ABCMdb

PMID: 19214144

Yin JY, Huang Q, Yang Y, Zhang JT, Zhong MZ, Zhou HH, Liu ZQ
Characterization and analyses of multidrug resistance-associated protein 1 (MRP1/ABCC1) polymorphisms in Chinese population.
Pharmacogenet Genomics. 2009 Mar;19(3):206-16., [PubMed]

Sentences

No. Mutations Sentence Comment

5 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln Results The allelic frequencies of Cys43Ser (128G > C), Thr73Ile (218C > T), Arg723Gln (2168G > A), and Arg1058Gln (3173G > A) in mainland Chinese were 0.5, 1.4, 5.8, and 0.5%, respectively. Login to comment 6 ABCC1 p.Arg723Gln None of these mutations had any effect on MRP1/ABCC1 expression and trafficking, but that Arg723Gln mutation significantly reduced MRP1/ ABCC1-mediated resistance to daunorubicin, doxorubicin, etoposide, vinblastine, and vincristine. Login to comment 7 ABCC1 p.Cys43Ser The Cys43Ser mutation did not affect all tested drug resistance. Login to comment 8 ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln In contrast, the Thr73Ile mutation reduced resistance to methotrexate and etoposide, whereas the Arg1058Gln mutation increased the response of two anthracycline drugs and etoposide in HEK293 and CHO-K1 cells as well as vinblastine and methotrexate in CHO-K1 cells. Login to comment 9 ABCC1 p.Arg723Gln Conclusion The allelic frequency of the Arg723Gln mutation is relatively higher than other SNPs in mainland Chinese population and therefore this mutation significantly reduces MRP1/ABCC1 activity in multidrug resistance. Pharmacogenetics and Genomics 19:206-216 c 2009 Wolters Kluwer Health | Lippincott Williams & Wilkins. Login to comment 23 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln The four most common nonsynonymous SNPs in the Asian population are Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations [15,17]. Login to comment 24 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln While Cys43Ser (128G > C) is located in the first transmembrane (TM), Thr73Ile (218C > T), Arg723Gln (2168G > A) and Arg1058Gln (3173G > A) are located in the first intracellular loop, the first NBD, and the seventh intracellular loop, respectively (Fig. 1a). Login to comment 25 ABCC1 p.Cys43Ser ABCC1 p.Gly671Val ABCC1 p.Arg433Ser To date, only three naturally occurring mutations of MRP1/ABCC1 (Gly671Val, Arg433Ser, and Cys43Ser) have been fully investigated for their effects on MRP1/ ABCC1-mediated MDR [18-20]. Login to comment 28 ABCC1 p.Arg433Ser For example, the substitution of highly conserved Arg433 by Ser significantly decreased the transport of leukotriene C4 and estrone sulfate, but increased doxorubicin resistance [18]. Login to comment 35 ABCC1 p.Cys43Ser ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln ABCC1 p.Arg1058Gln Fig. 1 COOH L0 NBD1 NBD2 NH2 KCFQNTVLVWVPCFYLWACFPFYF TM1(a) CL1 Thr73Ile …AWIQNDSLRENILFGC… NBD1 Arg723Gln * * * * …DLLHSILRSPMSFF… CL7 Arg1058Gln PFYFLYLSRHDRGYIQMTPLNKTK Cys43Ser Cys43Ser Thr73Ile Arg723Gln Arg1058Gln 1 Human Monkey Bovine Dog Mouse Rat Chicken 2 3 4 5 6 7 (b) Location and conservation of the amino acid residues with polymorphisms in multidrug-resistance-associated protein 1 (MRP1/ABCC1). Login to comment 36 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Arg1058Gln (a) Location of Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln in the schematic model of MRP1/ABCC1. Login to comment 51 ABCC1 p.Cys43Ser ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln ABCC1 p.Arg1058Gln Site-directed mutagenesis For site mutagenesis, cassettes containing various domains of MRP1/ABCC1 cDNA were first released from the full-length cDNA by double digestion (Not I/BamH I for Cys43Ser and Thr73Ile mutation; EcoN I/BsmB I for Arg723Gln mutation; and BsmB I/EcoR I for Arg1058Gln mutation), cloned into pGEM-T Easy (Promega), followed by site-directed mutagenesis using the QuikChange XL Site-Directed Mutagenesis Kit (Stratagene, La Jolla, California, USA) with the following primers (the substituted nucleotides are italicized): 50 -TCGTGTGGGTGCCTTGTTTTTACCTCTGGGC-30 (Cys43Ser); 50 -GATGACACCTCTCAACAAAACCAAA ACTGCCTTGGGATTTT-30 (Thr73lle); 50 -GGATTC AGAATGATTCTCTCCAAGAAAACATCCTTTTTGGA TG-30 (Arg723Gln); 50 -GCACAGCATCCTGCGGTCAC CCATGAGCT-30 (Arg1058Gln). Login to comment 62 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln The real-time PCR was carried Table 1 Primers and PCR condition for determining polymorphisms Polymorphisms Oligonucleotide primers Annealing temperature (1C) Restriction enzyme Cys43Ser (128G > C) F: GGTCCTCGTGTGGGTGCCAT 57.5 Nla III R: TAGAAGAAGGAACTTAGGGTCAACT Thr73Ile (218C > T) F: TCAGATGACACCTCTCAACAGAA 56.7 Hinf I R: CCAGTTTTCACCTCCCACATTAT Arg723Gln (2168G > A) F: GCCTGGATTCAGAATGATTCTCTTC 52.0 Taq I R: TACTGACCTTCTCGCCAATCTCTGT Arg1058Gln (3173G > A) F: TCTGCATTGTGGAGTTTT 53.0 Pst I R: GACGAAGAAGTAGATGAGGC F, forward; R, reverse. Login to comment 91 ABCC1 p.Cys43Ser Although the Cys43Ser mutation is located in the first TM helix, the other three are located in the intracellular loops or the NBD (Fig. 1a). Login to comment 92 ABCC1 p.Arg723Gln It is interesting to note that the Arg723Gln mutation is located between the Walker A and Walker B motives in NBD1, which is important for the ATPase activity of MRP1/ABCC1 to provide energy for substrate transport. Login to comment 94 ABCC1 p.Arg723Gln The distribution of polymorphisms in Chinese population In the 208 volunteers, genotyping of the Arg723Gln mutation identified 185 GG homozygotes, 22 GA Characterization of ABCC polymorphisms Yin et al. 209 heterozygotes, and one AA homozygote. Login to comment 95 ABCC1 p.Arg723Gln The frequencies of A and G alleles for the Arg723Gln mutation were 5.8 and 94.%, respectively. Login to comment 96 ABCC1 p.Thr73Ile Genotyping for the Thr73Ile mutation identified 202 CC homozygotes and six CT heterozygotes. Login to comment 97 ABCC1 p.Thr73Ile The frequencies of T and C alleles of the SNP for the Thr73Ile mutation were 1.4 and 98.6%, respectively. Login to comment 99 ABCC1 p.Cys43Ser ABCC1 p.Arg1058Gln The frequencies of C alleles for the SNP of Cys43Ser and A alleles for the SNP of Arg1058Gln were both about 0.5%. Login to comment 101 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln The genotyping and allelic frequencies of SNPs for Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations are shown in Table 2. Login to comment 102 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln The distribution of these SNPs in different populations and their comparison are summarized in Table 3. mRNA and protein expression levels of MRP1/ABCC1 mutants To determine whether these SNPs affect MRP1/ABCC1 expression, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations were recreated in MRP1/ABCC1 cDNA by site-directed mutagenesis and transiently transfected into HEK293 and