1.5 rs4148350 intron 15 GG 466 89.3 18 (3.3) NC T (0.06) GT 52 10.0 TT 4 0.8 rs4148351 intron 15 CC 416 79.5 17 (3.1) NC T (0.11) CT 97 18.6 TT 10 1.9 rs35626 intron 16 GG 261 50.1 19 (3.5) NC T (0.29) GT 220 42.2 TT 40 7.7 rs35628 intron 16 AA 441 84.0 15 (2.8) NC G (0.09) AG 77 14.7 GG 7 1.3 rs4148353 intron 16 GG 426 81.3 16 (3.0) NC T (0.10) GT 91 17.4 TT 7 1.3 rs4148356 exon 17 GG 516 96.3 4 (0.7) R723Q A (0.02) GA 19 3.5 AA 1 0.2 rs11075295 intron 17 AA 375 69.8 3 (0.6) NC G (0.17) AG 139 25.9 GG 23 4.3 rs3888565 intron 18 GG 380 70.6 2 (0.4) NC A (0.17) GA 134 24.9 AA 24 4.5 minor allele frequency (MAF).0.05 in HapMap CEU sample with minimally 75% genotype data were identified. Login to comment
207 Despite the fact that the ABCC1 rs4148356 SNP located between the Walker A and B motifs in NBD1 has been shown to affect resistance to a number of anticancer drugs [20], we did not find association of this SNP with DFS in breast cancer patients. We confirmed the previously observed lack of effect of rs4148356 (R723Q, 2168G.A) on ABCC1 expression [44]. Login to comment

[hide] Genetic variation of the ABC transporter gene ABCC... BMC Genet. 2015 Sep 23;16(1):114. doi: 10.1186/s12863-015-0271-3. Slomka M, Sobalska-Kwapis M, Korycka-Machala M, Bartosz G, Dziadek J, Strapagiel D
Genetic variation of the ABC transporter gene ABCC1 (Multidrug resistance protein 1-MRP1) in the Polish population.
BMC Genet. 2015 Sep 23;16(1):114. doi: 10.1186/s12863-015-0271-3., [PMID:26395522]

Abstract [show]
BACKGROUND: Multidrug resistance-associated protein 1 (MRP1), encoded by the ABCC1 gene, is an ATP-binding cassette transporter mediating efflux of organic anions and xenobiotics; its overexpression leads to multidrug resistance. In this study, 30 exons (from 31 in total) of the ABCC1 gene as well as and their flanking intron sequences were screened for genetic variation, using the High Resolution Melting (HRM) method, for 190 healthy volunteers representing the Polish population. Polymorphism screening is an indispensable step in personalized patient therapy. An additional targeted SNP verification study for ten variants was performed to verify sensitivity of the scanning method. RESULTS: During scanning, 46 polymorphisms, including seven novel ones, were found: one in 3' UTR, 21 in exons (11 of them non-synonymous) and 24 in introns, including one deletion variant. These results revealed some ethnic differences in frequency of several polymorphisms when compared to literature data for other populations. Based on linkage disequilibrium analysis, 4 haplotype blocks were determined for 9 detected polymorphisms and 12 haplotypes were defined. To capture the common haplotypes, haplotype-tagging single nucleotide polymorphisms were identified. CONCLUSIONS: Targeted genotyping results correlated well with scanning results; thus, HRM is a suitable method to study genetic variation in this model. HRM is an efficient and sensitive method for scanning and genotyping polymorphic variants. Ethnic differences were found for frequency of some variants in the Polish population compared to others. Thus, this study may be useful for pharmacogenetics of drugs affected by MRP1-mediated efflux.

Comments [show]

None has been submitted yet.