CHO-K1 cells. Login to comment 107 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln Subcellular localization of wild-type and mutant MRP1/ABCC1 To further determine whether Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutations influence the trafficking of MRP1/ABCC1 to the cell surface, we detected the subcellular localization of wild-type and mutant MRP1/ABCC1 in transiently transfected HEK293 and CHO-K1 cells through the process of immunostaining. Login to comment 108 ABCC1 p.Cys43Ser ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln ABCC1 p.Arg1058Gln As shown in Fig. 3, strong plasma membrane staining was observed with all cells that are transfected with either wild-type or mutant MRP1/ABCC1, but not in the Table 3 Comparison of distributive frequencies of MRP1/ABCC1 Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln polymorphisms in different ethnic populations Allelic frequency (n) SNPs (nucleic acid substitution) m w Population References NCBI SNP ID Cys43Ser (128G > C) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41395947 0 (0/26) 1 (26/26) Japanese [14] 0.005 (2/416) 0.995 (414/416) Chinese This study Thr73Ile (218C > T) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41494447 0 (0/26) 1 (26/26) Japanese [14] 0.037 (2/54) 0.963 (52/54) Chinese [17] 0.014 (1/72) 0.986 (71/72) Chinese [15] 0.029 (2/70) 0.971 (68/70) Malay [15] 0 (0/70) 1 (70/70) Indian [15] 0(0/72) 1 (72/72) Caucasian [15] 0.014 (6/416) 0.986 (410/416) Chinese This study Arg723Gln (2168G > A) 0.073 (7/96) 0.927 (89/96) Japanese [16] rs4148356 0.038 (1/26) 0.962 (25/26) Japanese [14] 0.056(3/54) 0.944 (51/54) Chinese [17] 0 (0/72) 1 (72/72) Chinese [15] 0.029 (2/70) 0.971 (68/70) Malay [15] 0 (0/70) 1 (70/70) Indian [15] 0 (0/72) 1 (72/72) Caucasian [15] 0.058 (24/416) 0.942 (392/416) Chinese* This study Arg1058Gln (3173G > A) 0.010 (1/96) 0.990 (95/96) Japanese [16] rs41410450 0 (0/26) 1 (26/26) Japanese [14] 0.005 (2/416) 0.995 (414/416) Chinese This study m, mutant; MRP1/ABCC1, multidrug-resistance-associated protein 1; SNP, single nucleotide polymorphism; w, wild-type. Login to comment 110 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Arg1058Gln Table 2 Genotyping and allelic frequencies of MRP1/ABCC1 polymorphisms SNPs (nucleic acid substitution) Allele Allelic frequency (n) Genotype Genotype frequency (n) Cys43Ser (128G > C) G 0.995 (414) GG 0.990 (206) C 0.005 (2) GC 0.010 (2) CC 0 (0) Thr73lle (218C > T) C 0.986 (410) CC 0.971 (202) T 0.014 (6) CT 0.029 (6) TT 0 (0) Arg723Gln (2168G > A) G 0.942 (392) GG 0.889 (185) A 0.058 (24) GA 0.106 (22) AA 0.005 (1) Arg1058Gln (3173G > A) G 0.995 (414) GG 0.990 (206) A 0.005 (2) GA 0.010 (2) AA 0 (0) MRP1/ABCC1, multidrug-resistance-associated protein 1; SNP, single nucleotide polymorphism. Login to comment 111 ABCC1 p.Cys43Ser 210 Fig. 2 1.5 HEK293 CHO-K1 RelativeABCC1mRNAlevel RelativeABCC1mRNAlevel HEK293 CHO-K1 1.0 0.9 1.1 0.8 1.1 ABCC1 β-actin R. level 1.0 0.5 0.0 W ild-type C ys43Ser Arg723G ln Arg1058G ln Thr73lle W ild-type Vector W ild-typeCys43Ser Thr73lle Arg723G lnArg1058G ln C ys43Ser Arg723G ln Arg1058G ln Thr73lle 1.0 1.1 0.8 0.8 0.9 ABCC1 β-actin R. level Vector W ild-type Cys43Ser Thr73lle Arg723G lnArg1058G ln 1.5 1.0 0.5 0.0 (a) (b) Effect of mutations on multidrug resistance-associated protein 1 (MRP1/ABCC1) expression. Login to comment 112 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln HEK293 and CHO-K1 cells were transiently transfected with vector control or wild-type, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 followed by preparation of RNAs for quantitative real-time reverse-transcribed PCR analysis of MRP1/ABCC1 R. level (relative level) (a), or preparation of cell lysates for western blot analysis of MRP1/ABCC1 protein level (b). Login to comment 116 ABCC1 p.Cys43Ser ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Arg723Gln ABCC1 p.Arg1058Gln ABCC1 p.Arg1058Gln Fig. 3 Vector Wild-type Cys43Ser Thr73lle Arg723Gln Arg1058Gln Vector MRP1/ ABCC1 P1 MRP1/ ABCC1 P1(a) MergeMerge Wild-type Cys43Ser Thr73lle Arg723Gln Arg1058Gln (b) Effect of mutations on subcellular localization of multidrug resistance-associated protein 1 (MRP1/ABCC1). Login to comment 117 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln HEK293 (a) and CHO-K1 (b) cells were transiently transfected with vector control or wild-type, Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1, followed by fixation and immunostaining of MRP1/ABCC1 using MRPr1 antibody and fluorescein isothiocyanate-conjugated secondary antibody. Login to comment 126 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln HEK293 cells stably transfected with vector, wild-type, or Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 were exposed to cisplatin, paclitaxel, etoposide, daunorubicin, doxorubicin, methotrexate, vinblastine, and vincristine at various concentrations for 72 h at 371C followed by methyl thiazolyl tetrazolium assay and determination of half maximal inhibitory concentration (IC50). Login to comment 132 ABCC1 p.Cys43Ser The Cys43Ser mutation does not seem to have any effect on the activity of MRP1/ABCC1 in conferring resistance to all the drugs tested in either of the cell lines used (Figs 4 and 5 and Tables 4 and 5). Login to comment 133 ABCC1 p.Arg723Gln In HEK293 cells, Arg723Gln confers lower resistance to all drugs compared with wild-types. Login to comment 134 ABCC1 p.Arg723Gln In CHO-K1 cells, Arg723Gln also significantly decreased resistance to all drugs except cisplatin, paclitaxel, and methotrexate when compared with wild-type MRP1/ABCC1. Login to comment 135 ABCC1 p.Arg1058Gln The Arg1058Gln mutant caused a significant decrease in resistance to anthracyclines and Fig. 5 IC50(nmol/l) Vincristine 20 15 10 5 0 Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln * * * * Vinblastine 15 10 5 0 Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln * * IC50(nmol/l)IC50(nmol/l) 15 10 5 0 * * Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln Daunorubicin IC50(nmol/l) IC50(nmol/l) Methotrexate Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln 15 10 5 0 15 10 5 0 Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln Doxorubicin 200 Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln Cisplatin IC50(nmol/l) 150 100 50 0 IC50(nmol/l) Paclitaxel 10 8 6 4 2 0 Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln IC50(nmol/l) Etoposide 20 15 10 5 0 Vector W ild-type C ys43Ser Thr73lle Arg1058G ln Arg723G ln * ** Effect of mutations on multidrug resistance-associated protein 1 (MRP1/ABCC1)-mediated multidrug resistance in CHO-K1 cells. Login to comment 136 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln CHO-K1 cells stably transfected with vector, wild-type, or Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln mutant MRP1/ABCC1 were exposed to cisplatin, paclitaxel, etoposide, daunorubicin, doxorubicin, methotrexate, vinblastine, and vincristine at various concentrations for 72 h at 371C followed by methyl thiazolyl tetrazolium assay and determination of half maximal inhibitory concentration (IC50). Login to comment 139 ABCC1 p.Arg1058Gln In CHO-K1 cells, the Arg1058Gln mutant also conferred lower resistance to vinblastine, methotrexate, anthracyclines, and etoposide. Login to comment 140 ABCC1 p.Thr73Ile In HEK293 cells, the Thr73Ile mutation was also found to cause less resistance to vincristine and methotrexate (Tables 4 and 5 and Fig. 4). Login to comment 142 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln Discussion In this study, we identified the allelic frequencies of Cys43Ser, Thr73Ile, Arg723Gln, and Arg1058Gln in a mainland Chinese population. Login to comment 144 ABCC1 p.Arg723Gln However, the study discovered that Arg723Gln could diminish the resistance activity of MRP1/ABCC1 to daunorubicin, doxorubicin, etoposide, vinblastine, and vincristine. Login to comment 145 ABCC1 p.Arg1058Gln In addition, Arg1058Gln can reduce drug resistance of etoposide, daunorubicin, and doxorubicin. Login to comment 147 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Arg1058Gln This study shows for the first time the frequencies of nonsynonymous mutations, Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln, in a large sample of healthy volunteers from mainland China. Login to comment 148 ABCC1 p.Cys43Ser ABCC1 p.Thr73Ile ABCC1 p.Arg1058Gln In the 208 Chinese volunteers enrolled in this study, few had Cys43Ser, Thr73Ile, and Arg1058Gln polymorphisms. Login to comment 151 ABCC1 p.Arg723Gln However, we found 22 heterozygotes and one homozygote in the 208 volunteers for Arg723Gln. Login to comment 154 ABCC1 p.Arg723Gln ABCC1 p.Thr73Ile However, the frequencies of the Arg723Gln A allele and the Thr73Ile Tallele in the Chinese population were higher than the Caucasians (P < 0.05) of whom these alleles have not been found. Login to comment 155 ABCC1 p.Arg723Gln In contrast, Arg723Gln has the highest frequency in Asian populations. Login to comment 157 ABCC1 p.Gly671Val ABCC1 p.Arg433Ser It has also been reported that Gly671Val and Arg433Ser mutations were found in Caucasian, but not in Asian populations [15,18,19]. Login to comment 161 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Arg1058Gln Table 4 Resistance factors of transfected HEK293 cells to chemotherapeutic agents Resistance factorsa Drugs WT MRP1/ABCC1 Cys43Ser (128G > C) Thr73lle (218C > T) Arg723Gln (2168G > A) Arg1058Gln (3173G > A) Cisplatin 0.95 ± 0.24 0.95 ± 0.14 0.83 ± 0.18 0.76 ± 0.20 1.10 ± 0.10 Paclitaxel 1.14 ± 0.09 0.99 ± 0.16 0.99 ± 0.21 1.10 ± 0.22 1.04 ± 0.16 Daunorubicin 17.82 ± 3.15 17.27 ± 2.37 19.73 ± 1.98 9.09 ± 1.68 8.73 ± 2.62 Doxorubicin 14.38 ± 0.75 15.13 ± 0.91 14.63 ± 1.52 3.63 ± 1.20 2.38 ± 1.03 Etoposide 12.65 ± 2.09 11.51 ± 1.92 13.08 ± 1.84 4.41 ± 0.67 6.65 ± 1.05 Methotrexate 10.80 ± 1.33 10.50 ± 1.58 6.70 ± 0.95 6.20 ± 0.90 10.70 ± 1.26 Vinblastine 5.44 ± 1.36 5.72 ± 1.60 5.64 ± 1.04 2.80 ± 1.26 5.44 ± 1.62 Vincristine 11.35 ± 3.11 11.17 ± 2.91 8.89 ± 2.40 3.76 ± 1.15 11.18 ± 2.82 IC50, half maximal inhibitory concentration; MRP1/ABCC1, multidrug resistance-associated protein 1; WT, wild-type. Login to comment 163 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Arg1058Gln Table 5 