Sentences [show]
No. Sentence Comment
137 Additional four variants located in the loop containing NBD1 alter amino acids sequence: c.1898G > A (p.Arg633Gln) and c.2012G > T (p.Gly671Val) are located 44 and 6 amino acids upstream of the Walker A motif, respectively, while c.2168G > A (p.Arg723Gln) and c.2876A > G (p.Lys959Arg) are located 37 amino acids downstream of this motif, respectively. Login to comment
140 Analysis of all the non-synonymous variants detected in this study by the PolyPhen-2 tool (data in Additional file 3) showed for HumDiv-trained model that five of them: c.814C > T (p.Pro272Ser), c.1898G > A (p.Arg633 Gln), c.2168G > A (p.Arg723Gln), c.2876A > G (p.Lys 959Arg), the novel one c.4093G > A (p.Asp1365Asn), probably have benign influence on the functioning of the protein. Login to comment
144 Table 2 Summary of ABCC1 variants detected during scanning by HRM Exon scanned by HRM dbSNP ID Variant position NM_004996.3: Intron/amino acid residue NP_004987.2: Observed genotypesa, b (n) HWE exact test P-valuec MAFd R/R R/V V/V 2 rs8187843 c.225 + 26G > A Intron 164 25 0 1 (A) 0.066 4 rs587783373* c.352-79G > A Intron 185 1 0 1 (A) 0.003 4 rs4148337 c.352-66 T > C Intron 15 80 91 0.727 (T) 0.296 5 rs483352860* c.596C > T p.Ser199Leu 186 1 0 1 (T) 0.003 6 rs8187846 c.677 + 17C > T Intron 188 1 0 1 (T) 0.003 7 rs483352864* c.809 + 16C > T Intron 188 1 0 1 (T) 0.003 7 rs45609533 c.809 + 31G > T Intron 183 5 0 1 (T) 0.013 7 rs903880 c.809 + 54C > A Intron 112 65 11 0.684 (A) 0.231 7 rs246232 c.809 + 64C > G Intron 84 90 14 0.174 (G) 0.314 8 rs546943313 c.810-73C > T Intron 187 1 0 1 (T) 0.003 8 rs200194736 c.814C > T p.Pro272Ser 187 1 0 1 (T) 0.003 8 rs2230669 c.816G > A p.Pro272= 172 16 0 1 (A) 0.043 8 rs246221 c.825 T > C p.Val275= 84 92 12 0.059 (C) 0.309 8 rs587783372* c.855G > A p.Pro285= 187 1 0 1 (A) 0.003 9 rs35587 c.1062 T > C p.Asn354= 78 91 16 0.185 (C) 0.332 9 rs35588 c.1218 + 8A > G Intron 82 91 16 0.245 (G) 0.327 9 rs483352877* c.1218 + 9C > T Intron 188 1 0 1 (T) 0.003 10 rs60782127 c.1299G > T p.Arg433Ser 186 2 0 1 (T) 0.005 12 rs17265551 c.1677 + 56C > T Intron 162 27 0 0.604 (T) 0.072 13 rs35604 c.1678-37G > A Intron 2 45 142 0.745 (G) 0.130 13 rs483352863* c.1678-34G > A Intron 188 1 0 1 (A) 0.003 13 rs35605 c.1684 T > C p.Leu562= 2 45 142 0.745 (T) 0.130 13 rs8187858 c.1704C > T p.Tyr568= 157 31 1 1 (T) 0.088 14 rs112282109 c.1898G > A p.Arg633Gln 187 1 0 1 (A) 0.003 16 rs8187863 c.2001C > T p.Ser667= 187 1 0 1 (T) 0.003 16 rs45511401 c.2012G > T p.Gly671Val 161 25 2 0.296 (T) 0.077 17 rs4148356 c.2168G > A p.Arg723Gln 181 9 0 1 (A) 0.024 19 rs45607032 c.2461-39_2461-38delAT Intron 179 9 0 1 (delAT) 0.024 19 rs2074087 c.2461-30C > G Intron 0 44 144 0.083 (C) 0.117 19 rs45492500 c.2461-27G > A Intron 172 14 2 0.056 (A) 0.048 21 rs11075296 c.2871 + 26C > T Intron 0 0 189 1 - 22 rs768191257 c.2876A > G p.Lys959Arg 187 1 0 1 (G) 0.003 22 rs3851716 c.3079 + 10G > A Intron 0 0 188 1 - 22 rs34794353 c.3079 + 24C > T Intron 187 1 0 1 (T) 0.003 22 rs3887893 c.3079 + 62 T > C Intron 67 96 25 0.358 (C) 0.388 