Resistance factors of transfected CHO-K1 cells to chemotherapeutic agents Resistance factorsa Drugs WT MRP1/ABCC1 Cys43Ser (128G > C) Thr73lle (218C > T) Arg723Gln (2168G > A) Arg1058Gln (3173G > A) Cisplatin 0.94 ± 0.05 0.98 ± 0.12 0.89 ± 0.04 0.99 ± 0.09 0.89 ± 1.10 Paclitaxel 0.94 ± 0.11 0.88 ± 0.10 0.96 ± 0.05 1.00 ± 0.07 0.96 ± 0.06 Daunorubicin 12.97 ± 2.76 13.09 ± 2.68 13.07 ± 2.81 2.96 ± 0.58 4.81 ± 1.01 Doxorubicin 15.44 ± 1.37 15.84 ± 0.91 15.44 ± 1.95 6.46 ± 0.90 7.22 ± 0.86 Etoposide 16.57 ± 1.91 16.44 ± 1.95 4.84 ± 0.51 3.56 ± 0.36 4.77 ± 0.56 Methotrexate 3.78 ± 1.07 3.70 ± 1.01 3.60 ± 1.39 3.75 ± 1.08 1.67 ± 0.53 Vinblastine 10.35 ± 1.61 10.32 ± 1.70 10.27 ± 1.66 5.73 ± 0.87 8.50 ± 1.32 Vincristine 6.93 ± 1.13 6.78 ± 1.18 6.79 ± 1.04 2.27 ± 0.34 6.85 ± 1.14 IC50, half maximal inhibitory concentration; MRP1/ABCC1, multidrug resistance-associated protein 1; WT, wild-type. Login to comment 165 ABCC1 p.Cys43Ser ABCC1 p.Arg723Gln ABCC1 p.Arg1058Gln 214 The four SNPs (Cys43Ser, Thr73lle, Arg723Gln, and Arg1058Gln) studied here are located in various domains of human MRP1/ABCC1. Login to comment 166 ABCC1 p.Arg723Gln Although the location of SNPs in protein has not always been an accurate predictor of phenotypic change in the expression or function of the protein [18,19], the location of Arg723Gln in the NBD1 suggests that this mutation likely would affect the function of the protein by affecting the ATPase activity of MRP1/ABCC1. Login to comment 167 ABCC1 p.Arg723Gln Indeed, we found that Arg723Gln mutation decreased the resistance of the cell to nearly all drugs tested in HEK293 and CHO-K1 cells (see also, discussion in the last paragraph). Login to comment 168 ABCC1 p.Arg723Gln Interestingly, Arg723Gln is also the most commonly found nonsynonymous SNP of the four SNPs in Chinese and other Asian populations. Login to comment 171 ABCC1 p.Cys43Ser ABCC1 p.Arg1058Gln Nonetheless, their drug-resistance profiles were rather different: Arg1058Gln mutation decreased resistance to several anticancer drugs, whereas Cys43Ser mutation did not significantly affect resistance to any drugs tested. Login to comment 173 ABCC1 p.Cys43Ser In a previous study, however, the Cys43Ser mutation did seem to cause a decrease in resistance to vincristine in HeLa cells [20]. Login to comment 174 ABCC1 p.Cys43Ser The reason for the difference between these two studies is not known, however, considering that different cell lines may have different impacts on the effect of mutations on MRP1/ABCC1 function (see also, discussion in the last paragraph), it is tempting to speculate that HeLa cells behave differently than HEK293 and CHO-K1 cells regarding the effect of Cys43Ser mutation on MRP1/ABCC1 function. Login to comment 175 ABCC1 p.Arg1058Gln The Arg1058Gln mutation can increase the response of two anthracyclines and etoposides in HEK293 and CHO-K1 cells as well as vinblastine and methotrexate in CHO-K1 cells. Login to comment 177 ABCC1 p.Thr73Ile The selective effect on drug resistance also exists for the Thr73Ile mutation in the first cytoplasmic loop. Login to comment 181 ABCC1 p.Thr73Ile For example, the Thr73Ile mutation decreased vinblastine resistance in CHO-K1 cells, but not in HEK293 cells. Login to comment 184 ABCC1 p.Thr73Ile It is possible that HEK293 cells are able to suppress the Thr73Ile mutation-induced changes in both MRP1/ ABCC1 structure and activity. Login to comment