23 rs191017838 c.3171G > A p.Leu1057= 187 2 0 1 (A) 0.005 23 rs199773531 c.3196C > T p.Arg1066Trp 188 1 0 1 (T) 0.003 25 rs41278168 c.3591-5C > T Intron 187 1 0 1 (T) 0.003 27 rs200922662 c.3886C > T p.Arg1296Trp 187 1 0 1 (T) 0.003 27 rs201533167 c.3901C > T p.Arg1301Cys 187 1 0 1 (T) 0.003 Linkage disequilibrium analysis Based on full genotype sets of 44 polymorphic variants confirmed by Hardy-Weinberg equilibrium exact test (Table 2), linkage disequilibrium analysis using r2 and |D`| statistics was performed (Additional file 4). Login to comment
154 Bold variants signifies the ones which were validated by genotyping results Table 3 Summary of ABCC1 selected SNPs genotyping by HRM and comparing them with scanning results dbSNP ID Variant residue NM_004996.3: Intron/amino acid residue NP_004987.2: Observed genotypesa (n) HWE exact test P-valueb MAFc (genotyping) MAFc (scanning) Chi-square test P-valued R/R R/V V/V rs41395947 c.128G > C p.Cys43Se 380 0 0 1 - - - rs2230669 c.816G > A p.Pro272= 362 18 0 1 (A) 0.024 (A) 0.043 0.079 rs246221 c.825 T > C p.Val275 197 160 23 0.243 (C) 0.271 (C) 0.309 0.187 rs8187852 c.1057G > A p.Val353Met 379 0 0 1 - - - rs35587 c.1062 T > C p.Asn354= 204 142 33 0.247 (C) 0.274 (C) 0.332 0.044 rs35588 c.1218 + 8A > G Intron 190 160 30 0.709 (G) 0.289 (G) 0.325 0.214 rs60782127 c.1299G > T p.Arg433Ser 373 6 0 1 (T) 0.008 (T) 0.005 0.623 rs35605 c.1684 T > C p.Leu562= 13 105 262 0.588 (T) 0.172 (T) 0.130 0.063 rs8187858 c.1704C > T p.Tyr568= 325 55 0 0.242 (T) 0.072 (T) 0.087 0.374 rs45511401 c.2012G > T p.Gly671Val 346 28 3 0.007 (T) 0.045 (T) 0.077 0.038 rs4148356 c.2168G > A p.Arg723Gln 360 19 0 1 (A) 0.025 (A) 0.024 0.888 rs45517537 c.2581G > A p.Ala861Thr 380 0 0 1 - - - rs35529209 c.2965G > A p.Ala989Thr 378 0 0 1 - - - rs13337489 c.3140G > C p.Cys1047Ser 380 0 0 1 - - - rs28706727 c.3436G > A p.Val1146Ile 380 0 0 1 - - - rs2230671 c.4002G > A p.Ser1334= 204 140 32 0.296 (A) 0.271 (A) 0.277 0.850 rs28364006 c.4009A > G p.Thr1337Ala 380 0 0 1 - - - a Number of genotypes detected during this study, R - reference allele, V - variant allele. b P-value is consistent with Hardy-Weinberg equilibrium if P > 0.001. c Minor allele shown in brackets with its frequency. Login to comment
207 Recently, other data confirmed these observations and none of the amino acid substitutions: p.Arg633Gln, p.Gly671Val, p.Arg723Gln, detected also in our study, was found to change functionality of MRP1 transporter. Login to comment
210 Thus, it was demonstrated that variant c.2168G > A (p.Arg723Gln) reduced resistance activity of MRP1-overexpressing cells to drugs like daunorubicin, doxorubicin, etoposide, vinblastine and vincristine in vitro [36]. Login to comment
215 The discrepancy observed in different studies on clinical significance of c.2012G > T (p.Gly671Val) and c.2168G > A (p.Arg723Gln) is of unclear origin. Login to comment
389 37. Yin JY, Han LF, Huang Q, Xu XJ, Zhou HH, Liu ZQ. ABCC1 polymorphism Arg723Gln (2168G > A) is associated with lung cancer susceptibility in a Chinese population. Login to comment